HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

J. Biol. Chem., Vol. 275, Issue 34, 26259-26264, August 25, 2000

This Article Abstract Full Text (PDF) All Versions of this Article: 275/34/26259    most recent M004006200v1 Submit a Letter to Editor Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Kessler, S. P. Articles by Sen, G. C. Search for Related Content PubMed PubMed Citation Articles by Kessler, S. P. Articles by Sen, G. C. Social Bookmarking                      What's this?

Physiological Non-equivalence of the Two Isoforms of Angiotensin-converting Enzyme^*

Sean P. Kessler, Theresa M. Rowe, Janette B. Gomos, Patricia M. Kessler^§, and Ganes C. Sen^¶

From the Departments of  Molecular Biology and ^§ Cancer Biology, Lerner Research Institute, Cleveland Clinic Foundation, Cleveland, Ohio 44195

Received for publication, May 10, 2000, and in revised form, May 28, 2000

	ABSTRACT

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCECURES RESULTS DISCUSSION REFERENCES

The structurally related somatic and germinal isoforms of angiotensin-converting enzyme (ACE) contain the same catalytic active center and are encoded by the same gene, whose disruption causes renal atrophy, hypotension, and male sterility. The reason for the evolutionary conservation of both isozymes is an enigma, because, in vitro, they have very similar enzymatic properties. Despite the common enzymatic properties, discrete expression of both isoforms is maintained in alternate cell types. We have previously shown that sperm-specific expression of transgenic germinal ACE in Ace / male mice restores fertility without curing their other abnormalities (Ramaraj, P., Kessler, S. P., Colmenares, C. & Sen, G. C. (1998) J. Clin. Invest. 102, 371-378). In this report we tested the biological equivalence of somatic ACE and germinal ACE utilizing an in vivo isozymic substitution approach. Here we report that restoration of male fertility was not achieved by the transgenic expression of enzymatically active, somatic ACE in the sperm of Ace / mice. Therefore, the requisite physiological functions of the two tissue-specific isozymes of ACE are not interchangeable.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCECURES RESULTS DISCUSSION REFERENCES

The angiotensin-converting enzyme (ACE)¹ has long been regarded as a central player in the renin-angiotensin system through its action in converting angiotensin I to the vasopressive peptide. ACE also degrades bradykinin as well as the vasodilating, apoptosis-inducing peptide angiotensin (1-7). Although there are two isozymes of ACE in every mammal, both are transcribed in a tissue-specific fashion from distinct promoters within the same gene (2, 3). The 140-kDa somatic (sACE) isoform is expressed in vascular endothelial cells, epithelial cells in the kidney proximal tubules, brain, intestinal brush border cells, monocytes, epididymis, and Leydig cells of the testes (4-6). The 70-kDa germinal (gACE) isoform is expressed exclusively in late pachytene spermatocytes (7). The overall sequence homology between isoforms across mammalian species is 80-90%.

Expression in such diverse tissue types evokes a broader, modern view of ACE as a physiological mediator of multiple regulatory processes. This concept was illustrated in ACE-deficient mice that suffer from gross kidney structural abnormalities, altered vascular wall architecture, electrolyte imbalance, and male infertility (8-10). The fertility defect was due to poor sperm migration through the oviduct and failure to bind and penetrate the zona pellucida. However, there was no fertility defect in angiotensinogen knockout mice. Taken together, these results suggest that gACE may hydrolyze an oviduct or ovum-specific substrate (11). The absolute requirement for ACE expression was demonstrated in Drosophila in which two unique genes encode alternatively expressed ACE-like isozymes, AnCE and Acer (12). Two embryonic lethal mutants have mapped to the Ance gene locus, and heteroallelic combinations of these two mutations produced sterile male progeny (13).

Transcription initiations of gACE and sACE mRNAs occur at two alternative sites within the same gene. The gACE-specific sequences are spliced out of the mature sACE transcript, whereas the gACE transcription initiates within an intron of the sACE transcription unit (2, 3, 6). As a result, the two proteins contain 665 common residues at their carboxyl termini, whereas at the amino termini, sACE and gACE contain 664 unique residues and 72 unique residues, respectively (14). Both ACE isoforms are type I ectoproteins that are anchored in the plasma membrane through hydrophobic regions present near their carboxyl termini. In addition, a soluble form of the sACE protein containing the extracellular domain is also produced by the regulated action of a membrane-associated cleavage-secretion process (15-17).

Both isozymes share a common catalytic center located in the identical carboxyl-terminal domains. As expected, the enzymatic properties of the gACE and carboxyl-terminal domain of sACE are very similar owing to the common sequence shared by both isozymes (18-21). In contrast, sACE contains another catalytic center in its unique amino-terminal domain (8, 19). Although both domains of sACE contain the same zinc-binding motif (His-Glu-X-Y-His), the amino-terminal active site cleaves LHRH 30 times faster and the hematopoietic peptide NH₂-acetyl-Ser-Gly-Lys-Pro 40 times faster than the carboxyl-terminal active site (18, 22). Similar substrate preferences were observed for the AnCE and Acer proteins (12, 23).

The evolutionary conservation of the two isoforms of ACE indicates that both are functionally indispensable (6). Moreover, their tissue-specific expression suggests that the specific physiological function of an isoform requires its expression in the correct tissue, a concept that was experimentally supported by our observation that gACE expression in sperm alone is sufficient for maintaining male fertility (24). It remains unclear, however, given the similarities in their enzymatic properties in vitro, why the two isoforms are needed. The conservation of gACE is especially puzzling because the carboxyl-terminal active site of sACE is both structurally and functionally identical to the single active site of gACE. Moreover, the recombinant sACE carboxyl-terminal domain can hydrolyze several sperm-specific proteins in vitro (20). Thus, one would expect that sACE should be able to carry out all physiological functions of gACE if expressed in the appropriate tissues. This idea was experimentally tested in the studies reported here. By creating transgenic mice that express sACE exclusively in ACE-deficient sperm, we demonstrate that each isoform is functionally distinct. Enzymatically active, sperm surface-bound sACE failed to restore Ace / male fertility. Although the level of sACE expression exceeded that of normal gACE expression, there was no fertility blockage in Ace +/ mice that also contained the somatic ace transgene. Our results explain the strict evolutionary requirement for the expression of both ACE isoforms. In addition, we demonstrate the applicability of an in vivo isozymic substitution approach to test the functional equivalence of any two or more isoforms that share very similar enzymatic properties.

	EXPERIMENTAL PROCECURES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCECURES RESULTS DISCUSSION REFERENCES

Plasmid Construction-- The full-length rabbit somatic ace cDNA was assembled in pCDNA3 (Invitrogen) that contains the T7 and CMV promoters. The 177-bp NcoI-XhoI genomic GC-rich fragment (3) was joined at the unique XhoI site to the remainder of the somatic ace cDNA amplified by HiFidelity reverse transcriptase-polymerase chain reaction (Roche Molecular Biochemicals) on rabbit lung mRNA template utilizing a sense primer rACEp5Xho1 (5'GCTACAACTCGAGCGCCGAGCAGG3' and antisense primer rACEpendAS (5'CCCGTCGACTCAGGAGTGTCTTAGCTCCACCTCG3'). The vector containing the PGK2-somatic ace transgene (Ps), was then generated by substituting the sperm-specific 515-bp human phosphoglycerate kinase II (PGK2) promoter for the T7 and CMV promoters (24). The 5246-bp (Ps) transgene, released by SpeI and AsnI digestion, was purified from agarose gel using Geneclean II (BIO 101, Inc., Vista, CA) prior to microinjection into FVB zygotes by the Cleveland Clinic Foundation Transgenic Core Facility utilizing standard techniques.

Expression of sACE in Vitro and in Vivo-- Prior to transgene micro-injection, we tested for expression of full-length, enzymatically active sACE protein in vitro. A coupled transcription/translation reaction with [³⁵S]Met was performed according to instructions in the T7 TNT kit (Promega). The resulting 140-kDa rabbit sACE protein was visualized in an 8% SDS-polyacrylamide gel and autoradiographed for 16 h. Expression of enzymatically active sACE in vivo was tested by transiently transfecting plasmid AP005 into the ACE-expressing opossum kidney cells (OPK) (ATCC CRL-1840) and human fibrosarcoma cells (HT1080) (ATCC CCL-121) using Fugene 6 Transfection Reagent according the manufacturer's instructions (Roche Molecular Biochemicals). Cells were cultured as described previously (25). The standard ACE enzyme assay that measures the cleavage of His-Leu from Hip-His-Leu was performed on the cell extracts as described (19).

Southern Blot Hybridization-- Genomic DNA (15 µg) was digested overnight with SacI as described (24). The DNA was electrophoresed in a 0.8% TBE agarose gel, transferred to Hybond N+ membrane (Amersham Pharmacia Biotech), pre-hybridized and hybridized in Church Buffer and washed as described (26). The 405-bp somatic ace probe used for founder identification was generated from plasmid AP005 by EcoRI digestion. The 218-bp mouse Ace exon 13-14 probe was obtained by reverse transcriptase-polymerase chain reaction amplification from mouse testes total RNA and cloned into pBluescriptII (Stratagene) to yield mouse Ace 13-14/pBSII (2). The exon 13-14 probe, released by BamHI and HindIII digestion, was used for all subsequent genotyping since it hybridized to both mouse Ace and transgenic rabbit ace genes. Probes were radiolabeled with [-³²P]dCTP as indicated in the Random Prime Labeling Kit (Roche Molecular Biochemicals). After exposing to a PhosphorImager screen for 4 h, each band was quantitated using ImageQuant analysis software. Copy number and transgene homozygosity was determined by normalizing the transgene signal to the corresponding mouse Ace signal.

Western Blot and Immunoprecipitated ACE Enzyme Assay-- Tissues isolated from age-matched adult mice were homogenized in ACE lysis buffer as described (19). All Line A, C, and D extracts (100 µg) were electrophoresed on an 8% SDS-polyacrylamide gel electrophoresis and then transferred to Immobilon-P (Millipore). Membranes were probed with the goat anti-rabbit ACE polyclonal antisera 447 (17) as described previously (24).

The immunoprecipitation ACE enzyme assay was performed by incubating 200 µg of tissue extract with antisera 447 diluted 1:150 in 150 µl of ACE lysis buffer. Following rotation at 4 °C for 1 h, 30 µl of ACE lysis buffer equilibrated rabbit anti-goat-agarose beads (Sigma) was added. Incubation was continued for an additional 1 h at 4 °C with rotation. Following extensive washing with ACE lysis buffer, the standard ACE enzyme assay that measures the cleavage of His-Leu from Hip-His-Leu was performed on the rabbit ACE tethered to the agarose beads (19).

Quantitation of Rabbit ACE Expression-- Un-fixed, adult testes were embedded in O.C.T. (Tissue-Tek) in dry ice/methanol bath and cryo-sectioned at 20-µm thickness. Slides were equilibrated at 25 °C for 30 min in 50 mM Tris, pH 7.4, 100 mM NaCl prior to probing with 800 pM ¹²⁵I-351A (2176 Ci/mmol) (Peptide Radioiodination Service Center, Washington State University, Pullman, WA) as described (27). All sections were quantitated with subtraction of background using ImageQuant software analysis of signals obtained by Molecular Dynamics PhosphorImager.

Histology and Immunohistochemistry-- Age-matched, adult kidneys and testes were fixed in Histochoice (Sigma), paraffin-embedded, cross-sectioned at 5 µm thickness, and hematoxylin and eosin-stained by the Lerner Research Institute Histology Core (Cleveland, OH). Immunohistochemistry was performed following standard de-paraffinization procedures employing Clear-Rite and Flex solutions (Richard Allan). Slides were twice boiled in 10 mM sodium citrate, pH 6.0, for 5 min and returned to PBS. The slides were blocked for 2 h at 25 °C in PBS + 10% horse serum + 0.3% Triton X-100 (blocking buffer). The primary antibody 447, diluted 1:1000 in blocking buffer, was applied to the slides in a humid chamber for 16 h at 4 °C. Following washes in PBS + 0.3% Triton X-100 (PBST), anti-goat fluorescein isothiocyanate (1:200) (Santa Cruz Biotechnology) was applied to each section for 2 h in the dark at 25 °C. Following washes in PBST, Vectashield (Vector Laboratories) diluted 1:1 in PBS was applied. All stained slides were visualized with a Leica digital fluorescent microscope and Adobe Photoshop software.

Mating Scheme-- The C57Bl/6 strain Ace knockout mice were a kind gift from Oliver Smithies (9). To generate Ace knockout FVB strain mice, Ace +/ C57Bl/6 males were crossed with wild-type FVB females. Successive back-cross-matings were continued for 8 generations with Ace +/ males and wild-type FVB females (Taconic Farms). Since the previously reported transgenic mice, [PGK2-germinal ace-bghPa (Pg)] were FVB strain, generation of FVB strain Ace /, Pg +/ mice was performed by crossing FVB Ace +/ mice with Pg +/ FVB strain mice. Mating Ace +/, Pg +/ F₁ sibs was performed to generate F₂ Ace /, Pg +/ sibs that were used as the control group for the fertility assay. Similarly, FVB PGK2-somatic ace-bghpA (Ps) transgenic founder mice were mated with Ace +/ FVB mice to generate Ace +/, Ps +/ mice. Matings were then performed with all male and female genotypes to produce (Ace /, Ps +/) and (Ace /, Ps +/+) experimental males. The number of pups sired from all of these matings was recorded.

Fertility testing of all four Line A experimental males was conducted by mating each with a total of six wild-type age-matched females (The Jackson Laboratories) for 10 days. Females were observed for plugs. If no pups were produced within 22 days from male removal, the same females were mated with Ace +/ FVB males for 10 days. The number of pups per litter was noted. Control group fertility testing was performed with Ace /, Pg +/ sibs, age-matched to the Line A experimental group.

	RESULTS

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCECURES RESULTS DISCUSSION REFERENCES

Construction of the sACE Transgene-- The full-length rabbit somatic ace cDNA was assembled in the pCDNA3 vector by joining a 177-bp ace genomic fragment (3) to a large fragment of the somatic ace cDNA that was generated by HiFidelity reverse transcriptase-polymerase chain reaction (Fig. 1A). Verification of full-length sACE expression was demonstrated by an in vitro transcription and translation assay (Fig. 1B). The in vitro translated sACE was enzymatically active in the standard ACE enzyme analysis that measures the cleavage of Hip-His-Leu to His-Leu (data not shown) (19). Expression of rabbit sACE in vivo was measured following transient transfection into HT1080 cells and sACE-expressing opossum proximal kidney tubule (OPK) cells. Again, 140-kDa enzymatically active rabbit sACE was produced (Fig. 1, C and D). Verification of the species specificity of the antisera was also observed. The goat anti-rabbit ACE antisera did not detect sACE in whole mouse lung (Fig. 1C). With these results, the 515-bp human PGK2 promoter, previously shown to direct sperm-specific transgene expression in mice (24), was substituted for the CMV promoter in the CMV-somatic ace-bghpA construct to generate the PGK2-somatic ace-bghpA (Ps) transgene (Fig. 2).

View larger version (22K): [in this window] [in a new window]   Fig. 1.   Somatic ace cloning and expression. A, the somatic ace cDNA was positioned downstream of the CMV and T7 promoters in pCDNA3. B, autoradiograph of T7 promoter-driven sACE in an in vitro transcription and translation reaction incorporating [35S]Met. C, autoradiograph of a Western blot from HT1080 cells transiently transfected with CMV-sACE or pCDNA3. The 140-kDa rabbit sACE is detected by the goat polyclonal, anti-rabbit sACE antisera 447, secondary anti-goat horseradish peroxidase conjugate, and ECL TM reagent. Mouse lung extract serves as control. All lanes contain 20 µg of protein. D, ACE enzyme assay on cell extracts obtained from HT1080 and OPK cells transiently transfected with CMV-sACE.

View larger version (47K): [in this window] [in a new window]   Fig. 2.   Southern hybridization and mating scheme. Autoradiograph of a Southern blot hybridization utilizing the 405-bp somatic ace probe to analyze 15 µg of SacI-digested mouse genomic tail DNA. Four out of 21 FVB pups generated by micro-injection received the PGK2-somatic ace-bghpA transgene (Ps). Each founder was mated with Ace +/ FVB mice for transgene transmission. Founder and F1 generation SacI-digested DNA was hybridized with the murine exon 13-14 probe to determine the Ace and Ps genotype of each mouse based on the presence of a 6.6- (wild-type Ace allele), 8.4- (Ace knockout allele), and 3.7-kb transgene fragment. Line A (Ace /, Ps +/) mice were produced by mating Ace +/, Ps +/ sibs.

Generation of Ace /, Ps +/ Mice-- For generating transgenic mice, the 5.25-kb SpeI to AsnI fragment of the PGK2-somatic ace-bghpA expression vector was microinjected into fertilized FVB strain eggs. Out of 21 pups born, 4 had transgene integration. The founders were identified by Southern blot hybridization with a probe isolated from the rabbit somatic ace cDNA (Fig. 2). For establishing lines from the four transgenic mice, they were mated with FVB mice of the Ace +/ genotype. It was important to assess the effects of the somatic ace transgene on mice with syngeneic backgrounds because physiological properties, such as blood pressure or litter size, are known to vary significantly among different strains (24). Since our transgenic mice were of FVB strain, we transferred the Ace null genotype from the original C57Bl/6 background to the FVB background by repeated back-crossing for eight generations. Of the original four transgenic founders, only A (number 5), C (number 16), and D (number 18) transmitted the transgene (Fig. 2). Founder B (number 8) failed to transmit the transgene to any of 33 offspring analyzed (data not shown). Simultaneous verification of mouse Ace and Ps transgene genotype was performed using a mouse exon 13-14 probe. Hybridization of this probe to genomic DNA digested with SacI resulted in an 8.4-kb Ace knockout allelic fragment carrying the neo^r gene insertion, a 6.6-kb wild-type Ace fragment, and a 3.7-kb somatic ace transgene fragment (Fig. 2) (9). Further characterization of copy number and homozygosity was determined by PhosphorImager quantitation of the transgene normalized to the single copy mouse Ace gene. The copy number of Lines A, C, and D was determined to be four, two, and eight, respectively. Sibling matings were then performed between Ace +/, Ps +/ mice to generate the Ace /, Ps +/ male experimental mice used in the fertility analysis (Fig. 2).

Testis-specific Expression of Enzymatically Active Transgenic sACE-- Successful transmission of the Ps transgene was observed in Lines A, C, and D. A Western blot screen was performed to verify testes-specific expression of the Ps transgene. Fig. 3A illustrates the production of 140-kDa sACE in the testes of Lines A and C mice as detected by rabbit sACE-specific antisera. Line D, however, produced a larger ACE-like protein. The anti-rabbit ACE antisera did not cross-react with murine sACE or gACE present in the testes extracts of wild-type mice. Further tissue analysis revealed that expression of the transgene was confined to the testes. There was no expression in Line A (Ace +/, Ps +/) brain, blood, heart, intestine, kidney, liver, lung, or spleen. Verification of the species specificity of the antiserum was again observed. The goat polyclonal anti-rabbit ACE antisera did not detect sACE in any somatic tissue (Fig. 3B).

View larger version (31K): [in this window] [in a new window]   Fig. 3.   Tissue-specific expression of sACE in transgenic mice. A, autoradiograph of a Western blot on 80 µg of total testes extracts from Lines A, C, and D (Ace +/+, Ps +/), Line A (Ace /, Ps +/) and wild-type (Ace +/+) mice. Rabbit sACE (arrow) was detected with the goat anti-rabbit ACE antisera 447 (1:1000), anti-goat horseradish peroxidase conjugate (1:3000), and ECL TM reagent. The genotype of each mouse is listed. B, autoradiograph of a Western blot on 100 µg of total protein from a Line A (Ace +/, Ps +/) male. Transgene-expressed sACE was visualized as described in A. Bl, blood; Br, brain; H, heart; K, kidney; Li, liver; Lu, lung; Sp, spleen; T, testes.

Because all testes contain both gACE, expressed on the sperm, and sACE, expressed in the vasculature and somatic Leydig cells, we needed to quickly determine which founders expressed enzymatically active, transgene-encoded sACE in sperm. We devised an immunoprecipitation procedure in order to selectively immunoprecipitate the transgenic rabbit ACE away from the endogenous murine ACE. Equal quantities of whole testicular extracts from transgenic and non-transgenic, age-matched mice were incubated with the rabbit ACE-specific antisera raised in goat prior to immunoprecipitation with anti-goat antibody-conjugated latex beads. Following several washes, the standard ACE enzyme assay, measuring Hip-His-Leu cleavage, was performed on the rabbit ACE tethered to the beads. Mice from Line A and Line C both expressed enzymatically active sACE, whereas Line D failed to express active ACE when compared with non-transgenic, age-matched males (Fig. 4A). Although Line D produced a protein that was recognized by the anti-ACE antisera (Fig. 3A), it was not of correct molecular mass nor was it enzymatically active. No further experimentation was performed with mice from Line D and Line C mice. Mice from Line A were used exclusively for all further analysis.

View larger version (12K): [in this window] [in a new window]   Fig. 4.   Enzymatic analysis of transgene-expressed sACE. A, testis extracts from Lines A, C, D (Ace +/+, Ps +/), and wild-type (wt) (Ace +/+) mice were incubated with anti-rabbit ACE-specific goat antisera 447 and anti-goat-conjugated latex beads. Following washes, the standard in vitro ACE assay was performed on sACE tethered to the beads. The activity level of the wild-type mouse testes (2.0) has been subtracted from all samples. B, quantitation of sACE expressed on adult mouse sperm was measured by binding 125I-351A to 20-µm thick testis cryosections. Triplicate slides for each genotype are represented. Slides were exposed to a phosphor screen and quantitated by PhosphorImager analysis with background correction.

We wanted to compare the levels of gACE expression in the sperm of Ace +/ mice with the corresponding level of the transgenic sACE expression in the Ace /, Ps +/ mice to ensure that enough of the transgenic protein was being expressed. Because an ACE antiserum that reacts with both rabbit and mouse ACE with equal avidity was not available, we used an in situ ligand binding assay (28). In this assay, a radiolabeled angiotensin I analog (351A) was bound to testis sections, and bound radioactivity was quantitated by PhosphorImager analysis. The assay revealed that about 70-fold more probe was bound to a testis section of an Ace /, Ps +/ mouse than to a corresponding section of an Ace +/ mouse (Fig. 4B). Thus, the transgenic protein was expressed to a much higher level than the level of the natural proteins.

Histology of the Kidney and the Testis-- As previously reported for C57Bl/6 mice, in FVB Ace / mice, there was no observable distortion or abnormality of the testes architecture as revealed by hematoxylin and eosin staining (not shown) (8, 11). Consequently, the overall histology of a testes section from an Ace /, Ps +/ mouse was indistinguishable from that of an Ace +/+ mouse (Fig. 5A, 1 and 2). In contrast, the same was not true for the kidney. Compared with the kidney of a wild-type mouse, the kidney structure of an Ace /, Ps +/ mouse was profoundly abnormal (Fig. 5A, 3 and 4). Thus, as expected, transgene somatic ace expression in the sperm did not cure the kidney defects of the Ace / mouse.

View larger version (69K): [in this window] [in a new window]   Fig. 5.   Histology and immunohistochemistry. A, hematoxylin and eosin-stained sections of wild-type adult mouse testes (1) and kidney (3), compared with age-matched (Ace /, Ps +/) mouse testes (2) and kidney (4). B, immunohistochemistry on sperm from (Ace /) and (Ace /, Ps +/) testes. Sperm-specific expression in the 5-µm section was detected with goat anti-rabbit ACE antisera 447 (1:1000) and anti-goat fluorescein isothiocyanate conjugate (1:200). 1 and 2 and 3 and 4 are × 10 and 40 magnification, respectively.

To demonstrate the sperm-specific sACE expression in the Ps transgenic testes, an immunohistochemical assay was performed. Testes cross-sections, probed with the anti-rabbit ACE antisera, displayed a cobblestone staining pattern indicative of surface localization of sACE on the sperm (Fig. 5B, 2 and 4). Sperm-specific staining intensified coincident with sperm maturation. The greatest staining was observed on fully mature sperm in the lumen of the seminiferous tubules. No staining occurred in Leydig cells, Sertoli cells, nor any of the blood vessels of the testes, indicating testicular expression was restricted to the sperm. An age-matched, Ace / testes did not exhibit staining with this antisera (Fig. 5B, 1 and 3).

Effect of Transgene Expression on the Fertility Status of Male Mice-- Previously, we reported that the PGK2 promoter-driven, sperm-specific expression of rabbit gACE restored fertility in an Ace / mouse. However, the mice from that study were of mixed background due to the crossing of the C57Bl/6 strain, harboring the Ace / allele, with the FVB strain, harboring the PGK2-germinal ace (Pg) transgene (24). To verify that the same results were true for pure FVB strain, we assessed the fertility of male Ace /, Pg +/ mice in a syngeneic FVB background (Fig. 6). Fertility was restored to the Ace / male that expresses rabbit gACE on the sperm. Thus, the FVB background could be used for testing the fertility effects of sACE expression in sperm.

View larger version (12K): [in this window] [in a new window]   Fig. 6.   Fertility testing of sACE-expressing mice. Three Line A (Ace /, Ps +/), and one Line A (Ace /, Ps +/+) mice were each mated with six different wild-type females. After failure to sire pups, the same females were mated with Ace +/ males, and the number of pups/litter are shown (). The reported average for FVB strain is denoted (). Fertility of all genotype males mated with various genotype females is also noted. The control mating is between (Ace /, Pg +/) sibs of FVB strain.

By having established that sufficient levels of enzymatically active, surface-bound sACE were produced by Ps +/ sperm, a mating scheme was employed to test the ability of the transgene to complement the Ace / mutant phenotype. Fig. 6 presents mating outcomes from three adult males (Ace /, Ps +/) and one adult male (Ace /, Ps +/+). All were Line A males mated with six separate wild-type adult females. The mice were mated for 10 days or the equivalent of two estrous cycles. All females were plugged within the 10-day mating period but produced no offspring. Following a 21-day gestational waiting period, the same females were mated for another 10 days with an Ace +/, non-transgenic age-matched male to prove female fertility. In all of the ACE-deficient mice expressing sACE on the sperm, none sired pups demonstrating the lack of ability of sACE to provide fertility functions. The expression of the somatic ace transgene did not interfere with the function of endogenous gACE. Males (Ace +/, Ps +/), (Ace +/, Ps +/+), (Ace +/+, Ps +/), and (Ace +/+, Ps +/+) were mated with females with various Ace and Ps genotypes to generate the experimental Ace /, Ps +/ male mice. The data revealed no abnormalities due to the expression of sACE on the surface of the sperm, even at levels 70-fold above the level expressed off of the native allele of an Ace +/ mouse (Fig. 6).

	DISCUSSION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCECURES RESULTS DISCUSSION REFERENCES

Genetic dissection is a common approach used to determine the specific roles of individual components of complex physiological pathways. Recent advances in gene ablation and transgene expression techniques have enabled investigators to apply this approach to mice and evaluate the contributions of different gene products in mediating multi-factorial diseases such as hypertension. Thus, genes for each component of renin-angiotensin system, renin, angiotensinogen, ACE, and AII receptors have been knocked out individually (29). As anticipated, blood pressure regulation was perturbed in mice lacking any of the above genes. The same approach has also been used to determine the effects of gene dosage on some of the components of renin-angiotensin system (30). These studies have, in addition, produced some unexpected results. For example, mice deficient in ACE exhibit, in addition to low blood pressure, dramatic renal atrophy, vascular wall thickening, electrolyte imbalance, and male infertility. The last phenotype was traced to the inability of sperm of Ace / mouse to migrate within the oviduct and bind to the zona pellucida (11). That ACE expression in sperm alone is sufficient for imparting male fertility was demonstrated by combining the powers of transgenic and knockout technology. By using a sperm-specific promoter, gACE was expressed solely in developing sperm of transgenic mice. By appropriate matings of the transgenic strain with Ace / mice, experimental mice expressing gACE only in sperm were produced. Those male mice were fertile but they still maintained the other defects of the Ace / mice (24).

In the current study, we have exploited the above experimental approach to examine the physiological reciprocity between the two isozymes of ACE. Because the genetic background of a mouse influences its physiological properties, such as blood pressure and litter size, we decided to conduct this series of experiments with mice of syngeneic background. For this purpose, the Ace / genotype was transferred from the C57Bl/6 strain to FVB strain, the strain of choice, by repeated back-crossing. The transgenic mice were also generated in the FVB background. As a result, mating of the transgenic and the knockout mice produced offspring of the same genetic background. The above experimental system was used in the current study to inquire whether sACE, if exclusively expressed in sperm, can substitute for gACE in supporting male fertility.

Structurally, sACE contains all of gACE except the 72 residues at its amino terminus (14). Thus, the carboxyl-terminal active center is completely conserved between the two proteins, and in vitro, they cleave many substrates, including angiotensin I, with equal efficiency (6, 20). In contrast, several studies have indicated that the amino-terminal active center, present only in sACE, has enzymatic properties that are distinct from those of the shared active center (22). Therefore, it is conceivable that, in vivo, the two active centers are designed to act upon two sets of different substrates, both isozymes cleaving a common set of peptides and only sACE cleaving a second set. If this scenario were true, sACE should be able to carry out all physiological functions of gACE, a hypothesis tested in our investigation. Isozyme-specific physiological functions of ACE have been tested before by us and others (11, 24). As mentioned previously, by mating transgenic and knockout mice, we have shown that gACE expression in sperm is sufficient for maintaining male fertility (24). Similar conclusions were reached by Hagaman et al. (11), who used mice carrying an isozyme-specific sACE gene knockout. In another study, attempts to produce isozyme-specific gACE knockouts generated mice that expressed no gACE and sACE but a truncated sACE containing the amino-terminal active center only. Because the truncated protein contained no membrane-anchoring domain, it was totally secreted and accumulated in the serum. Those mice exhibited all of the defects of Ace / mice (8).

Results reported here clearly demonstrate the potential use (or the first successful use) of this experimental design to test the physiological equivalence of any two or more alternatively expressed isozymes that share similar enzymatic properties. In our study, sACE cannot functionally fulfill the role of gACE in sperm functions. The experiments were designed to ensure that both transgenic proteins are expressed in the same cells of the same tissue at the same developmental stage. Quantitation of the levels of expression of the proteins by several methods established that transgenic sACE was expressed at a level higher than that of endogenous gACE and comparable to that expressed in transgenic gACE mice. Moreover, the expressed transgenic sACE was enzymatically active when tested in vitro. Why, then, could it not restore the sperm functions as transgenic gACE could? It is reasonable to speculate that it was probably due to the failure of sACE to recognize and bind the relevant putative substrate present in the oviduct whose cleavage allows the sperm transport. Given the structural differences of the two isoforms, the unique 72 residues of gACE, not present in sACE, may be required for recognition of this substrate. Conversely, the extra amino-terminal half of sACE, not present in gACE, may prevent access of the substrate to the binding site. We think that the binding of the putative oviduct or zona pellucida substrate to sACE is defective, not its cleavage by the active center. The same carboxyl-terminal active center is present in both isozymes, and neither 351A binding nor cleavage of Hip-His-Leu was affected. Moreover, expression of sACE in large excess did not block the function of gACE in the Ace +/, Ps +/+ mice, indicating that sACE does not act as a dominant inhibitor by competing for binding to the same substrate as gACE. Further experimental mice designed to express exclusively the sACE carboxyl-terminal domain and target it to the surface of ACE-deficient sperm may be required to resolve this matter while the search for the putative oviduct/ovum ACE substrate continues.

	ACKNOWLEDGEMENTS

We thank Natasha Lerner for animal assistance. We thank Indira Sen for providing the anti-ACE antisera and Oliver Smithies for the Ace knockout mice. We appreciate the technical advice we received from Clemencia Colmenares, Valerie Stewart, Judy Drazba, and Robert Speth.

	FOOTNOTES

^* This work was supported by National Institutes of Health Grant HL 48258.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

^¶ To whom correspondence should be addressed: Dept. of Molecular Biology, NC20, Lerner Research Institute, 9500 Euclid Ave., Cleveland, OH 44195. Tel.: 216-444-0636; Fax: 216-444-0513; E-mail: seng@ccf.org.

Published, JBC Papers in Press, May 30, 2000, DOI 10.1074/jbc.M004006200

	ABBREVIATIONS

The abbreviations used are: ACE, angiotensin-converting enzyme; sACE, somatic ACE; gACE, germinal ACE; PGK2, phosphoglycerate kinase 2; Ps, PGK2-somatic ace; Pg, PGK2-germinal ace; bp, base pair; kb, kilobase pair; CMV, cytomegalovirus; OPK, opossum kidney cells; PBS, phosphate-buffered saline.

	REFERENCES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCECURES RESULTS DISCUSSION REFERENCES

CiteULike

Complore

Connotea

Del.icio.us

Digg

Reddit

Technorati

This article has been cited by other articles:

				G. Kondoh, H. Watanabe, Y. Tashima, Y. Maeda, and T. Kinoshita Testicular Angiotensin-Converting Enzyme with Different Glycan Modification: Characterization on Glycosylphosphatidylinositol-Anchored Protein Releasing and Dipeptidase Activities J. Biochem., January 1, 2009; 145(1): 115 - 121. [Abstract] [Full Text] [PDF]

				E. Deguchi, T. Tani, H. Watanabe, S. Yamada, and G. Kondoh Dipeptidase-Inactivated tACE Action In Vivo: Selective Inhibition of Sperm-Zona Pellucida Binding in the Mouse Biol Reprod, November 1, 2007; 77(5): 794 - 802. [Abstract] [Full Text] [PDF]

				Y. Ueda, R. Yamaguchi, M. Ikawa, M. Okabe, E. Morii, Y. Maeda, and T. Kinoshita PGAP1 Knock-out Mice Show Otocephaly and Male Infertility J. Biol. Chem., October 19, 2007; 282(42): 30373 - 30380. [Abstract] [Full Text] [PDF]

				S. P. Kessler, P. deS. Senanayake, C. Gaughan, and G. C. Sen Vascular expression of germinal ACE fails to maintain normal blood pressure in ACE-/- mice FASEB J, January 1, 2007; 21(1): 156 - 166. [Abstract] [Full Text] [PDF]

				R. Yamaguchi, K. Yamagata, M. Ikawa, S. B. Moss, and M. Okabe Aberrant Distribution of ADAM3 in Sperm from Both Angiotensin-Converting Enzyme (Ace)- and Calmegin (Clgn)-Deficient Mice Biol Reprod, November 1, 2006; 75(5): 760 - 766. [Abstract] [Full Text] [PDF]

				T. M. Rowe, M. Rizzi, K. Hirose, G. A. Peters, and G. C. Sen A role of the double-stranded RNA-binding protein PACT in mouse ear development and hearing PNAS, April 11, 2006; 103(15): 5823 - 5828. [Abstract] [Full Text] [PDF]

				S. P. Kessler, S. Hashimoto, P. S. Senanayake, C. Gaughan, G. C. Sen, and J. Schnermann Nephron Function in Transgenic Mice with Selective Vascular or Tubular Expression of Angiotensin-Converting Enzyme J. Am. Soc. Nephrol., December 1, 2005; 16(12): 3535 - 3542. [Abstract] [Full Text] [PDF]

				H. Nishimura, E. Kim, T. Nakanishi, and T. Baba Possible Function of the ADAM1a/ADAM2 Fertilin Complex in the Appearance of ADAM3 on the Sperm Surface J. Biol. Chem., August 13, 2004; 279(33): 34957 - 34962. [Abstract] [Full Text] [PDF]

				S. Fuchs, H. D. Xiao, J. M. Cole, J. W. Adams, K. Frenzel, A. Michaud, H. Zhao, G. Keshelava, M. R. Capecchi, P. Corvol, et al. Role of the N-terminal Catalytic Domain of Angiotensin-converting Enzyme Investigated by Targeted Inactivation in Mice J. Biol. Chem., April 16, 2004; 279(16): 15946 - 15953. [Abstract] [Full Text] [PDF]

				S. Han, W. Xie, S. R. Hammes, and J. DeJong Expression of the Germ Cell-specific Transcription Factor ALF in Xenopus Oocytes Compensates for Translational Inactivation of the Somatic Factor TFIIA J. Biol. Chem., November 14, 2003; 278(46): 45586 - 45593. [Abstract] [Full Text] [PDF]

				S. P. Kessler, P. deS. Senanayake, T. S. Scheidemantel, J. B. Gomos, T. M. Rowe, and G. C. Sen Maintenance of Normal Blood Pressure and Renal Functions Are Independent Effects of Angiotensin-converting Enzyme J. Biol. Chem., May 30, 2003; 278(23): 21105 - 21112. [Abstract] [Full Text] [PDF]

				S. Metayer, F. Dacheux, J.-L. Dacheux, and J.-L. Gatti Germinal Angiotensin I-Converting Enzyme Is Totally Shed from the Rodent Sperm Membrane During Epididymal Maturation Biol Reprod, December 1, 2002; 67(6): 1763 - 1767. [Abstract] [Full Text] [PDF]

				W. X. Liao and A. C. Roy Lack of association between polymorphisms in the testis-specific angiotensin converting enzyme gene and male infertility in an Asian population Mol. Hum. Reprod., March 1, 2002; 8(3): 299 - 303. [Abstract] [Full Text] [PDF]

				S. P. Kessler, J. B. Gomos, T. S. Scheidemantel, T. M. Rowe, H. L. Smith, and G. C. Sen The Germinal Isozyme of Angiotensin-converting Enzyme Can Substitute for the Somatic Isozyme in Maintaining Normal Renal Structure and Functions J. Biol. Chem., February 1, 2002; 277(6): 4271 - 4276. [Abstract] [Full Text] [PDF]

				S. Metayer, F. Dacheux, Y. Guerin, J.-L. Dacheux, and J.-L. Gatti Physiological and Enzymatic Properties of the Ram Epididymal Soluble Form of Germinal Angiotensin I-Converting Enzyme Biol Reprod, November 1, 2001; 65(5): 1332 - 1339. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) All Versions of this Article: 275/34/26259    most recent M004006200v1 Submit a Letter to Editor Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Kessler, S. P. Articles by Sen, G. C. Search for Related Content PubMed PubMed Citation Articles by Kessler, S. P. Articles by Sen, G. C. Social Bookmarking                      What's this?