JBC INTERFERin siRNA transfection reagent

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Originally published In Press as doi:10.1074/jbc.M003322200 on June 15, 2000

J. Biol. Chem., Vol. 275, Issue 35, 27013-27020, September 1, 2000
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
275/35/27013    most recent
M003322200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wang, Y.
Right arrow Articles by Prywes, R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wang, Y.
Right arrow Articles by Prywes, R.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Activation of ATF6 and an ATF6 DNA Binding Site by the Endoplasmic Reticulum Stress Response*

Yan WangDagger, Jingshi ShenDagger, Natalia Arenzana, Witoon Tirasophon§, Randal J. Kaufman§, and Ron Prywes

From the Department of Biological Sciences, Columbia University, New York, New York 10027 and the § Department of Biological Chemistry and Howard Hughes Medical Institute, University of Michigan Medical Center, Ann Arbor, Michigan 48109

Received for publication, April 18, 2000, and in revised form, June 13, 2000

    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

ATF6 is a member of the basic-leucine zipper family of transcription factors. It contains a transmembrane domain and is located in membranes of the endoplasmic reticulum. ATF6 has been implicated in the endoplasmic reticulum (ER) stress response pathway since it can activate expression of GRP78 and other genes induced by the ER stress response. ER stress appears to activate ATF6 by cleavage from the ER membrane and translocation to the nucleus. However, direct DNA binding by ATF6 had not been demonstrated. In this report, we have identified a consensus DNA binding sequence for ATF6. This site is related to but distinct from ATF1/CREB binding sites. The site was placed in a reporter gene and was specifically activated by ATF6 overexpression and was strongly induced by the ER stress response. A dominant negative form of ATF6 blocked ER stress induction of both ATF6 site and GRP78 reporter genes. We further found that GAL4-ATF6 could be activated by ER stress. These results demonstrate that ATF6 is a direct target of the ER stress response. A proximal sensor of the ER stress response, human IRE1 (hIRE1), was sufficient to activate the ATF6 reporter gene, while a dominant negative form of hIRE1 blocked ER stress activation, suggesting that hIRE1 is upstream of ATF6 in the ER stress signaling pathway.

    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

The endoplasmic reticulum (ER)1 stress response is a mechanism by which cells protect themselves from many noxious insults that cause protein unfolding in the ER (reviewed in Ref. 1). Inducers of this response include inhibitors of glycosylation (tunicamycin), dithiothreitol, agents that affect calcium homeostasis such as calcium ionophores and thapsigargin (an inhibitor of an ER calcium-ATPase), and agents that perturb ER function and protein movement such as brefeldin A.

The ER stress response (also known as the unfolded protein response) causes an increase in gene expression of a number of ER chaperones, such as GRP78/BiP and GRP94, and erp72, which is related to protein-disulfide isomerase (1). These factors probably allow the cell to refold unfolded proteins in the ER. Analysis of the promoters of these genes has revealed a consensus sequence element, CCAATN9CCACG, that is required for ER stress induction of the promoters (2, 3). Mutation of this ER stress response element (ERSE) has shown that both the 5' CCAAT and 3' CCACG boxes are required. The variable central region was not sensitive to point mutations; however, some multiple base changes abolished activity (2, 3).

Not surprisingly, NF-Y/CBP binds to the 5' CCAAT box of the ERSE (4, 5); however, it has been less clear which factor(s) bind the element to mediate the ER stress response. In order to identify factors binding the ERSE, Yoshida et al. (2) utilized a yeast one-hybrid approach and found ATF6. While they were not able to show that ATF6 bound the ERSE directly, overexpression of ATF6 activated GRP78 reporter genes in mammalian cells in an ERSE site-dependent manner. They suggested that ATF6 can interact with the ERSE directly or indirectly in mammalian cells.

ATF6 is a member of the ATF/CREB basic-leucine zipper (bZIP) DNA-binding protein family (6). It is a 90-kDa protein with 670 amino acids (7). ATF6 contains a transmembrane domain at amino acids 378-398 with the N terminus facing the cytoplasm (8). By immunofluorescence and cell fractionation, Haze et al. (8) found that ATF6 resides in the ER. They were also able to identify an ER stress-induced 50-kDa cleavage product of ATF6, which is proposed to be an active form of the factor. Consistent with this model, the 50-kDa protein was found in nuclear fractions. In addition, expression of the cytoplasmic domain of ATF6 (aa 1-373) resulted in a protein that localized entirely in the nucleus and that activated expression of the GRP78 gene (8). We identified ATF6 in a yeast two hybrid-like screen interacting with the serum response factor, a transcription factor that controls growth factor induced expression of the c-fos gene (7). It is thus possible that ATF6 activation may affect other targets besides ERSE-containing genes.

In order to characterize the function and mechanism of activation of ATF6, we describe here the identification of a consensus DNA binding site for ATF6. This site is activated by overexpression of ATF6 and by ER stress inducers. In addition, a GAL4-ATF6 fusion protein is regulated by ER stress, demonstrating that ATF6 can respond to this signal.

    EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Binding Site Selection and Gel Mobility Shift Assays

Bacterial expression vector pET28bATF6bZIP was constructed by PCR amplification of the region of ATF6 encoding amino acids 287-432. This fragment was cloned into BamHI to XhoI sites of pET28b (Novagen) downstream of a polyhistidine tag. ATF6bZIP protein was expressed in Escherichia coli strain BLR (Novagen) from the pET28bATF6bzip vector and purified on Ni2+-agarose (Invitrogen) as described (9). Selection of ATF6bZIP binding to random oligonucleotides was done by gel mobility shift assay essentially as described (10). Briefly, the reaction conditions were 10 mM Tris-HCl, pH 7.5, 2 µg of herring sperm DNA, 1 mM DTT, and 20 ng of ATF6bZIP protein in 20 µl. This mixture was incubated with 1 ng of 32P-labeled N15 probe for 1 h at room temperature and loaded on a 4% polyacrylamide gel in 0.25× TBE (25 mM Trizma base, 25 mM boric acid, 1 mM EDTA). The N15 probe was 5'-TACGGATCCCTACAGGTGCN15GCAATCCAGGAATTCGT-3', where the central 15 nucleotides were random. It was annealed to PCR primer 2, 5'-ACGAATTCCTGGATTCG-3', and extended with the Klenow fragment of E. coli DNA polymerase. The double-stranded oligonucleotide was then labeled with [gamma -32P]ATP and T4 polynucleotide kinase. The position of the ATF6bZIP-DNA complex was estimated by comparison with the low affinity binding of the protein to a similarly labeled probe containing the c-fos AP1 site in the presence of 0.5 µg of herring sperm DNA. This position of the gel was excised from the gel, and the protein-bound DNA was soaked out of the gel slice in 10 mM Tris-HCl, pH 8.0, 1 mM EDTA. The excised DNA was PCR-amplified using PCR primer 2 and PCR primer 1 (5'-TACGGATCCCTACAGGTGC-3'). The PCR product was 32P-labeled and used for the next round of selection. This process was repeated for seven cycles. The PCR product from the sixth round of selection was subcloned into the BamHI and EcoRI sites of pBluescript II SK+ and sequenced.

The following double-stranded oligonucleotides were synthesized for binding experiments with ATF6bZIP and ATF1.
<UP>AFT6         </UP><UP>TCGAGACAGGTGCTGACGTGGCGATTCC</UP>

<UP>AFT6ml       </UP><UP>TCGAGACAGGTGCTGACGT<UNL>T</UNL>GCGATTCC</UP>

<UP>CRE </UP>(<UP>c-</UP><IT>fos</IT>)  <UP>GATCTTGAGCCCGTGACGTTTACACACTCA</UP>

<UP><SC>Sequences 1–3</SC></UP>
The nucleotide mutated in ATF6m1 is underlined. Full-length ATF1 with a polyhistidine tag at the N terminus was cloned into pET28b at the NcoI and SalI sites. Histidine-tagged ATF1 was purified from E. coli on Ni2+-agarose as described (9). Purified ATF6bZIP and ATF1 proteins were assayed for binding to the 32P-labeled oligonucleotides by gel mobility shift assay as described above. For competitions in Fig. 3A, increasing amounts of the ATF6 oligonucleotide were added or, as a control, 100 ng of oligonucleotide RP4 (5'-TCGAGAAGCGCCCAGGCCCGCGCGCA-3').

Plasmids

Luciferase Reporter Genes-- Oligonucleotides ATF6 and ATF6m1 containing one of the selected ATF6 sites and a single base mutation (underlined) were used in reporter genes. Their sequences are as follows.


<UP>ATF6     </UP><UP>CTCGAGACAGGTGCTGACGTGGCATTC</UP>

<UP>ATF6ml   </UP><UP>CTCGAGACAGGTGCTGACGT<UNL>T</UNL>GCGATTC</UP>

<UP><SC>Sequences 4 and 5</SC></UP>
They were cloned into pOFluc-GL3 (11) at an XhoI site 5' to the c-fos minimal promoter (-53 to +45 of the human c-fos promoter) and the firefly luciferase gene. Plasmid p5×ATF6GL3 contains five repeats of the ATF6 oligonucleotide, while pATF6GL3 and pATF6m1GL3 contain one copy each of their respective sites. The p4×CRE-luciferase reporter was from Stratagene. The p5×GAL4-E1b-luc reporter contains five GAL4 sites upstream of the adenovirus E1b minimal promoter and the firefly luciferase gene. The rat GRP78-luciferase reporter gene with -304 to +7 of the rat GRP78 promoter was as described (2).

Expression Vectors-- pCGNATF6 contains full-length ATF6 (aa 1-670) with an HA epitope tag at the N terminus as described (7). pCGNATF6-(1-373) contains amino acids 1-373 of ATF6 (generated by PCR amplification) in the XbaI-BamHI sites of pCGN (12). pCGNATF6-(1-373)m1 was made from pCGNATF6-(1-373) with the QuikChange site-directed mutagenesis kit (Stratagene). Amino acids 315-317 were changed from KNR to TAA. pSV40Gal4ATF6 contains the SV40 early promoter driving expression of GAL4's DNA binding domain (aa 1-147) fused to full-length ATF6 (aa 1-670). The expression vector for hIRE1alpha , pED-hIRE1, was as described (13). The dominant negative form of hIRE1alpha with the deletion of the C-terminal kinase and nuclease domains, pED-hIRE1Delta C, contains the coding region for amino acids 1-492 of hIRE1alpha . The cAMP-dependent protein kinase expression vector, pFC-PKA, was from Stratagene.

Transfections and Luciferase Assays

HeLa cells were grown in Dulbecco's modified Eagle's medium supplemented with 10% fetal calf serum. Cells were transfected by the calcium phosphate coprecipitation method (14). Each transfection mixture for a 60-mm diameter plate contained 0.5 µg of luciferase reporter gene, 0.1 µg of pRLSV40P as an internal control (15), the indicated amounts of expression constructs, and herring sperm DNA to give a total of 10 µg of DNA. HeLa cells were transfected for 16-20 h and then induced with 2 µg/ml tunicamycin for 12 h. The transfected cells were lysed and assayed for firefly and Renilla luciferase activity using the dual luciferase kit (Promega). The results were normalized to the Renilla luciferase activity of the internal control. Each experiment was repeated four or more times. The average and the S.E. are shown.

Immunoblotting

Cell lysates were prepared from transfected HeLa cells by resuspending the cells on the plate in 0.2 ml of 3× SDS sample buffer (6% SDS, 180 mM Tris-HCl (pH 6.8), 30% glycerol, 0.003% bromphenol blue, 1% beta -mercaptoethanol) and boiled for 5 min. The lysates were analyzed by immunoblotting using a 1:1000 dilution of anti-HA monoclonal antibody (Babco). Horseradish peroxidase-conjugated goat anti-mouse IgG (Sigma) was used as a secondary antibody at a 1:4000 dilution, and the signal was visualized using the ECL chemiluminescence kit (Amersham Pharmacia Biotech).

    RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Selection of an ATF6 DNA Binding Site-- Since ATF6 is a bZIP protein of the ATF/CREB family, it was likely that it could bind directly to DNA. We expressed a fragment of ATF6 (aa 287-432) spanning the bZIP domain with a polyhistidine tag. We found that the purified protein was able to bind weakly to ATF-related sites such as the c-fos FAP1 site, which is immediately 3' to the c-fos SRE (data not shown). Binding was readily apparent using 0.5 µg of herring sperm DNA as nonspecific competitor in the gel mobility shift assay but was not observed under more stringent conditions where we used 2 µg of herring sperm DNA. The binding was nearly undetectable under conditions where similar amounts of ATF1 bound a consensus ATF1/CREB site well (data not shown).

We decided to look for higher affinity ATF6 DNA binding sites by selecting from a pool of random oligonucleotides by gel mobility shift assays (10). We used a random oligonucleotide with 15 central random nucleotides and fixed ends allowing it to be amplified by PCR. We mixed the 32P-labeled random oligonucleotides with the purified ATF6bZIP protein in a gel mobility assay using the more stringent conditions of 2 µg of herring sperm DNA. The region of the gel where ATF6bZIP bound to the FAP1 site was excised, and the DNA was isolated and amplified by PCR. This amplified product was 32P-labeled and used in another round of gel mobility shift assay selection. This process was repeated seven times. The results from cycles 2, 6, and 7 are shown in Fig. 1. There was no clear band in cycles 1-4. A faint band was apparent at cycle 5. A strong band was observed at cycle 6 and was not further increased at cycle 7, suggesting that further rounds would not select for higher affinity sites (Fig. 1 and data not shown).


View larger version (59K):
[in this window]
[in a new window]
 
Fig. 1.   Selection of ATF6 DNA binding sites. DNA oligonucleotides binding to ATF6 were selected from a pool of oligonucleotides with 15 central random bases. Gel mobility shift assays were performed with or without bacterial expressed ATF6bZIP and 32P-labeled oligonucleotides from the indicated rounds of selection.

We subcloned the PCR products from the sixth round of selection and sequenced 20 individual clones. These results are shown in Fig. 2. Two sequences were found twice with all the others being unique. We tested all of the 20 products in a gel mobility shift assay for binding to ATF6bZIP protein and found they all bound similarly, although it was difficult to compare them quantitatively, since the amount of each product and the efficiency of 32P labeling varied (data not shown). Notably, all the subclones contained the sequence TGACGT. The sequence TGACGT is also the core of ATF1/CREB sites (known as CREs), which have the consensus TGACGTCA (16). We aligned the sequences according to the TGACGT core to determine a consensus binding site (Fig. 2). This suggests a consensus of (G)(G)TGACGTG(G/A), where the nucleotides in parentheses are less strongly maintained. We found that 18 of 20 had a G following the core sequence, suggesting that this nucleotide is particularly important. The flanking sequence that was fixed in the design of the random oligonucleotides may also contribute to binding by ATF6, since in 17 of 20 cases the core TGACGTG sequence was found juxtaposed to the 3'-flanking sequence. We have not included bases from the flanking sequence in the consensus; however, the final base of the consensus was G in two of four cases, and G is also the first base in the 3'-flanking sequence, suggesting a consensus of TGACGTGG. The only two sequences without GG at the end (sequence 2 in Fig. 2) seem to be exceptions to the rule and contain a perfect inverted repeat sequence TGACGTCA, which is identical to the ATF1/CREB consensus.


View larger version (59K):
[in this window]
[in a new window]
 
Fig. 2.   ATF6 consensus DNA binding sequence. DNA sequences were selected by gel mobility shift assays from the sixth round of selection shown in Fig. 1 and sequenced. The sequences from 20 subcloned sites are shown, with two being found identically twice (indicated as 2×). The sequences are aligned by the sequence TGACGT (underlined) that was found in all of the 20 subclones. The sequences from the position of the initial 15 random bases are shown in boldface type, and the fixed flanking sequence is shown in normal type. At the bottom is shown the number of times each nucleotide was found in positions relative to the common TGACGT sequence. Only bases from the random base positions were used for this determination of the consensus ATF6 binding site.

Specific DNA Binding by ATF6-- To demonstrate that binding by ATF6 was specific, we synthesized a double-stranded oligonucleotide corresponding to sequence 1 in Fig. 2 and will refer to this as the ATF6 site. This oligonucleotide was 32P-labeled, and strong binding of ATF6 was observed in a gel mobility shift assay (Fig. 3A). This binding was competed away by excess unlabeled ATF6 site oligonucleotide but not by 100 ng of a nonspecific oligonucleotide (Fig. 3A).


View larger version (37K):
[in this window]
[in a new window]
 
Fig. 3.   Specific binding of ATF6 to the consensus DNA binding sequence. A, gel mobility shift assays were performed with bacterial expressed ATF6bZIP and a 32P-labeled oligonucleotide containing the ATF6 consensus DNA binding site corresponding to sequence 1 in Fig. 2. Increasing amounts of this oligonucleotide (termed ATF6) were added as competitor to demonstrate specific binding. Nonspecific oligonucleotide RP4 (100 ng) was added as a control (-). B, gel mobility shift assays were performed with the indicated probes and either recombinant ATF6bZIP or ATF1. ATF6m1 contains a single point mutation, TGACGTTG, compared with the ATF6 site, TGACGTGG. The CRE probe corresponds to the c-fos CRE and has the core sequence TGACGTTT. C, the assays contained the ATF6 probe and increasing amounts of ATF6bZIP or ATF1. The positions of ATF6 and ATF1 DNA complexes are indicated.

Since the ATF6 consensus site is similar to CRE sites, we compared binding of ATF6 to these sites. We used a CRE oligonucleotide corresponding to the -60 CRE from the c-fos promoter, which contains the sequence TGACGTTT (17). ATF6 bound this site significantly more weakly than the ATF6 site (Fig. 3B, lanes 1 and 3). We also mutated the ATF6 site from TGACGTGG to TGACGTTG (referred to as the ATF6m1 site). ATF6 bound the ATF6m1 site significantly more weakly than the ATF6 site (Fig. 3B, lanes 1 and 2), suggesting that the G flanking the TGACGT core is critical to ATF6-specific binding. In contrast, we found that purified ATF1 bound all three sites, with stronger binding to the CRE and ATF6m1 sites (Fig. 3B, lanes 4-6).

It is also apparent that ATF1 binding to the CRE site is similar to ATF6 binding to the ATF6 site (Fig. 3B, compare lanes 6 and 1). Since high affinity binding of ATF1 to CRE sites is well characterized (16), this suggests that ATF6 binds its site with high affinity.

We next compared binding of ATF6 and ATF1 to the ATF6 site to further show that that ATF6 binds the site we have identified with high affinity compared with ATF1. A titration of similar amounts of these factors showed that ATF6 binds its site significantly better than ATF1 (Fig. 3C).

Activation of the ATF6 Site by ER Stress and ATF6 in Vivo-- To check whether the ATF6 consensus DNA binding site can function in vivo, we constructed a luciferase reporter gene with five ATF6 sites in front of the c-fos minimal promoter. This reporter was transfected into HeLa cells along with a full-length (aa 1-670) ATF6 expression vector. ATF6 strongly activated the 5× ATF6 site reporter (Fig. 4A). There was no effect of ATF6 on the internal control of the SV40 promoter driving a Renilla luciferase gene (data not shown). In order to determine whether the ATF6 sites were targets for the ER stress response, we treated the transfected cells with or without tunicamycin. Tunicamycin strongly activated the 5× ATF6-luciferase gene 30-fold (Fig. 4A). Tunicamycin also further increased ATF6 activation of the reporter, but only by about 2-fold. A reporter gene lacking the ATF6 sites was not induced by tunicamycin (data not shown). The internal control of SV40-Renilla luciferase was consistently reduced by tunicamycin treatment by about 50%, perhaps due to toxicity, and we have normalized the results to the Renilla luciferase activity to account for possible cell loss and variations in transfection efficiencies. We also found that other ER stress inducers, including thapsigargin and brefeldin A, induced expression of the 5× ATF6 reporter gene (data not shown). These results suggest that ATF6 is a general target of agents that induce the ER stress response and that the ATF6 site is a direct target of ATF6 in cells.


View larger version (63K):
[in this window]
[in a new window]
 
Fig. 4.   Activation of the ATF6 site reporter gene by tunicamycin and ATF6. A, HeLa cells were transfected with the 5× ATF6 site luciferase reporter gene (p5×ATF6GL3) with or without pCGNATF6 (3 µg) expressing full-length ATF6. In addition, pRLSV40P encoding Renilla luciferase was transfected as an internal control. After 36 h of transfection, the cells were induced with or without tunicamycin (2 µg/ml) for 12 h and assayed for firefly and Renilla luciferase activities. The results were normalized for Renilla luciferase activity and are averages with S.E. of four experiments. B, HeLa cells were transfected with p5×ATF6GL3, pRLSV40P and the indicated amounts of pCGNATF6 or pCGNATF6-(1-373) encoding the cytoplasmic domain of ATF6. After 48 h of transfection, the cells were lysed and assayed for luciferase activities. The results are representative of two experiments. C, HeLa cell extracts were made from the cells transfected in Fig. 4B and assayed by immunoblotting with anti-HA antibodies to the epitope on the N terminus of transfected ATF6. The positions of full-length ATF6 and ATF6-(1-373) are indicated by arrows. A background band was observed just below ATF6-(1-373).

Haze et al. (8) found that the cytoplasmic domain of ATF6 localized to the nucleus and activated GRP78 gene expression. We tested whether a similar ATF6 construct (aa 1-373) lacking the transmembrane and ER luminal domains could activate the 5× ATF6 site reporter. We used increasing amounts of ATF6-(1-373) and full-length ATF6 to compare their ability to activate the reporter. ATF6-(1-373) strongly activated the 5× ATF6 site reporter with as little as 10 ng of plasmid, activating as strongly as 3 µg of full-length ATF6 (Fig. 4B). To correlate this with ATF6 protein expression, we assayed transfected cell lysates by immunoblotting with antisera to the HA epitope tag at the N terminus of the ATF6 constructs. We found that transfection of 30 ng of ATF6-(1-373) gave a similar level of protein expression as 1 µg of full-length ATF6 (Fig. 4C). However, 30 ng of ATF6-(1-373) strongly activated reporter gene expression, while 1 µg of full-length ATF6 had little effect (Fig. 4B). This demonstrates that ATF6-(1-373) is an activated form of ATF6.

We also tested by immunofluorescence whether the ATF6 constructs localized to the ER or the nucleus. Similar to the results of Haze et al. (8), full-length ATF6 was localized outside the nucleus, consistent with ER localization, while ATF6-(1-373) was entirely localized to the nucleus (data not shown).

Haze et al. (8) detected a 50-kDa cleavage product of ATF6 that was induced by tunicamycin treatment. This was observed using antisera to endogenous ATF6. We have not been able to detect this 50-kDa fragment using our anti-ATF6 serum (7), at least partially due to the high background observed with this serum (data not shown). Upon overexpression of ATF6, Haze et al. (8) did not observe tunicamycin-induced ATF6 cleavage but did detect the constitutive presence of the 50-kDa cleavage product using anti-HA epitope sera and the same ATF6 construct as we have used. We have not clearly detected the 50-kDa form of ATF6 using the anti-HA sera (Fig. 4C, lanes 9 and 10). Using 3 µg of ATF6 plasmid, which is the amount that activates reporter gene expression, we do detect a generally higher background (Fig. 4C, lane 10) such that there may be basal cleavage at multiple sites leading to translocation of the ATF6 cytoplasmic domain to the nucleus. While a band is seen near the 50-kDa marker in lane 10, upon longer exposure this band is also present in all of the other lanes. It is possible that a fragment of ATF6 comigrates with the background band at about 55 kDa or that it is simply below the limits of our detection. This is possible, since low levels (3 ng) of ATF6-(1-373) partially activated the reporter gene (Fig. 4B) but were nearly undetectable in the immunoblot (Fig. 4C, lane 3). Further work will be required to resolve this issue (see "Discussion").

Specificity of Activation of the ATF6 Site-- Since the ATF6 site we have identified is similar to the consensus CRE site, we compared the ability of a 4× CRE luciferase reporter gene (with the multimerized sequence TGACGTCA) to be induced by tunicamycin and activated by ATF6. In contrast to the 5× ATF6 reporter, the CRE reporter was not induced by tunicamycin or by overexpression of ATF6-(1-373) (Fig. 5A). As a control, the 4× CRE reporter was strongly activated by the catalytic subunit of cAMP-dependent protein kinase.


View larger version (22K):
[in this window]
[in a new window]
 
Fig. 5.   Specific activation of the ATF6 site. A, HeLa cells were transfected with the 5× ATF6 site reporter or a 4× CRE reporter with or without tunicamycin or ATF6-(1-373) (100 ng) as described in the legend to Fig. 4. As a control for activation of the 4× CRE reporter, it was transfected with a cAMP-dependent protein kinase expression vector (1 µg). B, single site reporters with the consensus ATF6 site (ATF6GL3) or a mutant site (ATF6m1GL3) were transfected with or without tunicamycin or ATF6-(1-373) as described above. The point mutation in ATF6m1 is identical to that used in Fig. 3B (TGACGTTG compared with the consensus TGACGTGG). The results are averages with S.E. of four experiments.

The consensus ATF6 site contrasts with CRE sites in that it contains a G 3' to the TGACGT core CRE sequence. We therefore tested the importance of this nucleotide by comparing reporter genes with one copy of the ATF6 site (TGACGTG) or the ATF6m1 mutant site (TGACGTT). In vitro ATF6 bound the ATF6m1 site significantly more weakly than the ATF6 site, while ATF1 bound the ATF6m1 site somewhat better (Fig. 3B). The 1× ATF6 site reporter gene was induced by tunicamycin and ATF6-(1-373), although the activation was weaker than the 5× ATF6 reporter (Fig. 5B). In contrast, the ATF6m1 reporter was neither induced by tunicamycin nor activated by ATF6-(1-373). These results indicate that the activation of the ATF6 consensus site by tunicamycin and ATF6 is specific to the ATF6 consensus site and correlates with binding of ATF6 to the sites in vitro.

ATF6 Is Required for Activation of the ATF6 Consensus DNA Binding Site-- Since the ATF6 site reporter genes were activated by ER stress inducers, we sought to test whether endogenous ATF6 is required for this activation using a potentially dominant negative form of ATF6. We made point mutations in the basic region of ATF6 in the context of ATF6-(1-373). These mutations (KNR to TAA at aa 315-317) would be predicted to disrupt DNA binding activity of the cytoplasmic domain. It would act as a dominant negative if it dimerized with endogenous ATF6 and prevented its binding to ATF6 DNA binding sites. This construct, ATF6-(1-373)m1, did not activate the 5× ATF6 site reporter, as expected, and completely inhibited tunicamycin induction of the reporter (Fig. 6A). There was no effect of ATF6-(1-373)m1 on the SV40 promoter-Renilla luciferase internal control. The inhibition of tunicamycin induction of the ATF6 site by the ATF6 dominant negative mutants strongly suggests that endogenous ATF6 is mediating tunicamycin induction through this site.


View larger version (31K):
[in this window]
[in a new window]
 
Fig. 6.   ATF6 is required for tunicamycin induction of the consensus DNA binding site and the GRP78 promoter. A, HeLa cells were transfected with dominant negative ATF6, pCGNATF6-(1-373)m1 (1 µg), or with vector pCGN (-) together with the p5×ATF6GL3 reporter gene and pRLSV40, treated with or without tunicamycin, and assayed for luciferase activities as described in the legend to Fig. 4. ATF6-(1-373)m1 contains the complete cytoplasmic domain of ATF6 with three point mutations in the basic region (aa 315-317) that are predicted to abolish DNA binding. B, HeLa cells were transfected as above but with the rat GRP78 promoter-luciferase reporter gene. The results are averages with S.E. of four experiments.

To test whether ATF6 is required for ER stress induction of the GRP78 gene, which contains three ERSE elements, we transfected ATF6-(1-373)m1 with a rat GRP78 promoter reporter gene. This reporter was induced 3.5-fold by tunicamycin, and this induction was reduced to 1.6-fold by ATF6-(1-373)m1 (Fig. 6B).

Activation of GAL4-ATF6 by Tunicamycin-- Since levels of endogenous ATF6 appear to be sufficient to mediate tunicamycin induction of the ATF6 site, we were not able to show directly by transfection of ATF6 that it is required for induction of the site. In order to confirm that ATF6 can be activated by the ER stress response, we fused it to the GAL4 DNA binding domain and tested whether a 5× GAL4 site-luciferase reporter gene could then be induced by tunicamycin. While the GAL4 reporter was not induced by tunicamycin, cotransfection of increasing amounts of GAL4-ATF6 resulted in tunicamycin induction of the reporter (Fig. 7). Only the highest amounts of GAL4-ATF6 activated the reporter without tunicamycin induction. This is similar to the activation we see with full-length ATF6 (Fig. 4B) and may represent basal cleavage of the protein, releasing the cytoplasmic domain from the membrane. The tunicamycin induction of GAL4-ATF6 clearly shows that ATF6 is a target of the ER stress response.


View larger version (30K):
[in this window]
[in a new window]
 
Fig. 7.   Tunicamycin induction of GAL4-ATF6. Increasing amounts of a GAL4 DNA binding domain fusion with ATF6 were transfected with the 5× GAL4 site reporter gene and pRLSV40P as an internal control. The cells were treated with or without tunicamycin and assayed for luciferase activity as described for Fig. 4A. The results are averages with S.E. of four experiments.

IRE1 Is Required for Tunicamycin Induction of ATF6-- Ire1p is an ER transmembrane protein that is required for the ER stress response in the budding yeast, Saccharomyces cerevisiae (18, 19). Ire1p contains a cytoplasmic protein kinase domain along with a domain similar to endoribonuclease RNase L (20). Yeast Ire1p can be activated by ER stress signals, which leads to activation of its ribonuclease activity. This activity causes the cleavage of an mRNA for the transcription factor Hac1p at two sites removing an intron. The cleaved mRNA is subsequently religated by a tRNA ligase. This results in enhanced translation of Hac1p, which activates ER stress-responsive genes in yeast (20-23). Two mammalian homologues of yeast Ire1p have been cloned that have similar domains and ER membrane localization (13, 24). Overexpression of mammalian IRE1 (hIRE1alpha and mIRE1beta ) activated GRP78 gene expression, and dominant negative IRE1 was able to inhibit tunicamycin induction of GRP78 expression (13, 24). These results suggest that IRE1 is also a critical mediator of the ER stress response in mammalian cells.

Since GRP78 is regulated by ATF6 (2), we sought to determine whether IRE1 is necessary or sufficient for ATF6 activation as well. Overexpression of hIRE1alpha resulted in strong activation of the 5× ATF6 site reporter, which could be increased another 2.5-fold by tunicamycin treatment (Fig. 8A). We tested a dominant negative hIRE1alpha construct, hIRE1Delta C, which has a deletion of the C-terminal kinase and RNase L-like domains, for an effect on ATF6 activation. We found that hIRE1Delta C strongly inhibited tunicamycin induction of the 5× ATF6 site reporter gene (Fig. 8A). We tested point mutants, K599A and K907A, that abolish the kinase or nuclease activities, respectively,2 for their activation of the 5× ATF6 reporter gene. Neither of these were able to activate the reporter, suggesting that both activities are required for IRE1 function (Fig. 8B). Both of these point mutants only weakly inhibited tunicamycin induction; however, they were both expressed weakly (as assayed by immunoblotting) compared with hIRE1Delta C (data not shown). The K599A mutant was previously shown to block tunicamycin induction of the GRP78 gene in COS cells (13). This may be due to the higher expression of transfected genes in COS cells compared with HeLa cells. In addition, the hIRE1Delta C construct was found to be a more effective inhibitor of GRP78 induction in COS cells.3 These results show that hIRE1alpha overexpression is sufficient to induce ATF6 and suggest that IRE1 is required for ATF6 activation. This suggests that IRE1 is upstream of ATF6 in the ER stress response pathway. Further, both the kinase and nuclease activities of IRE1 appear to be required for ATF6 activation.


View larger version (30K):
[in this window]
[in a new window]
 
Fig. 8.   Role of hIRE1 in ATF6 activation. A, expression vectors (1 µg) for hIRE1alpha or a dominant negative form of hIRE1alpha lacking the C-terminal kinase and nuclease domains (hIRE1Delta C) were transfected into HeLa cells with the p5×ATF6GL3 reporter gene and pRLSV40P. The cells were treated with or without tunicamycin and assayed for luciferase activity as described for Fig. 4A. B, mutants of hIRE1alpha were tested for activation of the 5× ATF6 site reporter gene. The K599A and K907A mutants abolish hIRE1alpha kinase and nuclease activities, respectively. Vector pED (-) or the indicated mutants were transfected as described above without tunicamycin treatment. The results are averages with S.E. of four experiments.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

We have found that ATF6 binds directly to a consensus DNA binding site TGACGTG(G) in vitro. This site could also be activated by overexpression of ATF6 in vivo. When placed upstream of a reporter gene, the consensus ATF6 site was activated by agents that induce the ER stress response. Endogenous ATF6 appears to mediate this response, since dominant negative forms of ATF6 blocked the induction. A fusion of ATF6 to GAL4's DNA binding domain showed that it could mediate ER stress induction of a GAL4 reporter gene. These results firmly show that ATF6 is a target of the ER stress response.

Mori's group (2) identified ATF6 in a yeast one hybrid screen as interacting with the consensus ERSE CCAATN9CCACG. We found that dominant negative ATF6 could also block ER stress induction of the GRP78 promoter that contains three ERSE elements. In addition, ATF6-(1-373) activated expression of the GRP78 reporter, but not of one with mutations in the ERSEs (data not shown). These results further suggest that ATF6 is involved in ER stress induction of the GRP78 gene. NF-Y (CBP) can bind to the CCAAT box of the ERSE site (4, 5), and it has been proposed that ATF6 interacts with NF-Y and binds to the CCACG part of the site (8). Interestingly, this site is the complement of the 3'-half of the ATF6 consensus site we have identified, TGACGTGG. As a member of the bZIP family, ATF6 probably binds to the ATF6 site as a dimer. In fact, using different sized variants of ATF6, we have found that ATF6 can homodimerize, while it did not heterodimerize with either ATF1 or ATF2 in vitro.4 In the ERSE, it is likely that ATF6 only binds to the DNA through a single subunit with the binding stabilized by its interaction with NF-Y or another factor. This would explain why ATF6 does not bind to this site alone (2).5 A similar mechanism is used by Elk-1 binding with serum response factor to the serum response element of the c-fos gene (25).

We have used the isolated bZIP domain of ATF6 to identify its DNA binding site. It is possible that other sequences in the cytoplasmic domain (aa 1-373) will affect the DNA binding specificity. We have not been able to express the full cytoplasmic domain in a soluble form in E. coli in order to test this directly. However, the DNA binding site was activated strongly and specifically by ATF6-(1-373), suggesting that the full domain retains the specificity of the bZIP domain. Regions outside the bZIP domain, however, may affect its association with other factors such as NF-Y and thus affect its binding to other sites. We have also been unable to detect endogenous ATF6 binding activity in nuclear extracts of uninduced or tunicamycin induced HeLa cells (data not shown). Using the ATF6 binding site in a gel mobility shift assay with nuclear extracts, we detect binding of ATF1 and CREB, but not ATF6. This probably reflects the abundance of ATF1 and CREB and the low levels of the ATF6 cleavage product. Nevertheless, the cell can distinguish the ATF6 site from ATF1/CREB binding sites, since we found that only the former site was activated by ATF6-(1-373) and tunicamycin (Fig. 5A).

We propose that some ER stress-inducible genes are activated by direct ATF6 binding sites rather than the consensus ERSE sites. However, our analysis of the promoter regions of ER stress-inducible genes that have been identified has not revealed an ATF6 consensus site that is clearly required for ER stress induction. A match of TGACGTG was found in the mouse and rat GRP78 promoters at -344 and -378 of the transcriptional initiation site, respectively, but was not conserved in the human GRP78 promoter. This region of the rat GRP78 promoter was not required for tunicamycin induction of a reporter gene, since it contains three ERSE-like elements from -163 to -98. However, deletion of -457 to -154 in the rat GRP78 promoter strongly reduced the level of tunicamycin-induced expression from 40 to 7 relative units although the -fold tunicamycin induction was relatively unaltered, changing from 8- to 7-fold (3). Thus, further work will be required to show whether the putative ATF6 site at -378 contributes to ER stress induction of the rat GRP78 reporter gene. An ATF6 site may also be present outside the sequenced promoter regions or in other ER stress-inducible genes where the promoters have not been characterized. We feel it likely that ER stress induction of the ATF6 site occurs in natural promoters, since the induction was very specific with the model reporter gene; a single point mutation in the site abolished induction, and the similar CRE site was not induced at all by tunicamycin.

A BLAST search of the Eukaryotic Promotor Database at the National Center for Biotechnology Information revealed four mammalian promoters that match the ATF6 consensus site TGACGTG. Since the promoter data base is relatively small and limited to 600 bases of the promoter, this search is fairly limited. In addition, the statistical significance of a seven-base match is not very high. Nevertheless, the best match that contains the TGACGTGG sequence was the promoter of the human ADP-ribosylation factor 1 gene. ADP-ribosylation factor 1 is a small GTPase localized to the Golgi that affects vesicular transport (26) such that it is a reasonable candidate for a gene induced to compensate for ER perturbations. Other promoters matching the TGACGTG consensus were the mouse c-mos, human apolipoprotein CII, and human HMG-14 genes. Further work will be required to test these possible ATF6 targets.

The model for ER stress regulation of ATF6 proposed by Haze et al. (8) is that ATF6 is localized on the ER membrane and that upon ER stress it is cleaved off the membrane such that the N-terminal cytoplasmic domain can move to the nucleus and activate gene expression. Although we have not been able to confirm the cleavage of ATF6, our results are generally consistent with this model. We find by immunofluorescence of epitope-tagged ATF6 that it localizes to the ER or cytoplasm (data not shown). When the cytoplasmic domain of ATF6 (aa 1-373) was expressed separately, it localized completely to the nucleus. In addition, this fragment of ATF6 was a potent activator of transcription. Our inability to detect the 50-kDa cleavage product of ATF6 may be due to limits of sensitivity and the small amounts of this fragment that are generated. We used transfection of epitope-tagged ATF6 to look for cleavage, while Haze et al. used antisera to endogenous ATF6. It is possible that transfection of ATF6 results in high levels per cell and that only very low levels of 50-kDa ATF6 are generated in each cell. Nevertheless, Haze et al. also used the same epitope-tagged ATF6 construct in the same cells (HeLa) and detected basal levels of the ATF6 50-kDa cleavage product that we have not detected (Fig. 4C). We cannot account for this difference. Unfortunately, our antisera to ATF6 (7) had a high background in immunoblots such that we were not able to observe a clear 50-kDa product. Further experiments and improved reagents will be required for us to critically judge the presence and importance of the 50-kDa ATF6 cleavage product. Since we and Mori's group (8) have found that ATF6 is an activator of gene expression, the model of cleavage of ATF6 and movement to the nucleus is much more plausible than the alternative, which is that ATF6 acts on transcription as a transmembrane protein on the inner surface of the nuclear membrane or that the full-length protein dissociates from the membrane and moves to the nucleus.

A precedent for activation of a transcription factor by cleavage from the ER membrane is SRE-BP (reviewed in Ref. 27). SRE-BP is an ER transmembrane protein that is activated in response to low cholesterol. This results in cleavage of SRE-BP at two sequential sites. First it is cleaved in the luminal domain by site 1 protease followed by cleavage by site 2 protease in the transmembrane domain near the cytoplasmic face. This results in release of the DNA binding domain of SRE-BP, which moves to the nucleus. The site 1 protease site in SRE-BP was found to have the sequence RSVLS with cleavage between the leucine and serine (28). The arginine and leucine residues were absolutely required, while the other residues could be exchanged freely such that the requirement for the cleavage site is RXXL (28). Interestingly, a similar sequence, RRHLL, is present in the luminal domain of ATF6. We are currently testing whether this site and site 1 protease are required for ATF6 activation. The cleavage of SRE-BP is further regulated by its association with SREBP cleavage-activating factor, which senses cholesterol levels and controls its accessibility to the proteases (27). The precedent of SRE-BP activation raises the interesting questions of whether ATF6 activation is controlled by complexing factors and whether cleavage need occur in the luminal domain as well as near the junction of the cytoplasmic domain with the ER membrane.

The most proximal sensor of the ER stress response that has been identified is Ire1p. In yeast, this protein is required for transmission of the ER stress response (18, 19). It is an ER transmembrane protein with two catalytic domains in the C-terminal cytoplasmic domain: a protein kinase domain and a domain with endoribonuclease activity that is similar to RNase L (20). Ire1p has the remarkable ability to regulate the levels of Hac1p, a transcription factor, by inducing nonconventional splicing of its message, resulting in a transcript that is more efficiently translated (20-23).

Two mammalian homologues of Ire1p have been cloned, hIRE1alpha and mIRE1beta , which have similar ER localization and domain structure as yeast Ire1p (13, 24). Mammalian IRE1 appears to be required for the ER stress response, since it can induce GRP78/BiP and CHOP mRNA levels, two target genes of the ER stress response. In addition, dominant negative forms of IRE1 defective in the kinase and endonuclease domains blocked ER stress induction of target genes (13, 24).3 We similarly found that hIRE1alpha overexpression activated the ATF6 reporter and that point mutations in the kinase or endonuclease domains abolished this activation. An IRE1 construct with a deletion of the kinase and nuclease domains in fact acted as a dominant negative to block ER stress activation of the ATF6 reporter gene. These results suggest that IRE1 is upstream of ATF6 in the ER stress signaling pathway. How direct IRE1 activation of ATF6 is remains to be determined. Since we have had difficulty detecting the ATF6 cleavage product, we have not been able to test whether IRE1 induces ATF6 cleavage. Our preliminary results have also not detected tunicamycin-induced phosphorylation of ATF6 such that direct phosphorylation of ATF6 by IRE1 may not be involved.

One mechanism for activation of ATF6 by IRE1 could be through activation and phosphorylation by the stress-activated MAP kinases JNK and p38. It was recently found that tunicamycin and IRE1 can activate JNK kinase activity (29). It has also been shown that p38 can phosphorylate ATF6 in vitro and activate its transcription activity in myocytes (30). However, we found that JNK and p38 activators (activated MEKK and MKK6) did not activate the ATF6 reporter gene (data not shown). These results suggest that JNK and p38 activation are not sufficient for ER stress activation of ATF6. In addition, dominant negative TRAF2 blocked IRE1 activation of JNK (29) but had no effect on IRE1 activation of the ATF6 reporter by tunicamycin, suggesting that JNK activation is not required (data not shown).

Mouse IRE1beta overexpression also induced apoptosis (24). Since ER stress inducers can cause apoptosis as well as induction of ER chaperones that protect cells from apoptosis, it is intriguing to conclude that IRE1 can mediate both of these signals. It was recently found that caspase-12 is localized on the ER membrane and is partially required for induction of apoptosis by ER stress (31). ER stress induced the cleavage of caspase-12 to a fragment that was no longer associated with the ER (31). Since IRE1 can induce apoptosis, it will be interesting to determine whether it or ATF6 is required for caspase-12 activation.

A last interesting aspect of the ER stress signaling pathway is the role of presenilin-1 (PS1). PS1 is a multipass ER membrane protein that is mutated in some cases of familial Alzheimer's disease (32, 33). Cells with familial Alzheimer's disease-linked variants of PS1 have altered processing of the amyloid precursor protein that is processed to the amyloid-beta peptide (34, 35). Amyloid-beta peptide has been associated with the cerebral neuritic plaques found in Alzheimer's patients (36). PS1 is also required for cleavage of Notch, a transmembrane protein required for developmental decisions (37-39). Cleavage of Notch at the plasma membrane results in a fragment that can translocate to the nucleus and activate gene expression (40-43).

Recently, PS1 mutants were found to have a reduced ER stress response and to bind to hIRE1 in cultured cells (44). It was also found that hIRE1 is cleaved in response to ER stress such that the cytoplasmic domain can move to the nucleus (45). This movement of hIRE1 induced by ER stress was defective in PS1-/- cells, although the induction of GRP78 mRNA was only moderately reduced (45). These results suggest a connection of PS1 and IRE1 processing to the ER stress response and the possibility that defects in the ER stress pathway may contribute to Alzheimer's disease. It will be interesting to determine whether ATF6 activation is affected by presenilin-1 or other Alzheimer's-associated mutations.

    ACKNOWLEDGEMENTS

We thank Lian Duan for aid in purifying the ATF6bZIP protein and Dr. Kazutoshi Mori for the GRP78 reporter gene.

    FOOTNOTES

* This work was supported by NCI, National Institutes of Health Grant CA50329 (to R. P.).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Dagger These two authors contributed equally to this work.

To whom correspondence should be addressed: Dept. of Biological Sciences, Columbia University, Fairchild 813B, MC 2420, 1212 Amsterdam Ave., New York, NY 10027. Tel.: 212-854-8281; Fax: 212-854-7655; E-mail: mrp6@columbia.edu.

Published, JBC Papers in Press, June 15, 2000, DOI 10.1074/jbc.M003322200

2 W. Tirasophon and R. J. Kaufman, submitted for publication.

3 W. Tirasophon and R. J. Kaufman, unpublished results.

4 C. Zhu and R. P., unpublished results.

5 Y. Wang, J. Shen, and R. Prywes, unpublished results.

    ABBREVIATIONS

The abbreviations used are: ER, endoplasmic reticulum; ERSE, ER stress response element; bZIP, basic-leucine zipper; aa, amino acids; PCR, polymerase chain reaction; CRE, cAMP-response element; CREB, cAMP-response element-binding protein; HA, hemagglutinin; hIRE1, human IRE1; mIRE1beta , murine IRE1beta ; JNK, c-Jun N-terminal kinase; PS1, presenilin-1; TM, tunicamycin.

    REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

1. Kaufman, R. J. (1999) Genes Dev. 13, 1211-1233
2. Yoshida, H., Haze, K., Yanagi, H., Yura, T., and Mori, K. (1998) J. Biol. Chem. 273, 33741-33749
3. Roy, B., and Lee, A. S. (1999) Nucleic Acids Res. 27, 1437-1443
4. Roy, B., and Lee, A. S. (1995) Mol. Cell. Biol. 15, 2263-2274
5. Roy, B., Li, W. W., and Lee, A. S. (1996) J. Biol. Chem. 271, 28995-29002
6. Hai, T. W., Liu, F., Coukos, W. J., and Green, M. R. (1989) Genes Dev. 3, 2083-2090
7. Zhu, C., Johansen, F. E., and Prywes, R. (1997) Mol. Cell. Biol. 17, 4957-4966
8. Haze, K., Yoshida, H., Yanagi, H., Yura, T., and Mori, K. (1999) Mol. Biol. Cell 10, 3787-3799
9. Wang, B. Q., Kostrub, C. F., Finkelstein, A., and Burton, Z. F. (1993) Protein Expression Purif. 4, 207-214
10. Mavrothalassitis, G., Beal, G., and Papas, T. S. (1990) DNA Cell Biol. 9, 783-788
11. Clarke, N., Arenzana, N., Hai, T., Minden, A., and Prywes, R. (1998) Mol. Cell. Biol. 18, 1065-1073
12. Tanaka, M., and Herr, W. (1990) Cell 60, 375-386
13. Tirasophon, W., Welihinda, A. A., and Kaufman, R. J. (1998) Genes Dev. 12, 1812-1824
14. Wang, Y., Falasca, M., Schlessinger, J., Malstrom, S., Tsichlis, P., Settleman, J., Hu, W., Lim, B., and Prywes, R. (1998) Cell Growth Differ. 9, 513-522
15. Chen, X., and Prywes, R. (1999) Mol. Cell. Biol. 19, 4695-4702
16. Montminy, M. (1997) Annu. Rev. Biochem. 66, 807-822
17. Fisch, T. M., Prywes, R., and Roeder, R. G. (1987) Mol. Cell. Biol. 7, 3490-3502
18. Cox, J. S., Shamu, C. E., and Walter, P. (1993) Cell 73, 1197-1206
19. Mori, K., Ma, W., Gething, M. J., and Sambrook, J. (1993) Cell 74, 743-756
20. Sidrauski, C., and Walter, P. (1997) Cell 90, 1031-1039
21. Kawahara, T., Yanagi, H., Yura, T., and Mori, K. (1997) Mol. Biol. Cell 8, 1845-1862
22. Chapman, R. E., and Walter, P. (1997) Curr. Biol. 7, 850-859
23. Cox, J. S., and Walter, P. (1996) Cell 87, 391-404
24. Wang, X. Z., Harding, H. P., Zhang, Y., Jolicoeur, E. M., Kuroda, M., and Ron, D. (1998) EMBO J. 17, 5708-5717
25. Treisman, R. (1994) Curr. Opin. Genet. Dev. 4, 96-101
26. Jackson, C. L., and Casanova, J. E. (2000) Trends Cell Biol. 10, 60-67
27. Brown, M. S., and Goldstein, J. L. (1999) Proc. Natl. Acad. Sci. U. S. A. 96, 11041-11048
28. Duncan, E. A., Brown, M. S., Goldstein, J. L., and Sakai, J. (1997) J. Biol. Chem. 272, 12778-12785
29. Urano, F., Wang, X., Bertolotti, A., Zhang, Y., Chung, P., Harding, H. P., and Ron, D. (2000) Science 287, 664-666
30. Thuerauf, D. J., Arnold, N. D., Zechner, D., Hanford, D. S., DeMartin, K. M., McDonough, P. M., Prywes, R., and Glembotski, C. C. (1998) J. Biol. Chem. 273, 20636-20643
31. Nakagawa, T., Zhu, H., Morishima, N., Li, E., Xu, J., Yankner, B. A., and Yuan, J. (2000) Nature 403, 98-103
32. Rogaev, E. I., Sherrington, R., Rogaeva, E. A., Levesque, G., Ikeda, M., Liang, Y., Chi, H., Lin, C., Holman, K., Tsuda, T., Mar, L., Sorbl, S., Nacmias, B., Piacentini, S., Amaducci, L., Chumakov, I., Cohen, D., Lannfelt, L., Fraser, P. E., Rommens, J. M., and St. George-Hyslop, P. H. (1995) Nature 376 (6543), 775-778
33. Sherrington, R., Rogaev, E. I., Liang, Y., Rogaeva, E. A., Levesque, G., Ikeda, M., Chi, H., Lin, C., Li, G., Holman, K., Tsuda, T., Mar, L., Foncin, J.-F., Bruni, A. C., Montesi, M. P., Sorbi, S., Rainero, I., Pinessi, L., Nee, L., Chumakov, I., Pollen, D., Brookes, A., Sanseau, P., Polinsky, R. J., Wasco, W., Da Silva, H. A. R., Haines, J. L., Pericak-Vance, M. A., Tanzi, R. E., Roses, A. D., Fraser, P. E., Rommens, J. M., and St. George-Hyslop, P. H. (1995) Nature 375, 754-760
34. Borchelt, D. R., Thinakaran, G., Eckman, C. B., Lee, M. K., Davenport, F., Ratovitsky, T., Prada, C. M., Kim, G., Seekins, S., Yager, D., Slunt, H. H., Wang, R., Seeger, M., Levey, A. I., Gandy, S. E., Copeland, N. G., Jenkins, N. A., Price, D. L., Younkin, S. G., and Sisodia, S. S. (1996) Neuron 17, 1005-1013
35. Duff, K., Eckman, C., Zehr, C., Yu, X., Prada, C. M., Perez-tur, J., Hutton, M., Buee, L., Harigaya, Y., Yager, D., Morgan, D., Gordon, M. N., Holcomb, L., Refolo, L., Zenk, B., Hardy, J., and Younkin, S. (1996) Nature 383, 710-713
36. Haass, C., and De Strooper, B. (1999) Science 286, 916-919
37. De Strooper, B., Annaert, W., Cupers, P., Saftig, P., Craessaerts, K., Mumm, J. S., Schroeter, E. H., Schrijvers, V., Wolfe, M. S., Ray, W. J., Goate, A., and Kopan, R. (1999) Nature 398, 518-522
38. Struhl, G., and Greenwald, I. (1999) Nature 398, 522-525
39. Ye, Y., Lukinova, N., and Fortini, M. E. (1999) Nature 398, 525-529
40. Struhl, G., and Adachi, A. (1998) Cell 93, 649-660
41. Schroeter, E. H., Kisslinger, J. A., and Kopan, R. (1998) Nature 393, 382-386
42. Lecourtois, M., and Schweisguth, F. (1998) Curr. Biol. 8, 771-774
43. Kidd, S., Lieber, T., and Young, M. W. (1998) Genes Dev. 12, 3728-3740
44. Katayama, T., Imaizumi, K., Sato, N., Miyoshi, K., Kudo, T., Hitomi, J., Morihara, T., Yoneda, T., Gomi, F., Mori, Y., Nakano, Y., Takeda, J., Tsuda, T., Itoyama, Y., Murayama, O., Takashima, A., St. George-Hyslop, P., Takeda, M., and Tohyama, M. (1999) Nat. Cell Biol. 1, 479-485
45. Niwa, M., Sidrauski, C., Kaufman, R. J., and Walter, P. (1999) Cell 99, 691-702


Copyright © 2000 by The American Society for Biochemistry and Molecular Biology, Inc.
Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
EndocrinologyHome page
H.-Y. Seo, Y. D. Kim, K.-M. Lee, A.-K. Min, M.-K. Kim, H.-S. Kim, K.-C. Won, J.-Y. Park, K.-U. Lee, H.-S. Choi, et al.
Endoplasmic Reticulum Stress-Induced Activation of Activating Transcription Factor 6 Decreases Insulin Gene Expression via Up-Regulation of Orphan Nuclear Receptor Small Heterodimer Partner
Endocrinology, August 1, 2008; 149(8): 3832 - 3841.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
D. A. Cunha, P. Hekerman, L. Ladriere, A. Bazarra-Castro, F. Ortis, M. C. Wakeham, F. Moore, J. Rasschaert, A. K. Cardozo, E. Bellomo, et al.
Initiation and execution of lipotoxic ER stress in pancreatic {beta}-cells
J. Cell Sci., July 15, 2008; 121(14): 2308 - 2318.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
T. E. Audas, Y. Li, G. Liang, and R. Lu
A Novel Protein, Luman/CREB3 Reruitment Factor, Inhibits Luman Activation of the Unfolded Protein Response
Mol. Cell. Biol., June 15, 2008; 28(12): 3952 - 3966.
[Abstract] [Full Text] [PDF]


Home page