HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

J. Biol. Chem., Vol. 275, Issue 35, 27145-27154, September 1, 2000

This Article Abstract Full Text (PDF) All Versions of this Article: 275/35/27145    most recent M003808200v1 Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Jones, C. E. Articles by Nossal, N. G. Search for Related Content PubMed PubMed Citation Articles by Jones, C. E. Articles by Nossal, N. G. Social Bookmarking                      What's this?

Interaction of the Bacteriophage T4 Gene 59 Helicase Loading Protein and Gene 41 Helicase with Each Other and with Fork, Flap, and Cruciform DNA^*

Charles E. Jones, Timothy C. Mueser, and Nancy G. Nossal^§

From the Laboratory of Molecular and Cellular Biology, NIDDKD and the  Laboratory of Structural Biology Research, NIAMS, National Institutes of Health, Bethesda, Maryland 20892-0830

Received for publication, May 4, 2000, and in revised form, June 15, 2000

	ABSTRACT

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Bacteriophage T4 gene 59 helicase loading protein accelerates the loading of T4 gene 41 DNA helicase and is required for recombination-dependent DNA replication late in T4 phage infection. The crystal structure of 59 protein revealed a two-domain -helical protein, whose N-terminal domain has strong structural similarity to the DNA binding domain of high mobility group family proteins (Mueser, T. C., Jones, C. E., Nossal, N. G., and Hyde, C. C. (2000) J. Mol. Biol. 296, 597-612). We have previously shown that 59 protein binds preferentially to fork DNA. Here we show that 59 protein binds to completely duplex forks but cannot load the helicase unless there is a single-stranded gap of more than 5 nucleotides on the fork arm corresponding to the lagging strand template. Consistent with the roles of these proteins in recombination, we find that 59 protein binds to and stimulates 41 helicase activity on Holliday junction DNA, and on a substrate that resembles a strand invasion structure. 59 protein forms a stable complex with wild type 41 helicase and fork DNA in the presence of adenosine 5'-O-(thiotriphosphate). The unwinding activity of 41 helicase missing 20 C-terminal amino acids is not stimulated by 59 protein, and it does not form a complex with 59 protein on fork DNA.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Bacteriophage T4 59 protein is a helicase loading protein that plays an important role in recombination and replication. T4 phage with a mutation in gene 59 are UV-sensitive and are defective in repair and recombination (1, 2). Although the T4 gene 41 replicative helicase can assemble on single-stranded and forked DNA by itself, Barry and Alberts (3) showed that it is most efficiently loaded by the T4 gene 59 helicase loading protein. 41 helicase is essential for both unwinding the duplex ahead of the polymerase on the leading strand (4-6) and enabling the T4 gene 61 primase to make the RNA pentamers that initiate the discontinuous lagging strand fragments (7, 8).

41 helicase must be loaded on replication forks that begin at discrete replication origin sequences, as well as on forks that are created during recombination. 59 protein is required for recombination-dependent replication, the predominant form of new phage DNA synthesis in the late stage of T4 infection (reviewed in Refs. 9 and 10), and for double-strand break repair (11). It is becoming apparent from recent studies in a variety of systems that replicative helicases must often be reloaded on stalled replication forks to allow synthesis to continue (reviewed in Ref. 12).

59 protein binds to the helicase, even in the absence of DNA, and stimulates the DNA-dependent and -independent ATPase and DNA unwinding activities of the helicase. 59 protein also has a strong affinity for the T4 gene 32 ssDNA¹-binding protein, which enables it to load the helicase on 32 protein-covered DNA (3, 13-15). All three of these T4 proteins, the helicase, helicase loading protein, and ssDNA-binding protein, are required for high levels of polar branch migration from preformed recombination intermediates in vitro (16, 17). Early studies of the purified T4 59 helicase loading protein showed that it bound to both ss- and dsDNA (13, 14, 18). We have recently shown that 59 protein has the highest affinity for fork DNA, with either single-stranded or partially duplex arms (19). Maximum binding was observed with forks with arms of 12 or 18 nucleotides. Thus this small (26 kDa) basic protein must have binding sites for the duplex and the two arms of the fork DNA, as well as sites for the 41 helicase and 32 protein.

The crystal structure of full-length 59 protein has been solved to 1.45 Å by Mueser et al. (19).² 59 protein has a novel, almost entirely -helical fold and is divided into two domains of similar size. The N-terminal domain has strong structural similarity to the dsDNA binding domain of rat HMG1 and other HMG family proteins. HMG family members, which include sequence-specific transcription factors and structure-specific non-histone chromatin-binding proteins, bind duplex DNA as well as branched and cruciform DNA structures (20-23). We have proposed a highly speculative model of how 59 protein might bind to fork DNA based on the distribution of charged and hydrophobic residues on the surface of the protein and the assumption that the HMG-like N-terminal domain binds the duplex region of the fork and holds the beginning of the arms in an open conformation (19).

This paper is directed at further understanding the parameters controlling the interaction of the T4 gene 59 helicase loading protein with DNA and with the T4 41 helicase. We show that the binding of 59 protein to ssDNA is strongly length-dependent, increasing greatly as the length is increased from 25 to 56 bases. We find that 59 protein binds to forked DNA in which the arm corresponding to the lagging strand template is completely duplex but cannot stimulate unwinding by the helicase unless more than 5 nucleotides closest to the fork are single-stranded. Consistent with the roles of these proteins in recombination, we find that 59 protein binds to and stimulates 41 helicase activity on four-way junction DNA and on a substrate that resembles a strand invasion structure. 59 protein fails to stimulate the helicase activity of a recombinant gene 41 protein with a 20-residue C-terminal deletion. Moreover, under conditions where the full-length helicase forms a complex with 59 protein on fork DNA, there is no complex formed with the truncated helicase.

	EXPERIMENTAL PROCEDURES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Cloning of T4 Gene 41 in a T7 Polymerase Expression Vector-- T4 gene 41 and its ribosome-binding site were originally cloned downstream of the lambda P_L promoter in the plasmid pDH518 (24). To move gene 41 into a T7 polymerase expression plasmid, we first removed the 69-bp XbaI fragment containing the ribosome-binding site and part of the multicloning site region from pT7.7 (25) to give pT7.7Xba. The 2340-bp NsiI to NarI fragment from pDH518, containing the ribosome-binding site followed by T4 gene 41 and the IS2 terminator, was then ligated into the 2389-bp PstI to ClaI fragment of pT7.7Xba to create pNN4101.

Construction of a Plasmid Encoding 41 Helicase with a C-terminal 20-Amino Acid Deletion (41C20)-- To create a plasmid encoding the 41 helicase with a deletion of the 20 amino acids after Arg-455, pNN4101 was cut partially with BlpI and completely with SacI to remove a 40b/33b fragment. This fragment was replaced by ligating the following Duplex 1, made by annealing synthetic oligonucleotides obtained from Sigma:

Purification of Wild Type and C20 T4 41 Helicase-- BL21(DE3)pLysS (26) containing either the T4 gene 41 wild type helicase expression plasmid pNN4101 or the 41C20 expression plasmid pCJ1006 were grown overnight at 30 °C in 50 ml of Terrific Broth (Life Technologies, Inc.) containing 50 µg/ml carbenicillin (Life Technologies, Inc.) and 30 µg/ml chloramphenicol (Sigma). Overnight cultures were used to inoculate 4 liters of the same broth containing 50 µg/ml carbenicillin. The cultures were incubated at 37 °C to A₆₀₀ = 0.5, at which point isopropylthioglucoside was added to a final concentration of 1 mM. After 2 h, the cell paste (each approximately 12 g) was harvested by centrifugation and stored at 80 °C. Each cell paste was suspended at 4 °C in 210 ml of lysis buffer (10% sucrose; 1 mM EDTA, 50 mM NaTAPS buffer (Sigma), pH 8.5, 1 mM [4-(2-aminoethyl)-benzenesulfonyl fluoride hydrochloride] (ICN), with 1 Complete^TM protease inhibitor mixture tablet (Roche Molecular Biochemicals) added per 50-ml volume). Lysis was achieved by three freeze-thaw cycles with an ethanol/dry ice bath and water at room temperature. Lysed cell suspensions were centrifuged for 2 h at 100,000 × g at 4 °C. Following centrifugation, both wild type and C20 mutant proteins were located in the supernatant fraction. The helicases were precipitated by adding an equal volume of 40% ammonium sulfate in AT buffer (10% glycerol, 50 mM NaTAPS, pH 8.5, 0.5 mM TCEP-HCl (Pierce), and 0.1 mM [4-(2-aminoethyl)-benzenesulfonyl fluoride hydrochloride]). The precipitated protein was recovered by centrifugation; pellets were washed in AT buffer containing 25% ammonium sulfate, dissolved in a small volume of AT buffer, and then diluted with enough buffer to reduce the ammonium sulfate concentration to below 0.1 M. Each sample was loaded at 4 °C onto a hydroxylapatite column (Bio-Gel HT (Bio-Rad), 3.8 cm diameter (15-ml bed volume)) that had been equilibrated with AT buffer containing 8 mM MgSO₄. The column was then washed with AT buffer, and bound protein was eluted with a gradient (250 ml) of 0-0.6 M ammonium sulfate in AT buffer. At this stage the wild type and C20 helicases were pure by SDS-PAGE analysis but contained nuclease that degraded supercoiled plasmid and ssDNA. The pooled hydroxylapatite column fractions were dialyzed against AT buffer containing 8 mM MgSO₄ and applied to a Q-Sepharose column (50-ml bed volume). Helicase eluted in a single peak at approximately 0.2 M NaCl, using a gradient (2 liters) of 0-0.5 M NaCl in AT buffer with 8 mM MgSO₄. Fractions free of nuclease contamination were used in unwinding and gel mobility shift assays.

59 Protein-- The purification of 59 protein used in assays and for antibody production was described in Refs. 27 and 19, respectively.

Antibody to T4 59 Helicase Loading Protein-- Rabbit antibody against 59 protein was produced by Spring Valley Labs using their standard protocol. Preimmune serum was obtained prior to inoculation. IgG was purified from preimmune and immune sera by passage through protein A affinity columns (Pierce). Following elution from the affinity column, the purified IgG was dialyzed against 10 mM Tris-HCl buffer, pH 7.5, with 10% glycerol.

DNA Substrate Preparation-- Oligonucleotides (reverse phase cartridge purified by Sigma) were 5'-end-labeled with [-³²P]ATP (NEN Life Science Products) using T4 polynucleotide kinase (Amersham Pharmacia Biotech). For fork DNA, partially complementary radiolabeled and unlabeled oligonucleotides were mixed (radiolabeled:unlabeled oligonucleotide = 1:1.35) in buffer containing 10 mM Tris-Cl, pH 8.0, 1 mM EDTA, and 0.2 M NaCl, heated at 95 °C for 3 min, 68 °C for 60 min, and slowly cooled to 24 °C in about 3 h. In the substrate constructions described below, unincorporated [³²P]ATP was removed from the DNA by filtration through mini spin-columns (Probe Quant 50, Amersham Pharmacia Biotech). Proper annealing of substrates was checked by gel electrophoresis. In the case of cruciform and strand invasion DNA, annealed samples were further purified by electroelution from 6% polyacrylamide gels using an electroelution device (Owl Scientific, Inc.).

Fork DNA-- The fork with 30-base arms was constructed by annealing (5') ³²P-oligonucleotide A (56 bases) with B (60 bases); complementary regions are underlined. For oligonucleotide A, 5' TAACGTATTCAAGATACCTCGTACTCTGTACAGGTTGCGATCCGACTGTCCTGCAT, and for oligonucleotide B, 5' GATCATGCAGGACAGTCGGATCGCAACCTGATTTACTGTGTCATATAGTACGTGATTCAG.

Flap DNA-- Flap DNA substrates were made by annealing 20-, 25-, or 30 base oligonucleotides (see sequences C-E below) to the 5' end of A. To finish the flap, this hybrid DNA was further annealed with B for 30 min at 34 °C, followed by slow equilibration to room temperature. Oligonucleotide A was radiolabeled in all of the substrates, except for the smallest flap construct. In this case, the 20-base oligonucleotide C was radiolabeled. For oligonucleotide C, 5' GAGGTATCTTGAATACGTTA 20 bases; for oligonucleotide D, 5' AGTACGAGGTATCTTGAATACGTTA 25 bases; and for oligonucleotide E, 5' TACAGAGTACGAGGTATCTTGAATACGTTA 30 bases.

To make the completely duplex fork (see Fig. 3), F was annealed to the single-stranded arm of B in the fork made from oligonucleotides A, B, and E. For oligonucleotide F, 5' CTGAATCACGTACTATATGACACAGTAAAT 30 bases.

Cruciform and Branched DNA-- Cruciform DNA substrate was made by annealing the [³²P]DNA fork substrate described above (oligonucleotides A + B) with a second fork constructed from G and H (see below, complementary sequences underlined), which had single-stranded arms complementary to those of the first fork. These forks were first annealed separately and then joined to form cruciform in a second annealing reaction. To make the strand invasion substrate, only G was annealed to the A + B fork. For oligonucleotide G, 5' TGACGCCAGACTGTAGACGCACCTCTGGTCTACAGAGTACGAGGTATCTTGAATACGTTA; for oligonucleotide H, 5' CTGAATCACGTACTATATGACACAGTAAATGACCAGAGGTGCGTCTACAGTCTGGCGTCA.

Three-way junction branch DNA was made from three oligonucleotides that were the generous gift of Ken Kreuzer, Duke University. For oligonucleotide I, 5' AAAATGAGAAAATTCGACCTATCCTTGCGCAGCTCGAGAAGCTCTTACTTTG 52 bases; for oligonucleotide J, 5' CACGCTGCCGAATTCTGGCTTGCTAAAGGATAGGTCGAATTTTCTCATTTT 51 bases; and for oligonucleotide K, 5' CAAAGTAAGAGCTTCTCGAGCTGCGCTAGCAAGCCAGAATTCGGCAGCGT 50 bases. Oligonucleotides I and J (complementary sequences underlined) were first annealed, and the resulting fork was then annealed with K.

Helicase Unwinding Assay-- Reaction mixtures contained 25 mM Tris acetate, pH 7.5, 60 mM potassium acetate, 6 mM magnesium acetate, 20 mM dithiothreitol, 200 µg/ml bovine serum albumin, and 2 mM rATP. The ³²P-5'-labeled DNA substrate was added to a final concentration of 3 nM. After 1 min equilibration to 30 °C, 59 protein was added followed by 41 helicase for a final reaction volume of 5 µl. Reactions were allowed to proceed for 1-45 min before addition of 2.5 µl of stop buffer (17% glycerol, 60 mM EDTA, 8.5% SDS, with bromphenol blue and xylene cyanol as electrophoresis markers). DNA products were separated on 10% polyacrylamide (29:1 acrylamide:bisacrylamide), 1× Tris acetate/EDTA gels (14 × 16 cm) at 6.25 V/cm. Gels were vacuum-dried on DE81 paper (Whatman) and autoradiographed on BioMax film (Eastman Kodak Co.).

Gel Retardation Assays-- Unless otherwise indicated, reaction mixtures contained 3 nM [³²P]DNA substrate, 25 mM Tris acetate, pH 7.5, 60 mM potassium acetate, 6 mM magnesium acetate, 20 mM dithiothreitol, 200 µg/ml BSA, and 2 mM ATP in a total volume of 5 µl. Samples were incubated for 5 min at 30 °C. Proteins were added at the concentrations shown with each figure. In reactions with antibody, immune or preimmune IgG (770 nM final concentration) was added directly to the assay mixture after the initial 5-min incubation, and the incubation at 30 °C continued for an additional 3 min. Loading buffer (2 µl of 15% glycerol with bromphenol blue and xylene cyanol) was added, and the samples were immediately loaded on 6% DNA retardation gels (NOVEX), which were electrophoresed at 12.5 V/cm in an X-cell electrophoresis device (NOVEX) at 4 °C in pre-cooled 1/2× Tris/borate/EDTA buffer. Electrophoresis run times varied according to the DNA substrate as follows: cruciform/partial cruciform, 130 min; fork/flap and branch, 100 min. Gels were dried on DE81 paper and viewed by autoradiography.

	RESULTS

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

DNA Binding by the T4 59 Helicase Loading Protein

T4 59 Helicase Loading Protein Binding to ssDNA Is Length-dependent-- The initial characterization of the T4 59 protein established that it bound to ssDNA, both long circular phage DNA and short oligonucleotides (3, 13, 28). We have found that, at the low DNA concentration used in the T4 DNA replication reactions, the formation of stable 59 protein-DNA complexes is strongly length-dependent. Fig. 1 shows a gel mobility shift assay of T4 59 protein binding to oligonucleotides of 25-80 bases, with the DNA at 3 nM and protein at 15 or 60 nM. 59 protein formed stable complexes only with oligonucleotides greater than 40 bases. Binding was undetectable for oligonucleotides of 25 and 34 bases. Weak binding occurred for lengths of 41 and 49 bases. Higher affinity binding occurred for DNA substrates of 56, 60, and 80 bases. There was a single-shifted band with the 41-, 49-, 56-, and 60-base oligonucleotides, but two bands with the 80-mer. Binding affinity did not correlate exactly with small differences in length. The stronger binding to the 56-mer than to the 60-mer may reflect differences in the secondary structures of these single strands, which have different sequences (see oligonucleotides A and B, "Experimental Procedures").

View larger version (27K): [in this window] [in a new window]   Fig. 1.   Binding of ssDNA by the T4 59 protein is strongly length-dependent. ssDNA oligonucleotides were present at 3 nM, and 59 protein was added at the indicated concentrations. The affinity of 59 protein for the 56-base (b) oligonucleotide was much greater than for the 41-base length.

Multiple Copies of T4 59 Protein Bind to Duplex DNA-- There is also a strong length dependence in the affinity of 59 protein for linear duplex DNA. Duplexes of 35 bp were not bound by 59 protein, whereas 52-bp duplexes appeared to be complexed with multiple copies of the protein. The number of shifted bands with the 52-mer increased with protein concentration, reaching a plateau of five bands at 300 nM and higher concentrations of 59 protein (Fig. 2 and data not shown). This is consistent with five copies of 59 protein bound to the 52-bp DNA, which is similar to the 9-10 nucleotide-binding site size of 59 protein for ssDNA reported by Lefebvre and Morrical (28). Since we have shown (19) that forks with either single-stranded or double-stranded arms bind equally well to 59 protein, the linear ss- or dsDNA may be binding to the same site on the protein. However, since the binding site size determination by Lefebvre and Morrical (28) was done under very different conditions with long ssDNA, it is certainly possible that the observed similarity is fortuitous. On the 167-base pair linear DNA, more than seven shifted bands were apparent (Fig. 2).

View larger version (40K): [in this window] [in a new window]   Fig. 2.   Multiple copies of T4 59 protein bind to duplex DNA. The final concentration for all DNA samples was 3 nM, and 59 protein was added at the indicated final concentrations. Note that higher concentrations of 59 protein were required to shift the duplex DNA than similar length ssDNA (Fig. 1). Arrows mark the locations of shifted 59 protein-DNA complexes.

T4 59 Protein Binds to Fork or Flap DNA Substrates but Does Not Bind to Completely Duplex Three-branch Structures-- We previously showed that 59 protein binds with higher affinity to fork DNA than to similar length single-stranded oligonucleotides and that this fork binding required that each arm be greater than 6 bases. Binding was not decreased with flap DNA formed by annealing one or both fork arms to a complementary oligonucleotide, leaving only the five bases closest to the fork single-stranded (19). The gel mobility shift assay in Fig. 3 shows that 59 protein binds to a fork whose 30-base lagging or leading arm or both arms have been made completely double-stranded, by annealing a 30-base complementary oligonucleotide (B-D). By contrast, no binding of 59 protein occurred in mobility shift assays with a double-stranded branch (three-way junction) DNA substrate (Fig. 4, lanes 6-8). The failure of 59 protein to bind the completely double-stranded branch DNA may be due to its less flexible structure (see "Discussion"). In Fig. 3, the decreased amount of DNA present in lanes containing higher concentrations of 59 protein, compared with lanes containing low concentrations of 59 protein or no 59 protein, is caused by precipitation of 59 protein-DNA complexes, which do not migrate into the gel during electrophoresis. Our laboratory has noted this phenomenon repeatedly, and others (13, 29) have made the same observation.

View larger version (38K): [in this window] [in a new window]   Fig. 3.   T4 59 protein binds flap DNA substrates with completely duplex arms. DNA was present at 3 nM final concentration, and 59 protein was added at the indicated final concentrations. As described in the text, the decreased amount of DNA present in lanes containing higher concentrations of 59 protein compared with lanes containing lower concentrations of 59 protein, or no 59 protein, is the result of the precipitation of 59 protein-DNA complexes that do not migrate into the gel during electrophoresis. Fork DNA substrate diagrams are arranged with the lagging strand above the leading strand, and arrows represent the 3' end of each strand; * marks the position of 32P for these diagrams and for those in all subsequent figures.

View larger version (56K): [in this window] [in a new window]   Fig. 4.   T4 59 protein does not bind three-way junction (branch) DNA. DNA was present at a final concentration of 3 nM. 59 protein does not bind forks in which a continuous strand of complementary DNA is annealed to the two arms, forming a three-way junction (lanes 5-8).

T4 59 Protein Binds Cruciform DNA-- A portion of the N-terminal domain of the T4 59 protein has strong structural similarity to the dsDNA binding domain of HMG family proteins (19), many of which bind to Holliday junction (cruciform) DNA. Like these HMG proteins, 59 protein bound cruciform DNA with 30-base pair arms (Fig. 5D). It also bound a strand invasion structure with two double-stranded and two single-stranded arms (Fig. 5C).

View larger version (40K): [in this window] [in a new window]   Fig. 5.   T4 59 protein binds to cruciform DNA and to a three-stranded DNA analogous to a strand invasion structure. DNA was present at 3 nM, and 59 protein was added at the indicated final concentrations. See "Experimental Procedures" for sequences of the DNA. Arrows mark the locations of protein-free DNA substrates.

Interaction of T4 59 Helicase Loading Protein with the T4 41 Helicase

A Single-stranded Gap of 10 Nucleotides on the Lagging Strand Is Required to Load the Helicase-- The hexameric T4 41 helicase moves 5' to 3' on the single-strand of a DNA fork, which corresponds to the lagging strand template (4, 29, 30). However, since the helicase unwinds fork DNA faster than duplex DNA with only a 5' single-stranded extension, it is likely that the helicase is also in contact with the leading strand arm of the fork (31). We have used flap DNA structures, of the arrangement used in Fig. 3, to investigate the length of ssDNA on the lagging and leading strands of fork DNA required for loading T4 41 helicase by 59 protein (Fig. 6). 59 protein stimulated unwinding of a fork DNA with 30-base single-stranded arms, and the same fork with a 25-base oligonucleotide annealed to the arm corresponding to the leading strand template (Fig. 6A). However, unwinding on forks with a 25-mer annealed to the lagging strand template was barely detectable (Fig. 6B), although mobility shift assays showed that 59 protein binds to these forks with a 5-base single-stranded gap on the lagging strand (Ref. 19 and Fig. 3). In contrast, 59 protein did stimulate unwinding when the gap on the lagging strand was extended to 10 bases (Fig. 6C). With this substrate, the labeled 20-mer was still annealed to the lagging strand unwound by the helicase. Thus the forks that were unwound must have had only 10 single-stranded bases on their lagging strand. In the experiments shown in Fig. 6, more 59 protein was required to unwind the fork with the partially duplex lagging strand than the fork with single-stranded arms. This probably indicates that the 10-base single-stranded space is a minimum width for accommodating 59 protein and the helicase.

View larger version (36K): [in this window] [in a new window]   Fig. 6.   T4 59 protein stimulates unwinding of DNA flap substrates by 41 DNA helicase when a gap of 10 single-stranded bases is present on the lagging strand. DNA was present at 3 nM. Helicase (monomer concentrations) and 59 protein were added at the indicated final concentrations. Reactions were incubated at 30 °C for 5 min. Fork and flap DNA drawings are oriented with lagging strand template on top. A, forks with single-stranded lagging strand arms are unwound. B, forks with gaps of 5 bases (b) on the lagging strand arm are unwound very poorly. C, forks with a gap of 10 bases on the lagging strand arm are unwound. Gels in A-C were electrophoresed for 3.5, 3.5, and 4 h, respectively.

T4 59 Protein Stimulates Unwinding of DNA Cruciform and Strand Invasion Structures by 41 DNA Helicase-- 41 helicase alone, at a concentration of 200 nM (monomer), was not able to unwind Holliday junction cruciform DNA during 10- or 45-min reactions (Fig. 7, lanes 2 and 15, respectively) and unwound only small amounts of the three-stranded structure (Fig. 7, lanes 7 and 17). Unwinding of each of these substrates was accelerated by 59 protein (Fig. 7, lanes 4 and 5, and 9 and 10). At 10 nM 59 protein, the helicase unwound most of the strand invasion structure to a fork, with a portion unwound completely to single strands (Fig. 7, lane 9). 41 DNA helicase did not unwind the completely duplex three-way junction branch DNA (see Fig. 4) in the presence or absence of 59 protein (data not shown).

View larger version (47K): [in this window] [in a new window]   Fig. 7.   T4 59 protein stimulates unwinding of cruciform DNA substrates by 41 DNA helicase. DNA was present at 10 nM. Helicase was present at a final concentration of 200 nM (monomer) where indicated. During 10- (lanes 1-14) or 45-min (lanes 15-18) reactions at 30 °C, a fraction of the cruciform DNA was unwound by T4 41 helicase in the presence of 59 protein (lanes 4 and 5), but no unwinding was observed without the 59 protein (lanes 2 and 15). The strand invasion structure was unwound by helicase and the 59 loading protein to a greater extent than the cruciform (compare lanes 10 and 5, respectively). The helicase alone (lanes 7 and 17) unwound small amounts of the strand invasion DNA.

T4 59 Protein Loads 41 Helicase onto Fork DNA; 59 Protein Remains in the Complex-- In experiments where ATPS was substituted for rATP, a significant amount of fork DNA was shifted when both 41 helicase and 59 protein were present (Fig. 8A, lane 7; Fig. 8B, lane 4). The amount of complex formed in the presence of rATP was much lower (Fig. 8A, lane 10). This shifted complex was absent when either 41 or 59 protein was separately incubated with the fork DNA substrate (Fig. 8B, lanes 1 and 7). In an identical reaction, an antibody to 59 protein was added after allowing time for DNA-protein complexes to form. The further retardation of the shifted band (Fig. 8B, lane 5) demonstrated that 59 protein was a component of the complex. The supershift with the antibody was dependent on the presence of 59 protein (compare Fig. 8B, lanes 2 and 5 with 8), and required IgG raised against 59 protein (Fig. 8B, compare lanes 5 and 6).

View larger version (33K): [in this window] [in a new window]   Fig. 8.   T4 59 protein loads 41 DNA helicase onto fork DNA; 59 protein remains in the complex. DNA was present at 10 nM. Samples were electrophoresed for 90 min. A, 41 helicase (monomer concentration) and 59 protein were used at the final concentrations shown. Final concentrations of ATPS and rATP were 2 mM. The fork DNA substrate is not unwound by the helicase in reactions containing ATPS. B, final concentrations of 41 helicase and 59 protein were 360 (monomer) and 180 nM, respectively. ATPS was used at a final concentration of 2 mM. The protein-DNA complex formed with the helicase and 59 protein (lane 4) is further shifted by addition of antibody against 59 protein (lane 5) but not by preimmune IgG (lane 6). See "Experimental Procedures" for a description of the rabbit antibody against 59 protein and for binding reactions and electrophoresis conditions.

T4 59 Protein Does Not Stimulate Unwinding of Fork DNA by a Mutant of 41 Helicase Lacking the C-terminal 20 Amino Acids-- Richardson and Nossal (32) initially showed, by trypsin digestion, that the C-terminal 20 residues of the 41 helicase are not required to unwind fork DNA (see also Fig. 9). This tryptic fragment could also interact with the primase for pentamer synthesis on naked ssDNA. (32). However, the C terminus was required for interaction with other T4 replication proteins (see "Discussion"). We have constructed a plasmid expressing 41 helicase with a 20-residue C-terminal deletion (4120) (see "Experimental Procedures"). Fig. 9 shows that 59 protein is unable to stimulate the helicase activity of this truncated protein. Although the truncated helicase has unwinding activity comparable to the wild type (compare lanes 10-12 with lanes 4-6), only the wild type helicase activity is increased by the T4 59 protein (compare Fig. 9, lanes 1-3, with lanes 7-9).

View larger version (39K): [in this window] [in a new window]   Fig. 9.   T4 59 protein does not stimulate unwinding of fork DNA by a mutant of 41 helicase lacking the C-terminal 20 amino acids. DNA was present at 3 nM. Where indicated, 59 protein was used at a final concentration of 120 nM. Final monomer concentrations of 41 helicase are shown in the figure.

T4 59 Protein Does Not Load T4 41 Helicase That Lacks the 20 C-terminal Amino Acids-- The failure of T4 59 protein to activate the unwinding activity of the C-terminal 20-amino acid deletion mutant of the helicase results from its failure to load the truncated protein on the DNA. As indicated above (Fig. 8), 59 protein loads full-length 41 helicase onto fork DNA and remains part of the complex. A shifted complex of fork DNA, 59 protein, and helicase did not form when the 4120 mutant protein was substituted for the wild type helicase (Fig. 10, compare lanes 8-10 with lanes 5-7).

View larger version (46K): [in this window] [in a new window]   Fig. 10.   T4 59 protein does not load T4 41 helicase that lacks the 20 C-terminal amino acids. DNA was present at 3 nM. Wild type (WT) and C20 mutant helicase enzymes were used at a final concentration of 360 nM (monomer); 59 protein was added at the indicated final concentrations. ATPS (2 mM final concentration) was substituted for rATP to inhibit the unwinding activity of 41 helicase. The shifted band formed by DNA bound to 59 protein and wild type helicase (lanes 5-7) is absent when the C20 is substituted for the wild type helicase (lanes 8-10).

	DISCUSSION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

The crystal structure of the T4 59 helicase loading protein revealed a two-domain helical protein, with no obvious cleft for DNA binding (19). The protein surface of both domains is rich in basic, aromatic, and hydrophobic residues. The N-terminal domain has significant structural similarity to the DNA-binding domain of eukaryotic HMG family proteins. HMG domains bind in the minor groove of duplex DNA, bending and partially unwinding the duplex (21, 23, 33, 34). HMG box proteins also bind to the open (unstacked) conformation of Holliday junction (cruciform) DNA (22, 23). Mueser et al. (19) proposed a speculative model of 59 protein docked on fork DNA that is shown in Fig. 11A. This model is based on the assumption that the HMG-like N-terminal domain (on the left in Fig. 11A) binds the duplex ahead of the fork and holds the beginning of the arms in an open conformation. The arms of the fork are in positions dictated by the distribution of charged and hydrophobic residues on the surface of the protein and by the size of the fork arms required for tight binding. A single-stranded fork arm corresponding to the lagging strand template (shown in red) traverses a narrow groove that lies between the N- and C-terminal domains. A duplex arm, composed of the green template strand and the blue new leading strand, is docked on the bottom surface of the C-domain. This model suggests that a single 59 protein monomer binds simultaneously to the duplex and two arms of the fork, to one or more subunits of the helicase, and to 32 protein (not shown in Fig. 11A). The remaining subunits of the hexameric helicase would surround the lagging strand. Additional 59 protein monomers may be bound to these other subunits of the helicase, as suggested by the 1:1 stoichiometry reported by Raney et al. (29). In this paper, we have tested this model by further experiments to determine which DNA structures are tightly bound by T4 59 protein, and which structures can be unwound by the helicase (summarized in Fig. 11C).

View larger version (33K): [in this window] [in a new window]   Fig. 11.   Structural features of DNA required for binding to T4 59 protein and for unwinding by the 41 helicase. A, a speculative model of T4 gene 59 helicase loading protein bound on a DNA replication fork. This model is adapted from Mueser et al. (19). The dsDNA ahead of the fork, composed of leading strand template (green) and lagging strand template (red), is positioned at the HMG-like structure in the N-domain (left), and leading strand template (green)/primer (blue) duplex is docked to the bottom surface of the C-domain (right). A long segment of ssDNA, representing the lagging strand (red), traverses the shallow groove between the N- and C-domains. A helicase monomer (light blue oval) is proposed to bind to 59 protein between the lagging and leading strand arms (19). The other subunits of the hexameric helicase (not shown on the figure) would surround the lagging strand (see "Discussion"). B, a speculative model of two 59 protein molecules bound to a cruciform. The 5' end of each crossing strand (blue) would occupy the position of the new leading strand of the fork on one 59 molecule, whereas the 3' end (red) would be in the position of the lagging strand on the second 59 protein. C, diagram showing which fork and cruciform DNA structures are bound by T4 59 protein and unwound by the T4 41 helicase in the presence of 59 protein. The DNA structures are drawn in the same orientation as the fork DNA on the model of 59 protein in A. The hexameric helicase (circle) is shown on the DNA structures it unwinds. The helicase is placed on the strand that would occupy the position of the fork lagging strand, if each of these DNAs binds to 59 protein as predicted by the model in A. Arrows represent the 3' end of each strand; * indicates the position of 32P label in the substrates tested.

DNA Structures Bound by 59 Protein-- 59 protein bound to a fork whose arms were completely double-stranded but did not bind tightly to three-way junction DNA in which there is no break between the strands annealing to the fork arms corresponding to the leading and lagging strand templates. The arms of the three-way junction DNA have been reported to meet at approximately equal angles (35). This relatively inflexible configuration is apparently not readily accommodated by the 59 protein structure. Like the HMG proteins, 59 protein did bind a four-way junction (cruciform) DNA structure that was composed of non-complementary arms to prevent branch migration. It also bound a structure composed of three of the four strands in the cruciform, which is analogous to that formed when a single-strand invades a duplex. If the strand invasion DNA binds in the manner suggested by the fork model, the invading strand (red in Fig. 11C) would occupy the position of the lagging strand of the fork. The displaced portion (red) of the leading strand (blue) would extend away from the leading strand arm on the bottom surface of the protein. It is possible that the cruciform could accommodate two 59 molecules, as shown in Fig. 11, B and C. The 5' end of each crossing strand (blue) would occupy the position of the new leading strand of the fork on one 59 molecule, whereas the 3' end (red) would be in the position of the lagging strand on the second 59 protein. Ultimately, a crystal structure of 59 protein complexed with fork DNA will be required to show how the DNA is bound on the protein. Our mobility shift studies indicate that the helicase loading protein can accommodate the fourth strand present in recombination intermediates and underscore the need for flexibility between the arms of the bound DNA.

A Single-stranded Gap on the Lagging Strand Is Required for Loading the Helicase-- T4 41 helicase moves 5' to 3' on the lagging strand of the replication fork (4, 29). Early experiments (4) showed that the helicase would not unwind a blunt end fragment but did unwind a duplex with a 5' 32-base single-stranded extension. Helicase activity was greater on forked substrates with both 3' and 5' arms (31). Fig. 11C summarizes our experiments to determine the structure of DNA required for the 41 helicase to be loaded by the 59 protein. At concentrations of the helicase where unwinding is observed only when the 59 protein is present, we find that the helicase will unwind a fork with a single-stranded gap of 10 bases on the 5' (lagging strand) arm (Fig. 6C) but barely unwinds a similar fork with a 5-base gap (Fig. 6B). Since 59 protein binds to a fork with a completely duplex lagging stand (Fig. 3), the lagging strand gap is required for loading the helicase. Helicase will unwind forks with a 5-base gap on the 3' (leading) strand, if the lagging strand is single-stranded (Fig. 6A). The requirement for a single-stranded gap on the lagging strand, but not the leading strand, is consistent with the structure of the replication fork on which the helicase is normally assembled.

Unwinding of Cruciform and Strand Invasion Structures-- In the presence of T4 59 helicase loading protein, the 41 helicase unwinds both a four-stranded cruciform and a three-stranded DNA structure like that formed during strand invasion (Figs. 7 and 11). Unwinding of these structures was anticipated because both the helicase and 59 protein are required for recombination-dependent DNA replication in vivo and for branch migration during recombination in vitro (see below). In Fig. 11C, the cruciform and strand invasion three-stranded structures are drawn in the same orientation as the fork DNA on the model of 59 protein in Fig. 11A. The hexameric helicase (circle) is shown on the strand occupying the position of the lagging strand, if these DNAs bind to 59 protein as predicted by the fork model in A. There is only one 5'-ended single-strand on the three-stranded structure. Helicase would be expected to bind there. The duplex that includes the 3' end of this strand would be bound by the HMG-like N-terminal domain of 59 protein. Helicase moving 5' to 3' on this strand would give unlabeled single-strand and labeled fork as the initial products. The labeled fork would be rapidly unwound to single strands. In agreement with this prediction, both labeled fork and single strand were observed as products in the reaction with the lower concentration of 59 protein, whereas at the higher 59 protein concentration there was only labeled single-stranded product (Fig. 7).

There was much less unwinding of the cruciform, which has no single-stranded arms. The only labeled product is a single strand. If the HMG-like domain of 59 protein binds the cruciform in an unstacked open configuration, there may be enough accessible unpaired nucleotides at the cruciform junction to permit slow loading of the helicase. If two helicases were loaded on the cruciform as diagrammed in Fig. 11, B and C, the initial products would be two forks. The finding of ssDNA as the only product is not surprising because the rate of unwinding of the fork is so much faster than unwinding of the cruciform. The rate-limiting step may be loading the helicase on the cruciform. If only one of the two helicases shown on the cruciform in Fig. 11B was present, no unwound product would have been detected. The single helicase would move 5' to 3' on the strand it encircles, opening the duplex ahead. Since the other ends of the strands forming this duplex are still bound in the four-stranded structure, the unwound duplex would reanneal rapidly. Strand exchange was not possible with this cruciform sequence. The possibility that a single helicase could unwind one arm, and that this unwinding would be enough to facilitate strand exchange between homologous arms of a cruciform, remains to be tested.

Role of T4 Helicases in Origin and Recombination-initiated DNA Replication-- The first replication after phage T4 infection is initiated from one or more specific origins (reviewed in Ref. 36). Stable R-loops accumulate at the T4 uvsY origin in vivo (37). Bidirectional replication from the R-loop at the origin would require two helicase molecules (Fig. 12A). 41 helicase ahead of the leftward leading strand would open the duplex and allow primer synthesis by the T4 61 primase for lagging strand synthesis on the displaced strand. A second helicase would be required for rightward replication, using the first lagging strand fragment as the leading strand. Our experiments (Fig. 6) demonstrate that 59 protein can load the helicase on forks with a single-stranded lagging strand template (leftward fork in Fig. 12A) and forks with a single-stranded gap on the lagging strand template (rightward fork). In vivo, early origin-dependent T4 replication is abolished by mutations in the 41 helicase but not by mutations in the 59 helicase loading protein (10, 38). In vitro, replication from a preformed R-loop at the uvsY origin requires the 41 helicase and is strongly stimulated by 59 protein.³

View larger version (24K): [in this window] [in a new window]   Fig. 12.   Models for the role of 41 helicase in replication and recombination. A, two helicases are required for bidirectional replication from an origin. The helicase at each fork opens the duplex ahead of the polymerase, and enables primer synthesis by the primase. Helicase (circles) are shown on the strands they surround. Arrows above the circles show the direction of helicase movement. B, semiconservative and conservative replication at forks initiated by recombination. In semiconservative replication, the displaced strand serves as the lagging strand template, and the helicase role is like that at an origin. In conservative replication, the invading strand serves as the lagging strand template. The helicase at the right catalyzes the branch migration needed for reannealing the duplex behind the leading strand, and also interacts with the primase on the invading strand. C, branch migration at four way junctions. Branch migration is catalyzed by 5' to 3' movement of the helicase. The direction of branch migration depends on which strands are encircled by the helicase. D, replication coupled to branch migration at a four-way junction. See text for further discussion of this figure.

Most of the replication of the linear duplex DNA of T4 phage requires the phage enzymes needed for DNA recombination (reviewed in Ref. 36). Mosig (Ref. 10 and references therein) proposed that the forks for this recombination-dependent replication are initiated by invasion of one duplex by the 3' end of a single-strand extension from another duplex, which serves as the primer for new leading strand synthesis. Mosig also suggested that the 3' single-stranded extension would be created by incomplete replication at the end of linear duplex T4 DNA, or by 5' to 3' degradation at a double-strand break. Similar models for replication following strand invasion have been proposed by Paques and Haber (39) to explain double-strand break-induced replication in yeast.

Two 41 hexameric helicases would be required for synthesis following strand invasion, if the invading strand serves as a template for new lagging strand (conservative replication, Fig. 12B, bottom). The helicase at the left opens the duplex ahead of the leading strand polymerase, whereas the helicase at the right catalyzes the branch migration needed for reannealing of the duplex behind the leading strand polymerase and also interacts with the primase initiating the lagging strand fragments. If the helicase ahead of the polymerase moves faster than the helicase behind, or remains on the fork for a longer time, the displaced strand on the elongating D-loop would serve as the template for most lagging strand synthesis in the highly branched network (semiconservative replication, Fig. 12B, top). This is more likely since there is evidence suggesting that interaction between the helicase and polymerase helps to keep the helicase on the fork (6, 27).

Two T4 encoded helicases, Dda and 41 (3), are capable of opening the duplex ahead of the polymerase. Unlike 41 helicase, the Dda helicase is not loaded by 59 protein, and it does not interact with the T4 61 primase (3). Genetic experiments indicate that T4 DNA replication is decreased by mutations in either gene dda or 59 and is essentially eliminated by mutations in both genes (40). Recombination-driven replication in the late stage of T4 infection is severely impaired by mutations in gene 59, even when the Dda helicase is active. Interaction between helicase and primase activities has been observed in other systems such as Escherichia coli and phage T7. It seems likely that a helicase-primase interaction will also be important for recombination-coupled replication and double-strand break repair in other systems. Yeast Pol-primase is required for the yeast mating type switch (41).

Branch Migration at Holliday Junctions-- The T4 59 helicase loading protein and the 41 helicase are both needed for recombination, as shown by the rec phenotype of gene 59 mutants (2, 42), and the characterization of gene 41 mutants defective in recombination (43, 44). Salinas and Kodadek (16) showed that, under physiological buffer conditions, the T4 UvsY protein facilitated homologous pairing by the T4 UvsX strand transferase and 32 protein, but extensive polar branch migration did not occur until both 41 helicase and 59 protein were added. In a simpler system, Kong et al. (17) found that only the 41 helicase, 59 protein, and 32 protein were required to drive extensive polar branch migration from circular ssDNA annealed on a single-stranded extension of a complementary duplex. Our finding that 59 protein binds and loads the helicase on four-way junction cruciform DNA (Figs. 5 and 7) is consistent with the role of these proteins in branch migration. As described above, the single-stranded product of cruciform unwinding by 41 helicase is most easily explained by two helicases unwinding the cruciform simultaneously (Fig. 11). In this case, the direction of branch migration would depend on which two strands of the cruciform the helicases moved 5' to 3' on (Fig. 12C). Replication coupled to helicase-catalyzed branch migration on recombination intermediates (Fig. 12D) gives coordinated extension of the two strands of the invading DNA, leaving the donor DNA unchanged, as recently proposed for double-strand break repair (41).

59 Protein Remains on a Fork with the Helicase with ATPS-- Our gel mobility studies indicate that 59 protein loads the helicase on fork DNA in the presence of ATPS (Fig. 8). Further retardation of this complex by antibody to 59 protein shows that 59 protein is retained on the fork with the helicase, prior to ATP hydrolysis. Whether or not 59 helicase loading protein travels with the helicase remains to be determined. When ATP replaced ATPS, a fork complex dependent on both 59 protein and the helicase was barely detectable, but the fork is rapidly unwound under these conditions.

The C Terminus of 41 Helicase Is Essential for Its Interaction with the 59 Helicase Loading Protein-- A truncated 41 helicase, missing the C-terminal 20 residues, retains helicase activity similar to that of the full-length protein. However, its helicase activity is not stimulated by 59 protein (Fig. 9), and it does not form a shifted complex on fork DNA with the helicase loading protein (Fig. 10). The C terminus of the helicase is also required for interaction with other T4 replication proteins. Earlier studies with a similar truncated helicase, formed by limited digestion by trypsin, showed that it retained the ability to interact with the 61 primase to allow pentamer primer synthesis on naked ssDNA. However, there was no pentamer synthesis by wild type 41 helicase on ssDNA covered with 32 protein, unless the clamp (45 protein) and clamp loader (44/62 protein complex) were present, and no pentamer synthesis with the truncated helicase even when the clamp and clamp loader were present (32). The clamp and the clamp loader also stimulated the GTPase of wild type helicase on ssDNA covered with 32 protein, albeit to a much lesser extent than the stimulation by 59 protein (3). Taken together, these studies suggest that 59 protein normally loads 41 helicase on 32 protein-covered DNA, but helicase can bind without 59 protein if the clamp and clamp loader are present. The C terminus of the helicase is required for it to bind 32 protein-covered DNA with either 59 protein or the clamp and clamp loader.

Functional Similarity between T4 59 Protein and E. coli PriA and RuvA-- T4 41 helicase, loaded by 59 protein, is required for both coordinated leading and lagging strand synthesis and for branch migration. Thus 59 protein combines functions carried out by the E. coli PriA and RuvA proteins. Like 59 protein, PriA binds to fork DNA and to the three-stranded junction at the 3' end of the invading strand of D-loop structures, where it initiates primosome assembly (45-48). Unlike T4 59 protein, PriA has 3' to 5' helicase activity, which enables it to expose ssDNA on the lagging strand of a stalled replication fork or a phage Mu strand transfer complex, to make room for replisome assembly. Conversely, 59 protein binds Holliday junction cruciform DNA (Fig. 5), for which PriA has no affinity. This difference in DNA recognition reflects the differences in biological activities of the T4 59 and E. coli PriA proteins. PriA is important for loading the DnaB helicase on replication forks other that those at the oriC origin but, in contrast to T4 59 protein, has no apparent role in branch migration during recombination. In this respect, T4 59 protein resembles E. coli RuvA protein, which binds Holliday junction DNA and facilitates its interaction with the RuvB helicase (49). Branch migration of this junction is catalyzed by the complex of RuvA and RuvB proteins. The RuvAB complex is not involved in replication fork progression or primer synthesis, and its structure and helicase mechanism (50, 51) differ from those of the T4 59 and 41 proteins. The dual roles of T4 59 helicase loading protein and 41 helicase are responsible for the coupling of recombination and replication, for which phage T4 infection serves as an outstanding model.

	ACKNOWLEDGEMENTS

We thank Debbie Hinton, Peggy Hseih, Michael Lichten, and Hiroshi Nakai for helpful comments on the manuscript.

	FOOTNOTES

^* The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

^§ To whom correspondence should be addressed: Laboratory of Molecular and Cellular Biology, Bldg. 8, Rm. 2A19, NIDDKD, National Institutes of Health, Bethesda, MD 20892-0830. Tel.: 301-496-2724; Fax: 301-402-0240; E-mail: ngn@helix.nih.gov.

Published, JBC Papers in Press, June 27, 2000, DOI 10.1074/jbc.M003808200

² Research Collaboratory for Structural Bioinformatics Protein Data Bank, Protein Data Bank code 1C1K.

³ N. Nossal, K. Dudas, and K. Kreuzer, submitted for publication.

	ABBREVIATIONS

The abbreviations used are: ssDNA, single-stranded DNA; dsDNA, double-stranded DNA; ATPS, adenosine 5'-O-(thiotriphosphate); TAPS, [tris(hydroxymethyl)methyl]aminopropanesulfonic acid); TCEP, tris(2-carboxyethyl)-phosphine hydrochloride; bp, base pair; HMG, high mobility group.

	REFERENCES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

CiteULike