| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
J. Biol. Chem., Vol. 275, Issue 35, 27332-27338, September 1, 2000
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
,¶
From the Department of Biochemistry and Molecular
Biology, the University of Oklahoma Health Sciences Center, Oklahoma
City, Oklahoma 73190 and the § Structural Biology Center,
Argonne National Laboratory, Argonne, Illinois 60439
Received for publication, January 27, 2000, and in revised form, April 24, 2000
 |
ABSTRACT |
|---|
 TOP
 ABSTRACT
 INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
|
|---|
Heterotrimeric human single-stranded DNA
(ssDNA)-binding protein, replication protein A (RPA), is a central
player in DNA replication, recombination, and repair. The C terminus of
the largest subunit, RPA70, contains a putative zinc-binding motif and
is implicated in complex formation with two smaller subunits, RPA14 and
RPA32. The C-terminal domain of RPA70 (RPA70-CTD) was characterized
using proteolysis and x-ray fluorescence emission spectroscopy. The
proteolytic core of this domain comprised amino acids 432-616. X-ray
fluorescence spectra revealed that RPA70-CTD possesses a coordinated
Zn(II). The trimeric complex of RPA70-CTD, the ssDNA-binding domain of
RPA32 (amino acids 43-171), and RPA14 had strong DNA binding activity.
When properly coordinated with zinc, the trimer's affinity to ssDNA
was only 3-10-fold less than that of the ssDNA-binding domain in the
middle of RPA70. However, the DNA-binding activity of the trimer was
dramatically reduced in the presence of chelating agents. Our data
indicate that (i) Zn(II) is essential to stabilize the tertiary
structure of RPA70-CTD; (ii) RPA70-CTD possesses DNA-binding activity,
which is modulated by Zn(II); and (iii) ssDNA binding by the trimer is
a synergistic effect generated by the RPA70-CTD and RPA32.
Replication protein A
(RPA)1 is a nuclear
ssDNA-binding protein highly conserved in eukarya. Initially identified
as a protein essential for SV40 DNA replication, the protein
subsequently has been shown to be involved in practically all aspects
of DNA metabolism, including replication, recombination, and repair.
Human RPA is a heterotrimer with three subunits of 70, 32, and 14 kDa,
which are referred to as RPA70, RPA32, and RPA14, respectively (for a
review, see Ref. 1).
RPA binds to DNA in several, at least two, binding modes. The first
mode has been characterized as an interaction with 8-10 nucleotides
(nt) (2-4). In the second mode, the occluded size of DNA per RPA
trimer is about 30 nt (2, 3, 5, 6). Electron microscopy has revealed
three different molecular shapes: globular, elongated contracted, and
elongated extended. Globular and elongated extended modes were
hypothesized to be associated with 8-10- and 30-nt binding modes,
respectively, whereas the contracted one was interpreted as an
intermediate (2).
It is generally accepted that the first binding mode corresponds to the
interaction between ssDNA and the central part of RPA70 (amino acids
181-422; RPA70-(181-422)) (2, 3, 5, 6). This part is composed
of two tandem ssDNA-binding domains, called A and B (7); both have the
characteristic topology of an OB fold (8). Domains A and B
interact with 8 nt of DNA, as demonstrated by structural analysis
(7).
Additional DNA binding activity was revealed in the central domain of
RPA32 (9-13). Subsequent structural analysis showed that the central
part of RPA32 (RPA32-(43-171)) also contains an OB fold (14). This
domain possesses additional similarity to DNA-binding domains A and B
from RPA70. Two conserved aromatic amino acids, which stack DNA bases
in the structure of RPA70, were conserved in the RPA32 OB fold.
Although RPA14 contains an OB fold, this domain does not seem to bind
with ssDNA. Three lines of evidence support this conclusion. First,
RPA14 was never detected to be cross-linked with ssDNA. Second, up to
70 N-terminal amino acids comprising a larger part of the RPA14 OB fold
could be removed without loss of viability in yeast (10). Third, two
conserved aromatic amino acids, which stack DNA in DNA-binding domains,
are missing in RPA14 OB fold (14).
Recently, the C-terminal part of RPA70 has been shown to possess ssDNA
binding activity. Brill and Bastin-Shanower (15) hypothesized that the
C terminus of RPA70 may be a fourth OB fold ssDNA-binding domain of
RPA. According to their model, which is based on results obtained by
mutational analysis, this domain extends (in yeast) from amino acid 416 to the end of RPA70 and is structurally similar to gp32, yet another
ssDNA-binding OB fold with a zinc-binding domain inserted in the
middle of the structure (16). The Brill and Bastin-Shanower model
contrasts with that posed by Walther et al. (17), who
suggested that the C-terminal part of RPA70 is composed of two
structural and functional domains: a ssDNA-binding domain comprising
amino acids 440-510 and the subunit interaction domain that extends
from amino acid 511 to the end of RPA70.
The C-terminal part of RPA70 contains a putative Cys4-type
zinc-finger motif, the
CX4CX14CX2C
sequence (where X represents any amino acid other than C),
which is conserved in all known RPA70 homologues (1). This structural
designation was based solely on the conservation of the four cysteines
in the amino acid sequence. Direct involvement of zinc in the structure
and function of this motif has been postulated but not demonstrated (18, 19). The motif has been suggested to be involved in binding to damaged DNA, but the role of this region in DNA binding is not
clear. Dong et al. (20) concluded that the zinc finger motif is important for RPA function in nucleotide excision repair but not in
DNA replication. In contrast, Lin et al. (21) present evidence that the motif is important for DNA replication and mismatch repair but not for nucleotide excision repair.
To date, the C terminus of RPA70 is the only part of the protein with
no structural information. Here we characterize the RPA70 C-terminal
domain (RPA70-CTD) as a fragment comprising amino acids 432-616 and
demonstrate that Zn(II) plays a structural role in this domain. We
demonstrate that reducing agents (DTT) and chelating agents (EDTA)
destabilize the domain and its DNA binding activity.
Plasmid Construction--
All of the plasmids were constructed
on the basis of the pET15b vector (Novagen, Inc.). The construct
pET15b-hRPA14·32-(43-171)·70-(436-616) was described
previously (9). The cloning of the
pET15b-hRPA14·32-(43-171)·70-(405-616) and
pET15b-hRPA14·32-(43-171)·70-(419-616) trimers was performed according to the same protocol with one modification: RPA70 fragments 405-616 and 419-616 were first inserted in pET15b between equivalent sites NdeI and BamHI. As a result of cloning,
three residues, MAS, were added to the N terminus of RPA32-(43-171).
The N termini of RPA14 and RPA70 fragments 405-616 and 419-616 were
fused to a plasmid-encoded hexahistidine tag (His tag) and a thrombin
cleavage site.
Protein Purification--
Trimers were expressed in bacterial
BL21 (DE3) cells and purified according to the original protocol
(Novagen) using a HiTrap Chelating column (Amersham Pharmacia Biotech).
10 µM ZnCl2 was added to all buffers. After
His tag removal with bovine thrombin, RPA trimers were purified by
anion exchange chromatography (HiTrap Q; Amersham Pharmacia Biotech)
using a gradient of NaCl from 50 mM to 1 M in
buffer containing 20 mM Tris, pH 7.6, 5 mM DTT,
and 10 µM ZnCl2. Finally, a high salt buffer
was replaced with one containing 1 mM Hepes, pH 7.5, 50 mM NaCl, and 10 mM DTT using either a HiTrap
desalting column (Amersham Pharmacia Biotech) or a dialysis against the
same buffer. Protein concentrations were determined using the assay of
Bradford (22) and by comparison with known standards on Coomassie
Blue-stained SDS-polyacrylamide gels. For crystallization, protein was
concentrated to 8-10 mg/ml using UltraFree-MC concentrator with 10,000 Nominal Molecular Weight Limit filter unit (Millipore Corp.). To
incorporate selenomethionine (Se-Met) into the complex, BL21(DE3) cells
were grown in a methionine-depleted medium as described previously (9,
23). The Se-Met-containing trimer (Se-Met
RPA14·32-(43-171)·70-(436-616)) was purified using the same protocol.
Proteolysis and Identification of Proteolytic Domains--
5
µg of purified RPA14·32-(43-171)·70-(405-616) or
RPA14·32-(43-171)·70-(419-616) was treated with 0.5 ng of
trypsin (5 ng for RPA14·32-(43- 171)·70-(436-616)) in 5 µl of solution containing 5 mM Hepes (pH 7.5), 50 mM NaCl, and 5 mM DTT. 2 µl of the reaction fraction was taken after 30 min and diluted 10-fold with double distilled H2O. Samples were analyzed by matrix-assisted
laser desorption/ionization time-of-flight mass spectrometry
(ESCoR Laser Mass Spectroscopy Facility at the University of Oklahoma Health Sciences Center, Oklahoma City). Where indicated, 1 mM EDTA was added to
RPA14·32-(43-171)·70-(436-616).
Electrophoretic Mobility Shift Assays--
Assays were conducted
using 32P-end-labeled (dN)31 oligonucleotide
with a sequence of GGGAATTCCATATGAGCAGTGTTCAACTTTC as described previously (9), with the following modifications. 1 mM EDTA was excluded from the running buffer, and, where indicated, 0.5 mM DTT was added to the running buffer. Binding activity
was estimated using a Gel Doc 1000 system (Bio-Rad).
Crystallization--
Crystals of the
RPA14·32-(43-171)·70-(436-616) trimer were grown by the method of
sitting drop vapor diffusion in Cryschem plates (Hampton Research). The
sitting drop consisted of equal amounts of the protein and reservoir
solution. The reservoir solution contained 0.1 M Hepes, pH
7.8, 9% glycerol, and 1.6 M ammonium sulfate. Crystals
were grown at room temperature overnight and were best for data
collection after 2-3 days. The Se-Met
RPA14·32-(43-171)·70-(436-616) trimer was crystallized under
similar conditions.
X-ray Data Collection and Fluorescence Emission Spectra--
A
2.8-Å resolution MAD experimental data from Se-Met
RPA14·32-(43-171)·70-(436-616) crystal has been collected on the
19ID beamline of the Structural Biology Center at Argonne National Laboratory. X-ray fluorescence emission spectra were recorded by an
XR-100CR x-ray detector (AmpTek Corp.) at 12.66 keV and 12.0 keV and
analyzed by the MAESTRO program for Windows model A65-B32 (version
5.00) (EG&G ORTEC Corp.).
Limited Tryptic Proteolysis Reveals Stable Core at the C Terminus
of the RPA70 Subunit--
The C terminus of RPA70, which is distal to
amino acid 420, is an independently folded functional part of the
largest subunit. This fragment is the only part of RPA70 necessary and
sufficient for complex formation with the two smaller subunits, RPA14
and RPA32 (24, 25). We sought to solve the structure of this fragment, because it was the only part of RPA lacking structural information.
In our strategy, the first step toward protein crystallization is to
identify a soluble fragment containing a domain of interest and to
accurately map the borders of this domain. The protein should be
truncated as much as possible but not so truncated as to remove a
folded portion of the domain. The C-terminal region of RPA70 has very
low solubility if expressed individually (24, 26). This fact excluded
the possibility of crystallizing this domain on its own. We
demonstrated previously that the C-terminal part of RPA70
(RPA70-(436-616)) is sufficient to form a soluble trimeric complex,
RPA14·32-(43-171)·70-(436-616), with the central domain of RPA32
(RPA32-(43-171)) and RPA14 (9). We therefore set out to crystallize a
version of this trimeric complex. Because there was no indication that
the complex containing the 436-616 fragment was optimal, we also
prepared trimers containing longer C-terminal fragments, 405-616 and
419-616. These three constructs were expressed in bacteria and
purified to homogeneity.
Limited tryptic digestion of RPA14·32-(43-171)·70-(405-616)
revealed a proteolytically resistant domain at the C terminus of RPA70
sufficient to form a trimer with two smaller subunits (Fig.
1A). No detectable tryptic
products were derived from RPA14 and RPA32-(43-171) in agreement with
our previous observations. A similar experiment with
RPA14·32-(43-171)·70-(419-616) produced identical results (data
not shown).
The molecular masses of the human RPA14·32-(43-171)·70-(405-616)
proteolytic fragments were determined by mass spectroscopy. Samples for
this analysis were taken after 30 min of trypsin digestion, as
indicated in Fig. 1A. For the RPA70-(405-616) fragment,
four peaks with molecular masses of 24,767.9, 23,638.5, 23,388.3, and 21,397.8 Da were identified in the interval between 20,000 and 26,000 Da (Fig. 1B). A similar experiment with
RPA14·32-(43-171)·70-(419-616) revealed only two peaks of 23,094 and 21,398 Da derived from the 419-616 fragment (data not shown).
Analysis of the predicted tryptic map suggested a possible proteolytic
pathway (Fig. 1C). The fragment 405-616 plus an extra four
amino acids, GSHM, remaining after the pET15b His tag (Novagen) removal
(predicted mass 24,795 Da) was initially digested by trypsin in one of
three potential sites, Lys410, Arg412, or
Lys431, producing a mixture of shorter fragments: 411-616
(predicted mass 23,681 Da), 413-616 (predicted mass 23,411 Da), and
432-616 (predicted mass 21,421 Da). In the course of time, fragments
411-616 and 413-616 were further digested; finally, stable homogenous 432-616 product was generated (Fig. 1A). The only
proteolytic product derived from the digestion of 419-616 (plus GSHM;
predicted mass 23,118 Da) was a fragment comprising amino acids
432-616 with a predicted molecular mass of 21,421 Da (data not shown). Significantly, Lys443 and Arg612, the potential
trypsin sites nearest to the N- and C-terminal ends of the 432-616,
were resistant to proteolysis. All experimentally measured masses were
systematically lower than their theoretical counterparts by about 25 Da; this disagreement may be attributed to the absolute miscalibration.
We concluded that the C-terminal part of RPA70 has a single
proteolytically resistant domain, RPA70-CTD, which extends from amino
acid 432 to the end of the largest subunit at amino acid 616, a result
confirmed by limited proteolysis of
RPA14·32-(43-171)·70-(436-616). The 436-616 fragment, which is
only four amino acids shorter than 432-616, was found to be resistant
to digestion with a 10-fold higher concentration of trypsin (Fig.
2, lanes 1-5).
Structural Role for Metal Ion and Factors Affecting RPA70-CTD
Stability--
The putative zinc-binding motif is conserved in all
homologues of RPA. Its function(s) are not known, but evidence has
recently been presented that a metal ion, presumably zinc, is required for the function of this motif (17, 19). With the possible structural role of zinc in mind, we added low (10 µM)
concentrations of ZnCl2 in all buffers during protein
purification and avoided metal-chelating reagents like EDTA. The role
of metal ions for the RPA70-CTD structure was analyzed by limited proteolysis.
The RPA14·32-(43-171)·70-(436-616) trimer was subject to limited
tryptic digestion in both the absence and presence of EDTA. When the
trimer was treated with trypsin in the absence of EDTA, it was
resistant to proteolysis. No degradation was seen after 1 h (Fig.
2, lanes 1-5), and only slight digestion was
observed even after 24 h (data not shown). In contrast, when a
sample was preincubated on ice with 1 mM EDTA for 30 min,
it was mostly degraded after 20 min and completely degraded after
1 h (Fig. 2, lanes 7-10). The rate of
degradation was dependent on EDTA concentration and, to some extent, on
preincubation time; the higher the concentration of EDTA (up to 10 mM was tested) or the longer preincubation time (up to
3 h tested), the faster the degradation (data not shown). These
data suggest that a metal ion plays a structural role for the
RPA70-CTD; without the ion, the structure is compromised, and the
protein becomes sensitive to tryptic digestion.
The destabilizing effect of EDTA was reversible. The
RPA14·32-(43-171)·70-(436-616) trimer was preincubated with 10 mM EDTA for 24 h and then applied to HiTrap Q ion
exchange column. The column was washed with 20 column volumes of buffer
containing 5 mM DTT and 10 µM
ZnCl2 and then developed with a salt gradient. Most, if not
all, tryptic resistance in the eluted protein fraction was recovered
(data not shown).
The removal of DTT had the same effect on stability of RPA70-CTD as the
addition of EDTA. RPA14·32-(43-171)·70-(436-616) was applied to
an ion exchange column, washed with 20 column volumes of buffer with 10 µM ZnCl2 and no DTT, and developed by a
gradient. The eluted trimer was not resistant to trypsin, although zinc was in solution. As with EDTA, the effect of DTT was reversible (data
not shown).
Metal Ion Modulates ssDNA Binding Activity of
RPA14·32-(43-171)·70-(436-616)--
We reasoned that a
structural destabilization of RPA70-CTD may accompany a detectable loss
of function, in particular ssDNA binding activity. A significant
decrease in ssDNA binding activity by RPA in the absence of DTT, which
has been reported by Park and co-workers (19), supported this
conclusion. To further test this hypothesis, we used electrophoretic
mobility gel shift assays to analyze ssDNA binding of the
RPA14·32-(43-171)·70-(436-616) trimer in the presence and absence
of EDTA and a strong chelator of transition metals, 1,10-phenanthroline
(ortho-phenanthroline; OP). Increasing amounts of the trimer
were preincubated with 32P-end-labeled (dN)31
in the presence or in the absence of 10 mM EDTA or 1 mM OP and resolved by gel electrophoresis.
The addition of 10 mM EDTA significantly reduced ssDNA
binding affinity of RPA14·32-(43-171)·70-(436-616). The binding
affinity in the absence of EDTA was about 3-10-fold higher then in its presence (Fig. 3A). The
exclusion of DTT from the buffer produced similar results (data not
shown), in agreement with results reported by Park and co-workers (19).
The strongest decrease was observed in the presence of OP. The addition
of 1 mM OP generated a 10-30-fold drop in the DNA binding
affinity, which correlates with the results of Lao et al.
(18). Significantly, OP only weakly interacts with ions of magnesium or
calcium but has a strong affinity to divalent cations of transition
metals, including zinc (27). Together, these data strongly suggest a
structural and functional role for transition metal in RPA70-CTD.
The ssDNA binding activity of the RPA trimeric core and the major
ssDNA-binding domain of RPA70 (RPA70-(181-432)) were compared. Although we have already described this experiment (9), we believe the
experiment bears repeating, for two reasons. First, in our previous
experiment, the trimer was purified with EDTA and without Zn(II) in the
buffers. Second, EDTA was a component of the reaction buffer in our
previous electrophoretic mobility shift assays. Both factors would
decrease the apparent affinity of RPA14·32-(43-171)·70-(436-616)
for ssDNA. In our current studies, RPA14·32-(43-171)·70-(436-616)
was purified in the presence of Zn(II). To prevent a possible negative
effect of the EDTA presence and DTT absence, EDTA was excluded, and 0.5 mM DTT was added to the running buffer. Under these
conditions, the trimer was found to have only 3-10-fold lower affinity
for (dN)31 than did RPA70-(181-432) (Fig.
4). Importantly, the binding affinity of
RPA70-(181-432) was comparable with that reported earlier (9), whereas
the affinity of the truncated trimer was 10-30-fold higher.
RPA14·32-(43-171)·70-(436-616) Crystallization and Data
Collection--
Initial crystallization trials of
RPA14·32-(43-171)· 70-(436-616) were performed using commercial
Crystal Screen (Hampton Research). Two slightly different
crystallization conditions were identified. They were further optimized
to improve crystal quality. Crystals grew overnight, diffracted to
2.9-3.0 Å on the laboratory x-ray machine, had low (0.15-0.2
degrees) mosaic spread, and belonged to a trigonal or hexagonal
space group with the unit cell parameters of a = b = 89 Å and c = 352 Å. Crystals were
unstable in x-ray at room temperature, so all data were collected from
crystals cooled in a stream of low temperature (100 K) N2
gas. Before flash cooling, crystals were promptly transferred for
30-60 s in the crystallization buffer containing 25% glycerol. The
freezing slightly increased the mosaic spread (up to 0.3-0.4 degrees)
and significantly shrank the unit cell along the c axis; the
new parameters were a = b = 88.4 Å,
and c = 341.5 Å. A full 3.0-Å resolution data set was
collected, and the unit cell was assigned as P3121 or P3221.
Se-Met was biochemically incorporated in the trimer as described
under "Materials and Methods." Mass spectroscopic analysis confirmed that more than 95% of the 16 methionines (six in RPA70-CTD and five in RPA32-(43-171) and RPA14) were replaced with
selenomethionine. The N-terminal methionines in RPA70-CTD and
RPA32-(43-171) were removed. Crystals of Se-Met-modified
RPA14·32-(43-171)·70-(436-616) were grown under conditions
similar to those for native trimer. The 2.8-Å resolution,
four-wavelength MAD experiment has been collected. The results of
structural analysis will be reported elsewhere.
Fluorescence Emission Indicates the Presence of Zinc--
The
x-ray fluorescence emission spectra of Se-Met-labeled
RPA14·32-(43-171)·70-(436-616) crystal were analyzed. A crystal was mounted in CryoLoop supported by MicroTube (Hampton Research) and
cooled in a stream of low temperature (~100 K) N2 gas.
Three x-ray emission spectra were measured. The first emission spectrum was recorded using an incident beam with an energy of 12.66 keV, the
K absorption edge for selenium. Four detectable peaks were revealed (Fig. 5A). Two were
expected: the 12.66-keV signal was a background of the beam, and the
11.29-keV signal was the selenium emission with the expected
theoretical value of 11.22 (K
The second spectrum was recorded using an incident beam with
energy of 12.0 keV (Fig. 5B). This energy is below the
selenium absorption edge, so the selenium emission signal disappeared. By contrast, the zinc signal was noticeably stronger as compared with
the background signal of the beamline. The third spectrum was recorded
at the same energy (E = 12.0 keV) but with mother liquor and without crystal (Fig. 5C). As expected, the zinc
signal disappeared after the crystal was removed from the CryoLoop,
indicating that this signal belonged to the crystal. By contrast, the
iron signal persisted in the absence of the crystal. Subsequent
analysis revealed that the iron signal came from the MicroTube, a
stainless steel hollow tube that supported the CryoLoop.
The intensity of the fluorescence spectral lines enabled us to estimate
the relative concentrations of selenium and zinc in the crystal.
Assuming that the trimer has one Zn(II) (one zinc finger motif) per 16 selenium (the presence of 16 Se-Met was confirmed by mass spectroscopic
analysis), and taking into account that the beam was tuned to maximize
the intensity of Se (I(Se) = Imax(Se)), but not zinc emission
(I(Zn) < Imax(Zn)), the zinc
signal was expected to be proportional to selenium in the ratio of
X:16, where X = I(Zn)/Imax(Zn); X < 1. Qualitatively, this is in agreement with experimental data, which
indicated that at least one Zn(II) was bound per trimer.
Several lines of evidence indicate that Zn(II) is an associated part of
the putative zinc finger motif. First, zinc was not a component of the
buffer; the protein was dialyzed against a buffer with no zinc before
crystallization, and there was no zinc in the reservoir buffer. Second,
zinc was not found in the structure of RPA14·32-(43-171) (14). This
strongly suggests that zinc is bound with RPA70-CTD. Third, a metal ion
is required for structural coordination and functional activity of the
putative zinc finger motif, which is a part of RPA70-CTD. The
fluorescence emission data also exclude the possibility that many other
transition metals other than zinc are coordinated in the putative
zinc-binding motif. Fluorescence analysis, however, cannot rule out
calcium or magnesium as possible candidates; energies of their emission
lines are out of the covered spectral interval. However, it seems
unlikely that these metals are coordinated, because the activity of RPA
was strongly affected by 1,10-phenanthroline. OP forms very weak
complexes with magnesium and calcium but has strong affinity to ions of transition metals, including zinc (27).
In this paper, we characterized the C-terminal domain of RPA70 as
a fragment comprising amino acids 432-616. Combined with a recently
published structural study of the N-terminal domain (29), our data have
completed the structural characterization of the RPA70 domains.
The largest subunit is composed of four domains. The N-terminal
protein-protein interaction domain extends from the N terminus to amino
acid 110, as defined by NMR and proteolytic studies. Although not
explicitly mentioned by the authors of the NMR structural study, this
domain has a characteristic topology of an OB fold (29). The fragment
from residue 111 to around 180 is unstructured, as determined by
biochemical and genetic studies as well as by NMR analysis (9, 29). The
remaining part of RPA70 is composed of three DNA-binding domains, A, B,
and C. Domain A extends from residue 181 to 291, and B extends from 300 to 420, and both have the topology of an OB fold, as confirmed by
structural analysis (7). The C-terminal DNA-binding domain C contains
residues 432-616. This domain has been hypothesized to be one more OB
fold with a zinc-binding domain inserted in the middle (15).
Three real or putative OB folds (one from each subunit) form a
trimerization core. These are RPA14, RPA32-(43-171), and RPA70-CTD. Two domains (RPA32-(43-171) and RPA70-CTD) have been demonstrated to
possess ssDNA-binding activity. The interaction of RPA32-(43-171) and
RPA14 is mediated by the two C-terminal helices. RPA70-CTD has been
hypothesized to contribute one or two more helices in the trimerization
interface (9, 14).
Three alternative models for the interaction of
RPA14·32-(43-171)·70-(436-616) with ssDNA are possible. First,
the interaction is mediated exclusively by the ssDNA-binding domain of
RPA32 (RPA32-(43-171), DNA-binding domain D); the effect of zinc is an
indirect effect of RPA70-CTD structural destabilization on ssDNA
binding by RPA32. Second, the interaction is mediated exclusively by
RPA70-CTD; the effect of zinc is a direct effect of structural
destabilization in this domain. Third, the interaction is a synergistic
effect mediated by both RPA70-CTD and RPA32-(43-171); the effect of
zinc is an effect of structural destabilization in one of two
ssDNA-binding domains.
Three lines of evidence support the third model. First, ssDNA binding
affinity of RPA14·32-(43-171) is 3 orders of magnitude less than
that of RPA70-(181-422) (9). Similar affinity for the trimer could be
expected if the first model were correct. Second, a binding affinity
for individual domains A, B, C, and D has been shown to be in the same
order of magnitude (15).2 It
strongly suggests that the second model is not a case either. Furthermore, it is difficult to reconcile the binding activity of only
one ssDNA-binding domain in the trimer containing two. Third, the
binding of RPA-(181-422) to ssDNA is a synergistic effect of domains A
and B. It is reasonable to expect similar synergistic effect and
comparable affinity for the trimer containing domains C and D.
Our data taken with other recently published results let us hypothesize
that RPA may have three different binding modes. In agreement with the
existing model, the first mode corresponds to ssDNA binding by domains
A and B and is associated with the globular molecular shape and
8-10-nt binding site. In the second mode, ssDNA is contacted by
domains A, B, and C. This mode corresponds to the elongated contracted
shape and 13-nt binding site, which was recently characterized by
Lavrik et al. (30). Finally, all four RPA domains (A-D)
contact DNA, generating the elongated extended shape. In this mode, RPA
contacts between 19 and 31 bases.
In this paper, we determined that RPA70-CTD is associated with Zn(II),
using synchrotron beam radiation and x-ray fluorescence emission
spectra. This technique, which is not commonly used, may prove to be a
generic method for characterizing metalloproteins. Determining what
type of metal ion is present in a metalloprotein is a challenging
problem. Biochemical and spectral methods have been used to address
this problem. For biochemical approaches, it is straightforward to
detect the presence of a metal ion but usually difficult to
characterize the exact type of ion, particularly if the divalent cation
is a transition metal whose chemical properties are highly similar
(31).
For spectral methods (both optical and x-ray), it is not difficult to
detect a signal from a given type of metal. However, it is difficult to
show that this signal is significant; trace amounts of practically
every element are present in biological solutions and buffers. It is
necessary, therefore, to show that metal ion and protein are present in
stoichiometric amounts. Here, the relative concentrations of zinc and
the protein were compared based on intensities of zinc and selenium
x-ray emission signals. The amount of zinc was in question, while that
of selenium was proportional to protein concentration, with the
proportion coefficient being approximately equal to the number of
methionines in the protein. Although the beamline was not adopted for
conducting quantitative experiments of this kind, a qualitative
experiment generated a compelling result.
The described method may be of general interest for two reasons. First,
although in our case the spectra were recorded from a protein crystal,
a crystalline sample should not be a prerequisite for this kind of
experiment. Similar emission spectra could be recorded using protein in
solution and controlling for metal in the buffer. Second, the
sensitivity of the method may be increased by using a more accurate
quantitative measurement like EXAFS (32, 33).
Determining a role for RPA70-CTD has been controversial. In most
preparations of RPA, small concentrations of EDTA were used in the RPA
purification protocols. Most typically, RPA has been purified in the
presence of 0.25-1.0 mM EDTA. To the best of our knowledge, neither zinc nor other ions of transition metals were added
during RPA purification. Our data indicate that the presence of even
this amount of EDTA destabilizes the structure and compromises functions of RPA70-CTD.
Fortunately, the contaminating effect of EDTA on RPA70-CTD is
reversible, and the integrity of the domain may be restored. To this
end, an EDTA-containing protein buffer should be replaced, using any
convenient method, with one containing Zn(II), DTT, and no EDTA. The
structural integrity of RPA70-CTD may be assayed using tryptic
digestion as described above.
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
View larger version (33K):
[in a new window]
Fig. 1.
Proteolytic characterization of the
C-terminal domain of RPA70. A, 5 µg of purified
RPA14·32-(43-171)·70-(405-616) was digested with 0.5 ng of
trypsin. Aliquots were removed at the designated times, resolved by gel
electrophoresis, and visualized by Coomassie Blue staining. An
arrow indicates a moment, 30 min from the beginning, when a
sample for mass spectroscopic analysis was taken. An interval of mass
between arrow ends on the gel approximately
corresponds to that shown in B. On the left are
molecular mass markers. B, mass spectroscopic
characterization of the RPA14·32-(43-171)·70-(405-616) tryptic
digestion. Shown is an interval of mass from about 20,000 to 26,000 Da,
which covers proteolytic products derived from the RPA70 fragment.
C, suggested pathway of RPA70-(405-616) tryptic digestion.
Shown is fragment 405-616 of the RPA70 sequence. Potential trypsin
sites (Lys and Arg residues; K and R) are
capitalized. Important amino acids discussed here are
numbered. Trypsin-resistant sites, Lys443
and Arg612, are marked with asterisks. Four
amino acids at the N terminus shown in italics came with the
pET15b His tag expression system (Novagen) and are not a part of RPA70.
Omitted for clarity, fragment 451-600 is represented by
multiple dots. Proteolytic fragments are shown
with arrows. Their mass
spectroscopy-measured/computer-predicted masses are
indicated.
View larger version (69K):
[in a new window]
Fig. 2.
RPA70-CTD is coordinated with metal ion.
5 µg of purified RPA14·32-(43-171)·70-(436-616) with His
tag fused to RPA14 (HT + RPA14; lanes
1 and 6) was digested with 5 ng of trypsin
without EDTA (lanes 2-5) and with 1 mM EDTA (lanes 7-10). The latter
sample was preincubated with EDTA on ice for 30 min before digestion.
Aliquots were removed at the designated times, resolved by gel
electrophoresis, and visualized by Coomassie Blue staining. On the
left are molecular mass markers.
View larger version (45K):
[in a new window]
Fig. 3.
Metal ion modulates ssDNA-binding activity of
the RPA14·32-(43-171)·70-(436-616) trimer. The trimer was
incubated with 20 fmol of 32P-labeled (dN)31 in
the absence/presence of 10 mM EDTA (A) or 1 mM OP (B). Complexes were resolved by
nondenaturing gel electrophoresis and visualized by autoradiography.
The numbers above each line refer to
the molecular excess of the protein over the DNA probe. The mobility of
the free ssDNA is shown.
View larger version (21K):
[in a new window]
Fig. 4.
A comparison of ssDNA binding activity of
RPA14·32-(43-171)·70-(436-616) and RPA70-(181-432). The
electrophoretic mobilities of the designated subcomplexes were
estimated the same way as indicated in the legend for Fig. 3. In this
experiment, 0.5 mM DTT was added to the running buffer
(0.5× TB).
1) or 11.18 (K2) (28). The two
smaller peaks with energies of 8.68 and 6.46 keV were characterized as
being zinc (K1 = 8.64 and
K2 = 8.62 keV) and iron
(K1 = 6.40 and
K2 = 6.39 keV), respectively.
View larger version (22K):
[in a new window]
Fig. 5.
X-ray fluorescence emission indicates the
presence of zinc in RPA14·32-(43-171)·70-(436-616) crystal.
A, an emission spectrum from the crystal was recorded using
a beam with the energy of 12.66 keV (selenium absorption K
edge). Four peaks, which correspond to the primary beam
(Beam), selenium (Se), zinc (Zn), and
iron (Fe), are marked. B, an emission from the
same crystal recorded with the energy of 12.00 keV (below selenium
absorption edge). Selenium emission has disappeared. C, the
same as B, but the crystal has been removed. The zinc signal
has gone with the crystal, while iron is still present.
DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
| |
ACKNOWLEDGEMENTS |
|---|
We thank Joan and Ronald Conaway, Lori Frappier, and Andrei Okorokov for useful discussions; Aled Edwards and Karla Rodgers for critical reading of the manuscript; Hiro Matsumoto and Bruce Baggenstoss for prompt mass spectroscopic analysis; and members of Structural Biology Center 19-ID beamline at the Advanced Photon Source, Argonne National Laboratory for support.
| |
FOOTNOTES |
|---|
* This work was supported by National Institutes of Health Grant GM61192-01 (to A. B.). Use of the Argonne National Laboratory Structural Biology Center beamlines at the Advanced Photon Source was supported by the United States Department of Energy, Office of Biological and Environmental Research, under Contract W-31-109-ENG-38.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
¶ To whom correspondence should be addressed: Dept. of Biochemistry and Molecular Biology, University of Oklahoma Health Sciences Center, 975 N.E. 10th St., BRC-466, Oklahoma City, OK 73190. Tel.: 405-271-8346; Fax: 405-271-3910; E-mail: Alexey-Bochkarev@ouhsc.edu.
Published, JBC Papers in Press, June 15, 2000, DOI 10.1074/jbc.M000620200
2 E. Bochkareva, unpublished observations.
| |
ABBREVIATIONS |
|---|
The abbreviations used are: RPA, replication protein A; ssDNA, single-stranded DNA; nt, nucleotide; RPA70-CTD, RPA70 C-terminal domain; DTT, dithiothreitol; Se-Met, selenomethionine; OP, ortho- phenanthroline; OB, oligonucleotide/oligosaccharide binding.
| |
REFERENCES |
|---|
|
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
|
|---|
| 1. | Wold, M. S. (1997) Annu. Rev. Biochem. 66, 61-92 |
| 2. | Blackwell, L. J., Borowiec, J. A., and Masrangelo, I. A. (1996) Mol. Cell. Biol. 16, 4798-4807 |
| 3. | Blackwell, L. J., and Borowiec, J. A. (1994) Mol. Cell. Biol. 14, 3993-4001 |
| 4. | Pfuetzner, R. A., Bochkarev, A., Frappier, L., and Edwards, A. M. (1997) J. Biol. Chem. 272, 430-434 |
| 5. | Kim, C., Paulus, B. F., and Wold, M. S. (1994) Biochemistry 33, 14197-14206 |
| 6. | Kim, C., Snyder, R. O., and Wold, M. S. (1992) Mol. Cell. Biol. 12, 3050-3059 |
| 7. | Bochkarev, A., Pfuetzner, R. A., Edwards, A. M., and Frappier, L. (1997) Nature 385, 176-181 |
| 8. | Murzin, A. G. (1993) EMBO J. 12, 861-867 |
| 9. | Bochkareva, E., Frappier, L., Edwards, A. M., and Bochkarev, A. (1998) J. Biol. Chem. 273, 3932-3936 |
| 10. | Philipova, D., Mullen, J. R., Maniar, H. S., Lu, J., Gu, C., and Brill, S. J. (1996) Genes Dev. 10, 2222-2233 |
| 11. | Sibenaller, Z. A., Sorensen, B. R., and Wold, M. S. (1998) Biochemistry 37, 12496-12506 |
| 12. | Kolpashchikov, D. M., Weisshart, K., Nasheuer, H. P., Khodyreva, S. N., Fanning, E., Favre, A., and Lavrik, O. I. (1999) FEBS Lett. 450, 131-134 |
| 13. | Mass, G., Nethanel, T., and Kaufmann, G. (1998) Mol. Cell. Biol. 18, 6399-6407 |
| 14. | Bochkarev, A., Bochkareva, E., Frappier, L., and Edwards, A. M. (1999) EMBO J. 18, 4498-4504 |
| 15. | Brill, S. J., and Bastin-Shanower, S. (1998) Mol. Cell. Biol. 18, 7225-7234 |
| 16. | Shamoo, Y., Friedman, A. M., Parsons, M. R., Konigsberg, W. H., and Steitz, T. A. (1995) Nature 376, 362-366 |
| 17. | Walther, A. P., Gomes, X. V., Lao, Y., Lee, C. G., and Wold, M. S. (1999) Biochemistry 38, 3963-3973 |
| 18. | Lao, Y., Lee, C. G., and Wold, M. S. (1999) Biochemistry 38, 3974-3984 |
| 19. | Park, J. S., Wang, M., Park, S. J., and Lee, S. H. (1999) J. Biol. Chem. 274, 29075-29080 |
| 20. | Dong, J., Park, J. S., and Lee, S. H. (1999) Biochem. J. 337, 311-317 |
| 21. | Lin, Y. L., Shivji, M. K., Chen, C., Kolodner, R., Wood, R. D., and Dutta, A. (1998) J. Biol. Chem. 273, 1453-1461 |
| 22. | Bradford, M. M. (1976) Anal. Biochem. 72, 248-254 |
| 23. | Van Duyne, G. D., Standaert, R. F., Karplus, P. A., Schreiber, S. L., and Clardy, J. (1993) J. Mol. Biol. 229, 105-124 |
| 24. | Gomes, X. V., and Wold, M. S. (1995) J. Biol. Chem. 270, 4534-4543 |
| 25. | Kim, D. K., Stigger, E., and Lee, S. H. (1996) J. Biol. Chem. 271, 15124-15129 |
| 26. | Henricksen, L. A., Umbricht, C. B., and Wold, M. S. (1994) J. Biol. Chem. 269, 11121-11132 |
| 27. | Auld, D. S. (1988) Methods Enzymol. 158, 110-114 |
| 28. | Bearden, J. A. (1967) Rev. Modern Phys. 39, 78-99 |
| 29. | Jacobs, D. M., Lipton, A. S., Isern, N. G., Daughdrill, G. W., Lowry, D. F., Gomes, X., and Wold, M. S. (1999) J. Biomol. NMR 14, 321-331 |
| 30. | Lavrik, O. I., Kolpashchikov, D. M., Weisshart, K., Nasheuer, H. P., Khodyreva, S. N., and Favre, A. (1999) Nucleic Acids Res. 27, 4235-4240 |
| 31. | Hainaut, P., and Milner, J. (1993) Cancer Res. 53, 1739-1742 |
| 32. | Dewald, H. D., Watkins, J. W., Elder, R. C., and Heineman, W. R. (1986) Anal. Chem. 58, 2968-2975 |
| 33. | Hard, T., Rak, A., Allard, P., Kloo, L., and Garber, M. (2000) J. Mol. Biol. 296, 169-180 |
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati What's this?
This article has been cited by other articles:
|
|
 |
|
  E. Fanning, V. Klimovich, and A. R. Nager A dynamic model for replication protein A (RPA) function in DNA processing pathways Nucleic Acids Res., September 10, 2006; 34(15): 4126 - 4137. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Lin, J. B. Robbins, E. K. D. Nyannor, Y.-H. Chen, and I. K. O. Cann A CCCH Zinc Finger Conserved in a Replication Protein A Homolog Found in Diverse Euryarchaeotes J. Bacteriol., December 1, 2005; 187(23): 7881 - 7889. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Liu, M. Kvaratskhelia, S. Hess, Y. Qu, and Y. Zou Modulation of Replication Protein A Function by Its Hyperphosphorylation-induced Conformational Change Involving DNA Binding Domain B J. Biol. Chem., September 23, 2005; 280(38): 32775 - 32783. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Das, L. Rajagopalan, V. S. Mathura, S. J. Rigby, S. Mitra, and T. K. Hazra Identification of a Zinc Finger Domain in the Human NEIL2 (Nei-like-2) Protein J. Biol. Chem., November 5, 2004; 279(45): 47132 - 47138. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Weisshart, P. Pestryakov, R. W. P. Smith, H. Hartmann, E. Kremmer, O. Lavrik, and H.-P. Nasheuer Coordinated Regulation of Replication Protein A Activities by Its Subunits p14 and p32 J. Biol. Chem., August 20, 2004; 279(34): 35368 - 35376. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. E. Nuss and G. M. Alter Denaturation of replication protein A reveals an alternative conformation with intact domain structure and oligonucleotide binding activity Protein Sci., May 1, 2004; 13(5): 1365 - 1378. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. E. Pestryakov, D. Y. Khlimankov, E. Bochkareva, A. Bochkarev, and O. I. Lavrik Human replication protein A (RPA) binds a primer-template junction in the absence of its major ssDNA-binding domains Nucleic Acids Res., March 26, 2004; 32(6): 1894 - 1903. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y.-M. Loo and T. Melendy Recruitment of Replication Protein A by the Papillomavirus E1 Protein and Modulation by Single-Stranded DNA J. Virol., February 15, 2004; 78(4): 1605 - 1615. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. S. Krishna, I. Majumdar, and N. V. Grishin Structural classification of zinc fingers: SURVEY AND SUMMARY Nucleic Acids Res., January 15, 2003; 31(2): 532 - 550. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Dabrowski, M. Olszewski, R. Piatek, A. Brillowska-Dabrowska, G. Konopa, and J. Kur Identification and characterization of single-stranded-DNA-binding proteins from Thermus thermophilus and Thermus aquaticus - new arrangement of binding domains Microbiology, October 1, 2002; 148(10): 3307 - 3315. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H.-S. Kim and S. J. Brill Rfc4 Interacts with Rpal and Is Required for Both DNA Replication and DNA Damage Checkpoints in Saccharomyces cerevisiae Mol. Cell. Biol., June 1, 2001; 21(11): 3725 - 3737. [Abstract] [Full Text]
|
|
|
|
|
|
K. Komori and Y. Ishino Replication Protein A in Pyrococcus furiosus Is Involved in Homologous DNA Recombination J. Biol. Chem., July 6, 2001; 276(28): 25654 - 25660. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. A. Bastin-Shanower and S. J. Brill Functional Analysis of the Four DNA Binding Domains of Replication Protein A. THE ROLE OF RPA2 IN ssDNA BINDING J. Biol. Chem., September 21, 2001; 276(39): 36446 - 36453. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
