HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

J. Biol. Chem., Vol. 275, Issue 35, 27360-27365, September 1, 2000

This Article Abstract Full Text (PDF) All Versions of this Article: 275/35/27360    most recent M910363199v1 Submit a Letter to Editor Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Kamino, K. Articles by Shizuri, Y. Search for Related Content PubMed PubMed Citation Articles by Kamino, K. Articles by Shizuri, Y. Social Bookmarking                      What's this?

Barnacle Cement Proteins

IMPORTANCE OF DISULFIDE BONDS IN THEIR INSOLUBILITY^*

Kei Kamino^§, Koji Inoue^¶, Tadashi Maruyama^¶, Nobuhiko Takamatsu^**, Shigeaki Harayama^¶, and Yoshikazu Shizuri

From the  Shimizu Laboratories, Marine Biotechnology Institute, 1900 Sodeshi, Shimizu, Shizuoka 424-0037, Japan, ^¶ Kamaishi Laboratories, Marine Biotechnology Institute, 75-1, Heita, Kamaishi, Iwate 026-0001, Japan, and the ^** Department of Biosciences, School of Science, Kitasato University, 1-15-1, Kitasato, Sagamihara, Kanagawa 228, Japan

Received for publication, December 23, 1999, and in revised form, April 29, 2000

	ABSTRACT

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Barnacles produce a cement that is a proteinaceous underwater adhesive for their secure attachment to the substratum. The biochemical properties of the cement have not previously been elucidated, because the insolubility of the cement proteins hampers their purification and characterization. We developed a non-hydrolytic method to render soluble most of the cement components, thereby allowing the proteins to be analyzed. Megabalanus rosa cement could be almost completely rendered soluble by its reduction with 0.5 M dithiothreitol at 60 °C in a 7 M guanidine hydrochloride solution, the high concentration of dithiothreitol being indispensable to achieve this. The effectiveness of this reduction treatment was confirmed by the detachment of the barnacle from the substratum. Three proteins comprising up to 94% of the whole cement were identified as the major cement components. The cDNA clone of one of these major proteins was isolated, and the site-specific expression of the gene in the basal portion of the adult barnacle, where the cement glands are located, was demonstrated. A sequence analysis revealed this cement component to be a novel protein of 993 amino acid residues, including a signal peptide. This is the first report of the major component of the barnacle cement protein complex.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

The barnacle is a marine organism that attaches firmly to various substrata in water. The barnacle achieves the underwater adhesion by secreting proteinaceous cement from the cement gland into the space between its calcareous base and the substratum (1-3). To adhere effectively, the cement needs to accomplish several functions such as coagulation, displacement of water from the substratum, establishment of interfacial contact, and molecular attraction between dissimilar materials (4, 5). Understanding the structures and functions of the cement components may help to elucidate the mechanisms for the biological adhesive that is involved in barnacle settlement and to design interesting biomimetic polymers. This may also lead to the development of a specific remediation strategy for barnacle fouling.

A quantitative amino acid analysis has revealed that the cement is principally composed of proteinaceous substances (6). DOPA (peptidyl-3,4-dihydroxyphenylalanine), which is a common constituent of mussel-foot proteins (7), has not been found in the cement (8, 9). The partial compositions of the cement proteins in Megabalanus rosa (9) and Balanus eburneus (10) have recently been reported. M. rosa cement was shown to consist of three groups of proteins, i.e. a formic acid-soluble fraction (SF1),¹ a formic acid-soluble fraction after reduction by tri-n-butylphosphine (SF2), and an insoluble fraction after reduction (IF) (9). SF1 and SF2 contain three similar proteins of approximately 60 kDa that are rich in Ser, Thr, Gly, and Ala, and other smaller proteins. IF, which accounts for 47% of the cement, was not characterized, because it could only be rendered soluble after cyanogen bromide (CNBr) cleavage.

We developed in this study a method to render soluble nearly all the components of M. rosa cement that enabled all the major cement proteins to be identified without any cleavage of the peptide bonds. In addition, the complementary DNA clone corresponding to a major M. rosa cement protein was isolated and sequenced.

	EXPERIMENTAL PROCEDURES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Fractionation of the Cement According to the Solubility in a Guanidine Hydrochloride Solution-- Cement of M. rosa was collected as described in our previous study (9) within 1 day of its secretion and stored at 20 °C until being used. The cement was suspended in a 10 mM sodium phosphate buffer (pH 6.0) containing 6 M guanidine hydrochloride (GdnHCl), and the suspension was centrifuged at 200,000 × g for 1 h at 20 °C. The protein fraction in the supernatant is designated as GdnHCl-soluble fraction 1 (GSF1). The precipitate was resuspended in the same solution and again centrifuged. This procedure was conducted twice more to completely remove GSF1 from the precipitate. The precipitate was resuspended in a 1.5 M Tris-HCl buffer (pH 8.5) containing 7 M GdnHCl and 20 mM EDTA (3 mg/ml) and then reduced with 0.5 M dithiothreitol (DTT) for 1 h at 60 °C while continuously agitating. The sulfhydryl groups of the proteins were carboxymethylated by a 2.5-fold amount of monoiodoacetic acid (w/w) to DTT in the dark at room temperature for 20 min, the reaction being terminated by adding 2-mercaptoethanol. The resulting suspension was centrifuged as already described. The protein fraction in the supernatant is designated as GdnHCl-soluble fraction 2 (GSF2), and the precipitate is designated as the GdnHCl-insoluble fraction (GIF). Each fraction was dialyzed against 0.1% acetic acid at 4 °C and then flash-evaporated. The methods of Laemmli (11) and of Schäger and Jagow (12) were employed for an SDS-PAGE analysis. A peptide map analysis of the major cement proteins was carried out as follows. Each protein band by SDS-PAGE was visualized with the Copper Stain kit (Bio-Rad) and then cut out. Each gel piece was destained and treated with CNBr in 70% (v/v) formic acid (9). After evaporating to remove the CNBr and formic acid, the peptide fragments derived from each protein were separated by SDS-PAGE and visualized by CBB-R250 staining. Electrophoretic transfer of the major cement proteins and peptide fragments to a polyvinylidene difluoride (PVDF) membrane (Pro Blott, PE-Biosystems) was conducted according to the method of Ikeuchi (13) by adding 0.1% SDS in a blotting buffer. The N-terminal amino acid sequences were determined with a PSQ-2 protein sequencer (Shimadzu, Japan). The amino acid composition of Mrcp-100k, a major protein component of M. rosa cement, was determined as follows. GSF2 was separated by SDS-PAGE and then electrophoretically transferred to a PVDF membrane. After a brief CBB-R250 staining, Mrcp-100k was cut out and hydrolyzed in vacuo in constantly boiling HCl (5.7 N), including 0.02% phenol at 110 °C for 24, 48, and 72 h, or in 4 M methane sulfonic acid (Pierce) at 110 °C for 24 h. The amino acid compositions of the hydrolysates were analyzed by a Pico-Tag amino acid analysis system (Waters, Division of Millipore). The glycosylation of Mrcp-100k was investigated as follows. After separating GSF2 by SDS-PAGE and electroblotting to a PVDF membrane, the sample was treated with periodate to oxidize the oligosaccharide. The generated aldehyde was reacted with a biotinhydrazide reagent and with horseradish peroxidase (HRP)-labeled avidin by using a GP-sensor (Honen, Japan). Bound HRP was visualized by its reaction with an HRP1000 immunostaining kit (Konica, Japan).

Test on Barnacles of Their Detachment from the Substratum-- Barnacles of about 1 cm in diameter attached to mussel shells (M. rosa) or to a plastic substratum (Balanus amphitrite) were collected, and the whole soft tissue within the shell was carefully removed. Each intact barnacle shell attached to the substratum was put into a 50-ml conical tube and immersed in a 1.5 M Tris-HCl buffer (pH 8.5) containing 7 M GdnHCl. The barnacle shell was then treated by adding or not 0.2 M or 0.5 M DTT in a nitrogen atmosphere while gently agitating at 60 °C.

Isolation of mRNA and cDNA Synthesis-- Barnacles (M. rosa) of about 4 cm in diameter at the calcareous base were collected from Miyako Bay in Iwate prefecture, Japan. The whole soft tissue of the barnacle was homogenized, and total RNA was extracted with a total RNA separator kit (CLONTECH Laboratories). Poly(A)⁺ RNA was isolated by using Oligotex-dT30 (Takara Shuzo Co., Japan). cDNA was prepared from M. rosa mRNA with a Zap-cDNA synthesis kit (Stratagene) according to the instructions of the supplier.

Screening the cDNA Library-- The DNA probe for screening the cDNA library was generated by the polymerase chain reaction (PCR) with two primers designed from the partial amino acid sequence of one of the CB peptides, CB-8 (9) (Fig. 1). Primary PCR was performed in 100 µl of a reaction mixture containing 3 µg of each primer, 200 µM dNTPs, 1× Tth buffer, 4 units of Tth DNA polymerase (Toyobo, Japan), and 0.3 µg of the M. rosa cDNA. DNA amplification was carried out with 29 thermal cycles, each involving 95 °C for 1 min, 52 °C for 30 s, and 70 °C for 2 min. Secondary PCR was performed in the same manner, except that 10 µl of the amplified reaction mixture from primary PCR was used as the DNA template. Amplified DNA of the expected size (110 bp) was purified by electrophoresis on 3% NuSieve 3:1 Agarose gel (FMC Bio Products). The 110-bp DNA fragment was subcloned into the SmaI site of pUC19. The insert was sequenced with a Prism dye terminator cycle sequencing kit and 373A DNA sequencer (PE-Biosystems). The insert excised from the pUC19 clone by digestion with EcoRI and BamHI was ³²P-labeled by a random primer DNA labeling kit (Takara), apart from using an oligonucleotide primer (TACCTAGACCACGAACTGCCC) complementary to the 110-bp insert. This labeled probe was used for screening a -phage cDNA library of M. rosa (14). Ten positive clones were picked up, and the cDNA inserts were subcloned into pBluescript SK(II) according to the manufacturer's specification for the ExAssist system (Stratagene). The molecular sizes of the inserts were determined by agarose gel electrophoresis after being digested by the appropriate restriction enzymes. The cDNA clone containing the longest insert was sequenced as already described.

View larger version (21K): [in this window] [in a new window]   Fig. 1.   Oligonucleotide primers used for PCR amplification of the Mrcp-100k cDNA fragment, and nucleotide sequence of the amplified 110-bp DNA. The DNA sequences of the primers are denoted according to the IUPAC code, r = (A/G), Y = (C/T), K = (G/T), D = (A/G/T), and n = (A/C/G/T). Arrows indicate the sense and antisense primers. The N-terminal amino acid sequence of CB-8 (9) are shown for comparison, and the amplified region is underlined. 110-bp DNA was used for screening the M. rosa cDNA library.

Sequence Analysis by Computer-- A homology search analysis was made of the SwissProt and Protein Information Resource (PIR) data bases by using the FASTA or BLAST program. The secondary structure (15), isoelectric points (16), and hydropathic characteristics (17) were predicted by using GENETYX-MAC, version 7.0.1.

Northern Blot Hybridization-- The upper portion of the body, which contained the cirri, thorax, prosoma, and hemolymph, and the basal portion mainly comprising the mantle, muscle, ovariole, cement gland (18), and hemolymph were separated with a surgical knife and collected. Total RNA was prepared from each portion by using a total RNA separator kit (CLONTECH). 20 µg of total RNA was electrophoresed on 1% agarose gel, transferred to a Hybond N⁺ nylon membrane (Amersham Pharmacia Biotech), and hybridized with [-³²P]dCTP-labeled 110-bp DNA.

	RESULTS

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Constituents of the Barnacle Cement-- The proportions by weight of GSF1, GSF2, and GIF in the cement were 24%, 70%, and 6%, respectively. This indicates that more than 90% of the cement had been rendered soluble by this method. The SDS-PAGE analysis showed that GSF1 was composed of a protein with a molecular mass of ca. 68 kDa, which was named M. rosa cement protein-68k (Mrcp-68k), and some minor proteins (Fig. 2, lane 2). Proteins with molecular masses of 180 kDa, 40 kDa, and of a little less than 20 kDa were consistently detected as minor constituents. The N-terminal sequence and amino acid composition of Mrcp-68k agree with those of SF2-60k from our previous study (9), which contained high levels of Ser, Thr, Gly, and Ala. This previously designated protein was therefore renamed Mrcp-68k.

View larger version (73K): [in this window] [in a new window]   Fig. 2.   Major constituents in the M. rosa cement identified by SDS-PAGE. Lanes 2 and 3, GSF1 and GSF2 prepared from M. rosa cement, respectively. Lane 4, M. rosa cement proteins rendered soluble by heat denaturation in 4.2% 2-mercaptoethanol and 2% SDS after removing GSF1. Lane 1, high molecular mass standards (Bio-Rad). Numbers on the left side of lane 1 indicate molecular masses (kDa). The names of major proteins are indicated on the right side of lane 4. The samples were separated by SDS-PAGE (8% polyacrylamide gel including 6 M urea and a Tris-Gly buffer system). The gel was stained with Coomassie Blue R-250 after electrophoresis.

The SDS-PAGE analysis of the GSF2 fraction obtained after the treatments with 0.5 M DTT revealed that the fraction contained two major proteins of 100 and 52 kDa, in addition to Mrcp-68k, which was also found in GSF1. These proteins were named Mrcp-100k and Mrcp-52k, respectively (Fig. 2, lane 3). Mrcp-100k and Mrcp-52k were not rendered soluble by a 15 mM Tris-HCl buffer (pH 6.8) containing 4.2% 2-mercaptoethanol and 2% SDS with heat denaturation at 100 °C for 3 min (Fig. 2, lane 4). After the DTT treatment, these two proteins became soluble in a 0.1% acetic acid solution, but were insoluble in a neutral pH buffer without SDS. The addition of SDS to the blotting buffer was required for electrophoretic transfer of the two major proteins, Mrcp-100k and -52k, to the hydrophobic PVDF membrane.

In our previous work (9), the eight major CB peptides (CB-1 through CB-8) were derived from the formic acid-insoluble fraction (IF) of M. rosa cement by CNBr cleavage. An SDS-PAGE analysis of the CNBr-cleaved products of Mrcp-100k and -52k gave six (CB-2, -3, -5, -6, -7, and -8) and two CB peptides (CB-1 and -4), respectively (data not shown). The N-terminal amino acid sequence of Mrcp-100k was HRPSFERRXXGXLRSPVAADLDDDEIGM, where X is not determined, but it was most likely Cys. The amino acid composition of Mrcp-100k isolated by SDS-PAGE was determined as shown in Table I. No glycosylation was detected in Mrcp-100k.

The insoluble fraction after this DTT treatment was named GIF. Although it was a proteinaceous substance, a method for rendering GIF soluble without hydrolysis was not discovered in this study.

Effect of the Reduction Treatment on the Detachment of Barnacles from the Substratum-- The effect of the DTT treatment on barnacle detachment from the substratum was the same for both M. rosa and B. amphitrite. The barnacle shell became spontaneously detached from the substratum after a 1-h treatment by 0.5 M DTT, and became detached after a 1-day treatment by 0.2 M DTT, whereas the shell remained attached without any DTT treatment for 2 days.

Molecular Cloning of Mrcp-100k cDNA-- cDNA clones were isolated on the basis of the partial amino acid sequence of the CB peptides. According to the amino acid sequence of the CB-8 peptide fragment (9) in Mrcp-100k, two PCR primers were synthesized (Fig. 1), and PCR was performed by using M. rosa cDNA as the template. The amplified 110-bp-long DNA was subsequently cloned and sequenced. The predicted amino acid sequence of the 110-bp DNA fragment completely matched the corresponding amino acid sequence of the CB-8 peptide (Fig. 1). About 100,000 clones of an M. rosa cDNA library were screened by using ³²P-labeled 110-bp DNA as a probe, and more than 30 positive clones were obtained. DNA inserts from 10 randomly selected clones were subcloned into pBluescript SK() and were found to carry inserts of about 3.3 kbp. A restriction endonuclease analysis of these 10 clones indicated them to be identical (data not shown). A plasmid containing the largest cDNA fragment was selected for sequencing.

Structures of Mrcp-100k cDNA and the Encoding Polypeptide-- The DNA insert of the longest plasmid was 3299 bp long (Fig. 3) and encoded a polypeptide of 993 amino acids. The molecular mass and isoelectric point were deduced to be 113,639 daltons and 9.86, respectively. The first 18 amino acid residues were thought to be the signal peptide, because of its high hydrophobicity, and the N-terminal amino acid sequence of mature Mrcp-100k was thought to begin at the 19th residue. The 9th, 10th, and 12th amino acids of the mature N-terminal sequence of Mrcp-100k were confirmed to be Cys residues by the deduced sequence from the cDNA. When the putative signal peptide was omitted from the deduced amino acid sequence, a discrepancy in molecular mass between the estimated figure from SDS-PAGE (100 kDa) and the calculated one from the predicted sequence (112 kDa) was apparent. The amino acid sequence of mature Mrcp-100k deduced from the cDNA had 23 Met residues and was presumably cleaved into 24 fragments by the CNBr treatment. The predicted amino acid sequence of Mrcp-100k contained six of the eight CB peptides (CB-2, -3, -5, -6, -7, and -8). The only discrepancy between the amino acid sequences of the CB peptides and the predicted Mrcp-100k sequence was the second residue of CB-3: It was Thr in the CB-3 sequence, whereas Ile was predicted in the Mrcp-100k sequence. Mrcp-100k was confirmed to give the six CB peptides in the SDS-PAGE peptide map obtained by CNBr cleavage. The other smaller fragments of Mrcp-100k by CNBr cleavage, which could not be detected by SDS-PAGE, were thought to have migrated to the front of SDS-PAGE. Two peptide bands with slightly higher molecular masses than that of CB-1 on a gel of SDS-PAGE (9) were partial cleavage products of Mrcp-100k. The most abundant amino acid residue was Leu (111 residues of the 975 total residues; Table I), with Ser (84 of 975) and Ile (75 of 975) following. The content of Cys was calculated to be 1.4% of the total residues (14 of 975). The experimentally determined amino acid composition of Mrcp-100k agrees, in general, with that deduced from the cDNA sequence (Table I). No repetitive motif or sequence periodicity was suggested in the predicted amino acid sequence of Mrcp-100k. The hydropathic profile indicates a short alternating pattern of hydophobic and hydrophilic residues throughout Mrcp-100k. The arrangement of amino acid species in its primary structure was investigated by comparing the proportions of hydrophobic, neutral, and hydrophilic amino acids in 10 segments of the Mrcp-100k sequence (r1-r10; Fig. 4A). The isoelectric points were also calculated in the 10 segments (Fig. 4B). Although the proportions of the hydrophobic, neutral, and hydrophilic amino acids were almost the same in all the regions of Mrcp-100k, a gradient in the isoelectric points from the N-terminal region, r1, to the C-terminal region, r10, was apparent. Prediction of the secondary structure (15) suggested that 87% of the total sequence formed a -sheet structure. No similar sequence has so far been found by a computer-aided homology search of the SwissProt and PIR data bases.

View larger version (70K): [in this window] [in a new window]   Fig. 3.   Nucleotide sequence of Mrcp-100k cDNA and the predicted amino acid sequence of Mrcp-100k. The nucleotides are numbered on the right side of the sequence, the termination codon is indicated by an asterisk, and the Met residues are boxed. Underlined are the partial amino acid sequences of the CB peptides (CB-2, -3, -5, -6, -7 and -8) that were determined by a protein sequence analysis (9). The N-terminal sequence of mature Mrcp-100k is shown by a dotted underline.

View larger version (39K): [in this window] [in a new window]   Fig. 4.   Comparison of the fragments divided into 10 segments (r1 to r10) from the whole Mrcp-100k sequence. A, proportions of hydrophobic, neutral, and hydrophilic amino acids. B, transition of the predicted isoelectric point for each region.

RNA Blot Analysis-- The RNA blot analysis was performed by using total RNA, which had been prepared from the upper or basal portion of the body of adult M. rosa, to confirm the site of the Mrcp-100k gene expression. The transcript of the Mrcp-100k gene was only detected in the basal portion where the cement glands are located (Fig. 5).

View larger version (91K): [in this window] [in a new window]   Fig. 5.   Site specificity of Mrcp-100k gene expression in the basal portion of the adult barnacle where the histologically distinct cement gland is localized. 20 µg of total RNA extracted from the basal or upper portion of the adult barnacle was electrophoresed in a formaldehyde gel, transferred to a nylon membrane, and hybridized with a 110-bp DNA probe. The basal portion mainly comprises the mantle, muscle, ovariole, cement gland (18), and hemolymph, whereas the upper portion contained the cirri, thorax, prosoma, and hemolymph.

	DISCUSSION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

We have previously shown (9) that, although proteins like SF2-60k (renamed Mrcp-68k in this study) and those smaller than 20 kDa, could be rendered soluble in an aqueous formic acid solution by reduction with tri-n-butylphosphine, a half portion (47%) of the cement proteins (IF) remained insoluble. In this study, we successfully rendered more than 90% of M. rosa cement soluble by reducing with 0.5 M DTT in a GdnHCl solution. Peptide mapping by CNBr cleavage indicated that IF was mainly composed of Mrcp-100k and -52k. Thus, more than 90% of M. rosa cement was composed of the three major proteins, Mrcp-100k, Mrcp-68k, and Mrcp-52k, and some minor proteins. The similarity between Mrcp-100k and -52k is noteworthy, i.e. their behavior in rendering the cement soluble, contents in the cement, and electroblotting characteristics. Mrcp-68k was different in these respects from Mrcp-100k and -52k in that it could easily be rendered soluble by conventional reduction with 2-mercaptoethanol in SDS containing a buffer (pH 6.8). The amino acid composition of Mrcp-68k was rich in Ser, Thr, Gly, and Ala, and considerably different from the composition of Mrcp-100k. Barnacle underwater adhesion thus seems to be cooperatively achieved by a complex of distinct proteins.

Naldrett et al. (10) have reported that B. eburneus cement could be rendered partially soluble by a reductive treatment in 2.5% 2-mercaptoethanol and 2% SDS. The 58-kDa protein in B. eburneus cement resembles Mrcp-68k in its amino acid composition and molecular mass (9, 10) (Table I). Although nothing resembling Mrcp-100k and -52k has been reported in B. eburneus cement, the sequence of a short peptide fragment (WCD-11), which had been derived from whole B. eburneus cement (10) by the CNBr cleavage, indicates good homology with part of the Mrcp-100k sequence (Fig. 6). B. eburneus cement thus appears to have similar constituents to those of M. rosa cement.

View larger version (9K): [in this window] [in a new window]   Fig. 6.   Alignment between Mrcp-100k and WCD11, the latter being the peptide fragment generated by the CNBr treatment of crude B. eburneus cement (10). Identical amino acids are indicated with vertical lines, and conserved replacements are indicated by double dots. The residue before the first amino acid of WCD11, Leu, is likely to be Met, because WCD11 was prepared by the CNBr treatment.

Although Mrcp-100k and -52k were both rendered soluble by reduction with 0.5 M DTT in a GdnHCl solution at pH 8.5, they were not by reduction with 4.2% 2-mercaptoethanol in 2% SDS at pH 6.8, nor by reduction with tri-n-butylphosphine (9). With the latter treatment, tri-n-butylphosphine has poor solubility in an aqueous solution, so reduction might be insufficient. Reduction with 2.5% 2-mercaptoethanol in the presence of 2% SDS at pH 8.45 was also inadequate to render soluble the corresponding proteins in B. eburneus cement (10). The reliability of the DTT treatment was also confirmed by the detachment test on M. rosa and B. amphitrite from substrata. DTT has been shown to be at least 1000 times more effective than 2-mercaptoethanol for cleaving disulfide bonds (19). This indicates that disulfide bonds would have contributed to the stability of the protein complex in the barnacle cement. The low Cys content of Mrcp-100k seems to be incompatible with the extensive requirement of a reductant to give solubility. However, Mrcp-100k was composed of abundant hydrophobic residues, and a small number of disulfide bonds in Mrcp-100k may be hidden by the hydrophobic barrier, providing a possible explanation for the requirement of a high concentration of DTT and GdnHCl. It is not known whether the disulfide bonds of the cement proteins are intermolecular or intramolecular.

A discrepancy in the molecular mass estimation for Mrcp-100k was apparent when comparing the mass calculated from the predicted sequence with the apparent mass determined by SDS-PAGE. The addition of SDS to the blotting buffer was required for the electrophoretic transfer of Mrcp-100k and -52k to the PVDF membrane. This observation is consistent with the high content of hydrophobic residues in the protein. The high hydrophobicity of the polypeptide may have contributed to the anomalous mobility by SDS-PAGE. Post-translational processing of the C-terminal region is another possible explanation. Although the N-terminal sequences of Mrcp-100k and of the CB peptides agree with those of the predicted sequence, determinations at the C-terminal end and of the exact mass by matrix-assisted laser desorption ionization-time of flight (MALDI-TOF) mass spectrometry were unsuccessful. Although the experimentally determined amino acid composition of Mrcp-100k was generally in agreement with that deduced from the cDNA sequence, complete agreement was not apparent. This may suggest post-translational processing of Mrcp-100k. The cause of this discrepancy in the molecular mass estimation for Mrcp-100k was not found in this study.

This is the first report on the complete primary structure of barnacle underwater adhesive protein. No protein similar to Mrcp-100k has been found in sequence data bases, suggesting that the function of Mrcp-100k is unique and it has not previously been reported. Specific characteristics are generally believed to be required for underwater adhesion, i.e. coagulation, displacement of water from the substratum, and establishment of interfacial contact and molecular attraction between unlike materials (4, 5). Although the role of Mrcp-100k in underwater adhesion is not clear, its insoluble behavior is noteworthy. The results of this work lead us to believe that Mrcp-100k and -52k are essential for stabilizing the cement complex in seawater. The hydropathic profile of Mrcp-100k indicates a pattern of short alternating hydrophobic and hydrophilic residues throughout the whole region. The proteins involved in the formation of insoluble amyloid plaque have recently been characterized (20), and the pattern of alternating polar and nonpolar residues in a "cross- " sheet structure was found to be essential to form insoluble fibrils. The -sheet structure was also predicted to be rich in Mrcp-100k. Thus, the molecular mechanisms for forming an insoluble proteinaceous multimer may be similar between amyloid plaque and barnacle cement. Although a similar distribution of hydrophobic, neutral, and hydrophilic amino acids was found in each region of Mrcp-100k (Fig. 4A), the predicted isoelectric points indicate a gradient from the N-terminal region (r1) to the C-terminal region (r10) (Fig. 4B). The adhesive protein of the mussel, foot protein-2 (fp-2), has been pointed out to contain clusters of amino acids with acidic charges in the N- and C-terminal regions. It has been speculated that these clusters of acidic charges play a role in initiating the assembly of these proteins in seawater by reducing the basic charges in the central region of fp-2 (7). In Mrcp-100k, the gradient of charge distribution from the N to C termini may play a similar role in the initial assembly of the proteins by reducing the charge at the site for attachment and may provide the mechanism for assemble with other cement components in seawater.

Some researchers (1, 2, 18, 21) have reported a histologically distinct cement organ and cement duct in the basal portion, near the ovariole, of the adult barnacle. The Northern blot analysis indicates that the Mrcp-100k gene was probably expressed by the histologically distinct cement gland in the basal portion of the barnacle. The cement would be transported through the duct and then secreted into the space between the calcareous base and the substratum.

	ACKNOWLEDGEMENTS

We thank F. Sasaki, S. Dobashi, I. Hiramatsu, S. Komukai, D. Miki, S. Ohdo, and S. Kanai for their technical assistance and advice, and S. Miyachi for encouragement. Special thanks are given to J. H. Waite for his critical reading of this manuscript.

	FOOTNOTES

^* This work was performed as part of the Industrial Science and Technology Frontier Program supported by the New Energy and Industrial Technology Development Organization.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

The nucleotide sequence(s) reported in this paper has been submitted to the GenBank^TM/EMBL Data Bank with accession number(s) AB033942.

^§ To whom correspondence should be addressed: Tel.: 81-543-66-9215; Fax: 81-543-66-9256; E-mail: keikamino@shimizu.mbio.co.jp.

Present address: Ocean Research Institute, The University of Tokyo, 1-15-1 Minamidai, Nakano-ku, Tokyo 164-8639, Japan.

Published, JBC Papers in Press, June 5, 2000, DOI 10.1074/jbc.M910363199

	ABBREVIATIONS

The abbreviations used are: SF1, SF2 and IF, Megabalanus rosa cement fractions separated by their solubility in aqueous formic acid; GdnHCl, guanidine hydrochloride; GSF1, GSF2 and GIF, Megabalanus rosa cement fractions separated by their solubility in a GdnHCl solution; DTT, dithiothreitol; PAGE, polyacrylamide gel electrophoresis; CB peptides, eight major peptide fragments generated by the CNBr treatment of IF, named CB-1 through CB-8; PCR, polymerase chain reaction; Mrcp, Megabalanus rosa cement protein; HRP, horseradish peroxidase; bp, base pair(s); PVDF, polyvinylidene difluoride.

	REFERENCES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

CiteULike

Complore

Connotea

Del.icio.us

Digg

Reddit

Technorati

This article has been cited by other articles:

				I. Y. Phang, N. Aldred, X. Y. Ling, J. Huskens, A. S. Clare, and G. J. Vancso Atomic force microscopy of the morphology and mechanical behaviour of barnacle cyprid footprint proteins at the nanoscale J R Soc Interface, July 1, 2009; (2009) rsif.2009.0127v1. [Abstract] [Full Text] [PDF]

				D. S. Hwang, H. J. Yoo, J. H. Jun, W. K. Moon, and H. J. Cha Expression of Functional Recombinant Mussel Adhesive Protein Mgfp-5 in Escherichia coli Appl. Envir. Microbiol., June 1, 2004; 70(6): 3352 - 3359. [Abstract] [Full Text] [PDF]

				P. Flammang, J. Ribesse, and M. Jangoux Biomechanics of Adhesion in Sea Cucumber Cuvierian Tubules (Echinodermata, Holothuroidea) Integr. Comp. Biol., December 1, 2002; 42(6): 1107 - 1115. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) All Versions of this Article: 275/35/27360    most recent M910363199v1 Submit a Letter to Editor Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Kamino, K. Articles by Shizuri, Y. Search for Related Content PubMed PubMed Citation Articles by Kamino, K. Articles by Shizuri, Y. Social Bookmarking                      What's this?