HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

J. Biol. Chem., Vol. 275, Issue 36, 27566-27575, September 8, 2000

This Article Abstract Full Text (PDF) All Versions of this Article: 275/36/27566    most recent M001015200v1 Submit a Letter to Editor Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by McMahon, B. Articles by Godson, C. Search for Related Content PubMed PubMed Citation Articles by McMahon, B. Articles by Godson, C. Social Bookmarking                      What's this?

Lipoxin A₄ Antagonizes the Mitogenic Effects of Leukotriene D₄ in Human Renal Mesangial Cells

DIFFERENTIAL ACTIVATION OF MAP KINASES THROUGH DISTINCT RECEPTORS^*

Blaithin McMahon, Catherine Stenson, Fiona McPhillips, Aine Fanning^§, Hugh R. Brady, and Catherine Godson^¶

From the Centre for Molecular Inflammation and Vascular Research, Department of Medicine and Therapeutics, Mater Misericordiae Hospital and the Conway Institute of Biomolecular and Biomedical Research, University College Dublin, 41 Eccles St., Dublin 7, Ireland

Received for publication, February 8, 2000, and in revised form, June 5, 2000

	ABSTRACT

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

The lipoxygenase-derived eicosanoids leukotrienes and lipoxins are well defined regulators of hemeodynamics and leukocyte recruitment in inflammatory conditions. Here, we describe a novel bioaction of lipoxin A₄ (LXA₄), namely inhibition of leukotriene D₄ (LTD₄)-induced human renal mesangial cell proliferation, and investigate the signal transduction mechanisms involved. LXA₄ blocked LTD₄-stimulated phosphatidylinositol 3-kinase (PI 3-kinase) activity in parallel to inhibition of LTD₄-induced mesangial cell proliferation. Screening of a human mesangial cell cDNA library revealed expression of the recently described cys-leukotriene₁/LTD₄ receptor. LTD₄-induced mesangial cell proliferation required both extracellular-related signal regulated kinase (erk) and PI 3-kinase activation and may involve platelet-derived growth factor receptor transactivation. LTD₄-stimulated the MAP kinases erk and p38 via a pertussis toxin (PTX)-sensitive pathway dependent on PI 3-kinase and protein kinase C activation. On screening a cDNA library, mesangial cells were found to express the previously described LXA₄ receptor. In contrast to LTD₄, LXA₄ showed differential activation of erk and p38. LXA₄ activation of erk was insensitive to PTX and PI 3-kinase inhibition, whereas LXA₄ activation of p38 was sensitive to PTX and could be blocked by the LTD₄ receptor antagonist SKF 104353. These data suggest that LXA₄ stimulation of the MAP kinase superfamily involves two distinct receptors: one shared with LTD₄ and coupled to a PTX-sensitive G protein (G_i) and a second coupled via an alternative G protein, such as G_q or G₁₂, to erk activation. These data expand on the spectrum of LXA₄ bioactions within an inflammatory milieu.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

Lipoxygenase products of arachidonic acid exert pleiotropic effects in biological systems. Leukotrienes derived from the 5-lipoxygenase pathway are significant regulators of leukocyte trafficking, vascular permeability, smooth muscle tone, and cell growth (reviewed in Ref. 1). Lipoxins (an acronym of lipoxygenase interaction products) are generated by the sequential action of 5 and 12 or 15 and 5 lipoxygenases, depending on the cellular context (2, 3). Lipoxins (LX) modulate neutrophil trafficking across endothelia and epithelia (reviewed in Refs. 2 and 4) and promote nonphlogistic phagocytosis of apoptotic neutrophils by macrophages (5). Therefore, in the context of effects on neutrophil trafficking, LXs act as endogenous "braking signals" in the inflammatory process (2, 4, 5). LXA₄¹ and LTD₄ have previously been shown to exert counter-regulatory roles on renal mesangial cell function (6-10). Mesangial cells are modified smooth muscle cells playing a pivotal role in renal physiology by regulating circulation and glomerular structural integrity. LTD₄ has been implicated in the development of glomerulonephritis triggering mesangial cell contraction, reduced glomerular capillary area, a fall in renal blood flow, a fall in glomerular filtration rate (11-15), and mesangial cell proliferation (16). In contrast to this essentially proinflammatory scenario, LXs inhibit neutrophil recruitment to inflamed renal glomeruli in models of acute glomerulonephritis and attenuate LTD₄-induced smooth muscle and mesangial cell contractility (7, 8, 17, 18). Furthermore, LXA₄ modulates LTD₄-induced decreases in glomerular filtration rate (6).

Controversy exists as whether these agents act at distinct receptors in target cells (6, 9, 10) or whether LXA₄ antagonizes the cellular and in vivo actions of LTD₄ by competing for a common receptor (6). [³H]LTD₄ binding to mesangial cells can be competitively displaced by LXA₄, and LXA₄ can attenuate LTD₄-induced increases in IP₃ generation, suggesting partial agonism (6). In neutrophils, monocytes, and intestinal epithelia, cDNA cloning and expression studies indicate that the LXA₄ receptor is a member of the chemokine receptor superfamily (19-22), distinct from the leukotriene B₄ receptor (23) and with a high degree of homology to the formylmethionylleucylphenylalanine-like receptor (19). The myeloid LXA₄ receptor is coupled to phospholipaseA₂ and phospholipase D activation through pertussis toxin-sensitive G proteins (19, 20). LTD₄ receptor activation may be coupled to both pertussis toxin-sensitive and pertussis toxin-insensitive G proteins dependent on cell type and differentiation (24). LTD₄ activation causes a rise in intracellular calcium from both intracellular and extracellular stores (25-28). A human cysteinyl leukotriene receptor (cysLT₁/LTD₄) has recently been cloned (29). This receptor binds LTD₄ with high affinity (K_d = 0.3 nM) and is functionally coupled to calcium mobilization upon stimulation with LTC₄ and LTD₄ (29). In monocytes, LTD₄ stimulation is associated with PKC- translocation and subsequent activation of Raf-1 (30). Relatively little is known of the cellular signaling pathways elicited by either LTD₄ or LXA₄ in mesangial cells. MAP kinases are a family of serine-threonine kinases activated by a cascade of protein-protein interactions. Activation of MAP kinases is critical to several aspects of mesangial cell function, such as proliferation, cell adhesion, and gene expression (31). MAP kinase activation subsequent to receptor stimulation has been extensively demonstrated. Tyrosine phosphorylation of growth factor receptors leads to a series of kinase reactions culminating in phosphorylation and activation of MAP kinase (reviewed in Ref. 32). More recently, it has become appreciated that receptors coupled to heterotrimeric G proteins can stimulate MAPK activation (reviewed in Ref. 33). Based on the sequence specificity of the MAPK tripeptide phosphorylation motif, three families have been identified: extracellular-related signal regulated kinases (erks); p38, a homologue of yeast HOG-1; and c-Jun N-terminal kinases. MAPKs are activated by a family of dual specificity kinases (MAPK kinase or MAPK/erk kinase) subsequent to MAPK/erk kinase kinase activation. Several molecules linking ligand binding to G protein-coupled receptors (GPCRs) to MAP kinase activation have been identified; among these is phosphoinositide 3-kinase (PI 3-kinase) (34, 35). Activation of the PI 3-kinase family of lipid kinases regulates multiple cell functions, including proliferation.

Here, we present data on proliferative responses to both LTD₄ and LXA₄ in mesangial cells and on activation of members of the MAP kinase superfamily (erk and p38 kinases). These data indicate that LTD₄-induced proliferation can be blocked by LXA₄ and requires both erk and PI 3-kinase activation. LXA₄ blocked LTD₄-induced PI 3-kinase activity in parallel to inhibitory effects on mesangial cell proliferation. LXA₄ may cause differential activation of MAP kinases by binding to both a common LTD₄ receptor and a specific LXA₄ receptor through which inhibition of proliferation is effected. Furthermore, we demonstrate LTD₄ activation of MAP kinases in mesangial cells by a PTX-sensitive pathway involving activation of PI 3-kinase and PKC. A mesangial cell cDNA library has been screened, and we have established expression of the myeloid LXA₄ receptor (19-21) and cysLT₁/LTD₄ receptor (29).

	MATERIALS AND METHODS

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

LTD₄ and LXA₄ were purchased from Cascade Biochemicals (Reading, Berks, United Kingdom). An SV40-transformed human mesangial cell line (36, 37) was provided by Prof. J. D. Sraer (Hopital Tenon, Paris, France). Human recombinant PDGF-BB and rabbit anti-PI 3-kinase p85 antibody were obtained from Upstate Biotechnology Inc. (Lake Placid, NY). AG 1478 was purchased from Biomol (Exeter, United Kingdom). The anti-phospho-p38 MAPK antibody and anti-phospho-MAPK antibody were obtained from New England Biolabs (Beverly, MA). Pertussis toxin was obtained from List Biologicals (Campbell, CA). Pan-ras antibody was purchased from Oncogene Research Products (Cambridge, MA). SKF 104353 was a gift from Smithkline Beecham (King of Prussia, PA). GF 109203X and AG 1296 were obtained from Calbiochem (Nottingham, United Kingdom). LXA₄ receptor antisera was a generous gift from Dr. Charles Serhan (Harvard Medical School, Boston, MA). ATF₂-GST fusion protein was provided by Dr. Roger Davis (University of Massachusetts, Worcester, MA). PGEX-KG-Raf-RBD-GST fusion protein was obtained from Prof. Luke O'Neill (Trinity College, Dublin, Ireland). Transfer membranes were from Millipore (Bedford, MA). Silica gel TLC plates were obtained from Merck (Darmstadt, Germany). Cell Titer ⁹⁶Aqueous nonradioactive proliferative assay and protein kinase C assay kits were purchased from Promega (Madison, WI). The SMART ^TM PCR cDNA library construction kit was obtained from CLONTECH (Palo Alto, CA). Oligonucleotides used in PCR were synthesized by Genosys (Pampisford, Cambs, United Kingdom). All other reagents were purchased from Sigma (Pode, Dorset, United Kingdom).

Human Mesangial Cell Culture-- SV40-transformed human mesangial cells were cultured in RPMI 1640 medium supplemented with 5% fetal calf serum (FCS), penicillin (100 units/ml), and streptomycin (100 µg/ml). These cells retain the phenotypic characteristics of mesangial cells, including stellate morphology, typical -actinin expression, and production of extracellular matrix proteins and are negative for cytokeratin and endothelial markers (36, 37). Cells were grown in six-well plates for determination of MAP kinase activity. Before being treated with the indicated agents, cells were cultured in serum-free medium or media containing 0.5% FCS (24-48 h) as indicated.

Cell Proliferation Assay-- Mesangial cells were plated on 96-well plates (500 cells/well) and cultured in 5.0% FCS for 24 h. Prior to the experiments, cells were incubated for 48 h in serum-free culture medium. Incubation was continued for another 48 h with the indicated agents as detailed in the figure legends. Proliferation of mesangial cells was measured by determination of the number of viable cells using an assay in which a tetrazolium salt is reduced by viable cells to aqueous soluble formazan (Promega) and A_450 nm is determined (38). The quantity of formazan product as measured by A_450 nm was directly proportional to the number of living cells.

cDNA Library Construction and Receptor Cloning-- A mesangial cell cDNA library was constructed using 2 µg of total RNA from mesangial cells as a template for SMART PCR cDNA library construction (CLONTECH). The library was used as template in an amplification reaction with oligonucleotides based on the myeloid LXA₄ receptor. The resulting PCR product was further analyzed by Southern blotting and showed hybridization with a [³²P]dCTP-labeled internal probe based on the myeloid receptor (data not shown). The library was also used as template in PCRs with oligonucleotides based on the cysLT₁/LTD₄ receptor (29). An initial product obtained using sequences spanning the open reading frame was further amplified with internal oligonucleotides. In both cases, the resulting products were subcloned into PCR2.1 (Invitrogen, San Diego, CA) and partially sequenced using the ABI 310 automated sequencer (Perkin-Elmer). Total RNA was extracted from human renal mesangial cells cultivated in 0.5% FCS for 48 h using Trizol reagent (Life Technologies, Inc.). cDNA was produced by reverse transcription. Oligonucleotide sense and antisense primers were constructed from published sequences of myeloid LXA₄ receptor (19), cysLT₁ receptor (29), and glyceraldehyde-3-phosphate dehydrogenase and contained the following sequences: LXA₄ receptor, TTCCGGATGACACGCACAGTC (sense) and CCAATTGGTCCTACAGTTA (antisense); LTD₄ receptor, TGCATTGCAATTGTTTTTCC (sense) and AATTGGATGCAGCCAGAGAC (antisense); glyceraldehyde-3-phosphate dehydrogenase, ACCACAGTCCATGCCATC (sense) and TCCACCACCCTGTTGCTG (antisense). A hot start cycle of 72 °C (5 min), 4 °C (5 min), and 94 °C (5 min) preceding addition of Taq polymerase was included in which the library was template. Amplification protocols for LXA₄ receptor consisted of 35 repetitive cycles of denaturing at 94 °C (1 min), annealing at 61 °C (1 min), and extension at 72 °C (1 min 20 s). LTD₄ receptor was amplified by 35 repetitive cycles of denaturing at 94 °C (1 min), annealing at 60 °C (1 min), and extension at 72 °C (1 min 20 s). Primers for glyceraldehyde-3-phosphate dehydrogenase were used as internal controls, as described. Amplification protocols for glyceraldehyde-3-phosphate dehydrogenase consisted of 35 repetitive cycles of denaturing at 94 °C (30 s), 64 °C (1 min), and 72 °C (1 min). Amplified cDNA was separated by agarose gel (1.1%) electrophoresis and visualized with ethidium bromide.

Western Blot Analyses of Phosphorylated MAP kinases-- Subconfluent cell cultures were rendered quiescent by serum restriction in 0.5% FCS RPMI 1640 medium for 24-48 h. After this period, cells were stimulated with various agents for indicated times as detailed in the legends to Figs. 3-8. After washing cells once with ice cold phosphate-buffered saline, lysates were harvested in ice cold hypotonic lysis buffer containing 50 mM Tris, pH 7.5, 150 mM-NaCl, 5% Triton X-100, and protease inhibitors (2 mM phenylmethylsulfonyl fluoride, 1 mg/ml leupeptin, 20 mM -glycerophosphate, 0.5 mM dithiothreitol, and 1 µM sodium orthophosphate). The lysates were centrifuged and supernatants processed for immunoblotting as described previously (39). Protein was assayed in appropriately diluted samples by the method of Bradford. The cell lysates (40 µg of protein/well) were resolved on a 10% SDS-polyacrylamide gel before blotting onto polyvinylidene difluoride membranes. Equal loading and transfer of proteins was verified by staining a portion of the membranes with Coomassie Brilliant Blue. Nonspecific sites on the membranes were blocked by incubation in 5% (w/v) nonfat milk TBS. The blots were incubated with primary antibody. Antisera specific for phosphorylated p38 MAPK (Tyr-182) or phosphorylated erk (Thr-202/Tyr-204) were diluted 1:1000 in blocking buffer containing 0.1% Tween-20. After overnight incubation at 4 °C, blots were washed with TBS with 0.1% Tween-20 and incubated with an appropriate alkaline phosphatase-conjugated secondary antibody. Specific antibody binding was measured with a colorimetric substrate (4-nitroblue tetrazolium chloride and 5-bromo-4-chloro-3-indolyl-phospate). Data were quantitated using the Gelworks and Grabit programs (Ultra-Violet Products).

Erk Activity Assay-- Erk activity was measured using myelin basic protein as substrate (40). Cells were treated with various agents as indicated and phospho-erk immunoprecipitated from 50 µg of cell lysate. Kinase activity was determined in 20 mM HEPES, 20 mM MgCl₂, 20 mM -glycerophosphate, 100 µM Na₃VO₄, 2 mM dithiothreitol, 20 µM ATP, pH 7.7, containing 2.5 µCi of [-³²P]ATP/tube (3000Ci/mmol) and 4 µg of myelin basic protein. The phosphorylation reaction proceeded for 20 min at 30 °C and was terminated by adding denaturing sample buffer and boiling the samples. Lysates were resolved by SDS-polyacrylamide gel electrophoresis, and phosphorylated substrate was detected by autoradiography.

SAPk Assay-- SAPk activity was measured using a solid phase assay with recombinant ATF₂-GST fusion protein as substrate (41). Lysates were prepared from cells treated as indicated, and cell lysates were incubated with ATF₂-GST-conjugated agarose beads.

Protein Kinase C Activity Assay-- PKC activity was measured in immunoprecipitates from serum-starved mesangial cells treated with LTD₄ (1 nM), LXA₄ (1 nM), vehicle, or phorbol 12-myristate 13-acetate (100 nM, positive control) using the Promega peptide phosphorylation kit according to the manufacturer's instructions.

Phosphatidylinositol 3-Kinase Activity Assay-- PI 3-kinase activity was detected by measuring the level of [-³²P]ATP phosphorylation of a phosphoinositides by the immunoprecipitated kinase (42). Mesangial cells were cultivated in 100-mm dishes as described above prior to stimulation with various agents for 50 s. Cells were harvested in lysis buffer (10 mM HEPES, 400 mM KCl, 1 mM EDTA, 0.5 mM dithiothreitol, 10% glycerol, 1 mM benzamide, 1 mM phenylmethylsulfonyl fluoride, 1 mM -glycerophosphate at 4 °C for 30 min.). Insoluble material was removed by centrifugation at 4 °C for 10 min at 10,000 × g. 100 µg of protein/sample was incubated with 1 µl of anti-PI 3-kinase p85 antibody or preimmune serum overnight at 4 °C. Protein A-Sepharose beads (Sigma) were added, and incubation continued for an additional 2 h. Immunoprecipitated PI 3-kinase activity was measured using dispersed phosphoinositide as substrate (final concentration, 0.2 mg ml¹). Identity of products was confirmed by comparison with authentic phospholipid standards. PI 3-kinase activity was defined as LY 294002-sensitive lipid kinase activity. Products were quantified by phosphorimage analysis (Bio-Rad).

Ras Activation Assay-- Ras activation was measured using a Raf-1-GST fusion protein that binds GTP-bound, i.e. active, Ras as described previously (43). In brief, pGEX-KG-Raf-RBD-GST expression was induced with isopropyl-1-thio--D-galactopyranoside, and the fusion protein was isolated from glutathione-Sepharose beads. Mesangial cells were serum deprived for 48 h prior to incubation with indicated ligands. Cell lysates were prepared in 50 mM HEPES, pH 7.4, 10 mM NaF, 75 mM NaCl, 1% Nonidet P-40, 1 mM phenylmethylsulfonyl fluoride, 1 mM Na₂VO_3. Equal quantities of lysate protein (as determined by Bradford assay) were incubated with GST-Raf-RBD-coupled glutathione-agarose beads. Bound protein was dissociated by heating the samples to 95 °C. Activated Ras was detected by immunoblotting the denatured, dissociated protein using a pan-Ras antibody (1: 25 dilution). Bound primary antibody was detected using enhanced chemiluminescence.

	RESULTS

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

LTD₄-stimulated Proliferation of Mesangial Cells Is Inhibited by LXA₄-- LTD₄ stimulated proliferation of renal mesangial cells. This response was dose-dependent, with a maximal effect seen at 1 × 10⁸ M and an EC₅₀ of approximately 1 × 10⁹ M. In contrast, LXA₄ (1 × 10¹² to 1 × 10⁶ M) had no significant effect on mesangial cell proliferation. However, the mitogenic effect of LTD₄ (1 × 10⁹ M) was negated by coincubation of the cells with equimolar LXA₄ (Fig. 1). The effects of LXA₄ were apparent at 24 h and maximal at 48 h. The mitogenic effect of LTD₄ was not mimicked by its precursor LTC₄ (data not shown). The involvement of the previously described myeloid LXA₄ receptor in the antiproliferative effect of LXA₄ on LTD₄-stimulated cells was suggested by our observation that neutralizing antisera (20, 44) to the LXA₄ receptor blocked the antiproliferative effect of LXA₄ (Fig. 1).

View larger version (18K): [in this window] [in a new window]   Fig. 1.   LXA4 antagonizes LTD4-stimulated mesangial cell proliferation. Subconfluent cultures of transformed human mesangial cells were serum-starved for 48 h before being stimulated with LXA4 (1 nM), LTD4 (1 nM), PDGF- (10 ng/ml), vehicle, or combinations as indicated for 48 h before determining the number of viable cells by formazan reduction. The effects of LXA4 receptor blocking antisera were investigated by pretreating the cells for 60 min with antisera (1:500) or control sera (1:500 FCS) before the addition of the indicated agents. Results are expressed as fold/basal (vehicle-treated) cell proliferation. Data are mean ± S.E. of four independent experiments performed in duplicate. *, p < 0.05, **, p < 0.005, relative to vehicle-treated cells. Inset shows concentration dependence of LTD4-stimulated proliferation.

Human Mesangial Cells Express Myeloid LXA₄ Receptor and cysLT₁/LTD₄ Receptor-- The generation of a mesangial cell cDNA library afforded the opportunity to screen for the previously described LXA₄ (19) and cysLT₁/LTD₄ receptors (29). To this end, a PCR strategy was adopted that allowed amplification of two independent cDNA fragments that were subcloned and partially sequenced. Subsequent sequence analysis verified the cloning of the corresponding receptors in the mesangial cell exhibiting complete identity at the nucleic acid level (Fig. 2). We have also used reverse transcription-PCR to analyze expression of the receptors in the transformed human mesangial cell line used in the studies described here. Using primers identical to those used to screen the cDNA libraries, we found expression of both receptor subtypes (data not shown) (details of primer sequences are provided above).

View larger version (50K): [in this window] [in a new window]   Fig. 2.   Human renal mesangial cells express LXA4 and cysLT1/LTD4 GPCRs. Nucleic acid comparison of mesangial cell LXA4 receptor and myeloid LXA4 receptor (a) and mesangial cell LTD4 receptor cysLT1/LTD4 receptor (b). Asterisks indicate nucleotides identical in both sequences. The alignment was carried out using the Dialign 2 program (64) following extraction of the myeloid LXA4 and cysLT1/LTD4 receptors from the GenBankTM data base sequences.

LXA₄ and LTD₄ Activate erk through Different Mechanisms-- Activation of p42-p44 erk was determined by immunoblotting with phospho-erk-specific antibodies. Treatment of mesangial cells with LXA₄ (10 nM) activated erk. This was detectable after 2 min, maximal at 15 min, and sustained at 30 min (Fig. 3a). In lysates from LTD₄ (10 nM)-stimulated cells, phospho-erk was detectable by 5 min, maximal at 10-15 min, and approximated basal by 30 min (Fig. 3c). In vitro phosphorylation of myelin basic protein was used to assay erk activity in lysates from cells stimulated with either eicosanoid (Fig. 3, b and d). These data corroborated the kinetics of erk activation seen with phosphospecific antibodies (Fig. 3, a and c). The dose dependence of erk activation in response to LXA₄ and LTD₄ was determined upon 15 min of stimulation with the indicated concentrations (Fig. 4). Densitometric analyses of immunoblots probed with phospho-erk-specific antibodies indicated a maximal effect of LXA₄ at 1 nM (Fig. 4a) and of LTD₄ at 10 nM (Fig. 4b).

View larger version (19K): [in this window] [in a new window]   Fig. 3.   Kinetics of LXA4- and LTD4-stimulated erk phosphorylation and activation. Transformed human mesangial cells were treated with LXA4 (10 nM), LTD4 (10 nM), or vehicle (0.1% ethanol) for the indicated times. Cell lysates were prepared and immunoblotted with phospho-erk-specific antibodies or assayed for erk activity by measuring myelin basic protein (MBP) phosphorylation. A, phospho-erk detected in lysates from LXA4-treated cells; B, erk activity in lysates from LXA4-treated cells; C, phospho-erk detected in lysates from LTD4-treated cells; D, erk activity in lysates from LTD4-treated cells. Insets show densitometric analysis of immunoblot results. Data are mean ± S.E. of three independent experiments. *, p < 0.05; **, p < 0.005.

View larger version (24K): [in this window] [in a new window]   Fig. 4.   Dose dependence of LXA4- and LTD4-stimulated erk phosphorylation. Transformed human mesangial cells were treated with the indicated concentrations of LXA4, LTD4, or vehicle (0.1% ethanol) for 15 min. Cell lysates were prepared and immunoblotted with phospho-erk-specific antibodies. A, phospho-erk detected in lysates from LXA4-treated cells; B, phospho-erk detected in lysates from LTD4-treated cells. Data are mean ± S.D. of two independent experiments.

In order to investigate the G proteins through which the mesangial cell LTD₄ and LXA₄ receptors couple, we used pertussis toxin labeling to ADP-ribosylate G_i/o containing heterotrimeric G proteins and thereby inhibited dissociation of functional  and subunits. In cells pretreated with PTX (100 ng/ml; 18 h), LTD₄-induced erk phosphorylation was abolished. In contrast, erk phosphorylation in response to LXA₄ persisted in PTX-treated cells (Fig. 5a). We compared the relative sensitivities of LTD₄- and LXA₄-stimulated erk phosphorylation to the LTD₄ receptor antagonist SKF 104353. This agent has previously been shown to block effects of both eicosanoids on calcium mobilization in rat mesangial cells (6). Interestingly, we found that whereas LTD₄-induced erk phosphorylation was inhibited to levels comparable to basal, LXA₄ activation persisted (Fig. 5b). Pretreatment of mesangial cells with the bisindolylmaleimide PKC inhibitor GF 109203X (10 µM) (45) inhibited erk phosphorylation in response to both LTD₄ and LXA₄ (Fig. 5c). Involvement of PKC in erk activation was further supported by experiments in which PKC down-regulation by treatment of the cells with phorbol ester (100 nM phorbol 12-myristate 13-acetate, 18 h) inhibited erk phosphorylation (data not shown). Furthermore, both LXA₄ and LTD₄ activated mesangial cell PKC as measured by in vitro peptide phosphorylation assay (Promega) (data not shown). In contrast to the ubiquity of PKC in LTD₄- and LXA₄-induced erk activation in response to either agent, the PI 3-kinase inhibitor wortmannin (200 nM) (46) inhibited LTD₄ activation but not LXA₄ activation of erk (Fig. 5d).

View larger version (20K): [in this window] [in a new window]   Fig. 5.   LXA4 and LTD4-stimulate erk through different mechanisms. Transformed human mesangial cells were treated with the indicated concentrations of LXA4, LTD4, or vehicle (0.1% ethanol) for 15 min. Cell lysates were prepared and immunoblotted with phospho-erk-specific antibodies. A, cells were pretreated with PTX (100 ng/ml, 18 h) before stimulation with LXA4 or LTD4 as indicated. B, cells were pretreated with SKF 104353 (100 nM, 15 min) before stimulation with LXA4 or LTD4 as indicated. C, cells were pretreated with GF109203X (10 µM, 5 min) before the addition of LXA4 or LTD4 as indicated. D, cells were pretreated with wortmannin (200 nM, 10 min) before stimulation with LXA4 or LTD4 as indicated. Data are mean ± S.E. of three independent experiments performed in duplicate. *, p < 0.05; **, p < 0.005.

LXA₄ and LTD₄ Activate p38 MAP Kinase-- Activation of p38 was investigated by immunoblotting with phosphospecific antibodies. p38 phosphorylation in response to LXA₄ (10 nM) was detectable within 2 min of stimulation (the earliest time point investigated) and was maximal by 10 min and remained elevated at 30 min (Fig. 6a). LTD₄ (10 nM) also activated p38, although less robustly than LXA₄ (Fig. 6c). Activity of the SAPks p38 and c-Jun N-terminal kinase was determined by phosphorylation of the recombinant fusion protein ATF₂-GST. ATF₂-GST phosphotransferase activity corroborated the phospho-p38 immunoblot data (Fig. 6, b and d). c-Jun N-terminal kinase activation was also investigated using phosphospecific antibodies as described for erk and p38. The data on c-Jun N-terminal kinase activation typically paralleled that seen for p38 (data not shown).

View larger version (17K): [in this window] [in a new window]   Fig. 6.   Kinetics of LXA4- and LTD4-stimulated p38 phosphorylation and SAPk activation. Transformed human mesangial cells were treated with LXA4 (10 nM), LTD4 (10 nM), or vehicle (0.1% ethanol) for the indicated times. Cell lysates were prepared and immunoblotted with phospho-p38-specific antibodies or assayed for SAPk activity by measuring ATF2-GST phosphorylation. A, phospho-p38 detected in lysates from LXA4-treated cells; B, SAPk activity in lysates from LXA4-treated cells; C, phospho-p38 detected in lysates from LTD4-treated cells; D, SAPk activity in lysates from LTD4-treated cells. Insets show densitometric analysis of immunoblot results. Data are mean ± S.E. of three independent experiments performed in duplicate. *, p < 0.05; **, p < 0.005.

The dose dependence of p38 phosphorylation was investigated. These data indicated a maximal effect of LXA₄ and LTD₄ on p38 phosphorylation at 1 nM (Fig. 7).

View larger version (19K): [in this window] [in a new window]   Fig. 7.   Dose dependence of LXA4- and LTD4-stimulated p38 phosphorylation. Transformed human mesangial cells were treated with the indicated concentrations of LXA4, LTD4, or vehicle (0.1% ethanol) for 15 min. Cell lysates were prepared and immunoblotted with p38 phosphospecific antibodies. A, phospho-p38 detected in lysates from LXA4-treated cells; B, phospho-p38 detected in lysates from LTD4-treated cells. Insets show densitometric analysis of immunoblot results. Data are mean ± S.D. of two independent experiments.

To investigate whether LXA₄ or LTD₄ was acting through a common receptor to activate p38, we used the discriminating agents as outlined above (PTX, SKF 104353, GF 109203X, and wortmannin). PTX pretreatment of mesangial cells blocked both LXA₄- and LTD₄-stimulated p38 phosphorylation (Fig. 8a). Exposure of human renal mesangial cells to SKF 1043543 (100 nM) inhibited both LXA₄ and LTD₄-induced phosphorylation of p38 (Fig. 8b). GF 109203X also inhibited activation of p38 in response to either agent (Fig. 8c). The PI 3-kinase inhibitor wortmannin inhibited LTD₄-stimulated p38 phosphorylation (Fig. 8d).

View larger version (20K): [in this window] [in a new window]   Fig. 8.   LXA4- and LTD4-stimulated p38 activity is PTX-sensitive and is inhibited by SKF 104353, GF 109203X, and wortmannin in mesangial cells. Transformed human mesangial cells were treated with LXA4 (1 nM), LTD4 (1 nM), or vehicle (0.1% ethanol) for 15 min. Cell lysates were prepared and immunoblotted with phospho-p38-specific antibodies. A, cells were pretreated with PTX (100 ng/ml, 18 h) before stimulation with LXA4 or LTD4 as indicated (1 nM, 15 min); B, cells were pretreated with SKF 104353 (100 nM, 15 min) before stimulation with LXA4 or LTD4 as indicated (1 nM, 15 min); C, cells were pretreated with GF109203X (10 µM, 10 min) before the addition of LXA4 or LTD4 as indicated (1 nM, 15 min); D, cells were pretreated with wortmannin (100 nM) before stimulation with LXA4 or LTD4 as indicated. Data are mean ± S.E. of four independent experiments performed in duplicate. *, p < 0.05; **, p < 0.005.

LTD₄ Activates Mesangial Cell Ras-- To further delineate the downstream signaling events subsequent to LTD₄ and LXA₄ stimulation and activation of the MAP kinases, Ras activity was measured. These data indicate that, whereas LTD₄ activates Ras, LXA₄ activation does not (Fig. 9).

View larger version (19K): [in this window] [in a new window]   Fig. 9.   LTD4 stimulation of mesangial cells activates Ras. Transformed human mesangial cells were serum-restricted (0.5% FCS) for 48 h prior to stimulation (15 min) with LTD4 (1 nM), LXA4 (1 nM), phorbol 12-myristate 13-acetate (PMA) (100 nM, 30 min) (positive control), or vehicles as indicated. Cell lysates were incubated with GST-Raf-RBD coupled to glutathione-agarose beads. Bound Ras-GTP was eluted off the beads, resolved by 15% SDS-polyacrylamide gel electrophoresis, and transferred to polyvinylidene difluoride. Ras-GTP was detected by Western blotting with pan-Ras antibody. Ras-GTP was detected by enhanced chemiluminescence. Inset shows densitometric analysis of immunoblot results. Data are mean ± S.D. of two independent experiments.

LTD₄-stimulated Proliferation Is PI 3-kinase- and erk-dependent and Involves PDGF Receptor Transactivation-- To investigate whether activation of PI 3-kinase and/or erk was required for the proliferative response to LTD₄, we investigated the effects of LY 294002 (100 µM) (47) and the erk inhibitor PD 98059 (10 µM) (48). Pretreatment of mesangial cells with either of these agents (both for 60 min) blocked LTD₄-stimulated proliferation (Fig. 10). Interestingly, inhibition of PDGF-associated tyrosine kinase activity with AG 1296 (49) blocked LTD₄-induced mitogenesis, whereas the epidermal growth factor receptor inhibitor AG 1478 (50) was without effect (although it did inhibit epidermal growth factor-induced proliferation; data not shown).

View larger version (18K): [in this window] [in a new window]   Fig. 10.   LTD4-stimulated proliferation: requirements for PI 3-kinase, erk, and PDGF receptor activation. Subconfluent cultures of transformed human mesangial cells were serum-starved for 48 h before being stimulated with LXA4 (1 nM), LTD4 (1 nM), PDGF- (10 ng/ml), epidermal growth factor (EGF) (10 ng/ml), vehicle, or combinations as indicated for 48 h before determining the number of viable cells by formazan reduction. Results are expressed as -fold/basal mesangial cell proliferation. Data are mean ± S.E. of four independent experiments performed in duplicate. *, p < 0.05; **, p < 0.005. A, cells were pretreated with LY 294002 (10 µM, 60 min) or PD 98059 (10 µM, 60 min) before stimulation with PDGF-, EGF, LXA4, or LTD4 as indicated; B, cells were pretreated with tyrophostin AG 1296 (10 µM, 60 min) before stimulation with PDGF- or LTD4 as indicated.

LXA₄ Inhibits LTD₄ Activation of PI 3-Kinase-- PI 3-kinase was immunoprecipitated from appropriately treated cells, and lipid kinase activity measured in the presence of [-³²P]ATP. LTD₄ activated PI 3-kinase, and a maximal effect was observed at 50 s (time course examined in initial experiments was 15 s to 5 min). The extent of activation was comparable to that seen with PDGF-, a positive control (51) used in these experiments. LXA₄ did not modulate PI 3-kinase activity; however, LXA₄ attenuated LTD₄-induced activation of PI 3-kinase (Fig. 11).

View larger version (26K): [in this window] [in a new window]   Fig. 11.   LXA4 inhibits LTD4 activation of PI 3-kinase. Cells were treated with LXA4 (10 nM), LTD4 (10 nM), PDGF- (10 ng/ml), vehicle, or both LTD4 and LXA4 for 50 s. Lysates were harvested, and PI 3-kinase was immunoprecipitated. Enzyme activity was determined by 32P incorporation into phosphatidylinositol. A, phospholipids were resolved by TLC and detected by phosphorimaging. Arrow indicates migration of authentic phosphatidylinositol 3,4,5-trisphosphate. B, relative PI 3-kinase activity assessed by phosphorimaging. Values given are fold/basal (i.e. PI 3-kinase activity in lysates from vehicle-treated cells) from 3-5 independent experiments. *, p < 0.05.

	DISCUSSION

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

Glomerulonephritis is characterized acutely by leukocyte infiltration and mesangial cell proliferation. Such mesangial cell proliferation is frequently associated with dysregulated matrix production and sclerosis. The resolution of glomerulonephritis is dynamically regulated and involves coordinated suppression of inflammation and promotion of recovery by processes that include the following: dissipation of local gradients of proinflammatory mediators; generation of endogenous braking signals, such as LXs, to inhibit further leukocyte recruitment; restoration of normal glomerular cell number by clearance of recruited leukocytes; and inhibition of mesangial cell proliferation (8) and potential regulation of matrix accumulation (44).

The functional significance of LTD₄ in renal inflammation is well established (6-16). Mesangial cell proliferation in response to paracrine mediators, such as LTD₄, is a pivotal event in the development of progressive renal injury (52). In this context, inhibition of leukotriene biosynthesis can blunt the mesangioproliferative response following immune-mediated injury (16); furthermore, increased LXA₄ production protects from decrements in glomerular function in models of nephritis in vivo (53). Of significance in this regard is the potential for transcellular production of mesangial cell LXA₄ from leukocyte LTA₄ (3). Pharmacologic inhibitors of LTD₄ have been shown to preserve glomerular filtration and barrier function in models of glomerulonephritis (12, 15).

The data presented here expand on the evidence that LXA₄ can act as an inhibitor of LTD₄ bioactions in an additional capacity to its established effects on modulating leukocyte trafficking (4, 5). We report that LXA₄ inhibits LTD₄-induced proliferation in human mesangial cells. The inhibitory effect of myeloid LXA₄ receptor antisera (22, 44) on the modulation of LTD₄-induced mesangial cell proliferation suggests that this effect is mediated through this distinct receptor. Given the relevance of LTD₄ in renal pathophysiology as outlined above, delineation of the signal transduction mechanisms activated by LTD₄ and its counter-regulator LXA₄ is important in identifying the locus of action of these mediators. In rat renal mesangial cells, the existence of a common LTD₄-LXA₄ receptor has been demonstrated (6). LXA₄ has been shown to displace specific [³H]LTD₄ binding. SKF 104353 inhibited the modest increases in inositol 1,4,5 trisphosphate turnover elicited by LXA₄, whereas pretreatment with LXA₄ abolished subsequent induction of inositol 1,4,5 trisphosphate formation in these studies (6). Our data on the activation of the MAP kinases erk and p38 in response to the two eicosanoids indicate the likelihood of expression of at least two LXA₄ receptor subtypes in human renal mesangial cells. These conclusions are supported by the following observations: whereas both LTD₄ and LXA₄ activated erk and p38 MAP kinases, the activation of both kinases in response to LTD₄ was antagonist (SKF 104353)-sensitive, and activation of erk in response to LXA₄ was insensitive. This suggested that LXA₄ might act at both a common LTD₄ and a distinct LXA₄ receptor. Consistent with this hypothesis are our data showing selective sensitivity of LXA₄ activation of the MAP kinases to PTX. P38 activation is PTX-sensitive, whereas erk activation is insensitive. In contrast, LTD₄ activation of both erk and p38 is PTX-sensitive.

Screening of the mesangial cell cDNA library verified expression of previously described LTD₄ and LXA₄ receptors. We propose that LXA₄ activates erk through two distinct receptors. One receptor is PTX-insensitive and may be coupled to PKC and downstream erk activation through G_q family members (G_q, G₁₂, G₁₆, and G_z). Stimulation of this receptor by LXA₄ results in sustained erk activation relative to the acute activation seen with LTD₄. Such sustained activation is associated with extraproliferative effects of erk, such as expression of cdk inhibitor protein and inhibition of DNA synthesis (54). A second common LTD₄-LXA₄ receptor (SKF 104353-sensitive) is coupled to PI 3-kinase, erk, and p38 activation via subunit release from G_i. Mesangial cells express PLC₁ and PLC₃ isoforms (37), which show differential sensitivity to activation by subunits (55). It is possible that the LXA₄-specific receptor activates PLC₁ and PLC₃, whereas LXA₄ and LTD₄ work through a common receptor to activate PLC₃.

PI 3-kinase is known to activate MAP kinases through multiple mechanisms, including activation of calcium-independent PKC, Akt/PKB and p70 ^s6 kinase. We have found that the PI 3-kinase inhibitor wortmannin blocked erk and p38 activation in response to LTD₄ (Fig. 7) (LY 294002 was also found to be inhibitory; data not shown). LXA₄-stimulated p38 and erk activities were differentially compromised by these agents; erk activity was relatively insensitive. These data suggested that LTD₄ activation of erk and p38 might be downstream of PI 3-kinase activation. Direct assay of PI 3-kinase activity indicated that LTD₄ activation of PI 3-kinase was blocked by SKF 104353 (data not shown). The degree of activation in response to LTD₄ was comparable to that seen with PDGF-, a potent mitogen known to activate mesangial cell PI 3-kinase (51, 56). LXA₄ did not activate PI 3-kinase; furthermore, co-stimulation of the cells with both LXA₄ and LTD₄ blunted the stimulation seen with LTD₄ alone. An essential role for both PI 3-kinase and erk activation in LTD₄-induced mesangial cell proliferation was suggested by its sensitivity to both LY 294002 and PD 98059 and the fact that LXA₄ activated erk but not PI 3-kinase and did not stimulate proliferation. Analogous requirements for both PI 3-kinase and erk activation in lysophosphatidic acid-induced renal epithelial cell proliferation and in PDGF-stimulated mesangial cell proliferation have recently been reported (56, 57). In addition, receptor tyrosine kinases have been shown to be transactivated by GPCRs. (58, 59). Such transactivation typically involves ligand-independent activation of receptor tyrosine kinases subsequent to activation of GPCRs. Recently, two groups have demonstrated a role for growth factor receptor transactivation in the context of bradykinin- and lysophosphatidic acid-stimulated PI 3-kinase (60, 61). We propose LTD₄ transactivates the PDGF receptor in mesangial cells as the specific inhibitor of the PDGF receptor, AG 1296, inhibited LTD₄-induced proliferation. The mechanisms of LXA₄-inhibition of PI 3-kinase activity and mesangial cell proliferation are currently under investigation and may involve phosphatase activation analogous to the inhibitory effects of somatostatin on insulin-induced mitogenesis mediated through the SST-2 GPCR subtype (62). Transcellular generation of 15-epi-LXs by neutrophil-adenocarcinoma cell (A549) coincubations have been shown to inhibit A549 cell proliferation by an unknown mechanism (63).

In summary, these data demonstrate expression of previously described LXA₄ and LTD₄ receptors in renal mesangial cells. These receptors are coupled to activation of MAP kinases. LTD₄-stimulated mesangial cell proliferation was dependent on erk and PI 3-kinase activity and involves PDGF- receptor transactivation. LXA₄ inhibited LTD₄-induced proliferation. These data further expand on the anti-inflammatory repertoire of lipoxins.

	ACKNOWLEDGEMENTS

We thank Dr. Vincent Healy for advice on establishing the PI 3-kinase assay, Prof. Finian Martin for helpful discussions, Prof. Luke O'Neill and Dr. Eva Palsson (Trinity College Dublin) for pGEX-GST-Raf-RBD protein and advice on the Ras activation assay, Prof. J. D. Sraer (Hopital Tenon) for the gift of transformed human mesangial cells, and Dr. Roger Davis (University of Massachusetts, Worcester, MA) for ATF₂-GST fusion protein.

	FOOTNOTES

^* This work was funded by grants from The Health Research Board, Forbairt (Enterprise Ireland), and The Wellcome Trust.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Current address: Imperial Cancer Research Fund Medical Oncology Unit, Western General Hospital National Health Service Trust, Edinburgh EH4 2XU, United Kingdom.

^§ Current address: Sir Patrick Dun's Research Laboratories, Trinity College Medical School, St. James Hospital, Dublin 8, Ireland.

^¶ To whom correspondence should be addressed. Tel.: 353-1-803-2188; Fax: 353-1-830-8404; E-mail: cgodson@mater.ie.

Published, JBC Papers in Press, June 26, 2000, DOI 10.1074/jbc.M001015200

	ABBREVIATIONS

The abbreviations used are: LXA₄, lipoxin A₄; AG 1296, 6,7-dimethoxy-3-phenylquinoxaline; AG 1478, 4-(3-chloroanilino)-6,7-dimethoxyquinazoline; GF 109203X, bisindolylmaleimide; PD 98059, 2-amino-3-methoxyflavone; PDGF, platelet-derived growth factor; PKC, protein kinase C; PTX, pertussis toxin; LY 294002, 2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one; erk, extracellular-related signal regulated kinase; GST, glutathione S-transferase; GPCR, G protein-coupled receptor; cysLT, cysteinyl leukotriene; LTD₄, leukotriene D₄; LX, lipoxin; PI 3-kinase, phosphatidylinositol 3-kinase; MAP, mitogen-activated protein; MAPK, MAP kinase; PCR, polymerase chain reaction; FCS, fetal calf serum; SAPk, Stress-activated protein kinase; PLC, phospholipase C.

	REFERENCES

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

CiteULike

Complore

Connotea

Del.icio.us

Digg

Reddit

Technorati

This article has been cited by other articles:

				V. Martins, S. S. Valenca, F. A. Farias-Filho, R. Molinaro, R. L. Simoes, T. P. T. Ferreira, P. M. R. e Silva, C. M. Hogaboam, S. L. Kunkel, I. M. Fierro, et al. ATLa, an Aspirin-Triggered Lipoxin A4 Synthetic Analog, Prevents the Inflammatory and Fibrotic Effects of Bleomycin-Induced Pulmonary Fibrosis J. Immunol., May 1, 2009; 182(9): 5374 - 5381. [Abstract] [Full Text] [PDF]

				N. Baker, S. J. O'Meara, M. Scannell, P. Maderna, and C. Godson Lipoxin A4: Anti-Inflammatory and Anti-Angiogenic Impact on Endothelial Cells J. Immunol., March 15, 2009; 182(6): 3819 - 3826. [Abstract] [Full Text] [PDF]

				D. El Kebir, L. Jozsef, and J. G. Filep Opposing regulation of neutrophil apoptosis through the formyl peptide receptor-like 1/lipoxin A4 receptor: implications for resolution of inflammation J. Leukoc. Biol., September 1, 2008; 84(3): 600 - 606. [Abstract] [Full Text] [PDF]

				D. El Kebir, L. Jozsef, T. Khreiss, W. Pan, N. A. Petasis, C. N. Serhan, and J. G. Filep Aspirin-Triggered Lipoxins Override the Apoptosis-Delaying Action of Serum Amyloid A in Human Neutrophils: A Novel Mechanism for Resolution of Inflammation J. Immunol., July 1, 2007; 179(1): 616 - 622. [Abstract] [Full Text] [PDF]

				D. Mitchell, S. J. O'Meara, A. Gaffney, J. K. G. Crean, B. T. Kinsella, and C. Godson The Lipoxin A4 Receptor Is Coupled to SHP-2 Activation: IMPLICATIONS FOR REGULATION OF RECEPTOR TYROSINE KINASES J. Biol. Chem., May 25, 2007; 282(21): 15606 - 15618. [Abstract] [Full Text] [PDF]

				N. Chiang, C. N. Serhan, S.-E. Dahlen, J. M. Drazen, D. W. P. Hay, G. E. Rovati, T. Shimizu, T. Yokomizo, and C. Brink The Lipoxin Receptor ALX: Potent Ligand-Specific and Stereoselective Actions in Vivo Pharmacol. Rev., September 1, 2006; 58(3): 463 - 487. [Abstract] [Full Text] [PDF]

				C. Bonnans, K. Fukunaga, R. Keledjian, N. A. Petasis, and B. D. Levy Regulation of phosphatidylinositol 3-kinase by polyisoprenyl phosphates in neutrophil-mediated tissue injury J. Exp. Med., April 17, 2006; 203(4): 857 - 863. [Abstract] [Full Text] [PDF]

				H. Fu, J. Karlsson, J. Bylund, C. Movitz, A. Karlsson, and C. Dahlgren Ligand recognition and activation of formyl peptide receptors in neutrophils J. Leukoc. Biol., February 1, 2006; 79(2): 247 - 256. [Full Text] [PDF]

				S.-H. Wu, X.-H. Wu, C. Lu, L. Dong, and Z.-Q. Chen Lipoxin A4 Inhibits Proliferation of Human Lung Fibroblasts Induced by Connective TissueGrowth Factor Am. J. Respir. Cell Mol. Biol., January 1, 2006; 34(1): 65 - 72. [Abstract] [Full Text] [PDF]

				K. Rodgers, B. McMahon, D. Mitchell, D. Sadlier, and C. Godson Lipoxin A4 Modifies Platelet-Derived Growth Factor-Induced Profibrotic Gene Expression in Human Renal Mesangial Cells Am. J. Pathol., September 1, 2005; 167(3): 683 - 694. [Abstract] [Full Text] [PDF]

				V. Nascimento-Silva, M. A. Arruda, C. Barja-Fidalgo, C. G. Villela, and I. M. Fierro Novel lipid mediator aspirin-triggered lipoxin A4 induces heme oxygenase-1 in endothelial cells Am J Physiol Cell Physiol, September 1, 2005; 289(3): C557 - C563. [Abstract] [Full Text] [PDF]

				R. L. Simoes and I. M. Fierro Involvement of the Rho-Kinase/Myosin Light Chain Kinase Pathway on Human Monocyte Chemotaxis Induced by ATL-1, an Aspirin-Triggered Lipoxin A4 Synthetic Analog J. Immunol., August 1, 2005; 175(3): 1843 - 1850. [Abstract] [Full Text] [PDF]

				P. Maderna, S. Yona, M. Perretti, and C. Godson Modulation of Phagocytosis of Apoptotic Neutrophils by Supernatant from Dexamethasone-Treated Macrophages and Annexin-Derived Peptide Ac2-26 J. Immunol., March 15, 2005; 174(6): 3727 - 3733. [Abstract] [Full Text] [PDF]

				T. Ohse, T. Ota, N. Kieran, C. Godson, K. Yamada, T. Tanaka, T. Fujita, and M. Nangaku Modulation of Interferon-Induced Genes by Lipoxin Analogue in Anti-Glomerular Basement Membrane Nephritis J. Am. Soc. Nephrol., April 1, 2004; 15(4): 919 - 927. [Abstract] [Full Text] [PDF]

				D. Mitchell, K. Rodgers, J. Hanly, B. McMahon, H. R. Brady, F. Martin, and C. Godson Lipoxins Inhibit Akt/PKB Activation and Cell Cycle Progression in Human Mesangial Cells Am. J. Pathol., March 1, 2004; 164(3): 937 - 946. [Abstract] [Full Text] [PDF]

				B. McMahon and C. Godson Lipoxins: endogenous regulators of inflammation Am J Physiol Renal Physiol, February 1, 2004; 286(2): F189 - F201. [Abstract] [Full Text] [PDF]

				A. Ariel, N. Chiang, M. Arita, N. A. Petasis, and C. N. Serhan Aspirin-Triggered Lipoxin A4 and B4 Analogs Block Extracellular Signal-Regulated Kinase-Dependent TNF-{alpha} Secretion from Human T Cells J. Immunol., June 15, 2003; 170(12): 6266 - 6272. [Abstract] [Full Text] [PDF]

				T. Kucharzik, A. T. Gewirtz, D. Merlin, J. L. Madara, and I. R. Williams Lateral membrane LXA4 receptors mediate LXA4's anti-inflammatory actions on intestinal epithelium Am J Physiol Cell Physiol, April 1, 2003; 284(4): C888 - C896. [Abstract] [Full Text] [PDF]

				C. Brink, S.-E. Dahlen, J. Drazen, J. F. Evans, D. W. P. Hay, S. Nicosia, C. N. Serhan, T. Shimizu, and T. Yokomizo International Union of Pharmacology XXXVII. Nomenclature for Leukotriene and Lipoxin Receptors Pharmacol. Rev., March 1, 2003; 55(1): 195 - 227. [Abstract] [Full Text] [PDF]

				A. J. Schottelius, C. Giesen, K. Asadullah, I. M. Fierro, S. P. Colgan, J. Bauman, W. Guilford, H. D. Perez, and J. F. Parkinson An Aspirin-Triggered Lipoxin A4 Stable Analog Displays a Unique Topical Anti-Inflammatory Profile J. Immunol., December 15, 2002; 169(12): 7063 - 7070. [Abstract] [Full Text] [PDF]

				S. Mitchell, G. Thomas, K. Harvey, D. Cottell, K. Reville, G. Berlasconi, N. A. Petasis, L. Erwig, A. J. Rees, J. Savill, et al. Lipoxins, Aspirin-Triggered Epi-Lipoxins, Lipoxin Stable Analogues, and the Resolution of Inflammation: Stimulation of Macrophage Phagocytosis of Apoptotic Neutrophils In Vivo J. Am. Soc. Nephrol., October 1, 2002; 13(10): 2497 - 2507. [Abstract] [Full Text] [PDF]

				M. W. Vaughn, R. J. Proske, and D. L. Haviland Identification, Cloning, and Functional Characterization of a Murine Lipoxin A4 Receptor Homologue Gene J. Immunol., September 15, 2002; 169(6): 3363 - 3369. [Abstract] [Full Text] [PDF]

				C. Bonnans, I. Vachier, C. Chavis, P. Godard, J. Bousquet, and P. Chanez Lipoxins Are Potential Endogenous Antiinflammatory Mediators in Asthma Am. J. Respir. Crit. Care Med., June 1, 2002; 165(11): 1531 - 1535. [Abstract] [Full Text] [PDF]

				M. O. Leonard, K. Hannan, M. J. Burne, D. W. P. Lappin, P. Doran, P. Coleman, C. Stenson, C. T. Taylor, F. Daniels, C. Godson, et al. 15-Epi-16-(Para-Fluorophenoxy)-Lipoxin A4-Methyl Ester, a Synthetic Analogue of 15-epi-Lipoxin A4, Is Protective in Experimental Ischemic Acute Renal Failure J. Am. Soc. Nephrol., June 1, 2002; 13(6): 1657 - 1662. [Abstract] [Full Text] [PDF]

				I. M. Fierro, J. L. Kutok, and C. N. Serhan Novel Lipid Mediator Regulators of Endothelial Cell Proliferation and Migration: Aspirin-Triggered-15R-Lipoxin A4 and Lipoxin A4 J. Pharmacol. Exp. Ther., February 1, 2002; 300(2): 385 - 392. [Abstract] [Full Text] [PDF]

				J. Goh, A. W. Baird, C. O'Keane, R. W. G. Watson, D. Cottell, G. Bernasconi, N. A. Petasis, C. Godson, H. R. Brady, and P. MacMathuna Lipoxin A4 and Aspirin-Triggered 15-Epi-Lipoxin A4 Antagonize TNF-{alpha}-Stimulated Neutrophil-Enterocyte Interactions In Vitro and Attenuate TNF-{alpha}-Induced Chemokine Release and Colonocyte Apoptosis in Human Intestinal Mucosa Ex Vivo J. Immunol., September 1, 2001; 167(5): 2772 - 2780. [Abstract] [Full Text] [PDF]

				C. S. T. Hii, N. Moghadammi, A. Dunbar, and A. Ferrante Activation of the Phosphatidylinositol 3-Kinase-Akt/Protein Kinase B Signaling Pathway in Arachidonic Acid-stimulated Human Myeloid and Endothelial Cells. INVOLVEMENT OF THE ErbB RECEPTOR FAMILY J. Biol. Chem., July 13, 2001; 276(29): 27246 - 27255. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) All Versions of this Article: 275/36/27566    most recent M001015200v1 Submit a Letter to Editor Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by McMahon, B. Articles by Godson, C. Search for Related Content PubMed PubMed Citation Articles by McMahon, B. Articles by Godson, C. Social Bookmarking                      What's this?