JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M003593200 on June 20, 2000

J. Biol. Chem., Vol. 275, Issue 36, 27815-27822, September 8, 2000
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
275/36/27815    most recent
M003593200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Elberg, G.
Right arrow Articles by Tsai, S. Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Elberg, G.
Right arrow Articles by Tsai, S. Y.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Modulation of the Murine Peroxisome Proliferator-activated Receptor gamma 2 Promoter Activity by CCAAT/Enhancer-binding Proteins*

Gerard ElbergDagger §, Jeffrey M. Gimble||, and Sophia Y. TsaiDagger **

From the Dagger  Department of Molecular and Cellular Biology, Baylor College of Medicine, Houston, Texas 77030 and the  Department of Surgery, University of Oklahoma Health Sciences Center, Oklahoma City, Oklahoma 73190

Received for publication, April 27, 2000, and in revised form, June 19, 2000

    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Peroxisome proliferator-activated receptor gamma  (PPARgamma ) and CCAAT/enhancer-binding proteins (C/EBPs) are transcriptional regulators essential for adipocyte differentiation and function. Previous findings indicate that PPARgamma 2 transcription is regulated by members of the C/EBP family. We demonstrate here that C/EBPalpha and C/EBPdelta , but not C/EBPbeta , induce the activity of the PPARgamma 2 promoter in transiently transfected 3T3-L1 preadipocytes and bind to two juxtaposed low affinity C/EBP binding sites. Results obtained with chimeras containing interchanged C/EBPalpha -C/EBPbeta N-terminal transactivation domain and C-terminal DNA binding dimerization domain indicate that the N-terminal part of C/EBPbeta prevents it from binding to the PPARgamma 2 promoter. Indeed, deletion mutants of C/EBPbeta lacking the N-terminal part of the molecule are able to bind to the PPARgamma 2 promoter. We further demonstrate that deletion of a region located between amino acids 184-212, upstream of the DNA binding domain, permits C/EBPbeta binding to the PPARgamma 2 promoter, implicating an inhibitory region in C/EBPbeta for modulating DNA binding specificity to the PPARgamma 2 promoter. In summary, this study indicates that C/EBPbeta but not C/EBPalpha or C/EBPdelta is unable to bind to C/EBP binding sites in the mouse PPARgamma 2 promoter. The lack of binding is due to a region N-terminal of the C/EBPbeta DNA binding domain. Our findings illustrate a mechanism by which C/EBP isoforms differentially modulate the transactivation of the PPARgamma 2 promoter.

    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Obesity is a serious problem for humans in industrialized countries and a contributing factor for several diseases including type II diabetes, hypertension, cancer, and atherosclerosis (1). It results from an excessive accumulation of white adipose tissue, composed of adipocytes, which play a central role in energy storage and release of lipid metabolites. Among the factors orchestrating adipocyte differentiation, the nuclear receptor peroxisome proliferator-activated receptor gamma  (PPARgamma )1 and the CCAAT/enhancer-binding proteins (C/EBPs) are two key transcription factors (2, 3). PPARgamma has received considerable attention because of the fact that PPARgamma synthetic ligands, such as thiazoladinedione, are potent insulin-sensitizing drugs administrated to type II diabetic patients (2). Two PPARgamma isoforms, PPARgamma 1 and PPARgamma 2, are expressed in different tissues; the latter is reported to be restricted to adipose tissue and mammary glands (4-6). Compared with PPARgamma 1, PPARgamma 2 contains an additional N-terminal region composed of 30 amino acids, and distinct promoters regulate the expression of these two isoforms (5).

C/EBPs are expressed in a number of tissues and are involved in the regulation of several biological processes such as acute phase response, inflammatory and immune response, cell proliferation and differentiation, and control of energy metabolism (7-9). C/EBP family members display highly similar C-terminal basic DNA binding domains and leucine zipper dimerization domains but exhibit different N-terminal regions containing the activation domains. Consequently, the various C/EBP proteins form both homodimers and heterodimers and bind to a common DNA consensus sequence (7). C/EBPalpha and C/EBPbeta expression is regulated at the translational level via a leaky ribosome scanning mechanism. The C/EBPalpha mRNA is translated to 42- and 30-kDa proteins, both of which are activators that differ in their transcriptional potencies (10). Translation of the C/EBPbeta mRNA generates three different products: two transactivator proteins of 35 and 32 kDa called LAP1 and LAP2 (liver-enriched transcriptional activator protein 1 and 2) and a dominant negative form of 20 kDa called LIP (liver-enriched transcriptional inhibitory protein). The inhibitory activity results from the deletion of the transactivation domain in the 151 amino acids of the N-terminal region, which is truncated in LIP. Homodimers or heterodimers containing LIP bind to C/EBP binding sites but are transcriptionally inactive (11). In addition, some C/EBP family members act as inhibitors; C/EBPzeta (also called CHOP and GADD153) harbors a dimerization domain but not a functional DNA binding domain. Consequently, homodimers and heterodimers containing C/EBPzeta fail to bind C/EBP binding sites (12). The cell type specificity of C/EBP-regulated gene expression is thought to result from the tissue-restricted and temporal expression of a family member and combinatorial interactions with other transcription factors or coactivators (13-18). This combination results in transcriptional activation but also in some cases in inhibition of promoter activities (19-21). Several extracellular signaling pathways can regulate the activity of C/EBPs, especially C/EBPbeta , through the activation of different kinases and the subsequent phosphorylation of C/EBPs (9, 22, 23). In summary, the regulation of C/EBP activity is complex and integrates a network of specific protein expression and signal transduction pathways.

PPARgamma and C/EBPs are significantly elevated during adipocyte differentiation. C/EBPbeta and C/EBPdelta expression is transient and precedes the expression during terminal differentiation of C/EBPalpha and PPARgamma , which act cooperatively to complete adipogenesis (2, 3, 9). C/EBPalpha and C/EBPdelta transactivate the mouse PPARgamma 2 promoter via sites located at positions -340 bp and -327 bp relative to the transcriptional start site (24, 25), but no data has been shown to support a transactivation effect of C/EBPbeta on the mouse PPARgamma 2 promoter. We investigate here the transcriptional activity of various C/EBP isoforms on the mouse PPARgamma 2 promoter and demonstrate that in contrast to C/EBPalpha and C/EBPdelta , C/EBPbeta is unable to bind to C/EBP binding sequences and to stimulate PPARgamma 2 promoter activity.

    EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Plasmid Constructs-- Cloning of the mouse PPARgamma 2 promoter into the p19 luciferase vector and different C/EBPs into pEFbos vector have been described previously (24). The human p21WAF1/CIP1 gene promoter linked to the luciferase reporter vector was provided by Dr. M. Liu (26). Full-length murine coding sequences from the following vectors were excised with the restriction enzymes indicated: C/EBPalpha (EcoRI/HindIII fragment from MSV/C/EBP), C/EBPbeta (EcoRI/BamHI from MSV/C/EBPbeta ), and C/EBPdelta (EcoRI/BamHI from MSV/C/EBPdelta ) (vectors were provided by Dr. S. L. McKnight) (7). Each fragment was subcloned into the polylinker site of pSVSPORT 1 expression vector (Life Technologies, Inc.) and pBluescript II KS (pKS) (Stratagene, La Jolla, CA). The two C/EBPalpha -C/EBPbeta hybrids were generated by excision of XcmI/HindIII fragments from pSVSPORT1 C/EBPalpha and pSVSPORT1 C/EBPbeta , and the C/EBPalpha and C/EBPbeta fragments were ligated in the C/EBPbeta and C/EBPalpha vectors excised with XcmI/HindIII, respectively. Internal deletion constructs (pMEXCRP2Delta 163-191, Delta 116-191) were originally generated as published as the second translation form of C/EBP (27) and were provided by Dr. P. F. Johnson. A NcoI/PstI fragment of the coding sequences containing the internal deletion were inserted into pKS C/EBPbeta excised with NcoI/PstI. The numbering system used hereafter refers to the full-length C/EBPbeta isoform (Delta 184-212C/EBPbeta , Delta 137-212C/EBPbeta ). A Kozak sequence (referred to as KOZ) was generated around the first ATG of the coding sequence by replacing the EcoRI/SphI fragments of pKS C/EBPbeta , pKS Delta 184-212C/EBPbeta , and pKS Delta 137-212C/EBPbeta with a double-stranded oligonucleotide flanked by EcoRI/SphI restriction sites (the sense primer: 5'-AATTCCACCATGGACCGCCTGCTGGCCTGGGACGCAGCATG-3'). The coding sequences were then isolated as EcoRI/XbaI fragments and inserted into pSVSPORT1. N152C/EBPbeta was generated by replacing an Asp-718/NcoI fragment from pKS C/EBPbeta and replacing it with a double-stranded oligonucleotide flanked by Asp718/NcoI sites (the sense primer: 5'-GTACCGAATTCCAC-3'). The coding sequence isolated as an Asp718/XbaI fragment was inserted into pSVSPORT1. KOZ-N208 and KOZ-N213 C/EBPbeta (the latter containing two additional amino acids, A and K, at the N terminus) were generated by deletion of the EcoRI/XcmI fragment in pKS C/EBPbeta and replacing this fragment with double-stranded oligonucleotides flanked by restriction sites EcoRI/XcmI. The sense oligonucleotides were 5'-AATTCCACCATGGCGCCCGCCAAGGCCAAGAAG-3' and 5'-AATTCCACCATGGCGCCCGCCCAAGGCCAAGGCCAAGAAG-3' for KOZ-N213 and KOZ-N208, respectively. KOZ-N202 and KOZ-N191 C/EBPbeta were generated by deletion of an EcoRI/KasI fragment of pSVSPORT1 KOZ-N208C/EBPbeta and replacement of this fragment with double-stranded oligonucleotides ended with EcoRI/KasI restriction sites. The sense oligonucleotides were 5'-AATTCCACCATGGCGGGGCCGCCGGCG-3' and 5'-AATTCCACCATGGCCGACGCCAAGGCCGCGCCCGCCGCCTGCTTCGCGGGGCCGCCGGCG-3' for KOZ-N202 and KOZ-N191C/EBPbeta , respectively. All the constructs were restriction-mapped, and constructs containing synthesized oligodeoxynucleotides (Life Technologies, Inc.) were sequenced.

Antibodies-- Rabbit polyclonal antibodies used for Western blot analysis and supershift assays were purchased from Santa Cruz Biotechnology Inc. (Santa Cruz, CA). The antibody references are 14AA, C19, and C22 for C/EBPalpha , C/EBPbeta , and C/EBPdelta , respectively, except that in Fig. 5 Delta 198 was used as a C/EBPbeta antibody.

Cotransfection Assay and Luciferase Activity-- Preadipocyte 3T3-L1 cells, obtained from the American Type Culture Collection (Manassas, VA) were maintained in Dulbecco's modified Eagle's medium (high glucose) supplemented with 10% (v/v) calf serum, 100 units/ml penicillin, and 100 µg/ml streptomycin. The cells (105 cells/well in 6-well plates) were transiently transfected with 100 ng of PPARgamma 2 or p21 promoter/luciferase reporter constructs and 50 ng of each expression construct or empty vector, as a control. The transfection assays, using an adenovirus system, and the luciferase assays were performed as described previously (28).

Protein Overexpression and Analysis-- Expression of the various C/EBP constructs cloned in pSVSPORT1 was performed in COS-1 cells (obtained from the American Type Culture Collection) transiently transfected using diethylaminoethyl-dextran. The transfection and preparation of the COS-1 whole cell extracts was performed as described (29). One µg of protein from each transfected cell extract was loaded and fractionated on 12.5% (w/v) SDS-polyacrylamide gel electrophoresis, blotted on nitrocellulose membrane, and immunoreacted using different C/EBP antibodies. Detection was performed with an enhanced chemiluminescence kit (Amersham Pharmacia Biotech) according to the manufacturer's instructions.

Gel Shift-Supershift Assay-- COS-1 cell extracts overexpressing different C/EBP constructs were used for this assay. The probes, which were double-stranded oligonucleotides, were end-labeled with radioactive [alpha -32P]dCTP and [alpha -32P]dATP and purified on a Sephadex G25 column. The PPARgamma 2 promoter oligonucleotide contained two juxtaposed C/EBP binding sites with the following sequence.


<UP>ATTTTACTGCAATTTTAAAAAGCAATCAATATTG</UP>

<UP>     TGACGTTAAAATTTTTCGTTAGTTATAACTTGTT</UP>

<UP>Sequence 1</UP>
The mutated PPARgamma 2 promoter probe contained two consensus C/EBP binding sites with the following sequence.
<UP>ATTTTTGCGCAATTTTATTGCGCAATCAATATTG</UP>

   <UP>ACGCGTTAAAATAACGCGTTAGTTATAACTTATT</UP>

<UP>Sequence 2</UP>

The protein extracts (0.8-4 µg as specified in the figure legends) were incubated with or without antibody (0.8-1µg) or unlabeled oligonucleotides (in Fig. 4) for 30 min on ice prior to an additional incubation with the oligonucleotide probe (5×104 cpm) for 15 min at room temperature. The reaction buffer at a final volume of 12 µl contained 3.5 mM Hepes, pH 7.8, 70mM KCl, 3.5% (v/v) glycerol, 0.4 mM dithiothreitol, 0.07% (w/v) bovine serum albumin (molecular biology grade), 1 µg poly dIdC (Amersham Pharmacia Biotech), and 100 ng of shredded salmon sperm DNA (molecular biology grade). The protein-DNA complexes were separated on non-denaturing 6% (w/v) polyacrylamide gel at 190 V for 3h at 4 °C in TBE buffer (80 mM Tris-borate, 2 mM EDTA, pH 8.0). The gels were dried and submitted for autoradiography (12-30 h). In the experiments presented in Figs. 5, 7, and 8, 0.5% (w/v) 3-([(3-cholamidopropyl]dimethylammonio)-1-propanesulfonate (Sigma) was added to the reaction buffer to reduce nonspecific binding.

    RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Differential Effect of Various C/EBP Isoforms on PPARgamma 2 Promoter Activity-- The transcriptional activity of C/EBPalpha , C/EBPbeta , and C/EBPdelta on the mouse PPARgamma 2 promoter linked to a luciferase reporter gene was determined by transient transfection in 3T3-L1 preadipocytes. Fig. 1 shows that C/EBPalpha and C/EBPdelta transactivate the PPARgamma 2 promoter by 4- and 7-fold, respectively. In contrast, C/EBPbeta inhibits the basal promoter activity by approximately 70%. As a control for C/EBPbeta inhibitory action, the cells were cotransfected with p21 promoter/luciferase gene, a known target gene promoter for both C/EBPalpha and C/EBPbeta (23, 30). Cotransfection of C/EBPalpha , C/EBPbeta , or C/EBPdelta in 3T3-L1 preadipocytes stimulated the activity of the p21 promoter (Fig. 1). These experiments demonstrate that C/EBPbeta is unable to activate the PPARgamma 2 promoter.


View larger version (16K):
[in this window]
[in a new window]
  		Fig. 1.   Transcriptional activity of C/EBPalpha , C/EBPbeta , and C/EBPdelta on the mouse PPARgamma 2 promoter compared with the activity of the different C/EBPs on the human p21WAF1/CIP1 promoter. The control (empty) vector (pSVSPORT1) or expression plasmids encoding the cDNA for expression of the indicated proteins were transiently cotransfected in 3T3-L1 preadipocytes with either the PPARgamma 2 promoter (five different experiments) or p21WAF1/CIP1 promoter (three different experiments) linked to a luciferase reporter gene. The basal level of luciferase activity obtained with the control is set to 1, and transactivation is calculated as the ratio of the activities obtained with the different coexpressed C/EBPs to the basal luciferase activity. The data are expressed as the mean ± S.E.

We further investigated the modulating function of different C/EBPbeta isoforms on PPARgamma 2 promoter activity. The expression of the LAP1 isoform of C/EBPbeta was enhanced by the insertion of a Kozak sequence around the first start codon as described previously (11), whereas LIP was generated by deletion of the coding sequence for the 151 N-terminal amino acids. The different C/EBPbeta constructs were cotransfected with the PPARgamma 2 promoter-luciferase vector in 3T3-L1 preadipocytes. The expression of different forms of protein products was detected by an immunoblot analysis of the cell extracts, using a C/EBPbeta antibody. Fig. 2A shows that the C/EBPbeta construct induced the synthesis of 35- and 32-kDa proteins, corresponding to the molecular masses of LAP1 and LAP2, respectively. The insertion of the Kozak sequence in the C/EBPbeta construct induced the production of LAP1, whereas the LIP construct generated a 17-kDa protein. LIP expression was undetectable in the cells transfected with full-length C/EBPbeta constructs. The luciferase activity in these cell extracts demonstrated that full-length C/EBPbeta (LAP1), the mixture of LAP1 and LAP2, or the truncated form of C/EBPbeta (LIP) failed to stimulate PPARgamma 2 promoter activity. In contrast, the activator protein LAP1 or the mixture of LAP1 and LAP2, but not LIP, activated the p21 promoter (Fig. 2B). These results indicate that the inhibitory activity of C/EBPbeta on the PPARgamma 2 promoter is not mediated by preferential production of the dominant negative form of C/EBPbeta , LIP. Instead, the full-length C/EBPbeta is unable to activate the mouse PPARgamma 2 promoter, unlike the activity displayed by C/EBPalpha and C/EBPdelta .


View larger version (47K):
[in this window]
[in a new window]
  		Fig. 2.   Expression and transcriptional activity of C/EBPbeta isoforms.  A, Western blot analysis of different C/EBPbeta isoforms generated in 3T3L1 cells cotransfected with the PPARgamma 2 promoter linked to a luciferase reporter gene and different C/EBPbeta constructs as indicated. The proteins extracted for the measurement of PPARgamma 2 promoter-luciferase activity were separated via electrophoresis on a 12.5% (w/v) SDS-polyacrylamide gel (12 µg protein/lane). Expression of C/EBPbeta was detected by Western blot using a C/EBPbeta antibody. B, transcriptional activity of different C/EBPbeta isoforms on the mouse PPARgamma 2 promoter and on the human p21WAF1/CIP1 promoter. The experiment was performed as described in Fig. 1.

Binding Analysis of Various C/EBPs to C/EBP Binding Sites on the PPARgamma 2 Promoter-- To further examine the mechanism involved in the differential activation of the PPARgamma 2 promoter by C/EBP, we analyzed C/EBP binding to previously identified binding sites on the PPARgamma 2 promoter (24). These binding sites are composed of a core of two C/EBP half-sites (GCAAT). As a control, the sequence on the PPARgamma 2 promoter was mutated to form two adjacent C/EBP consensus binding sequences (TTGCGCAAT), created by changing the 5' flanking sequences adjacent to the core C/EBP recognition element (31). C/EBP proteins were produced in COS-1 cells by transfection of various C/EBP constructs. The expression of the different C/EBPs in the cell extracts was analyzed by Western blot and detected using C/EBPalpha , C/EBPbeta , or C/EBPdelta antibodies (Fig. 3A). C/EBP expression was not detectable in the control extract, consistent with the specific overexpression of different C/EBPs in the transfected cells. Binding analysis by a gel shift assay using C/EBP binding sites on the PPARgamma 2 promoter as a probe showed that C/EBPalpha and C/EBPdelta , but not C/EBPbeta , were able to bind to the C/EBP binding sites. As a positive control, we demonstrate that all three C/EBPs bind to the C/EBP consensus binding sequence with high efficacy. Addition of different C/EBP antibodies selective for each of the C/EBPs resulted in a supershift (Fig. 3B). These results indicate that C/EBP family members exhibit differential binding abilities to the non-consensus C/EBP binding sites on the PPARgamma 2 promoter and subsequently demonstrate different transactivation activities.


View larger version (67K):
[in this window]
[in a new window]
  		Fig. 3.   Binding activity of C/EBPalpha , C/EBPbeta , and C/EBPdelta . A, overexpression of the different C/EBPs. COS-1 cells were transfected with the pSVSPORT1 empty plasmid (control) or a plasmid encoding C/EBPalpha , C/EBPbeta , or C/EBPdelta . The cell lysates (1 µg of protein) were subjected to 12.5% SDS-polyacrylamide gel electrophoresis, and protein expression was detected by Western blot using C/EBPalpha , C/EBPbeta , and C/EBPdelta antibodies. B, binding activity of overexpressed C/EBPs analyzed by gel shift-supershift assay. COS-1-transfected cellular extracts (1 µg) were used to analyze the binding of different C/EBPs to C/EBP binding sites. Left side, C/EBP binding sites on the PPARgamma 2 promoter, composed of two adjacent GCAAT sequences (boxed). Right side, the sequence on the PPARgamma 2 promoter was mutated to form two adjacent consensus sequences for C/EBP binding (TTGCGCAAT) (boxed). Normal serum (NS) immunoglobulin or a C/EBP antibody (1 µg) was added to the reaction mixture, as indicated, for analysis by supershift assay.

We further characterized the binding activity of the various C/EBPs to the binding sites on the PPARgamma 2 promoter in comparison to the consensus sequence. The binding of radiolabeled oligonucleotides was studied in the presence of increasing concentrations of different non-labeled oligonucleotides. As shown in Fig. 4, the binding of C/EBPalpha and C/EBPdelta to the radiolabeled C/EBP binding sites on the PPARgamma 2 promoter was competed at high concentrations of the homologous competitor (IC50 = 105 ± 35 and 200 ± 50 nM, respectively). In comparison, a consensus C/EBP binding sequence competed at lower concentrations (IC50 = 1.65 ± 0.15 and 0.45 ± 0.15 nM for C/EBPalpha and C/EBPdelta , respectively). The binding of C/EBPalpha , C/EBPbeta , and C/EBPdelta to the radiolabeled consensus sequence was competed by the homologous non-labeled oligonucleotide (IC50 = 7.8 ± 2.4, 0.25 ± 0.1, and 1.3 ± 0.3 nM, respectively) but was hardly affected by non-labeled PPARgamma 2 promoter oligonucleotide, even at high concentrations. These results indicate that the C/EBP binding sites on the PPARgamma 2 promoter display a much lower binding affinity as compared with the consensus sequence.


View larger version (71K):
[in this window]
[in a new window]
  		Fig. 4.   Competition of the binding of different C/EBPs to radiolabeled C/EBP binding sites by increased concentrations of unlabeled oligonucleotides, analyzed by gel shift assay. Radiolabeled oligonucleotides containing C/EBP binding sites from the sequence on the PPARgamma 2 promoter (left side) or the mutated sequence to form consensus C/EBP binding sites (right side) were bound to different C/EBPs overexpressed in COS-1 extracts (1 µg of protein). The reactions were performed in the presence of increasing concentrations of non-labeled oligonucleotides as indicated.

Effect of the Coexpression of Different C/EBPs on the Binding and Transactivation of the PPARgamma 2 Promoter-- Because C/EBPbeta fails to bind to PPARgamma 2 promoter binding sites and inhibits the basal activity of the PPARgamma 2 promoter, we assumed that C/EBPbeta competed for endogenous C/EBPalpha or C/EBPdelta homo/heterodimers binding by producing inactive C/EBPalpha /beta or C/EBPbeta /delta heterodimers. Fig. 5A shows the effect of different combinations of C/EBPalpha , C/EBPbeta , and C/EBPdelta expression on the transactivation of the mouse PPARgamma 2 promoter linked to the luciferase gene. C/EBPalpha and C/EBPdelta activated the promoter 3.6 ± 1.4- and 14.1 ± 3.0-fold, respectively, and the combination of C/EBPalpha and C/EBPdelta activated the promoter 3.3 ± 0.7-fold. The combination of C/EBPalpha or C/EBPdelta expressed with C/EBPbeta did not transactivate PPARgamma 2 promoter over the basal promoter activity (1.6 ± 0.5- and 1.5 ± 0.6-fold activation, respectively). These results suggest that C/EBP heterodimers exhibited the activity of the less active member. The combination of C/EBPbeta with other C/EBP members showed higher activity than C/EBPbeta alone. It is possible that the homodimer fraction of the other C/EBP was present and that C/EBPbeta was not in excess, preventing it from heterodimerizing with endogenous C/EBPs. However, C/EBPbeta abolished the activity of both C/EBPalpha and C/EBPdelta . To further investigate whether heterodimers bind to the C/EBP binding sequence, we performed a gel shift experiment in which the different combinations of C/EBPs were expressed in COS cells and were supershifted by different C/EBP antibodies, allowing the identification of the species bound to the oligonucleotides. Fig. 5B shows that the different C/EBPs bound to the consensus sequence were specifically supershifted by their specific antibody, with no cross-reactivity of the selective antibodies with the other C/EBP members. C/EBPdelta antibody showed a poor supershift ability compared with the other antibodies but instead completely inhibited the C/EBPdelta binding. Fig. 5, C and D demonstrates the formation of heterodimers when two different C/EBP members were coexpressed. Fig. 5C shows the binding of the different C/EBP combinations to the non-consensus C/EBP binding sequence, and Fig. 5D shows the binding to the consensus sequence. The binding to the consensus sequence showed that heterodimers were formed, and their binding was supershifted by the antibodies selective for each of the C/EBP members present in the heterodimer. The binding of C/EBPalpha -C/EBPdelta and C/EBPbeta -C/EBPdelta mixtures was totally supershifted with C/EBPalpha antibody, consistent with the fact that C/EBPalpha was expressed in relative excess, forming a homodimer. In contrast, heterodimers containing C/EBPbeta did not bind to the non-consensus sequence as illustrated by the fact that C/EBPbeta antibody was unable to supershift the binding of C/EBPs on the non-consensus sequence (Fig. 5C). These results demonstrate that C/EBPbeta homodimers and heterodimers do not bind to the C/EBP non-consensus binding sequence present on the PPARgamma 2 promoter and that consequently C/EBPbeta heterodimers do not stimulate PPARgamma 2 promoter activity.


View larger version (99K):
[in this window]
[in a new window]
  		Fig. 5.   A, transcriptional activity of C/EBPalpha , C/EBPbeta , and C/EBPdelta on the mouse PPARgamma 2 promoter. Fifty nanograms of the control empty vector (pEFbos) and/or expression plasmids encoding the cDNA for expression of the indicated proteins were transiently cotransfected in 3T3-L1 preadipocytes with 100 ng of PPARgamma 2 linked to a luciferase reporter gene. The basal level of luciferase activity obtained with the control is set to 1, and transactivation is calculated as the ratio of the activities obtained with the different coexpressed C/EBPs to the basal luciferase activity. The data are expressed as the mean ± S.E. promoter (n = 4). B, gel shift-supershift assay of C/EBPs binding to two adjacent C/EBP binding consensus sequences. One microgram of COS-1-transfected cellular extracts was used for the analysis of the binding. C, gel shift-supershift assay of C/EBPs binding to the non-consensus sequence of C/EBP binding sites on the PPARgamma 2 promoter. Four micrograms of COS-1-transfected cellular extracts for expression of the different C/EBPs, as indicated in the figure, were used for the binding analysis. D, binding of C/EBPs to the C/EBP binding consensus sequences as in B. One microgram of COS-1-transfected cellular extracts was used for the analysis of the binding. In all experiments, 1 µg of normal serum (NS) immunoglobulin or a C/EBP antibody (Ab) was added to the reaction mixture, as indicated, for supershift analysis.

Identification of the Region of C/EBPbeta That Inhibits Binding to C/EBP Binding Sites on the PPARgamma 2 Promoter-- To investigate the structural basis involved in the differential binding of C/EBPbeta versus C/EBPalpha and C/EBPdelta , two hybrid molecules were constructed. C/EBPalpha -beta harbored the N-terminal part of C/EBPalpha (amino acids 1-273) and the C terminus of C/EBPbeta (amino acids 213-296); its counterpart C/EBPbeta -alpha was composed of the N-terminal part of C/EBPbeta (amino acids 1-212) and the C terminus of C/EBPalpha (amino acids 274-359). The N-terminal part of the molecules included the transactivation domain, and the C terminus contained the DNA binding and dimerization domains (Fig. 6A). Fig. 6, B and C shows that C/EBPalpha -beta was able to bind and transactivate the PPARgamma 2 promoter to a similar extent as C/EBPalpha . In contrast, C/EBPbeta -alpha failed to bind and activate the PPARgamma 2 promoter. As a control, C/EBPalpha -beta and C/EBPalpha or C/EBPbeta -alpha and C/EBPbeta showed similar binding to the consensus C/EBP binding site. These results indicate that the region N-terminal to the DNA binding domain of C/EBPalpha allows the binding to the PPARgamma 2 promoter binding sites. In contrast, the N-terminal region of C/EBPbeta did not permit the binding to these sites.


View larger version (33K):
[in this window]
[in a new window]
  		Fig. 6.   Transcriptional and binding activity of two C/EBPalpha -C/EBPbeta hybrid molecules. A, schematic representation of wild type C/EBPalpha and C/EBPbeta and the two hybrid molecules. C/EBPalpha -beta harbors the N-terminal part of C/EBPalpha (amino acids 1-273) and the C terminus of C/EBPbeta (amino acids 213-296). C/EBPbeta -alpha contains the N terminus of C/EBPbeta (amino acids 1-212) and the C terminus of C/EBPalpha (amino acids 274-359). AD, activation domain; BR, basic region; LZ, leucine zipper. B, cotransfection of 3T3-L1 preadipocytes. The control empty vector (pSVSPORT1) or indicated expression vectors were transiently cotransfected with the PPARgamma 2 promoter linked to a luciferase reporter gene. Results are expressed as luciferase activity relative to the basal level obtained with the control vector. The data are expressed as the mean ± S.E. from three different experiments. C, binding activity analyzed by gel shift assay. The different proteins overexpressed in transfected COS-1 cell extracts were reacted with C/EBP binding sites on the PPARgamma 2 promoter and with the sequence mutated to form a C/EBP binding site consensus sequence.

To further investigate whether a domain within C/EBPbeta was responsible for the prevention of the binding, we generated various constructs expressing the different length of the C-terminal part of C/EBPbeta containing the DNA binding and dimerization domains. The lane numbers in Fig. 7 represent the expression of different DNA constructs: 1, control (empty) vector; 2, N208C/EBPbeta ; 3, N202C/EBPbeta ; and 4, N191C/EBPbeta . These constructs contained a Kozak sequence to allow efficient protein expression. As shown in Fig. 7, A and B, although the level of expression of these different constructs varied greatly, all the truncated proteins bound to both PPARgamma 2 promoter and a consensus C/EBP binding site. The addition of C/EBPbeta antibody resulted in the inhibition of binding and weak supershift, showing the specific binding of the truncated C/EBPbeta proteins (Fig. 7B). These results further indicate that the N-terminal region, but not the DNA binding domain of C/EBPbeta , is responsible for the impaired binding of the full-length protein.


View larger version (78K):
[in this window]
[in a new window]
  		Fig. 7.   Binding activity of C/EBPbeta truncated proteins containing the C-terminal DNA binding domain and the dimerization domain of C/EBPbeta . The lane numbers represent the expression of different DNA constructs: 1, pSVSPORT1 (control empty vector); 2, KOZ-N208C/EBPbeta ; 3, KOZ-N202C/EBPbeta ; and 4, KOZ-N191C/EBPbeta . KOZ represents the insertion of a Kozak sequence around the start codon. A, expression of the different proteins in transfected COS-1 cells. The C/EBPbeta -related proteins expressed in COS-1 cell extracts (1 µg of protein) were detected by Western blot analysis using a C/EBPbeta antibody. B, binding of the C/EBPbeta truncated proteins overexpressed in COS-1 cells to radiolabeled oligonucleotides containing the C/EBP binding sites on the PPARgamma 2 promoter or the consensus binding sites on the mutated PPARgamma 2 promoter. The transfected cellular extracts (4 µg for the binding of PPARgamma 2 promoter oligonucleotide, 1 µg for the binding of mutated PPARgamma 2 promoter oligonucleotide) were preincubated without or with C/EBPbeta antibody (1 µg) for supershift analysis.

To investigate the role of the flanking regions of the DNA binding domain in C/EBPbeta inhibition of binding to the PPARgamma 2 promoter, we constructed a set of C/EBPbeta deletion mutants, N213C/EBPbeta , Delta 137-212C/EBPbeta , and Delta 184-212C/EBPbeta . These constructs, illustrated in Fig. 8A, contained a Kozak sequence inserted around the first start codon. The lane numbers represent the expression of different DNA constructs: 1, pSVSPORT 1 (control vector); 2, wild type C/EBPbeta ; 3, KOZ-C/EBPbeta ; 4, KOZ-N213C/EBPbeta ; 5, KOZ-Delta 137-212C/EBPbeta ; and 6, KOZ-Delta 184-212C/EBPbeta . The protein expression in COS-1 cells was analyzed by immunoblot and detected with a C/EBPbeta antibody directed to the C-terminal part of C/EBPbeta , therefore recognizing all mutant proteins (Fig. 8B). Lane 2 shows that the C/EBPbeta construct induced the synthesis of 38- and 35-kDa proteins, corresponding to the molecular masses of LAP1 and LAP2, respectively, and two 20- and 18-kDa proteins, corresponding to the molecular mass of LIP. The insertion of the Kozak sequence in the C/EBPbeta constructs (lane 3) inhibited the translation of lower molecular weight products as expected (11). N213C/EBPbeta (lane 4) was expressed at a lower level than the other C/EBPbeta proteins. The internally deleted C/EBPbeta , Delta 137-212C/EBPbeta (lane 5) and Delta  184-212C/EBPbeta (lane 6), expressed proteins of the expected sizes. Delta 184-212C/EBPbeta migrated as a doublet, which was also observed by other workers (27). The upper band disappeared when the extract was treated with alkaline phosphatase, suggesting that it resulted from phosphorylation (data not shown). We then analyzed the binding of these proteins to the C/EBP binding sites in the PPARgamma 2 promoter and to the C/EBP binding consensus sequence as a positive control (Fig. 8C). The binding specificity for C/EBPbeta -related proteins was analyzed by the addition of C/EBPbeta antibody, which resulted in a supershift. The results show that unlike C/EBPbeta (lanes 2 and 3), N213C/EBPbeta (lane 4), Delta 137-212C/EBPbeta (lane 5), and Delta 184-212C/EBPbeta (lane 6) were able to bind to the PPARgamma 2 promoter. Two specific complexes were resolved during analysis of Delta 184-212C/EBPbeta binding on the PPARgamma 2 promoter. Despite their binding activity on the PPARgamma 2 promoter, the two internally deleted mutants were unable to induce the PPARgamma 2 promoter activity, whereas they stimulated the activity of the p21 promoter (data not shown). These results indicate that the activation domain of the two internally deleted mutants is intact and that a C/EBPbeta structural motif prevents the PPARgamma 2 promoter transactivation. We conclude that the internal sequence of C/EBPbeta comprised between amino acids 184 and 212 flanking the DNA binding domain modulates C/EBPbeta binding to the PPARgamma 2 promoter.


View larger version (85K):
[in this window]
[in a new window]
  		Fig. 8.   Binding activity of various C/EBPbeta deletion proteins. The lane numbers represent the expression of different DNA constructs: 1, pSVSPORT 1 (control vector); 2, wild type C/EBPbeta ; 3, KOZ-C/EBPbeta ; 4, KOZ-N213 C/EBPbeta ; 5, KOZ-Delta 137-212 C/EBPbeta ; and 6, KOZ-Delta 184-212 C/EBPbeta . A, schematic representation of the different constructs coding for full-length, N-terminal, or internally deleted C/EBPbeta proteins. The expression of these proteins was promoted by the insertion of a Kozak sequence around the start codon as indicated. AD, activation domain; BR, basic region; LZ, leucine zipper. B, overexpression of the different C/EBPbeta -related proteins in COS-1 cells. The cells were transfected with the different constructs, and the protein detection in cell lysates (1 µg of protein) was performed by Western blot using a C/EBPbeta antibody. C, binding of the different C/EBPbeta -related proteins overexpressed in COS-1 cells to radiolabeled oligonucleotides containing the C/EBP binding site on the PPARgamma 2 promoter (left side) or the consensus C/EBP binding site on the mutated PPARgamma 2 promoter (right side). The transfected cellular extracts (4 µg for the binding of PPARgamma 2 promoter oligonucleotide, 0.8 µg for the binding of mutated PPARgamma 2 promoter oligonucleotide) were preincubated without or with C/EBPbeta antibody (0.8 µg) for supershift analysis.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

In this study, the results obtained using the luciferase reporter assay indicate that the mouse PPARgamma 2 promoter is differentially regulated by different C/EBPs. C/EBPalpha and C/EBPdelta induce, but C/EBPbeta inhibits, the activity of the promoter. We show that unlike C/EBPalpha and C/EBPdelta , which display low binding affinity, C/EBPbeta does not bind to two juxtaposed non-consensus sequences in the PPARgamma 2 promoter. The negative effect of C/EBPbeta on PPARgamma 2 promoter activity is possibly due to the formation of heterodimers containing exogenously expressed C/EBPbeta and other endogenous C/EBP family members, which are unable to bind C/EBP binding sites in the PPARgamma 2 promoter. Similarly, it has been reported previously that C/EBPdelta but not C/EBPbeta transactivates the IGF-I promoter via a core C/EBP half-site, GCAAT (32). A number of other studies show differential action of C/EBPalpha and C/EBPbeta in activating various promoters (13, 18, 33, 34). Our observations establish a link between the DNA sequence of C/EBP binding sites and the differential binding of various C/EBP members.

To understand the structural differences between C/EBPalpha and C/EBPbeta that mediate the differential biological effect on the PPARgamma 2 promoter, we created two hybrid molecules. The activity of these molecules generated by the exchange of the regulatory domains of C/EBPalpha and C/EBPbeta demonstrates that the N-terminal domain but not the DNA binding or leucine zipper domains of C/EBPbeta is responsible for the differential effect. Whereas the N-terminal part of C/EBPalpha allows binding to the PPARgamma 2 promoter and subsequent transactivation, the equivalent C/EBPbeta structure, N-terminal to the DNA binding domain, prevents this. The deletion of the amino acids upstream of the C/EBPbeta DNA binding domain shows that a region located at amino acids 184-212 prevents binding to the PPARgamma 2 promoter. Although the internally deleted Delta 137-212C/EBPbeta and Delta 184-212C/EBPbeta bind to the PPARgamma 2 promoter, these proteins are unable to induce PPARgamma 2 promoter activity. It is also possible that cell-specific factors necessary for C/EBPbeta -mediated PPARgamma 2 promoter activation are absent in 3T3-L1 preadipocytes. Previously, it was reported that the binding activity of C/EBPbeta is modulated by its interaction with other transcription factors and in response to cytokines, which enhanced C/EBPbeta binding to cognate DNA sequences (13, 18, 35). This region of C/EBPbeta contains a repressor domain called RD2 (repressor domain 2) that was characterized for its ability to partially inhibit C/EBPbeta binding to the albumin promoter in a cell-specific manner (27). Two possible mechanisms have been suggested for the action of RD2. 1) Phosphorylation of this region results in unfolding of C/EBPbeta from an inactive to an active state. 2) This region is involved in the interaction of C/EBPbeta with other modulating proteins bound to neighboring cis-regulatory sites, creating structural changes (27). Another study shows that C/EBPbeta chimeric proteins, containing either the leucine zipper or activation domain of C/EBPalpha , are unable to activate the CYP2D5 natural promoter but are fully active on an artificial promoter bearing a high affinity C/EBP binding site (36). Current models for C/EBPbeta transactivation involved a C/EBPbeta inactive state that is switched to be active, leading to C/EBPbeta -induced gene transcription (22, 37). The N-terminal transactivation domain interacts with the C-terminal part of the molecule and prevents its interaction with basic transcription machinery (22, 27). Therefore a range of signaling pathways, effector molecules, and protein-protein interactions might converge on the inhibitory regions of C/EBPbeta , depending on the architecture of the promoter. The region flanking the DNA binding domain that mediates differential DNA recognition provides specificity for members of different families of transcription factors that display high homology within their DNA binding domains. It has been reported that replacement of 20 amino acids adjacent to the DNA binding region in HNF3beta (hepatocyte nuclear factor 3) corresponding to residues in HFH-1 (HNF3/forkhead homologues) alters HNF3beta binding (38). Similarly, two other transcription factors, Ets1 and Ets2, contain inhibitory regions located adjacent to their DNA binding domains that affect DNA binding activity (39). Our results clearly demonstrate that the N-terminal part of C/EBPbeta modulates its binding to, and function on, the mouse PPARgamma 2 promoter. C/EBPbeta is a highly regulated transcription factor, and our observation may be relevant with regard to a mechanism by which C/EBPbeta regulates PPARgamma 2 expression. In this context, the human PPARgamma 2 promoter is activated by C/EBPbeta via a binding site located at -56 base pairs from the start codon (40). This site is conserved in the mouse PPARgamma 2 promoter (located at -120 base pairs), but the two other binding sites characterized in this study are different in the human and mouse promoters (5). These differences in C/EBP binding sites may reflect differences in the expression of human PPARgamma 2, which seems to be expressed at a lower level than its murine homologue (4, 5).

It appears that the role of C/EBPs in the transcriptional regulation of PPARgamma promoters is certainly complex and cannot be fully understood from results obtained in a unique experimental system. Based on experiments utilizing the ectopic expression of C/EBPs, C/EBPalpha or C/EBPbeta , but not C/EBPdelta , induces PPARgamma gene expression during the conversion of multipotential mesenchymal stem cells to adipocytes (41-43). Consistent with these results, the level of expression of PPARgamma during primary embryonic fibroblast differentiation is drastically reduced in cells derived from C/EBPbeta knockout mice compared with cells from wild type animals (44). In contrast, targeted deletion of C/EBPbeta in mice does not alter PPARgamma expression in adipose tissue but impairs adipogenesis (44). Studies on the PPARgamma promoters further reveal the complexity of the regulation of PPARgamma expression by C/EBPs. C/EBPs are able to activate the human PPARgamma 2 promoter but not the human PPARgamma 1 promoter (40). Glucocorticoid-induced adipocyte differentiation from bone marrow stromal cells mediated C/EBPdelta gene transcription within hours, whereas PPARgamma 2 gene transcription is activated within days (25). Our study and others (24, 25) show that C/EBPdelta is a potent transactivator of the mouse PPARgamma 2 promoter but that the ectopic expression of this transcription factor does not induce PPARgamma expression (43). The inability of C/EBPbeta to bind and to stimulate PPARgamma 2 promoter activity in our experimental system implies structural changes, mediated by the flanking region of the C/EBPbeta DNA binding domain. Also, tissues expressing high levels of C/EBPalpha and C/EBPbeta , such as liver or lung, do not contain detectable amounts of PPARgamma 2. It is possible that multiple C/EBP binding sites on the PPARgamma 2 promoter mediate the C/EBP response. Mutation of these two C/EBP binding sites at -340 bp and -327 bp relative to the transcriptional start site reduced C/EBPalpha and C/EBPdelta activation of the PPARgamma 2 promoter by approximately 50% (24), indicating that these sites contribute to PPARgamma 2 promoter activity. In addition, deletion of the promoter at -320 bp, which did not include the tandem repeat of the C/EBP binding sites, resulted in partial loss of C/EBPdelta -inducible activity, suggesting that other C/EBP binding sites might be involved in PPARgamma 2 promoter activation (25). These results together support a C/EBPbeta mechanism of action involving context-specific effects due to promoter composition and/or signal-dependent regulatory pathways.

The differential expression of various C/EBPs may play a central role in the transcriptional regulation of a number of adipocytic genes including PPARgamma 2. During the process of adipogenesis in 3T3-L1 preadipocytes, the expression of C/EBPbeta and C/EBPdelta is elevated during the early phase. Whereas C/EBPdelta expression declines abruptly, the level of C/EBPbeta decreases at a slower rate to a basal level, and, in parallel, the expression of C/EBPalpha is induced (9). Therefore, the expression of C/EBPbeta is accompanied by coexpression of C/EBPalpha and C/EBPdelta . A high level of expression of C/EBPs is probably necessary for the subsequent activation of the PPARgamma 2 promoter, considering the low affinity C/EBP binding sites of the promoter. The proximal promoter of the C/EBPalpha gene contains a C/EBP regulatory element, but it appears that a delay in transcription activation of C/EBPalpha by C/EBPbeta and C/EBPdelta occurs. This phenomenon is probably due to a delay in the acquisition of binding activity by these transcription factors, as suggested by the phosphorylation that C/EBPbeta undergoes concomitantly with the acquisition of DNA binding activity (37). Similarly, PPARgamma 2 transcription activation occurs with a delay of 18 h to 3 days as compared with C/EBPbeta and C/EBPdelta expression (25, 37, 40). To analyze whether the differential activity of various C/EBPs controls PPARgamma 2 transcription, further dissection of the molecular pathways involving C/EBPs in PPARgamma 2 expression is required. Such dissection may provide an insight into the finely tuned regulatory mechanisms necessary for adipocyte function.

    ACKNOWLEDGEMENTS

We thank Drs. M.-J. Tsai, J. Rosen, and M. Burcin and members of the laboratory for helpful discussions and Drs. D. Auboeuf, N. Barron, N. Osherov, and J. Wong for critical reading of the manuscript. We also thank Drs. S. L. McKnight (University of Texas, Southwestern Medical Center, Dallas, TX), P. F. Johnson (National Cancer Institute, Frederick Cancer Research and Development Center, Frederick, MD), and M. Liu (Baylor College of Medicine, Houston, TX) for providing plasmids.

    FOOTNOTES

* This work was supported in part by National Institutes of Health Grants DK44988 and DK55636 (to S. Y. T.).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

§ Present Address: Dept. of Integrative Biology and Pharmacology, MSB 5.004, University of Texas, 6431 Fannin Street, Houston, TX 77030.

|| Supported by National Institutes of Health Grant CA50898. Present Address: Zen-Bio, Inc., 3200 Chapel Hill-Nelson Blvd., Suite 102, P. O. Box 12593, Research Triangle Park, NC 27709.

** To whom correspondence should be addressed: Dept. of Molecular and Cellular Biology, Baylor College of Medicine, One Baylor Plaza, Houston, TX 77030. Tel.: 713-798-6251; Fax: 713-798-8227; E-mail: stsai@bcm.tmc.edu.

Published, JBC Papers in Press, June 20, 2000, DOI 10.1074/jbc.M003593200