HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

J. Biol. Chem., Vol. 275, Issue 36, 28291-28300, September 8, 2000

This Article Abstract Full Text (PDF) All Versions of this Article: 275/36/28291    most recent M002726200v1 Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Robyr, D. Articles by Wahli, W. Search for Related Content PubMed PubMed Citation Articles by Robyr, D. Articles by Wahli, W. Social Bookmarking                      What's this?

Determinants of Vitellogenin B1 Promoter Architecture

HNF3 AND ESTROGEN RESPONSIVE TRANSCRIPTION WITHIN CHROMATIN^*

Daniel Robyr^§¶, Anne Gegonne^§¶, Alan P. Wolffe^§, and Walter Wahli^**

From the  Institut de Biologie animale, Université de Lausanne, Bâtiment de Biologie, CH-1015 Lausanne, Switzerland and the ^§ Laboratory of Molecular Embryology, NICHD, National Institutes of Health, Bethesda, Maryland 20892-5431

Received for publication, March 30, 2000, and in revised form, June 2, 2000

	ABSTRACT

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

The liver-specific vitellogenin B1 promoter is efficiently activated by estrogen within a nucleosomal environment after microinjection into Xenopus laevis oocytes, consistent with the hypothesis that significant nucleosome remodeling over this promoter is not a prerequisite for the activation by the estrogen receptor (ER). This observation lead us to investigate determinants other than ER of chromatin structure and transcriptional activation of the vitellogenin B1 promoter in this system and in vitro. We find that the liver-enriched transcription factor HNF3 has an important organizational role for chromatin structure as demonstrated by DNase I-hypersensitive site mapping. Both HNF3 and the estrogen receptor activate transcription synergistically and are able to interact with chromatin reconstituted in vitro with three positioned nucleosomes. We propose that HNF3 is the cellular determinant which establishes a promoter environment favorable to a rapid transcriptional activation by the estrogen receptor.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Vitellogenin is the precursor of the yolk proteins that represent a major source of nutrients for the developing embryo in oviparous vertebrates (1). Its liver-specific expression is controlled by estrogen in adult females (2) through its receptor which interacts as a homodimer with the estrogen responsive element (ERE)¹ in the promoter of the vitellogenin genes (3, 4). Functional studies of the Xenopus vitellogenin B1 promoter in cultured human breast cancer cell lines have revealed the presence of an estrogen responsive unit (ERU: region 334 to 302 relative to the start site of transcription) composed of two imperfect EREs (5). A third functional ERE was detected farther upstream in the region 555 to 543. The Xenopus vitellogenin B1 promoter (6) encompasses additional cis-acting elements for the liver-enriched factors HNF3 and C/EBP as well as for the ubiquitous protein CTF/NF1 (7). Tissue specificity may be achieved by a combination of these various transcription factors together with a specialized chromatin structure.

Chromatin is intimately related to the expression of eukaryotic genes in vitro and in vivo (8). Nucleosome assembly over a promoter is implicated in establishing the repression of many inducible genes (9-11). Although nucleosomes were often reported to globally repress transcription, the precise position of a nucleosome on a promoter can also improve transcriptional activation (12-15). Such a nucleosome, positioned in vitro on the promoter of the vitellogenin B1 gene in a region devoid of transcription factor-binding sites (between 300 and 140 relative to the start site of transcription), potentiates estrogen receptor-dependent transcriptional activation. We have suggested that the wrapping of DNA around the histone octamer allows a better interaction between the distal estrogen receptor and proximal trans-activators (such as HNF3 and CTF/NF1) and/or the basal transcription machinery (14). Interestingly, HNF3 and NF1 are both able to modulate the position of a nucleosome (16-18) and HNF3 can replace linker histone on the serum albumin gene enhancer (19). Since HNF3 and NF1 bind to the vitellogenin B1 promoter, they may have important roles in the assembly of this regulatory DNA into organized chromatin structure in vivo.

In this study we have analyzed the interplay between the estrogen receptor and HNF3 on the vitellogenin B1 promoter within chromatin following microinjection into oocytes. We show that HNF3 induces DNase I hypersensitivity within the proximal regulatory elements concomitant to the activation of transcription. In addition, when expressed before chromatin assembly, HNF3 and the estrogen receptor activate transcription synergistically suggesting either that HNF3 establishes a chromatin structure favorable for subsequent association of the estrogen receptor binding or that they interact directly or through a common target. We have determined the positions of three nucleosomes over the vitellogenin B1 promoter in vitro. These nucleosomes do not interfere with ER and HNF3 recruitment and are not displaced.

	EXPERIMENTAL PROCEDURES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Plasmid Constructs-- The pBS(596/+8)VgB1 plasmid was obtained by subcloning the BamHI/RsaI fragment of pB1(596/+8)CAT8+ (5, 20) into pBluescript KS BamHI/EcoRV sites. The subcloned fragment contains the vitellogenin B1 (598/+8) promoter sequence and about 0.1 kilobase of the CAT reporter gene. The mutated promoters were prepared as follows. The pB1noERE plasmid was constructed by site-directed mutagenesis of the pBS(596/+8)VgB1 leading to the introduction of point mutations in all 3 EREs. The oligonucleotides used for the mutagenesis are shown hereafter with the underlined mutated residues: (338/297) 5'-CTCCAGACACTGTGAACCAACCCAAGATATCATAACCTCTTA-3'; (560/539) 5'-TGGAGGGACACAGGGAACATGC-3'. The mutations were verified by DNA sequencing. Additional EREs were also subcloned upstream of the TATA box to generate the construct pB1(6ERE). Briefly, 2 ERU oligos designed from the wild type promoter (position 337 to 300), which contains two imperfect EREs, were flanked by AvaI sites (top strand: 5'-TCGGGTCCAGTCACTGTGACCCAACCCAAGTTATCGTGACCTC-3'; bottom strand: 5'-CCCGAGAGGTCATGATAACTTGGGTTGGGTCACAGTGACTGG A-3'). The annealed oligonucleotides were multimerized and then introduced into the BglII site (position 41) of pBS(596/+8)VgB1. This generated one construct with 1 ERU and 1 ERE. Since the wild type promoter already contains 3 EREs, the mutated promoter was named pB1(6ERE). The single stranded DNAs were prepared from phagemids induced with the VCS M13 helper phage (21).

The plasmids used for in vitro mRNA transcription were prepared as follows. The xER coding sequence was amplified from pKCR2xER (22) by polymerase chain reaction using oligonucleotides generating XbaI and PstI sites. The polymerase chain reaction fragment was then introduced into the same sites of the plasmid pSP64(poly(A)) (Promega) to generate the xERpSP64(poly(A)) construct. rHNF3pMS(II) plasmid was obtained after introduction of the SacI/HindIII fragment (from pRB-HNF3, gift from K. S. Zaret) into the same sites of pMS(II) which is a modified version of pSP64(poly(A)) containing additional unique restriction sites after the poly(A) segment.²

In Vitro mRNA Synthesis and Microinjection of Xenopus Oocytes-- Constructs for in vitro mRNA synthesis were linearized either with EcoRI (xERpSP64(poly(A))) or with AvrII (rHNF3pMS(II)). The mRNA in vitro synthesis was carried out with the SP6 mMessage mMachine Kit (Ambion) according to the recommended procedure. The isolation procedure of Xenopus laevis oocytes was performed as described previously (23). Stage VI oocytes were microinjected (13.8 nl) (Drummond nanoject) with the indicated amount of in vitro transcribed mRNA. After an overnight incubation in MBSH buffer (23) at 18 °C, the oocytes nuclei (GV) were microinjected with the pBS(596/+8)VgB1 as ssDNA (1 ng). The oocytes were processed as described below generally after 6 h incubation at 18 °C.

Transcription Assay and DNA Recovery-- A group of 15 to 20 oocytes was collected per sample and homogenized in 10 µl/oocyte of 0.25 M Tris-HCl at pH 8.0. The equivalent of 10 oocytes was used for RNA purification and transcription analysis and the remaining 5 oocytes equivalent was used for DNA recovery. Total RNA was prepared from the homogenate using the RNazol^TM method (Tel-Test Inc.). The RNazol^TM reagent (500 µl) together with chloroform (50 µl) was added to the homogenate (100 µl) which was then incubated on ice for 15 min before centrifugation. The clear supernatant was then transferred to a fresh tube and precipitated with 1 volume of isopropyl alcohol. The washed RNA pellet (70% EtOH) was resuspended in 100 µl of TE buffer and precipitated once again for at least 1 h at 4 °C with 30 µl of 10 M LiCl. The RNA pellet was then washed with 70% EtOH and dissolved in 20 µl of diethyl pyrocarbonate-treated water. Half of the RNA sample (5 oocytes) was analyzed by primer extension.

The RNA (10 µl) was supplemented with 10 µl of a first strand synthesis buffer (×2, provided by Life Technologies, Inc.), 5 mM dithiothreitol and end-labeled CAT-(5'-GGTGGTATATCCAGTGATTTTTTTCTCCAT-3') and H4-(5'-GGCTTGGTGATGCCCTGGATGTTATCC-3') primers (0.2 pmol each). The H4 primer is used as an internal control and detects the endogenous histone H4 mRNA. Annealing occurred for 10 min at 65 °C, 30 min at 55 °C, 20 min at 37 °C, and 5 min at room temperature. The reverse transcription reaction was carried out at 42 °C upon addition of 1 µl of 10 mM dNTPs and 100 units of the Superscript^TM II RT (Life Technologies, Inc.). The reaction was stopped after 1 h by ethanol precipitation. The extension products were resolved on a 8% sequencing gel and visualized by autoradiography.

DNA was recovered from the remaining 5 oocytes equivalents of the homogenate (see above). DNA recovery after injection is a control monitoring the microinjection efficiency. This DNA was also used for the supercoiling assay (see below). One volume of 1% SDS and 20 mM EDTA, pH 8.0, was added to the sample which was then treated for 2-3 h with proteinase K (200 µg/ml) at 55 °C. DNA was then extracted twice with phenol/chloroform and precipitated at room temperature with isopropyl alcohol. The washed DNA pellet (70% EtOH) was then dissolved in 100 µl of TE buffer, treated with RNase A (100 µg/ml) for 1 h at 37 °C, extracted with phenol/chloroform, and finally isopropyl alcohol precipitated. The recovered DNA was quantitatively analyzed by Southern blot as described (21). Blots were then probed with random-primed labeled ssDNA from the vitellogenin B1 promoter.

DNase I-hypersensitive Site Analysis-- After injection, groups of 20 to 25 oocytes were collected and homogenized in 300 µl of digestion buffer (20 mM Tris-HCl, pH 8.0, 50 mM NaCl, 2 mM MgCl₂, 1 mM EDTA, 1 mM dithiothreitol, and 5% glycerol). The homogenate was divided into three 100-µl fractions and digested for 1 min (room temperature) with, respectively, 160, 120, and 80 units of DNase I (Life Technologies, Inc.). The reactions were stopped with 2 volumes of 1% SDS and 20 mM EDTA and treated for 1 h at 37 °C with RNase A (100 µg/ml). The samples were then incubated with Proteinase K (200 µg/ml) for at least 3 h. DNA was finally purified as described above (see "Transcription Assay and DNA Recovery"). The DNA pellets were resuspended in 50 µl of 1 × BamHI buffer and digested with 10 units of BamHI for 2 h (Life Technologies, Inc.). The samples were then once again extracted with phenol/chloroform and isopropyl alcohol precipitated. The DNA fragments were resolved on a 1.5% agarose gel, blotted to a Zeta-probe^TM GT membrane (Bio-Rad), and probed with a random-primed labeled promoter fragment (596/445). As a control, free dsDNA (2 ng/oocyte) was mixed with non injected oocytes and treated immediately with DNase I under the same conditions as described above.

Micrococcal Nuclease Assay-- The injected oocytes (20 per sample) were homogenized in 200 µl of MNase digestion buffer (10 mM Hepes, pH 8.0, 50 mM KCl, 2 mM MgCl₂, 3 mM CaCl₂, 1 mM dithiothreitol, 0.1% Nonidet P-40, and 8% glycerol) and split into four tubes (50-µl aliquots). Increasing amounts of micrococcal nuclease (Worthington) were added into the different aliquots (0.04, 0.2, 1, and 5 units) and digestion was allowed to proceed at room temperature for 20 min. The reaction was stopped with 1 volume of 1% SDS and 20 mM EDTA, pH 8.0. DNA was then purified according to the method described above (see "Transcription Assay and DNA Recovery"). The fragments following digestion were resolved on a 1.5% agarose gel in 1 × TBE and blotted into a Hybond-N+ membrane (Amersham Pharmacia Biotech) as indicated (21). The membrane was then probed with a random-primed labeled probe corresponding to the vitellogenin B1 promoter (region 596/+139).

Supercoiling Assay for Chromatin Disruption-- The supercoiling assay was performed according to a method described earlier (24). Generally, the equivalent of DNA recovered from one injected oocyte was loaded onto a 1.1% agarose gel in 1 × TPE buffer (40 mM Tris, 30 mM NaH₂PO₄, 10 mM EDTA). Chloroquine (90 µg/ml) was included in the gel and in the running buffer. Under these conditions the different topoisomers will be positively supercoiled, reflecting the differences in negative supercoiling depending on the original variations in nucleosomes density on the minichromosomes. Electrophoresis was performed overnight in the dark at 3.5 V/cm. DNA was subsequently blotted onto a Hybond-N+ membrane (Amersham Pharmacia Biotech) by capillary transfer as described (21). The membrane was then probed with random-primed labeled ssDNA from the vitellogenin B1 promoter.

Nucleosome Reconstitution-- Nucleosomes were reconstituted on radiolabeled DNA fragments by salt/urea dialysis as described earlier (25). After reconstitution, the oligonucleosome cores were loaded on 10-30% sucrose gradients and centrifuged for 24 h at 38,000 rpm at 4 °C in a Beckman SW41 rotor. Fractions were collected and analyzed in 0.5 × TBE nucleoprotein-agarose (0.7%) gels. Fractions containing trinucleosomes and above were pooled together, concentrated through a Microcon-30 (Amicon), dialized overnight at 4 °C against 10 mM Tris-HCl, pH 7.5, 0.1 mM EDTA, 1 mM ₂-mercaptoethanol, and then concentrated to 20 µg/ml. Samples were stored at 4 °C until use. Chicken erythrocyte oligonucleosomes were prepared after removal of linker histone (26) and used as control for isolation of the native trinucleosome complexes.

Micrococcal Nuclease Mapping-- Reconstituted chromatin (100 ng of DNA) was digested with 0.01, 0.02, and 0.04 units of MNase (Worthington) for 5 min at 22 °C in the presence of 0.5 mM CaCl₂. Digestions were started by concomitant addition of MNase and CaCl₂ and stopped by addition of 5 mM EDTA, 0.25% (w/v) SDS, and 1 mg/ml proteinase K. After phenol/chloroform extraction and precipitation, the recovered DNA was 5' end-labeled with [³²P]ATP and T4 polynucleotide kinase. End-labeled fragments were separated by electrophoresis in nondenaturing 6% polyacrylamide gels. DNA fragments of nucleosome core and chromatosome products were recovered and digested with restriction enzymes to determine microccoccal nuclease cleavage sites. The digestions were analyzed on 8% denaturing gel.

Gel Mobility Retardation Assay-- Recombinant HNF3 was purified by affinity chromatography from SF9 cells infected with an HNF3 recombinant baculovirus generated by the BaculoGold kit (Pharmingen). Purified hER was purchased at Panvera. Binding reactions were performed in a 15-µl final volume of 1 × binding buffer (10 mM Tris-HCl, pH 8.0, 5 mM MgCl₂, 50 mM NaCl, 150 µg/ml bovine serum albumin, 100 µg/ml poly(dI-dC)) with 100 fmol of labeled DNA and 300 fmol of HNF3 or hER. Protein-DNA complexes were separated on a 0.25 × TBE nondenaturing agarose gel.

DNase I Footprinting-- Binding reactions were performed as described above, except that poly(dI-dC) was omitted in the binding buffer. DNase I digestions were carried out at a final MgCl₂ concentration of 2.5 mM. Naked DNA was treated with 1 unit/ml DNase I for 20 s and reconstituted DNA with 10 units/ml for 40 s. Reactions were stopped by addition of EDTA to 10 mM and phenol/chloroform extraction. Footprints were analyzed by denaturing gel electrophoresis. For these experiments, Escherichia coli expressed and purified HNF3 was kindly provided by Dr. K. Zaret.

	RESULTS

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Regulation of the Vitellogenin B1 Promoter by ER and HNF3-- The estrogen receptor is only one of several transcription factors that regulate vitellogenin B1 gene expression. The basal promoter element (BPE, region 119/32) encompasses multiple binding sites for liver-enriched factors like HNF3 and C/EBP and for the ubiquitous CTF/NF1 (Fig. 1A) (7). The contribution of these proteins has been already analyzed in vitro or by transient transfection (20, 27). However, these assays provide limited insights on how these transcription factors might function within chromatin. We have therefore decided to take advantage of the Xenopus oocyte microinjection system to examine this issue. Microinjection of DNA into the nucleus of Xenopus leads to chromatin assembly (23) which has been shown to influence the transcriptional regulation of the Xenopus HSP70 and TR promoters (11, 28). Oocytes also provide an efficient translational machinery which allows the study of the regulation of a given promoter by expressing specific transcription factors (29, 30) by injecting mRNA encoding these components either before or after chromatin assembly.

View larger version (38K): [in this window] [in a new window]   Fig. 1.   . HNF3 and ER activate transcription synergistically in oocytes. A, schematic representation of the 5'-flanking region of the vitellogenin B1 promoter, subcloned upstream of a fragment of the CAT reporter gene (construct pBS(596/+8)VgB1). The promoter is composed of 1 ERU and 1 ERE (ERE3). Previous work have shown the position of a nucleosome in vitro between the ERU and the NRE (negative regulatory element: 133/119) (14, 20). The basal promoter element (BPE, 119/74) and the NRE encompass numerous cis-acting elements for the transcription factors CTF/NF1 (gray oval), HNF3 (dark rectangles), and C/EBP (black dot) (7). Additional putative CTF/NF1 recognition elements are located upstream of the nucleosome. B, groups of oocytes were injected with 3 ng of ER or HNF3 mRNA before chromatin assembly which occurs after injection of single stranded pBS(596/+8)VgB1 (1 ng) as indicated in the cartoon. Oocytes were incubated in the presence or absence of 50 nM E2 as indicated, shortly after the second injection. Transcription was assayed by primer extension 6 h later. The positions of the vitellogenin B1 transcripts (VitB1) and the endogenous H4 mRNA (internal control) are indicated.

The capacity of the intact ER to activate transcription was tested after injection of a CAT reporter template fused to the vitellogenin B1 promoter (596/+8), which contains three EREs (Fig. 1A). Since chromatin assembly occurs with more rapid kinetics on microinjected ssDNA during second strand synthesis in comparison to the injection of dsDNA (23), we made use a of ssDNA template. The ssDNA was injected after the expression of ER, meaning that the receptor was present during chromatin assembly. In contrast to an ealier report (31) we find that the exogenous ER activates transcription in injected oocytes (Fig. 1B, compare lane 1 to lanes 3 and 4). In this particular experiment the addition of 17--estradiol (E2) did not stimulate transcription further (Fig. 1B, lane 4). This is not surprising since mature oocytes already contain enough endogenous estradiol to ensure receptor activity (32, 33). Alternatively, ligand-independent activation may be obtained through the receptor AF-1 activation domain (34) or through the interaction with other proteins such as cyclin D1 (35, 36). In few other experiments, a modest additional 2-fold stimulation by exogenous estrogen was observed reflecting probable variations among oocytes batches.

The liver-enriched transcription factor HNF3 has multiple binding sites on the proximal region of vitellogenin B1 promoter (Fig. 1A) (7). One site lies just downstream of the nucleosome positioning sequence (14). HNF3 (37) significantly stimulates transcription when synthesized before chromatin assembly (Fig. 1B, lanes 5 and 6). Co-injection of both HNF3 and ER before chromatin assembly resulted in the strongest activity observed indicating that they might cooperate to facilitate transcription (Fig. 1B, lanes 7 and 8). This demonstrates that the assembly of the promoter into chromatin does not prevent its capacity to regulate transcription.

Several lines of evidence from previous studies have suggested that NF1 somehow influences the activity of a chromatin template when the transcription factor is present during chromatin assembly. Depletion of an NF1-like activity reduces transcription by 5-fold from the vitellogenin B1 promoter during the assembly of chromatin in Xenopus oocyte extract (38). Moreover, the CTF/NF1 proline-rich activation domain was shown to interact with the core histone H3 in yeast and mammalian cells in response to transforming growth factor  (18). Interestingly, one NF1 DNA binding element is located downstream of the positioned nucleosome in the vitellogenin B1 promoter (Fig. 1A). NF1 cannot interact in vitro with nucleosomal DNA over the murine mammary tumor virus promoter regardless of its binding site orientation and position (39). It was therefore important to test NF1 ability to affect transcription when expressed either before or after chromatin assembly. In our microinjection assay, however, expression of NF1 had no effect on transcription in the oocyte nucleus (data not shown).

In summary, these results indicate that HNF3 and ER are both competent to activate transcription from a chromatin template when present during or after chromatin assembly (Fig. 1B and data not shown). The crystal structure of the DNA-binding domain of HNF3 has striking similarities with the structured globular domain of the linker histone H5 (40, 41). Interestingly HNF3 can direct the assembly of a nucleosome on the serum albumin enhancer where it is able to replace the linker histone H1 in vivo (16, 17, 19). Its presence during chromatin assembly process might therefore modify the nucleosomal organization on the vitellogenin B1 promoter. This suggests either that the vitellogenin B1 promoter chromatin organization is already preset for activation or that HNF3 may participate in nucleosomes remodeling, directly or indirectly. We next tested the role of HNF3 in the organization of chromatin structure directly.

HNF3 Induces Strong DNase I-hypersensitive Sites on the Vitellogenin B1 Promoter-- DNase I-hypersensitive sites generally reflect the stable association of transcription factors with nucleosomal DNA. This increased accessibility also correlates with the activation of transcription. We have investigated DNase I accessibility to the vitellogenin B1 promoter upon expression of ER and HNF3 during chromatin assembly (Fig. 2).

View larger version (105K): [in this window] [in a new window]   Fig. 2.   HNF3 induces the formation of DNase I-hypersensitive sites on the vitellogenin B1 promoter. Groups of oocytes were injected with 3 ng of ER or HNF3 mRNA before chromatin assembly as described in the legend to Fig. 1. Oocytes were incubated in the presence or absence of 50 nM E2 as indicated, shortly after the second injection. Samples were treated with increasing amounts of DNase I (80, 120, or 160 units) as described under "Experimental Procedures." The free dsDNA control (pBS(596/+8)VgB1) was mixed with uninjected oocytes and treated immediately with DNase I under the same conditions. The purified DNA was then subjected to BamHI restriction (596) and after transfer, the filters were hybridized with a 151-base pair probe (596/445). On the left side are indicated the various positions within the vitellogenin B1 promoter (see also Fig. 1A). The arrowheads point to the DNase I-hypersensitive sites.

The vitellogenin B1 promoter is relatively resistant to DNase I digestion after injection as ssDNA into the Xenopus oocyte nuclei (Fig. 2, compare lanes 1-3 to free dsDNA which was mixed with non injected oocytes shortly before DNase I treatment, lanes 13-15). The expression of ER leads to no major transition in DNase I cleavage. There is a very weak cleavage by DNase I upstream of the 300 region potentially reflecting a low efficiency of ER association with the ERU (Fig. 2, lanes 4-6 and 10-12).

The strongest hypersensitive site is observed upon HNF3 expression and extends from the start site of transcription to the downstream boundary of the in vitro positioned nucleosome around 140 (Fig. 2, lanes 7-9) (14). We speculate that the presence of HNF3 leads to chromatin modification and facilitates the interaction of ER with the ERU.

Gene activation is often associated with an alteration or transition in chromatin structure. Such potential chromatin alterations on the vitellogenin B1 promoter were tested by monitoring DNA topology and micrococcal nuclease digestion (MNase). Single-stranded DNA was co-injected into the oocytes and chromatin assembly on the replicated duplex DNA was analyzed 6 h later (Fig. 3A). MNase-treated chromatin samples were blotted to a nylon membrane and were probed with a DNA sequence encompassing the whole promoter region and downstream sequences (596/+139). The MNase ladder observed in the absence of ER is consistent with the assembly of spaced nucleosomes (Fig. 3B, compare panels 1 and 3). The definition of the nucleosomal repeat is reduced upon expression of ER in the presence of estradiol (Fig. 3B, panel 2). Such a loss of nucleosomal repeat is generally interpreted as representative of nucleosome disruption (42, 43). However, the nucleosomal repeat does not entirely disappear in this assay. We suggest that the vitellogenin B1 promoter segment containing EREs shows evidence of limited chromatin reorganization dependent on the activity of ligand-bound estrogen receptor as revealed using micrococcal nuclease.

View larger version (45K): [in this window] [in a new window]   Fig. 3.   ER and chromatin disruption. A, groups of oocytes were injected with 3 ng ER mRNA as indicated. After an overnight incubation, ssDNA (1 ng of pBS(596/+8)VgB1) was injected and the ER expressing oocytes were incubated with 50 nM E2. Then, 6 h later, collected oocytes were assayed for MNase, DNA topology and transcription. B, the global nucleosomal array from the whole plasmid is wealky disturbed by ER when present during chromatin assembly. The injected oocytes were treated with increasing amounts of MNase (0.04, 0.2, 1, and 5 units). The free DNA control (lane 3) corresponds to dsDNA (pBS(596/+8)VgB1) mixed with uninjected oocytes (2 ng per oocyte) shortly before MNase treatment. After DNA transfer, the filter was hybridized with a random-primed labeled promoter probe encompassing region 596/+139. Lane 3 is a shorter exposure of the same filter. C, ER does not alter the DNA topology through the EREs of the vitellogenin B1 promoter. Two promoter constructs were injected as indicated in A together with [-32P]dCTP (0.1 µCi/oocyte). These constructs contain either no ERE (point mutations introduced in all EREs of the wild type promoter pBS(596/+8)VgB1) or 6 EREs (3 additional EREs corresponding to the wild type ERU and one ERE subcloned upstream of the TATA box). DNA was purified from each group and the topoisomers distribution was analyzed in a chloroquine-agarose gel as described under "Experimental Procedures." Lanes 9-12 are profiles of the corresponding lanes 5-7. D, transcriptional activation of the various promoter mutants. Groups of oocytes from the very same injection experiments used in C were analyzed by primer extension. The positions of the vitellogenin B1 transcripts (VitB1) and of the endogenous H4 mRNA (internal control) are indicated.

The loss of nucleosomes or the alteration in the path of DNA around an histone octamer can be estimated from a supercoiling assay. DNA topoisomers can be resolved in agarose gels containing chloroquine (44). In our experimental conditions the loss of nucleosomes from the injected template in the oocytes will generate DNA molecules with distinct topologies compared with unaltered chromatin templates. We have injected a mutated vitellogenin B1 promoter containing an insertion of 3 additional ERE upstream of the TATA box. Since the wild type promoter contains 3 EREs, this insertion will generate a construct with 6 EREs totally. Our data show that the expression of ER before chromatin assembly leads to the loss of nucleosomes from the minichromosomes (Fig. 3C, compare lanes 5 and 6 with lanes 7 and 8). The global change of topology is not dramatic and densitometric scans indicate the loss of only two to three nucleosomes. The addition of estradiol leads to a further small topological change toward loss of superhelicity. These data also indicate that changes in DNA topology is not proportional to levels of transcription since the alterations of topology are similar between both promoter constructs despite of the huge transcriptional activity (over 100-fold activation) observed with the promoter containing 6 EREs (Fig. 3D, lanes 7 and 8). Surprisingly, the introduction of point mutations in every single EREs of the wild type promoter did not prevent the receptor dependent change of DNA topology (Fig. 3C, lanes 1-4). Thus, our MNase digestion and topology assays (Fig. 3) suggest that a substantial alteration of the chromatin environment, dependent on the EREs, is not required for the activation of the vitellogenin B1 promoter by ER.

In Vitro Nucleosome Mapping Over the Vitellogenin B1 Promoter-- The lack of dramatic chromatin remodeling dependent on the estrogen receptor is consistent with the receptor binding in a linker region as predicted by the in vitro mapping of a nucleosome downstream of the ERU and functioning most effectively within a nucleosomal environment (14). In order to gain more insight on the link existing between transcription and nucleosome positioning we decided to map nucleosomes in vitro over the entire promoter area. We also analyzed the impact of linker histones on the position of nucleosomes.

We reconstituted nucleosome cores on a 724-base pair template containing the vitellogenin B1 promoter (596/+8) (Fig. 4). Reconstituted chromatin was then fractionated on a sucrose gradient (Fig. 4A). Fractions containing trinucleosomes were subsequently pooled and as a control, an aliquot was refractionated on a second sucrose gradient with MNase-treated erythrocyte chromatin (Fig. 4, B and C). Next we made use of these reconstituted templates to map the position of nucleosomes (Fig. 5). DNA fragments from core particles were eluted from the polyacrylamide gel after MNase treatment and digested with a set of endonucleases in order to map the translational positioning of nucleosomes relative to the vitellogenin B1 promoter sequences (Fig. 5). Although there is no strong translational positioning of any nucleosomes, it is possible to distinguish several positions despite of the relative nucleosome mobility along the promoter (See Fig. 5B for a summary). Two nucleosomes with preferred translational positionings are located over the TATA box (83/+63) and between the ERU and the upstream ERE (522/376) (thick arrows in Fig. 5B). In a series of additional experiments, different fragments of the vitellogenin B1 promoter were reconstituted and analyzed under the same conditions as above. Globally, the results obtained are similar than those observed with the full-length promoter (data no shown). No strong positioning signal could, however, be mapped in the region 300/140 where a mononucleosome was first described (14, 45). Weak bands indicate that the edge of a nucleosome (359/213) covers the ERU (334/302) (Fig. 5A, see SspI digestion). The lack of strong positions over this promoter area suggests that this third nucleosome is extremely mobile. Linker histones were shown to restrict nucleosome mobility on the Xenopus somatic 5 S RNA gene correlating with transcriptional repression (25). We have also found that the inclusion of histone H1 on the reconstituted vitellogenin B1 promoter has no apparent influence on the multiplicity of nucleosome positions (data not shown).

View larger version (73K): [in this window] [in a new window]   Fig. 4.   Preparation and characterization of nucleosome cores reconstituted on the vitellogenin B1 promoter. The fragment used in Figs. 4, 5, and 7 is composed of the vitellogenin B1 promoter (596/+8) and of a portion of the CAT gene (30/+90). A, radiolabeled DNA templates were reconstituted with increasing amounts of purified core histones (molar ratio of core histones to DNA: 0.8, 1, and 1.2). The products were fractionated on a 10-30% sucrose gradient and each fraction was analyzed by nucleoprotein gel electrophoresis. B and C, purified nucleosome cores co-sediment with native trinucleosome complexes. The fraction containing tri or more nucleosomes were combined and refractionated on sucrose gradient with unlabeled chicken erythrocyte oligonucleosomes (B). DNA from each fraction was run on a 1.5% agarose gel and stained with ethidium bromide. M, low DNA size marker. Fraction 1 corresponds to the bottom of the sedimentation gradient. Location after sedimentation of free DNA and mono-, di-, or trinucleosomes are indicated. C, autoradiogram of the gel in B showing the position of the reconstituted nucleosome fragment in the gradient.

View larger version (45K): [in this window] [in a new window]   Fig. 5.   Micrococcal nuclease mapping of core and chromatosome positions along the vitellogenin B1 promoter fragment. A, DNA from core particles (prepared from MNase-digested trinucleosome complexes) was eluted from a preparative acrylamide gel (not shown) and digested with restriction enzymes in order to define the positions of the histones-DNA particles. Dots, white or black arrows represent the multiple positions occupied by the histone octamers on the promoter. These positions are pointed on the schematic diagram (B) by the same symbols marked with an asterisk. Digestions in lanes 1-8 refer to the particles located in the vicinity of the AccI and AvaII restriction sites whereas lanes 9-12 and lanes 13-15 correspond, respectively, to the SspI/DraI and BglII/AvaI promoter regions. The following enzymes were used: PvuII (P), AccI (A), AvaII (Av), AlwNI (Al), BspHI (Bs), SspI (Ss), DraI (D), StyI (St), BglII (B), and AvaI (A1). Thick arrows, depicted in the diagram (panel B), represent the major core or chromatosome positions. Black, dotted and dashed boxes correspond to the EREs and HNF3 or NF1 DNA binding sites, respectively. The TATA box is displayed as a white box.

We conclude that nucleosomes have multiple positions over the vitellogenin B1 promoter with two preferences for the regions (522/376) and (83/+63) in vitro. Importantly the estrogen responsive elements are devoid of nucleosomes, except for one weak position over the ERU. This predicts that the estrogen receptor would be able to bind onto the promoter within chromatin. Similarily, one HNF3 recognition site (125/119) is free of nucleosomes. However, two HNF3 DNA binding elements (81/75 and 58/52) are embedded into the TATA box nucleosome.

The Estrogen Receptor and HNF3 Associate with the Vitellogenin B1 Promoter within Chromatin-- The nucleosome mapping described above is consistent with HNF3 and ER binding to internucleosomic regions. Therefore, these transcription factors should gain access to the promoter without difficulty. We have tested their DNA binding ability on the reconstituted vitellogenin B1 promoter (418/+150) (Fig. 6). We show that purifed ER and HNF3 are indeed able to interact with their cognate DNA binding elements within reconstituted chromatin. This interaction is specific since it is competed away by specific oligonucleotides and not by random sequences (Fig. 6, lanes 11-18). The specific complexes shifted by ER and HNF3 are different between free and reconstituted DNA indicating that nucleosomes are not displaced (Fig. 6, compares lanes 2-9 with lanes 11-18). We conclude that both proteins are competent for binding onto chromatin.

View larger version (51K): [in this window] [in a new window]   Fig. 6.   ER and HNF3 interact with the reconstituted 418/+150 vitellogenin promoter fragment. Free (lanes 1-9) or reconstituted (lanes 10-18) DNA was incubated with either purified ER (lanes 2-5 and 11-14) or HNF3 (lanes 6-9 and 15-18). Binding was performed either in the absence (ER, lanes 2 and 11; HNF3, lanes 6 and 15) or presence of oligonucleotide competitors (ER, lanes 3-5 and 12-14; HNF3, lanes 7-9 and 16-18. ere (consensus estrogen responsive element: AGCTTAGTTTATTGGGTCACAGTGACCTTACCACAAGGA); ere* (mutated ere: AGCTTAGTTTATTGGAACACAGTGTTCTTACCACAAGGA); h (HNF3 transthyretin-binding site: GTTGACTAAGTCAATAATCAGAATCAG); h* (mutated HNF3 transthyretin binding site: GTTGACAAAGTCAATAATCAGAATCAG); r (random sequence: CACAGTTGGCACAGTGCCAAAAGCC). The different shifted complexes are indicated on the left of the figure. The open and solid arrows represent the binding of HNF3 and ER to free DNA, respectively, whereas the tailed arrow corresponds to the interaction of either ER or HNF3 with a nucleosome.

It is, however, necessary to perform DNase I footprinting experiments in order to determine whether ER and/or HNF3 interact with nucleosomes or in linker regions (Fig. 7). The reconstituted vitellogenin B1 promoter shows a clear 10-base pair modulation in DNase I representative of the presence of a rotationally positioned nucleosomes (Fig. 7, compare lanes 1-4 with lanes 5-8). The nucleosome boundaries are indicated by arrows on the left side of Fig. 7 (as determined earlier in Fig. 5). The addition of HNF3 induces partial protection as well as appearance of DNase I-hypersensitive sites on both free and reconstituted DNA (Fig. 7, lanes 2-4 and 6-8). These protections correspond to the location of the previously identified HNF3-binding sites (7). One of these DNA-binding sites (125/119) is located in a region devoid of nucleosomes whereas the other two sites (81/75 and 58/52) lie within a nucleosome, apparently without disturbing it. Interestingly, others have suggested that HNF3 is able to modulate the position of a nucleosome (16, 17). Although we do not have such evidence for the vitellogenin B1 promoter, it is noteworthy that the 85/75 HNF3-binding site maps precisely to the upstream edge of a nucleosome.

View larger version (43K): [in this window] [in a new window]   Fig. 7.   DNase I footprinting of HNF3 on the reconstituted vitellogenin B1 promoter (596/+150). Increasing amounts of purified HNF3 proteins (0.3, 0.6, and 1.2 pM) were added to 100 ng of either naked (lanes 2-4) or reconstituted (lanes 6-8) DNA. Lanes 1 and 5 are control reactions for free and reconstituted DNA. Arrows represent the core particle positions along the vitellogenin B1 promoter and brackets correspond to the DNA-binding sites protected by HNF3. M, MspI-digested pBR322 size marker.

	DISCUSSION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

The vitellogenin B1 promoter was extensively analyzed in the past using either transient transfection or in vitro transcription assays (5, 20) but little is known about its regulation in a chromatin context. Early experiments have analyzed the effect of estrogen on chromatin opening in Xenopus and chicken liver nuclei (see discussion below). However, these previous studies gave no clear indication on the contribution of other hepatic nuclear factors. The Xenopus oocyte microinjection system allowed us to identify such a factor in a chomatin context. Here we show that the nuclear transcription factor HNF3 plays a majors role in opening chromatin and helping hormonal regulation of the vitellogenin gene. We have also mapped the position of nucleosomes in vitro over the vitellogenin promoter in order to relate chromatin structure to transcription.

A Function for HNF3 in Opening the Promoter of the Vitellogenin B1 Gene-- HNF3 increases dramatically the accessibility of the promoter to DNase I from the start site of transcription to the downstream boundary of the nucleosome mapped in vitro (see Fig. 2). This region contains several binding sites for HNF3. However, HNF3 has no recognition element on the vitellogenin B1 promoter upstream of this nucleosome and yet helps to promote DNase I accessibility in the ERU region. Although the ERU is about 180 base pairs apart from the closest HNF3-binding site, the folding of DNA around the histone octamer could bring them within a much closer range (14). Alternatively, the increased DNase I accessibility over a long distance like observed on the vitellogenin B1 promoter, rather than on a discrete area, is consistent with the disruption of a higher order chromatin structure. Several lines of evidence suggest that HNF3 might influence the formation of higher order chromatin structures. First, the winged-helix domain of HNF3 is found in the linker histones H5 and H1 and they all share striking similarities (40, 41, 46). Second, HNF3 was shown to replace a linker histone on the edge of a positioned nucleosome on the serum albumin enhancer but was not able to compact internucleosomic DNA as does H1 or H5 (19). Although the Xenopus oocytes contain a linker histone variant (cleavage stage linker histone B4) (47), this protein binds to DNA with much reduced affinity compared with H1 (48) and it is likely that HNF3 would replace B4 in chromatin when a specific recognition site is present.

Since HNF3 is a liver-enriched transcription factor and that the vitellogenin B1 gene is expressed exclusively in hepatocytes, it is possible that HNF3 might preset the promoter for a rapid response to estrogen. A previous study indicated that a male liver extract contains all the specific factors involved in the derepression and induction on the vitellogenin B1 promoter, but sufficient ER (49). More recently we have shown that the vitellogenin B1 proximal promoter is accessible to restriction enzyme in hepatocytes but not in erythrocytes where the gene is silent, indicating that chromatin structure is different in these cells (50). In the same study we could not detect any differences between estrogen-induced females and uninduced males suggesting that a tissue-specific factor, not related to gender (possibly HNF3), is responsible for this defined chromatin structure. Furthermore, an in vivo fooprinting study has revealed that the (81/70) HNF3-binding site is occupied in male and female hepatocytes but not in erythrocytes (7). As importantly, it was shown that the amount of injected ER mRNA required to activate chromosomal vitellogenin genes in oocytes is reduced when receptor-free liver nuclear extracts are co-injected (33).

The vitellogenin B1 promoter is also regulated by the ubiquitous transcription factor CTF/NF1 which was reported to interact with the core histone H3 and to modulate the nucleosome position (18). However, we observed neither an activation of transcription, nor an induction of DNase I-hypersensitive site in the oocyte system (data not shown) even though NF1 was previously shown to activate transcription synergistically with ER (27, 51).

HNF3, Nucleosome Positioning, and Implications in the Activation of the Vitellogenin B1 Gene-- HNF3 and ER cooperatively activate transcription when present during chromatin assembly suggesting either that they somehow interact physically or that HNF3 helps the recruitment of ER on a loosened chromatin environment. HNF3 was also implicated in directing the position of a nucleosome in vitro similar to that seen in vivo on the serum albumin enhancer (16, 17).

In this study we show that HNF3 is indeed able to interact with chromatin in linker regions and on apparent nucleosomes without disturbing their positions. Therefore DNase I hypersensitivity (Fig. 2) does not necessary reflect displacement of nucleosomes from DNA (11, 52). HNF3, like TR/RXR generates a robust DNase I-hypersensitive site without significant change in DNA topology (data no shown) suggesting that nucleosome numbers remain constant. Preferential DNase I cleavage might reflect direct recruitment by HNF3 by protein-protein contacts or local disruption of chromatin folding. We propose that HNF3 has a dual function in the activation of the vitellogenin B1 promoter. In a first step, HNF3 replaces the linker histones leading to a decompaction of the chromatin fiber (19). In a subsequent step, HNF3 may prevent the sliding of nucleosomes over important regulatory elements. The priming of the promoter by HNF3 during liver differentiation (53) will elicit a rapid response to estrogen in females or hormone-stimulated males. It is likely that the nucleosome (85/+60) positioned over the TATA box will be significantly altered upon initiation of transcription but HNF3 is probably not involved directly in this process since it does not displace this nucleosome (Fig. 7). One can speculate that additional cellular components would play in important role subsequent to the recruitment of ER to the promoter such as the SWI·SNF chromatin remodeling complex (54) or an histone acetyltransferase activity.

The Estrogen Receptor and Alterations in Chromatin Structure-- Our experiments indicate that ER in isolation induces a weak DNase I-hypersensitive site when expressed during chromatin assembly (Fig. 2). This is consistent with early in vivo experiments showing that Xenopus vitellogenin genes from estrogen-treated male liver cells display only a modest increase in DNase I sensitivity although transcription is efficient (55, 56). A more precise study of the chicken vitellogenin (VTG II) gene, which is already marked in liver by internal and 3' end hypersensitive sites, demonstrates the appearance of strong additional hypersensitive sites in the 5' end region of the gene upon estrogen treatment (57, 58). It seams that estrogen-related remodeling events are more important in chicken than in Xenopus, although we do not know whether this difference reflects more profound regulation specificities between both species. Importantly, the activation of the chromosomal Xenopus vitellogenin B2 gene in oocytes requires the expression of a huge excess of receptors in comparison to the level which is needed in a liver nucleus (33). However, co-injection of receptor-free liver nuclear extract significantly reduces the amount of receptor needed. This clearly suggests that the estrogen receptor does not easily activate transcription without other hepatic nuclear factors. This might also explain why estrogen induces strong DNase I-hypersensitive sites in chicken liver but not in our oocytes experiments.

The estrogen receptor interacts with SWI2·SNF2 suggesting that the SWI·SNF complex participates in chromatin remodeling events (54). However, in the oocyte system, we could not detect a change of topology which depends directly on any of the described vitellogenin B1 promoter EREs (Fig. 3) and the nucleosomal array is not dramatically altered by ER. It is not clear whether the DNase I-hypersensitive site stems only from the receptor binding to the promoter or from subsequent subtle chromatin alterations that are not detected in our crude assays. Activation of transcription by nuclear hormone receptors is believed to be mediated by a growing family of coactivators which includes SRC-1 (59), p300/CBP (60-62), ACTR (63), and P/CAF (64). All of the cofactors possess intrinsic histone acetyltransferase activity (63, 65-67). Thus it is probable that part of ER-dependent transcriptional activation of the vitellogenin B1 promoter will involve histone acetylation. The recent resolution of the nuclesome core particle has shown that one histone H4 tail makes intensive contacts with the face of an H2A/H2B dimer from an adjacent nucleosome (68). This is extremely relevant in the context of chromatin decompaction through acetylation.

Recently, two rotationally and translationally positioned nucleosomes were mapped in vivo on the human estrogen responsive pS2 promoter (69). Their positions were not affected by the estrogen receptor although the pS2 ERE is localized within the 5' edge of one nucleosome. According to the in vitro assembly of trinucleosomes on the vitellogenin B1 promoter (Fig. 5) the ERU lies in a linker region or at the edge of a nucleosome (359/213). Therefore, the receptor should gain access to the promoter without difficulty as we have seen with the gel shift experiments (Fig. 6). Moreover, since the presence of this nucleosome in vitro potentiates activation of transcription by ER (14), it seems unlikely that the receptor would favor a major chromatin perturbation in this region.

Unlike many promoters, the vitellogenin B1 gene does not require profound chromatin reorganization at the nucleosomal level. We think, however, that local higher-order chromatin structure unfolding, probably by HNF3, is a key event in liver-specific activation of the vitellogenin B1 gene. Such a role for HNF3 in the regulation of a nuclear hormone-regulated promoter is suggested for the first time.

	ACKNOWLEDGEMENTS

We thank K. S. Zaret for the kind gift of the HNF3 plasmid as well as for the bacterially expressed HNF3. We are grateful to A. K. Hihi and M. Vogelauer for helpful advice and critical reading of the manuscript.

	FOOTNOTES

^* This work was supported by the Etat de Vaud, Swiss National Science Foundation, "Fondation du 450e Anniversaire," and the National Institutes of Health.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

^¶ Contributed equally to the results of this work.

Present address: Dept. of Biological Chemistry, Molecular Biology Inst., University of California, Los Angeles, CA 90095.

^** To whom correspondence should be addressed. Tel.: 41-21-692-41-10; Fax: 41-21-692-41-15; E-mail walter.wahli@iba.unil.ch.

Published, JBC Papers in Press, June 14, 2000, DOI 10.1074/jbc.M002726200

² M. Stolow, unpublished data.

	ABBREVIATIONS

The abbreviations used are: ERE, estrogen responsive element; ER, estrogen receptor; ERU, estrogen responsive unit; CAT, chloramphenicol acetyltransferase; ssDNA, single stranded DNA; dsDNA, double stranded DNA; MNase, micrococcal nuclease; E2, estradiol.

	REFERENCES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES