Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M003980200 on June 7, 2000

J. Biol. Chem., Vol. 275, Issue 37, 29076-29081, September 15, 2000
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
275/37/29076    most recent
M003980200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hamada, M.
Right arrow Articles by Maraia, R. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hamada, M.
Right arrow Articles by Maraia, R. J.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Transcription Termination by RNA Polymerase III in Fission Yeast

A GENETIC AND BIOCHEMICALLY TRACTABLE MODEL SYSTEM*

Mitsuhiro HamadaDagger, Amy L. Sakulich, Shashi B. Koduru, and Richard J. Maraia§

From the Laboratory of Molecular Growth Regulation, NICHHD, National Institutes of Health, Bethesda, Maryland 20892-2753

Received for publication, May 10, 2000, and in revised form, June 5, 2000

    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

In order for RNA polymerase (pol) III to produce a sufficient quantity of RNAs of appropriate structure, initiation, termination, and reinitiation must be accurate and efficient. Termination-associated factors have been shown to facilitate reinitiation and regulate transcription in some species. Suppressor tRNA genes that differ in the dT(n) termination signal were examined for function in Schizosaccharomyces pombe. We also developed an S. pombe extract that is active for tRNA transcription that is described here for the first time. The ability of this tRNA gene to be transcribed in extracts from different species allowed us to compare termination in three model systems. Although human pol III terminates efficiently at 4 dTs and S. pombe at 5 dTs, Saccharomyces cerevisiae pol III requires 6 dTs to direct comparable but lower termination efficiency and also appears qualitatively distinct. Interestingly, this pattern of sensitivity to a minimal dT(n) termination signal was found to correlate with the sensitivity to alpha -amanitin, as S. pombe was intermediate between human and S. cerevisiae pols III. The results establish that the pols III of S. cerevisiae, S. pombe, and human exhibit distinctive properties and that termination occurs in S. pombe in a manner that is functionally more similar to human than is S. cerevisiae.

    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

RNA polymerase (pol)1 III is a multisubunit enzyme that is directed to initiate RNA synthesis by transcription factors (TF) that bind to gene promoter elements. pol III transcripts comprise a large variety of small nuclear and cytoplasmic RNAs (1). Although there is diversity in the promoter structures of pol III-transcribed genes, three classes are responsible for the synthesis of most cellular pol III transcripts, tRNAs, 5 S rRNA, and U6 small nuclear RNA (2). Each of these represent a gene class that utilizes a characteristic promoter structure and specific set of TFs (3). 5 S rRNA genes comprise class I and contain a principal internal promoter that is recognized by TFIIIA. Class 3 genes utilize upstream TATA elements and in metazoans an upstream element recognized by a distinct multisubunit TF (4). Class 2 genes are represented by tRNA genes, which use an internal promoter comprised of proximal box A and distal box B elements. Distinct subunits of TFIIIC bind to the A box, B box, and terminator element of the class 2 genes and facilitate the assembly of this class of preinitiation complexes (3, 5). For each gene class, TFIIIB (or related activity) binds just upstream of the start site of transcription, and this in turn serves as the initiation factor proper as it recruits pol III (Refs. 6-8 and references therein). Subunits of TFIIIB as well as pol III have been conserved from Saccharomyces cerevisiae to human, as have two TFIIIC subunits that localize near the start site of transcription (9-14). By contrast, the downstream TFIIIC subunits in these organisms reveal no recognizable sequence homology (12, 15, 16).

Some evidence suggests that efficient transcription requires termination and associated activities that promote pol III recycling (17-22). Upon encountering the dT(n) tract that comprises the pol III termination signal, by pol III itself, the enzyme pauses and releases the transcript and template (23-26). Multiple subunits of pol III affect termination (Refs. 26 and 27 and also see Ref. 28). Evidence that TFIIIC and/or associated factors, as well as the -UUU-OH terminus binding protein, La, may facilitate pol III termination and reinitiation, exists for human-derived systems (19, 21, 22, 29, 30).

We modified a suppressor tRNA gene, sup3-e (31, 32), to serve as a reporter of pol III termination in the fission yeast Schizosaccharomyces pombe. To complement the results obtained, we developed an S. pombe-derived extract that is active for tRNA transcription. We took advantage of the extraordinary conservation of the tRNA gene promoter and the ability of the pol III machinery from different species to initiate transcription on it. Because sequence context can affect termination and, in some cases, associated activities of apparent regulatory significance, we also examined different pols III on the same template (17-19, 21, 27, 30, 33, 34). By this approach, a clear difference between S. cerevisiae and human pol III termination signal recognition was demonstrated with S. pombe pol III termination at an intermediate dT(n) length. Another difference supported the idea that S. pombe pol III termination may be mechanistically more similar to human than is S. cerevisiae. Finally, we examined transcription in the presence of alpha -amanitin, a small toxin that is known to inhibit certain eukaryotic RNA polymerases. This revealed a correlation between the response to a minimal dT(n) signal and sensitivity to alpha -amanitin by these pols III on the same template and further distinguished the enzymes.

    EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

A PstI-EcoRI fragment containing the sup3-e gene (35) was isolated from pRIP 1/s (36) and used for polymerase chain reaction mutagenesis, and a 0.4-kilobase pair fragment was cloned into the PstI and SacI sites of plasmid pJK148 (37). The sequence following the mature tRNAUGASer 3'-end in the monomeric tRNAUGASer genes is GAGATCTT(n). The cRT sequence, GAGCTCGGCCAAAAAGGCCGGGCTCGGAAAGGAGGTCTCCGTCACCAGCAGGATTTGAACCAATCAAGACTAGAATACAGGATTGAAGTCTAACTTTTTTTTAGCT, immediately follows the test terminator. Three substitutions were made in tRNAUGASerM as follows: C40T, T46.3C and C47.6T, numbered according to Ref. 31. One substitution resides in the anticodon stem and one in the variable arm stem, each converting a G:C to a G:U base pair, whereas the third resides in the loop of the extra arm (31). In the DNA, these substitutions reside between the A and B box promoter elements, in a region that is highly variable, that does not affect the transcription of other tRNA genes (38-40). The resulting plasmids of the series, tRNAUGASerM-2T (designated pMSer-2T), tRNAUGASerWT-2T (designated pSer-2T), -3T, -4T, etc. were linearized with NdeI and used to transform yAS50, h(-S), leu1-32, ura4, ade6-704, obtained from ATCC (Manassas, VA) as strain SP1190 (41). After selection for leucine prototrophy, cells were grown in YES. RNA was extracted with guanidinium thiocyanate and acid phenol:chloroform, EtOH-precipitated, electrophoresed on 6% polyacrylamide-urea, blotted, and probed with 32P-labeled oligonucleotide DNAs (42). The tRNAUGASerM probe, 5'-TGCGCGGACAGAGCCCATTAAAT-3', "MSer-UGA," is complementary to bases A38-A51 of tRNAUGASerM, present in precursors and mature species. The probe, "5'-mSer," 5'-CCACTCGGACATAGTGACTTTAGC-3', is directed to the common 5'-region of mature tRNAsSer (31, 43). The tRNACUULys probe was described (44).

S. pombe (yAS50) and S. cerevisiae (CG-1945, CLONTECH) extracts used for in vitro transcription were prepared according to Nichols et al. (45) with the following modifications for S. pombe. After breaking cells with glass beads, the lysate was made 0.6 M NaCl by the slow addition of 5 M NaCl. The extraction buffer contained antipain dihydrochloride (2.5 µg/ml), bestatin (0.35 µg/ml), chymostatin (2 µg/ml), leupeptin (0.5 µg/ml), pepstatin (0.4 µg/ml), and Pefabloc SC (0.1 mg/ml), all obtained from Roche Molecular Biochemicals. HeLa nuclear extract was prepared by a standard method (46).

Transcription reactions (25 µl) contained 60 mM KCl, 20 mM HEPES, pH 7.9, 10 mM MgCl2, 0.2 mM EDTA, 500 ng of plasmid DNA, 0.6 mM CTP, ATP, UTP, 0.05 mM GTP, 0.5 µCi of [alpha -32P]GTP (ICN, Costa Mesa), and 0.5 µl of RNasin (Promega). alpha -Amanitin was from Sigma. Quantitation was performed on a PhosphorImager (Molecular Dynamics).

    RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Development of a tRNA Reporter Gene Whose Activity in Fission Yeast Is Dependent on Accurate and Efficient Termination by pol III-- To investigate the cis elements required for termination, we deleted the tRNAiMet sequence of sup3-e and introduced test terminators consisting of varying lengths of dT residues, T(n), in place of the cryptic inefficient terminator (Fig. 1). Preliminary data suggested that constructs bearing inefficient terminators nonetheless produced functional tRNA, presumably because readthrough transcripts were correctly processed at their 3'-ends (47-49) (not shown). tRNA structure appears to be a major determinant of recognition by 3'-processing enzymes (50, 51), and although certain artificial sequences placed downstream of an inefficient terminator can interfere with 3'-processing, others support processing (47, 49). To ensure that tRNA expression would be dependent on accurate termination, we inserted a sequence downstream of the test terminator to interfere with tRNA formation if pol III was to read through the test terminator. This sequence is referred to as the complementary readthrough (cRT) region and can base pair with the 3'-half of the tRNAUGASer precursor to form an extended duplex that is not recognizable as a tRNA precursor (not shown). These changes do not alter the tRNAUGASer sequence or the residues immediately surrounding the 3'-processing site. Upon accurate termination at the T1 test terminator, this gene, designated tRNAUGASerWT, would be expected to produce a nascent precursor of 112 nucleotides (Fig. 1).


View larger version (31K):
[in this window]
[in a new window]
  		Fig. 1.   Derivation of the opal suppressor tRNA reporter genes used here. Schematic representation of the dimeric sup3-e gene and the modifications that led to the monomeric tRNAUGASer genes. The A and B box promoter and terminator elements are represented by diagonally hatched rectangles. The spacer between the two tRNA sequences in sup3-e is represented by a cross-hatched rectangle denoted Tc. First, test terminators T(n) were inserted downstream of the tRNAUGASer, in place of Tc. Second, tRNAiMet was deleted, and a sequence complementary to the 3'-half of tRNAUGASer (designated cRT) was inserted downstream of Tn. Third, three "silent" substitutions (31) (indicated by omega ) were introduced between the intron (shaded) and B box, to distinguish the transcript from related endogenous tRNAs on Northern blots (see text). The primary transcripts produced from the tRNAUGASerM construct are indicated as 112 nucleotides (nt) for the test terminator, T1, or 210 nucleotides for the default 8T terminator, T2.

To distinguish tRNAUGASer from its predecessor tRNAUCASer and other tRNAsSer, we introduced three "silent" substitutions (31) to allow specific detection by Northern blotting. The resulting gene was designated tRNAUGASerM (Fig. 1). These substitutions reside between the intron and box B, in a region of tRNA genes that is highly variable, such that they would not be expected to, nor do they, affect transcription (Refs. 31 and 38-40 and data not shown).

Termination-dependent Expression of Suppressor tRNAUGASer-- S. pombe cells carrying the ade6-704 allele accumulate red pigment in limiting adenine but grow as white colonies when ade6-704 is efficiently suppressed by tRNAUGASer (31). An ade6-704, leu1-32 strain, yAS50, was transformed with tRNAUGASerWT constructs harboring various test terminators in a vector that undergoes homologous integration at the leu1+ locus (37). Colonies were selected for leucine prototrophy, and the percentage of suppressed colonies was scored. No suppression was observed in cells transformed with the tRNAUGASerWT gene harboring 2 Ts in its terminator (Fig. 2A). This suggested that readthrough transcription beyond the 2T test terminator did not lead to suppression. The tRNAUGASerWT gene bearing a 3T test terminator reproducibly resulted in a significant number of partially suppressed and fewer fully suppressed colonies (Fig. 2A). The 4T terminator supported more suppression than the 3T terminator but significantly less than 5T or longer T tracts. Suppressor activity from the 5T, 6T, and 7T terminators yielded comparable, near-saturating amounts of suppression. Leucine prototrophs that have lost tRNAUGASerWT upon homologous recombination at the leu1+ locus, as monitored by polymerase chain reaction, typically account for 10-15% of the colonies that yield no suppression in this assay (not shown). Multiple integrated copies can also contribute to color heterogeneity (not shown (37)). Notwithstanding these limitations, since the only variable in the experimental design is the length of the dT tract of the test terminator, the data indicated that a significant and functional increase in termination occurred between 3 Ts and 4 Ts (Fig. 2A). At dT tracts of 5 Ts or longer, suppressor activity appeared saturated. From this we conclude that highly efficient termination appeared to occur at 5 Ts.


View larger version (22K):
[in this window]
[in a new window]
  		Fig. 2.   Termination-dependent suppression in S. pombe. A, tRNAUGASerWT constructs with test terminators of varying length dT tracts as depicted in Fig. 1 were assayed for suppressor activity. Partial suppression (pink) and full suppression (white) are represented as percent suppressed colonies (vertical axis) as indicated in the inset; typically, ~200 colonies of each are represented. B, activity of the tRNAUGASerM gene constructs as in A. Note that leucine prototrophs that have lost the tRNAUGASer gene upon homologous recombination at the leu1+ locus typically account for 10-15% of the colonies that yield no suppression in this assay, as determined by polymerase chain reaction (not shown, see text).

As noted above, tRNAUGASerM transcripts can be followed in vivo, whereas tRNAUGASerWT are not distinguishable by Northern blotting (not shown). The ability to follow an in vivo phenotype and RNA expression from the same gene prompted us to focus on tRNAUGASerM for the remainder of this study. Suppression was not detected unless the tRNAUGASerM test terminator harbored at least 5 Ts (Fig. 2B). This gene yielded limited suppressor activity even with an 8T terminator, which, as will be shown below, directs highly efficient termination. Although a minimum of 5 Ts produced efficient suppression, longer T tracts led to only a moderate increase in suppression. These data suggested that the limited activity of the tRNAUGASerM gene was not due to limited termination efficiency and that a large increase in termination occurred between 4T and 5T terminators, with only moderate increases at longer dT tracts.

In Vivo Evidence of Highly Efficient Termination at 5 Ts by S. pombe pol III-- Northern blot analysis of RNAs from cells expressing tRNAUGASerM constructs is shown in Fig. 3A. Background signal in lanes U and C revealed limited cross-reactivity of our probe with endogenous tRNA species (Fig. 3A). Constructs with 2-4 Ts produced low levels of mature tRNAUGASerM, consistent with their unsuppressed phenotypes, in addition to longer transcripts (indicated as RT, Fig. 3A). A probe specific for cRT confirmed that the long transcripts represented readthrough beyond the test terminator (not shown; the multiple bands may reflect various conformers of the self-complementary RNA). Constructs with 5 or more Ts produced mostly mature tRNAUGASerM with relatively little RT, consistent with their suppressed phenotype. The size and reactivity with oligonucleotide probes directed to the intron, 5'-leader, and 3'-trailer of the nascent transcript that would be expected from the tRNAUGASerM gene indicated that the band designated by "left-arrow Term" (Fig. 3A) corresponds to a unprocessed pre-tRNA whose synthesis was terminated at the test terminator, whereas the bands between this and the mature tRNA are processing intermediates (52). Quantitation revealed that the amount of mature tRNA in the 4T sample was significantly higher than in the 3T, 2T, and control samples, although this nonetheless represented low termination efficiency (not shown). The relatively high ratio of mature tRNA to RT from constructs with 5 or more Ts indicated high termination efficiency (Fig. 3A). A control probe that detects tRNACUULys (Fig. 3C) indicated that the difference in tRNAUGASerM levels in the suppressed and unsuppressed cells was significant.


View larger version (61K):
[in this window]
[in a new window]
  		Fig. 3.   Correlation between suppression and efficient termination by pol III as monitored by tRNAUGASerM transcripts in vivo. Northern blots of RNAs prepared from cells bearing integrated tRNAUGASerM genes with the test terminators indicated above the lanes. Lane U represents RNA from an untransformed cell line, and lane C represents a leu1+ transformant that lacks a tRNAUGASerM gene. The blot was probed sequentially to detect tRNAUGASerM (A), a combination of highly related mature tRNASer species (B), and tRNACUULys (C), respectively. D shows two each of 2T and 3T samples from independent transformants. The left-arrow Term to the right of the figure indicates the position of the accurately terminated transcript (see text). Readthrough (RT) transcripts are indicated as are the positions of the various mature tRNAs.

We also examined the steady state levels of tRNAsSer that are related to tRNAUGASerM. Fig. 3B shows the blot in Fig. 3A after stripping and rehybridization with an oligonucleotide probe complementary to an invariant region of three tRNASer sequences as well as tRNAUGASerM using the same conditions for both hybridizations. Quantitation revealed that tRNAUGASerM contributed to the level of total tRNAsSer by ~50% in these cells and therefore that it accumulated to a level similar to or greater than the tRNAsSer expressed from individual endogenous genes. This indicated that the limited activity of tRNAUGASerM is not due to a deficiency in accumulation but is instead more consistent with a decrease in the specific activity of the mature tRNAUGASerM as a suppressor.

The presence of a band representing termination at the test terminator (left-arrow Term) was detectable from constructs containing 3 or more dTs but less clear in 2T samples as illustrated in Fig. 3D. This provided evidence that a small amount of termination indeed occurs at a 3T terminator but not a 2T terminator. We conclude that highly efficient termination occurs at 5 Ts in S. pombe and that tRNAUGASerM is a reporter of pol III termination in vivo only if termination is highly efficient and accurate.

Faithful tRNA Transcription in a High Salt Extract of S. pombe; Pol III Termination Signal Recognition Is More Similar to Human Than Is S. cerevisiae-- After several failed attempts to develop extracts of S. pombe cells that were active for tRNA transcription using buffers containing 0.15-0.4 M salts, we determined that activity could be obtained by increasing the concentration of salt present during the extraction. 0.6 M NaCl yielded extracts that were active for tRNA transcription. The following criteria indicated that the transcripts were synthesized de novo by pol III as follows: (i) synthesis required the presence of all four NTPs (not shown); (ii) transcript size varied expectedly, depending on the length of the dT tract (below); (iii) transcript production was decreased by tagetitoxin, an inhibitor of pol III (data not shown), and alpha -amanitin at an intermediate concentration (below). Transcription efficiency was monitored at varying concentrations of KCl and MgCl2 and was found to be optimal at 60 and 10 mM, respectively (not shown), similar to other in vitro pol III systems, including the ones used below.

To compare termination on the same template and therefore control for sequence context, transcription complexes were assembled on tRNAUGASerM gene constructs using human, S. cerevisiae, and S. pombe cell extracts as the source of TFs and pol III. We examined tRNAUGASerM genes that differed in the T1 test terminator, the dT tract length of which is indicated by the numbers above the lanes in Fig. 4. In this assay, promoter-initiated transcripts that are not terminated at T1 are extended to the default terminator, T2 (see Fig. 1). Human pol III terminated at 4 Ts with a low but significant amount of transcription to T2 (Fig. 4A). S. pombe pol III terminated at 5 Ts with a low but significant amount of the T2 transcript produced (Fig. 4B). S. cerevisiae pol III terminated at 5 Ts but with significantly lower efficiency than S. pombe at 5 Ts (Fig. 4, C and D). The bands in the T1 region of the gel are the size expected for termination at the test terminator, T1. Note that the multiple species in the T1 region in Fig. 4B (and Fig. 4C) increase as T2 transcripts decrease, suggesting that they are dependent on termination at T1, similar to what was observed in vivo (Fig. 3). Although we have not mapped the ends of these template-dependent species (lanes 5-8, Fig. 4B), they correspond to the nascent transcript and the processing intermediates identified on Northern blots (Fig. 3A). This suggested that this extract is competent for pre-tRNA processing as are S. cerevisiae extracts (45). The lack of intermediates in the HeLa system (Fig. 4A) probably reflects the inhibitory effect of the human La protein on pre-tRNA processing (see Fig. 1C in Ref. 53).


View larger version (63K):
[in this window]
[in a new window]
  		Fig. 4.   Species-specific differences in pol III termination signal recognition. tRNAUGASerM gene constructs bearing different length dT tracts at their test terminators, the length of which is indicated by the numbers above the lanes, were transcribed by human (A), S. pombe (B), and S. cerevisiae (C) pol III transcription complexes as indicated. Template DNA was omitted from the reactions represented by the - lanes. The T1 and T2 bands were quantitated and converted to termination efficiency (Te) by the equation Te = (T1/T2 + T1) × 100 and plotted on the vertical axis as a function of dT tract length (2T-8T) which was plotted on the horizontal axis in D; only the template-dependent bands in the T1 region, which includes the smaller processed species in B and C, as indicated by the T1 bracket to the right, were included in the quantitation.

Quantitation of the T1 and T2 bands was performed and termination efficiency (Te) was calculated according to the formula Te = (T1/T1 + T2) × 100. This revealed that termination by S. cerevisiae pol III was lower at 6 Ts than was S. pombe at 5 Ts (Fig. 4D). Human and S. pombe pols III terminated with >95% efficiency at 6 Ts, whereas this degree of efficiency was not attained by S. cerevisiae pol III until it encountered 8 Ts (Fig. 4D). We conclude that human pol III is the most sensitive to termination at a minimal dT(n) tract length, whereas S. cerevisiae was the least sensitive, and S. pombe was intermediate.

Another distinguishing feature of the termination pattern was reproducibly apparent in these experiments. Although human and S. pombe pol III require 4 and 5 Ts, respectively, for efficient termination, both exhibit a relatively distinct transition thereafter, as revealed by a sharp decline in T2 transcripts at the subsequent longer dT tracts (Fig. 4, A and B). The decline is not as sharp for S. cerevisiae pol III, as the intensity of T2 transcripts instead taper off more gradually (Fig. 4C). Thus, in Fig. 4C, about half of the amount of T2 that appears in lane 5 is seen in lane 6 and about half as much again appears in lane 7, whereas the decline was clearly more sharp for S. pombe (Fig. 4B, quantitation not shown). This is consistent with the idea that termination by S. cerevisiae pol III within a dT(n) tract may be a more of a stochastic process than occurs in the other pol III complexes (24).

alpha -Amanitin Sensitivity Distinguishes S. cerevisiae from S. pombe and Human pols III and Correlates with Termination Signal Recognition by These Enzymes-- A tRNAUGASerM gene bearing a 3T test terminator was used to examine the sensitivity to alpha -amanitin of the three pols III (Fig. 5A-C). Human pol III was clearly the most sensitive to alpha -amanitin; S. pombe was less sensitive, and S. cerevisiae was insensitive. Quantitation revealed that S. pombe pol III was ~50% inhibited by 400 µg/ml alpha -amanitin (Fig. 5D) as previously reported for the S. pombe 7SL RNA gene (54) (note that the concentrations used here may not reveal an accurate curve for the human enzyme). Since S. pombe and human pols III are sensitive to alpha -amanitin and S. cerevisiae is not, inhibition by this toxin provides another criterion that distinguishes these enzymes (55).


View larger version (53K):
[in this window]
[in a new window]
  		Fig. 5.   Species-specific differences in pol III sensitivity to alpha -amanitin. The tRNAUGASerM gene construct with an inefficient (3T) test terminator at T1 was transcribed by human (A), S. pombe (B), and S. cerevisiae (C) pol III transcription complexes in the presence of alpha -amanitin as indicated above the lanes in µg/ml. The position of the T2-terminated band is indicated. Quantitation using a recovery marker as an internal control was performed and plotted in D. We note that since intermediate points between 1 and 200 µg/ml were not included, the curve for human pol III is approximate, and in actuality may be steeper than shown but is plotted here for comparison only.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

We have developed a tRNA suppressor gene whose biological function in S. pombe is dependent on accurate and efficient termination by pol III, and we used it to study transcriptional termination in vivo and in vitro. We described for the first time extract derived from S. pombe that is active for faithful tRNA transcription, confirming the results obtained in vivo and establishing that pol III termination occurs efficiently at 5 Ts in S. pombe. Results obtained on the same templates demonstrated that S. cerevisiae pol III requires a longer dT tract than human or S. pombe pols III for termination and supported the idea that this enzyme terminates more stochastically than vertebrate or S. pombe pols III in a dT tract (24).

During the final stages of this work, after our in vitro transcription extract was developed, a paper appeared that described transcription of 7SL RNA in a low salt extract of S. pombe (54). The authors noted that 7SL RNA synthesis was sensitive to alpha -amanitin, and they concluded that the enzyme responsible was pol III because tRNA and 5 S rRNA synthesized in nuclei exhibited the same sensitivity. However, since tRNA transcription in vitro was not reported, it is unclear whether the S. pombe low salt extract would be active for tRNA transcription. In this regard, it is interesting to note that an upstream deletion mutant of the S. pombe 7SL RNA gene, slr1, was transcribed efficiently in HeLa extract but not in the S. pombe low salt extract (54). This suggests that the internal tRNA-like promoter of slr1 was recognized by factors in HeLa extract and that a comparable activity was not present in the S. pombe low salt extract. Our results indicate that high salt extraction is a critical determinant in obtaining tRNA transcription activity from S. pombe cells.

A conclusion that we wish to draw from our experiments with amanitin is that differential sensitivity to this compound provides clear biochemical evidence of the distinct nature of the pols III examined here. Mutations in eukaryotic RNA polymerases that confer resistance to alpha -amanitin have been mapped to a highly conserved region of the largest subunits of the RNA polymerases from prokaryotes and eukaryotes (reviewed in Ref. 28). A functional significance of this region was suggested by mutations in the homologous domain of Escherichia coli RNA polymerase that cause aberrant termination (56-59). It is noteworthy that the other known molecular effects of alpha -amanitin is inhibition of RNA 3'-OH cleavage by RNA pol II, an important activity that is common to all multisubunit RNA polymerases (60, 61). An additional reason to suspect a possible link between termination signal recognition and alpha -amanitin sensitivities observed here is that RNA 3'-OH cleavage is important for pol III termination (27). However, it remains unknown whether alpha -amanitin would inhibit RNA 3'-OH cleavage and/or termination by pol III.

We acknowledge that our approach was modeled in part from a strategy that used tRNA-mediated suppression in S. cerevisiae. In agreement with that study, our results showed that 5 Ts signal inefficient termination by S. cerevisiae pol III in vitro (62). Also in agreement, termination was inefficient with fewer than 6 Ts in that study, clearly more dTs than required in S. pombe using a comparable suppressor system (Fig. 2A).

Termination can be a powerful way to modulate gene expression, and differences in this phase of the transcription cycle may be associated with differential responses to trans-acting factors (Ref. 59 and references therein). The RNA-binding protein La, which recognizes the 3' UUU-OH terminus of nascent pol III transcripts, may be a good example of one such factor, as human La has been shown to regulate pol III recycling and associated activities in a terminator-dependent manner in an in vitro system (18, 19, 21). The evolutionarily divergent TFIIIC subunits (see Introduction), some of which bind at or near the terminator, may also play a role in termination, as a preparation of human holo-TFIIIC and associated factors have been reported to affect termination and recycling by pol III (22). Other lines of investigation also indicate that pol III termination is a complex multistep process (17, 26-28, 63). The system described here can be used in parallel with other systems to dissect further these important aspects of pol III termination in yeast and humans.

    ACKNOWLEDGEMENTS

We thank I. Willis and members of H. Levin's Laboratory for advice; and D. Jin, Y. Huang, and an anonymous reviewer for critical comments.

    FOOTNOTES

* The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Dagger Supported by the Japan Society for the Promotion of Science.

§ To whom correspondence should be addressed: 6 Center Dr., Rm. 416, Bethesda, MD 20892-2753. Tel.: 301-402-3567; Fax: 301-480-6863; E-mail: maraiar@mail.nih.gov.

Published, JBC Papers in Press, June 7, 2000, DOI 10.1074/jbc.M003980200

    ABBREVIATIONS

The abbreviations used are: pol, polymerase; TF, transcription factors; cRT, complementary readthrough; WT, wild type.

    REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

1. Willis, I. M. (1993) Eur. J. Biochem. 212, 1-11
2. Baserga, S. J., and Steitz, J. A. (1993) in The RNA World (Gesteland, R. F. , and Atkins, J. F., eds) , pp. 359-81, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
3. Kassavetis, G. A., Bardeleben, C., Bartholomew, B., Braun, B. R., Joazeiro, C. A. P., Pisano, M., and Geiduschek, E. P. (1994) in Transcription: Mechanisms and Regulation (Conaway, R. C. , and Conaway, J. W., eds) , pp. 107-126, Raven Press, Ltd., New York
4. Lobo, S. M., and Hernandez, N. T. (1994) in Transcription: Mechanisms and Regulation (Conaway, R. C. , and Conaway, J. W., eds) , pp. 127-159, Raven Press, Ltd., New York
5. Arrebola, A., Manaud, N., Rozenfeld, S., Marsolier, M.-C., Lefebvre, O., Carles, C., Thuriaux, P., Conesa, C., and Sentenac, A. (1998) Mol. Cell. Biol. 18, 1-9
6. Kassavetis, G. A., Braun, B. R., Nguyen, L. H., and Geiduschek, E. P. (1990) Cell 60, 235-245
7. Hernandez, N. (1992) in Transcriptional Regulation (McKnight, S. L. , and Yamamoto, K. R., eds) , pp. 281-313, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
8. McBryant, S. J., Baird, E. E., Trauger, J. W., Dervan, P. B., and Gottesfeld, J. M. (1999) J. Mol. Biol. 286, 973-981
9. Taggart, A. K., Fisher, T. S., and Pugh, B. F. (1992) Cell 71, 1015-1028
10. Lopez-De-Leon, A., Librizzi, M., Puglia, K., and Willis, I. M. (1992) Cell 71, 211-220
11. Wang, Z., and Roeder, R. G. (1995) Proc. Natl. Acad. Sci. U. S. A. 89, 7026-7030
12. Hsieh, Y. J., Wang, Z., Kovelman, R., and Roeder, R. G. (1999) Mol. Cell. Biol. 19, 4944-4952
13. Colbert, T., and Hahn, S. (1992) Genes Dev. 6, 1940-1949
14. Wang, Z., and Roeder, R. G. (1997) Genes Dev. 11, 1315-1326
15. Lagna, G., Kovelman, R., Sukegawa, J., and Roeder, R. G. (1994) Mol. Cell. Biol. 14, 3053-3064
16. Sinn, E., Wang, Z., Kovelman, R., and Roeder, R. G. (1995) Genes Dev. 9, 675-685
17. Dieci, G., and Sentenac, A. (1996) Cell 84, 245-252
18. Fan, H., Sakulich, A. L., Goodier, J. L., Zhang, X., Qin, J., and Maraia, R. J. (1997) Cell 88, 707-715
19. Goodier, J. L., and Maraia, R. J. (1998) J. Biol. Chem. 273, 26110-26116
20. Maraia, R. J. (1996) Proc. Natl. Acad. Sci. U. S. A. 93, 3383-3387
21. Maraia, R. J., Kenan, D. J., and Keene, J. D. (1994) Mol. Cell. Biol. 14, 2147-2158
22. Wang, Z., and Roeder, R. G. (1998) Mol. Cell 1, 749-757
23. Bogenhagen, D. F., and Brown, D. D. (1981) Cell 24, 261-270
24. Geiduschek, E. P., and Tocchini-Valentini, G. P. (1988) Annu. Rev. Biochem. 57, 873-914
25. Campbell, F. E., and Setzer, D. R. (1992) Mol. Cell. Biol. 12, 2260-2272
26. Shaaban, S. A., Bobkova, E. V., Chudzik, D. M., and Hall, B. D. (1996) Mol. Cell. Biol. 16, 6468-6476
27. Chedin, S., Riva, M., Schultz, P., Sentenac, A., and Carles, C. (1998) Genes Dev. 12, 3857-3871
28. Thuillier, V., Brun, I., Sentenac, A., and Werner, M. (1996) EMBO J. 15, 618-629
29. Gottlieb, E., and Steitz, J. A. (1989) EMBO J. 8, 851-861
30. Chu, W. M., Ballard, R. E., and Schmid, C. W. (1997) Nucleic Acids Res. 25, 2077-2082
31. Kohli, J., Munz, P., and Soll, D. (1989) in Molecular Biology of the Fission Yeast (Nasim, A. , Young, P. , and Johnson, B. F., eds) , pp. 75-96, Academic Press, Inc., San Diego
32. Willis, I., Nichols, M., Chisholm, V., Soll, D., Heyer, W. D., Szankasi, P., Amstutz, H., Munz, P., and Kohli, J. (1986) Proc. Natl. Acad. Sci. U. S. A. 83, 7860-7864
33. Maraia, R. J., Chang, D. Y., Wolffe, A. P., Vorce, R. L., and Hsu, K. (1992) Mol. Cell. Biol. 12, 1500-1506
34. Gunnery, S., Ma, Y., and Mathews, M. B. (1999) J. Mol. Biol. 286, 745-757
35. Hottinger, H., Pearson, D., Yamao, F., Gamulin, V., Cooley, L., Cooper, T., and Soll, D. (1982) Mol. Gen. Genet. 188, 219-224
36. Maundrell, K. (1993) Gene (Amst.) 123, 127-130
37. Keeney, J. B., and Boeke, J. D. (1994) Genetics 136, 849-856
38. Hofstetter, H., Kressman, A., and Birnstiel, M. L. (1981) Cell 24, 573-585
39. Jaozeiro, C. A. P., Kassavetis, G. A., and Geiduschek, E. P. (1996) Genes Dev. 10, 725-739
40. Murphy, M. H., and Baralle, F. E. (1983) Nucleic Acids Res. 11, 7695-7700
41. Connolly, T., and Beach, D. (1994) Mol. Cell. Biol. 14, 768-776
42. Maraia, R. (1991) Nucleic Acids Res. 19, 5695-5702
43. Mao, J., Schmidt, O., and Soll, D. (1980) Cell 21, 509-516
44. Van Horn, D. J., Yoo, C. J., Xue, D., Shi, H., and Wolin, S. L. (1997) RNA 3, 1434-1443
45. Nichols, M., Willis, I., and Soll, D. (1990) Methods Enzymol. 181, 377-394
46. Dignam, J. D., Lebovitz, R. M., and Roeder, R. G. (1983) Nucleic Acids Res. 11, 1475-1489
47. Adeniyi-Jones, S., Romeo, P. H., and Zasloff, M. (1984) Nucleic Acids Res. 12, 1101-1115
48. Vnencak-Jones, C. L., Wahab, S. Z., Zehner, Z. E., and Holmes, W. M. (1987) Mol. Cell. Biol. 7, 4134-4138
49. Furter, R., Snaith, M., Gillespie, D. E., and Hall, B. D. (1992) Biochemistry 31, 10817-10824
50. Castano, J. G., Tobian, J. A., and Zasloff, M. (1985) J. Biol. Chem. 260, 9002-9008
51. Levinger, L., Vasisht, V., Greene, V., Bourne, R., Birk, A., and Kolla, S. (1995) J. Biol. Chem. 270, 18903-18909
52. Intine, R. V. A., Sakulich, A. L., Koduru, S. B., Huang, Y., Pierstorrf, E., Goodier, J. L., Phan, L., and Maraia, R. J. (2000) Mol. Cell, in press
53. Fan, H., Goodier, J. L., Chamberlain, J., Engelke, D. R., and Maraia, R. J. (1998) Mol. Cell. Biol. 18, 3201-3211
54. Rodicker, F., Ossenbuhl, F., Michels, D., and Benecke, B. J. (1999) Gene Expr. 8, 165-174
55. Valenzuela, P., Hager, G. L., Weinberg, F., and Rutter, W. J. (1976) Proc. Natl. Acad. Sci. U. S. A. 73, 1024-1028
56. Yang, X., and Price, C. W. (1995) J. Biol. Chem. 270, 23930-23933
57. Weilbaecher, R., Hebron, C., Feng, G., and Landick, R. (1994) Genes Dev. 8, 2913-2927
58. Severinov, K., Markov, D., Severinova, E., Nikiforov, V., Landick, R., Darst, S. A., and Goldfarb, A. (1995) J. Biol. Chem. 270, 23926-23929
59. Jin, D. J., Burgess, R. R., Richardson, J. P., and Gross, C. A. (1992) Proc. Natl. Acad. Sci. U. S. A. 89, 1453-1457
60. Johnson, T. L., and Chamberlin, M. J. (1994) Cell 77, 217-224
61. Chafin, D. R., Guo, H., and Price, D. H. (1995) J. Biol. Chem. 270, 19114-19119
62. Allison, D. S., and Hall, B. D. (1985) EMBO J. 4, 2657-2664
63. Bobkova, E. V., and Hall, B. D. (1997) J. Biol. Chem. 272, 22832-22839

Copyright © 2000 by The American Society for Biochemistry and Molecular Biology, Inc.
Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
 Genes Dev.Home page
P. Richard and J. L. Manley
Transcription termination by nuclear RNA polymerases
Genes & Dev., June 1, 2009; 23(11): 1247 - 1269.
[Abstract] [Full Text] [PDF]

Home page
 ScienceHome page
A. Soma, A. Onodera, J. Sugahara, A. Kanai, N. Yachie, M. Tomita, F. Kawamura, and Y. Sekine
Permuted tRNA Genes Expressed via a Circular RNA Intermediate in Cyanidioschyzon merolae
Science, October 19, 2007; 318(5849): 450 - 453.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Cell. Biol.Home page
M. A. Bayfield, T. E. Kaiser, R. V. Intine, and R. J. Maraia
Conservation of a Masked Nuclear Export Activity of La Proteins and Its Effects on tRNA Maturation
Mol. Cell. Biol., May 1, 2007; 27(9): 3303 - 3312.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
C. A. S. Banks, S. E. Kong, H. Spahr, L. Florens, S. Martin-Brown, M. P. Washburn, J. W. Conaway, A. Mushegian, and R. C. Conaway
Identification and Characterization of a Schizosaccharomyces pombe RNA Polymerase II Elongation Factor with Similarity to the Metazoan Transcription Factor ELL
J. Biol. Chem., February 23, 2007; 282(8): 5761 - 5769.
[Abstract] [Full Text] [PDF]

Home page
 ScienceHome page
H. Kato, D. B. Goto, R. A. Martienssen, T. Urano, K. Furukawa, and Y. Murakami
RNA Polymerase II Is Required for RNAi-Dependent Heterochromatin Assembly
Science, July 15, 2005; 309(5733): 467 - 469.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
P. Braglia, R. Percudani, and G. Dieci
Sequence Context Effects on Oligo(dT) Termination Signal Recognition by Saccharomyces cerevisiae RNA Polymerase III
J. Biol. Chem., May 20, 2005; 280(20): 19551 - 19562.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Cell. Biol.Home page
Y. Huang, R. V. Intine, A. Mozlin, S. Hasson, and R. J. Maraia
Mutations in the RNA Polymerase III Subunit Rpc11p That Decrease RNA 3' Cleavage Activity Increase 3'-Terminal Oligo(U) Length and La-Dependent tRNA Processing
Mol. Cell. Biol., January 15, 2005; 25(2): 621 - 636.
[Abstract] [Full Text] [PDF]

Home page
 Nucleic Acids ResHome page
C. Kohrer, E. L. Sullivan, and U. L. RajBhandary
Complete set of orthogonal 21st aminoacyl-tRNA synthetase-amber, ochre and opal suppressor tRNA pairs: concomitant suppression of three different termination codons in an mRNA in mammalian cells
Nucleic Acids Res., December 1, 2004; 32(21): 6200 - 6211.
[Abstract] [Full Text] [PDF]

Home page
 Nucleic Acids ResHome page
Y. Huang, E. McGillicuddy, M. Weindel, S. Dong, and R. J. Maraia
The fission yeast TFIIB-related factor limits RNA polymerase III to a TATA-dependent pathway of TBP recruitment
Nucleic Acids Res., April 15, 2003; 31(8): 2108 - 2116.
[Abstract] [Full Text] [PDF]

Home page
 Nucleic Acids ResHome page
D. B. Schulman and D. R. Setzer
Identification and characterization of transcription factor IIIA from Schizosaccharomyces pombe
Nucleic Acids Res., July 1, 2002; 30(13): 2772 - 2781.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Cell. Biol.Home page
M. Hamada, Y. Huang, T. M. Lowe, and R. J. Maraia
Widespread Use of TATA Elements in the Core Promoters for RNA Polymerases III, II, and I in Fission Yeast
Mol. Cell. Biol., October 15, 2001; 21(20): 6870 - 6881.
[Abstract] [Full Text] [PDF]

Home page
 Nucleic Acids ResHome page
Y. Huang and R. J. Maraia
Comparison of the RNA polymerase III transcription machinery in Schizosaccharomyces pombe, Saccharomyces cerevisiae and human
Nucleic Acids Res., July 1, 2001; 29(13): 2675 - 2690.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
Y. Huang, M. Hamada, and R. J. Maraia
Isolation and Cloning of Four Subunits of a Fission Yeast TFIIIC Complex That Includes an Ortholog of the Human Regulatory Protein TFIIICbeta
J. Biol. Chem., September 29, 2000; 275(40): 31480 - 31487.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
275/37/29076    most recent
M003980200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hamada, M.
Right arrow Articles by Maraia, R. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hamada, M.
Right arrow Articles by Maraia, R. J.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2000 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement