| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
J. Biol. Chem., Vol. 275, Issue 38, 29623-29627, September 22, 2000
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
§,§,, and
From the Graduate School of Pharmaceutical Sciences,
University of Tokyo, Bunkyo-ku, Tokyo 113-0033, Japan and ¶ Natori
Special Laboratory, The Institute of Physical and Chemical Research,
Hirosawa 2-1, Wako-shi, Saitama 351-0198, Japan
Received for publication, December 29, 1999, and in revised form, April 21, 2000
 |
ABSTRACT |
|---|
 TOP
 ABSTRACT
 INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
|
|---|
Loss of function of S-II makes yeast sensitive to
6-azauracil. Here, we identified a multi-copy suppressor gene of this
phenotype, termed SSM1 (suppressor of 6-azauracil
sensitivity of the S-II null mutant 1), that encodes a novel protein
consisting of 280 amino acid residues. Although both the
SSM1 null mutant and the S-II/SSM1 double null
mutant were viable under normal growth conditions, they resembled the
S-II null mutant in being sensitive to 6-azauracil. Expression of the SSM1 gene was found to be repressed in the
S-II null mutant but was restored by overexpression of
chimeric S-II molecules that were able to stimulate transcription
elongation by RNA polymerase II in vitro. Furthermore, we
identified two transcription arrest sites within the transcription unit
of the SSM1 gene in vitro that could be relieved by S-II.
These results indicate that S-II confers yeast resistance to
6-azauracil by stimulating transcription elongation of the SSM1 gene.
Transcription is a complex process controlled at various steps,
such as initiation, elongation, and termination (1-4). Recently, it
has become evident that expression of several cellular and virus genes
is regulated at the transcription elongation step (5-8). So far,
multiple transcription elongation factors, such as S-II (TFIIS) (9,
10), elongin (SIII) (11, 12), TFIIF (13-15), TEF-b (16, 17), and ELL
(18), have been identified. Among them, S-II was originally purified
and characterized from mouse Ehrlich ascites tumor cells as a specific
stimulatory protein of RNA polymerase II (9, 10, 19-21). Subsequently,
S-II has been identified in various organisms and shown to make RNA
polymerase II read-through intrinsic blocks within the transcription
units of eukaryotic genes, in vitro, by promoting cleavage
of the 3'-end of the nascent RNA by RNA polymerase II (22-32).
To investigate the cellular functions of S-II in eukaryotic
transcription, we have been studying S-II from yeast
(Saccharomyces cerevisiae) (33-35). The yeast
S-II null mutant is viable but becomes sensitive to
6-azauracil (6-AU)1 (34, 36).
By creating various deletion mutants of S-II, we found that the
C-terminal 147 amino acid residues are sufficient for the stimulation
of RNA polymerase II and suppression of 6-AU sensitivity (34).
Furthermore, by creating chimeric molecules of mouse and yeast S-II, we
found that the region between Pro-131 and Phe-270 is responsible for
the species-specific interaction of S-II and RNA polymerase II (35).
These results suggested that the 6-AU sensitivity of the
S-II null mutant is caused by loss of function of S-II as a
transcription elongation factor. However, the target gene(s) for S-II
that confers yeast resistance to 6-AU has not yet been identified.
To gain more insight into the role of S-II in the sensitivity of yeast
to 6-AU, we have identified a gene, SSM1, that suppresses sensitivity to 6-AU. We found that S-II enhances transcription of the
SSM1 gene, resulting in suppression of the sensitivity of the
S-II null mutant to 6-AU.
Isolation of Clones Suppressing the 6-AU Sensitivity of the S-II
Null Mutant--
The yeast S-II null mutant (TNY14) (34)
was transfected with multi-copy type genomic clones of S. cerevisiae with an average insert size of 10 kilobase pairs
constructed in YEp13 by the method of Gietz et al. (37).
Clones that formed colonies on EMD (0.67% yeast nitrogen base without
amino acids, 0.5% casamino acids technical and 2% glucose) plates
containing 100 µg/ml of 6-AU were selected.
To determine the gene responsible for the suppression of 6-AU
sensitivity, various deletion mutants of the multi-copy clone that
suppressed 6-AU sensitivity were created by PCR, subcloned into YEp13,
and transfected to TNY14 to examine suppression of 6-AU sensitivity.
Plasmids were recovered from the transformants by the method of
Strathern and Higgins (38) and sequenced.
Assay of Suppression of 6-Azauracil Sensitivity--
Transformed
cells were cultured in EMD medium at 30 °C until the optical density
at 600 nm reached about 2.0. Then 2.5 × 106 cells
were transferred to 0.5 ml of fresh medium, incubated at 30 °C for
2 h, and then diluted 1000-fold with the medium. The cell
suspension was spread on YNBD (0.67% yeast nitrogen base without amino
acids and 2% glucose) or YNBGS (0.67% yeast nitrogen base without
amino acids, 0.5% casamino acids technical, 5% galactose, and
0.2% sucrose) plates with or without 100 µg/ml 6-azauracil. Colonies were examined after incubation at 30 °C for 5 days.
Overexpression of SSMI in the S-II Null
Mutant--
NcoI and SalI sites were introduced
to the 5'- and 3'-ends of the coding sequence of the SSM1 gene,
respectively. The resulting DNA was ligated to a
NcoI-SalI-digested pMYY4-3 containing the GAL1 promoter. The resulting plasmid was cloned and digested
with BamHI and PstI, and the insert was ligated
to a BamHI-PstI-digested pYO324 (39). The plasmid
was cloned again and transfected to TNY14, and the SSM1 gene was
overexpressed under the control of the GAL1 promoter.
Construction of the SSM1 Null Mutant and the S-II/SSM1 Double
Null Mutant--
The procedure was essentially the same as that used
for the construction of the S-II null mutant (34). The SSM1
gene was replaced by a selectable marker URA3 by a PCR
knockout strategy (40). For isolation of the SSM1 null
mutant, we introduced the PCR product into the TNY04 strain (33). For
isolation of the SSM1/S-II double null mutant, we introduced
it into the TNY03 (TNY04/s-ii::LEU2) strain. The
resulting colonies were examined for disruption of the SSM1 ORF by
colony PCR (41) using primers corresponding to the 5'- and 3'-flanking
regions of the SSM1 gene ( Northern Blotting Analysis--
Total cellular RNA was extracted
from yeast (42), and samples of 10 µg of RNA were subjected to 1.2%
formaldehyde-agarose gel electrophoresis. Then the RNA was transferred
to a nitrocellulose filter (Schleicher & Schuell). The filter
was baked at 80 °C and hybridized with a 32P-labeled
probe (the PCR product of the +1- to +843-bp fragment of the SSM1 gene)
for 15 h at 42 °C. It was then washed twice with 2× SSC (1×
SSC = 150 mM sodium chloride, 15 mM
sodium citrate) containing 0.1% SDS for 15 min and once with 0.1× SSC
containing 0.1% SDS for 10 min at 45 °C.
Detection of the Transcription Arrest Sites within the SSM1
Gene--
This was done essentially as described by Christie et
al. (43), using 3'- deoxycytidine-extended templates (44) derived from the fragments of the SSM1 gene. The fragments of the SSM1 gene
used were Isolation of a DNA Fragment (pR1) That Suppresses 6-Azauracil
Sensitivity of the S-II Null Mutant--
Previously, we found that
when the yeast S-II gene was disrupted, the resulting S-II
null mutants became sensitive to 6-AU (34, 36). Therefore, we looked
for genes that suppress the 6-AU sensitivity of S-II null
mutants. For this, we transfected multi-copy type genomic clones of
S. cerevisiae with an average insert size of 10 kilobase
pairs constructed in YEp13 into TNY14 (an S-II null mutant)
and isolated the colonies formed on a plate containing 100 µg/ml
6-AU. Of 91,000 transformants examined, 11 clones were resistant to
6-AU. Southern blot analysis of plasmids recovered from these clones
using S-II cDNA as a probe revealed that 8 of the 11 clones were
transfected with S-II DNA. Restriction maps of the plasmids recovered
from the remaining three clones were identical, indicating that these
clones were the same (data not shown). We further analyzed this plasmid
(pR1), which contained a 12-kilobase pair insert.
To restrict the region of pR1 needed to suppress the 6-AU sensitivity
of TNY14, we created various deletion mutants of pR1 and examined
whether they were able to suppress 6-AU sensitivity. As shown in Fig.
1, we first examined four clones (pR3,
pR5, pR14, and pR15) and found that pR5 and pR14 suppressed 6-AU
sensitivity. As pR14 was a part of pR5, we further prepared four
deletion mutants of pR14 (pR17, pR22, pR23, and pR27) and found that
pR17 was sufficient for the suppression of 6-AU sensitivity. We
determined the nucleotide sequence of pR17 and found that it contained
an ORF encoding 280 amino acid residues. We named this protein SSM1
(Fig. 2). A putative TATA box and a
poly(A) addition signal were found to be located at the 5'- and
3'-flanking regions of the ORF, respectively. A computer search
revealed that the amino acid sequence of SSM1 was 100% identical with
that encoded by YGL224C, whose function has not yet been
determined. Thus, YGL224C is the original gene name for
SSM1. It also showed 67% similarity with that encoded by
YER037W.
To examine whether in fact SSM1 has the ability to suppress 6-AU
sensitivity, we overexpressed the SSM1 gene in TNY14 under the control
of the GAL1 promoter. As shown in Fig.
3, TNY14 expressing SSM1 formed colonies
on a plate containing 6-AU, indicating that SSM1 is responsible for
conferring 6-AU resistance to TNY14.
Analysis of Deletion Mutant of SSM1--
We examined whether SSM1
is essential for the growth of yeast. For this, we replaced the SSM1
gene of uracil Expression of the SSM1 Gene in the S-II Null Mutant--
To
examine the relationship between S-II and transcription of the SSM1
gene, we performed Northern blot analysis of SSM1 mRNA in both wild
type and S-II null mutant strains using SSM1 cDNA as a
probe. As shown in Fig. 6, the intensity
of the band of SSM1 mRNA was significantly less in the
S-II null mutant than in the wild type strain irrespective
of culture time, indicating that S-II enhances expression of the SSM1
gene.
Previously, we demonstrated by using chimeric S-II molecules that
residues 132-270 of yeast S-II are indispensable for its specific
interaction with homologous RNA polymerase II (35). Therefore, to
examine whether a specific interaction of S-II and RNA polymerase II is
indispensable for S-II to enhance the expression of the SSM1 gene, we
separately expressed four chimeric S-II molecules in the
S-II null mutant. These chimeric S-II molecules are the same
as those we used previously to demonstrate a species-specific interaction between S-II and RNA polymerase II (Fig.
7A). We have shown that almost
equivalent amounts of chimeric S-II molecules are generated when
cDNAs for these molecules are expressed in an Escherichia
coli expression system, as determined by immunoblotting (35).
As shown in Fig. 7B, expression of the SSM1 gene in TNY14
was enhanced only when wild type S-II or EYE was introduced.
Introduction of mouse S-II or YEY did not seem to cause appreciable
enhancement of SSM1 gene transcription. To quantify the transcription
of the SSM1 gene in these transformants, intensity of the signals in Fig. 7B was scanned, and the amounts relative to that in the
wild type strain were calculated (Table
I). Level of SSM1 mRNA in TNY14 was
less than Identification of the Transcription Arrest Sites in the
Transcription Unit of the SSM1 Gene--
We examined whether possible
transcription arrest sites are present in the transcription unit of the
SSM1 gene in vitro. The transcription unit of the SSM1 gene
was divided into four fragments. Each fragment was amplified by PCR, a
poly(dC) tail was added at its 3'-end, and it was used as a template
for transcription by RNA polymerase II. As shown in Fig.
8, two bands of 105 and 115 bases,
respectively, were detected as well as the run off transcript of 390 bases when fragment 1 was used as a template. These bands represent RNA
molecules arrested at specific blocks to elongation in fragment 1. No
such premature transcripts were detected when the other three fragments
were employed. Because only fragment 1 contains the 5'-upstream region
of SSM1 cDNA, the arrest sites were assumed to be located in this
region.
We identified these arrest sites by nucleotide substitution experiments
(45). As shown in Fig. 9A, we
created three fragment 1 mutants. In mutants 1 and 2, 10 bases
corresponding to positions 101-110 and 111-120 of fragment 1 were
replaced by GACTTCAATA, respectively. This sequence corresponded to
positions 61-70 of fragment 1, where no transcription arrest was found
to occur. In mutant 3, positions 101-120 were replaced by
GACTTCAATAGACTTCAATA, which is a tandem repeat of GACTTCAATA. When
mutant 1 and mutant 2 were used as templates, the bands of 105 and 115 bases, respectively, became fainter than those obtained when wild type
fragment 1 was used as template, as shown in Fig. 9B. On the
other hand, both bands became fainter when mutant 3 was used as a
template. These results suggest that the two arrest sites are located
in positions 101-110 and 111-120. These arrest sites seemed to be
read through by RNA polymerase II when S-II was present. As shown in
Fig. 10, the intensity of both bands
decreased on addition of recombinant S-II to the reaction mixture.
It is clear that the SSM1 gene is responsible for the sensitivity
of TNY14 (a S-II null mutant) to 6-AU. Expression of the SSM1 gene in TNY14 was significantly enhanced by the introduction of
S-II, resulting in suppression of 6-AU sensitivity. The mode of action
of S-II is probably to make RNA polymerase II read through the two
transcription arrest sites present in the 5'-upstream region of the
SSM1 ORF. This is the first demonstration of a yeast gene whose
expression is controlled by transcription elongation factor S-II. It
should be noted that a basal level of expression of the SSM1 gene (less
than Nothing is known about the function of SSM1. It was difficult to
predict the function of SSM1 from its amino acid sequence, because no
appreciable functional domains were identified. SSM1 could be an enzyme
that inactivates 6-AU by modifying it. It could also be a protein that
represses the uptake of 6-AU. Extensive biochemical studies are needed
to elucidate the function of SSM1 in suppressing the toxicity of 6-AU
at 100 µg/ml to TNY14. Nevertheless, our finding that SSM1 suppresses
the sensitivity of TNY14 to 6-AU is important, because for the first
time it gave a clue to the function of S-II in vivo.
Sensitivity to 100 µg/ml 6-AU is the only phenotype so far identified
for the S-II null mutant (33, 34, 36). Except for the S-II
gene, the SSM1 gene was the only gene that reversed this phenotype, and
we found that expression of the SSM1 gene was controlled by S-II. It
may be important to identify other phenotypes, and the genes
responsible for them, in S-II null mutants. If these genes
have transcription arrest sites similar to those in the SSM1 gene, it
may be possible to extend the function of S-II to all these genes.
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
35 to 12 and +1130 to +1150).
163 to +227 (fragment 1), +1 to +408 (fragment 2), +300 to
+746 (fragment 3), and +514 to +917 (fragment 4), where +1 indicates
the first letter of the first Met codon in the SSM1 cDNA. These
fragments were amplified, subcloned into the
BamHI-XbaI sites of pGEM-3Z, and used as
templates for detection of transcription arrest sites.
RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
View larger version (16K):
[in a new window]
Fig. 1.
Mapping of the SSM1 gene on yeast chromosome
DNA. Various deletion mutants of pR1 (upper panel) and
pR14 (lower panel) were created and examined for suppression
of the 6-AU sensitivity of TNY14. Bars indicate regions
covered by the corresponding clones, and the results of suppression of
6-AU sensitivity are summarized on the right. The open
reading frame and the direction of transcription of the SSM1 gene are
shown by a horizontal arrow.
View larger version (63K):
[in a new window]
Fig. 2.
Nucleotide and deduced amino acid sequences
of the SSM1 gene. The deduced amino acid sequences of SSM1 is
shown below the nucleotide sequence. Numbers of nucleotides
are shown to the left of each row,
starting from the first nucleotide of pR17. TATA box-like sequences and
putative poly(A) addition sequences are indicated by white
letters.
View larger version (88K):
[in a new window]
Fig. 3.
Suppression of 6-AU sensitivity by expression
of the SSM1 gene in TNY14. S-II null mutant (TNY14,
left panel) and a transformant (right panel) in
which the SSM1 gene was overexpressed were examined for formation of
colonies on YNBGS plates with or without 100 µg/ml 6-AU.
TNY04 by the URA 3 gene (Fig.
4A). Colonies formed on
synthetic complete medium lacking uracil were examined for disruption
of the SSM1 ORF by PCR using two primers corresponding to the 5'- and
3'-flanking regions of the SSM1 gene. As shown in Fig. 4B, a
single 1556-bp band was detected with the deletion mutant, and a single
1100-bp band was detected with TNY04, confirming that the
deletion mutant is an SSM1 null mutant. As shown in Fig.
4C, this SSM1 null mutant formed colonies under
standard growth conditions, indicating that the SSM1 gene is not
essential for growth. However, like the S-II null mutant
(TNY14), the SSM1 null mutant was sensitive to 6-AU and
formed no colonies on the plate containing 6-AU. Similarly, the
S-II/SSM1 double null mutant also formed colonies under
normal growth conditions but formed no colonies in the presence of 6-AU (data not shown). Furthermore, the 6-AU sensitivity of the
SSM1 null mutant was suppressed by overexpression of SSM1
but not by overexpression of S-II (Fig.
5). These results suggest that SSM1 functions downstream of S-II in the suppression of 6-AU sensitivity and
that S-II participates in the transcription of the SSM1 gene.
View larger version (80K):
[in a new window]
Fig. 4.
Viability and 6-AU sensitivity of the
SSM1 null mutant. A, detection of SSM1
gene disruption in the SSM1 null mutant. Colony PCR was
performed using the wild type or SSM1 null mutant with
primers corresponding to the 5'-flanking region ( 35 to 12) and
3'-flanking region (+1130 to +1150) of the SSM1 gene, as shown by
arrows, to detect the bands corresponding to the open
reading frames of the SSM1 (top line, 1100 bp) or URA3
(bottom line, 1556 bp) genes. B, agarose gel
electrophoresis of the PCR products. The amplified DNA was separated on
an agarose gel and stained with ethidium bromide. Left lane,
TNY04 (haploid wild type); right lane,
TNY04/ssm1::URA3. Positions of PCR products of
1100 and 1556 bp are shown by arrowheads. C,
viability and 6-AU sensitivity of the SSM1 null mutant.
TNY04 (wild type), TNY14 (S-II null mutant), and
TNY04/ssm1::URA3 (SSM1 null mutant)
were examined for formation of colonies on YNBGS plates with or without
100 µg/ml 6-AU.
View larger version (77K):
[in a new window]
Fig. 5.
6-AU sensitivity of the transformants over
expressing the SSM1 or S-II genes in the SSM1 null
mutant. TNY04/ssm1 ::URA3 (SSM1
null mutant) and transformants of TNY14 in which the SSM1 gene or the
S-II gene was overexpressed were examined for formation of colonies on
YNBGS plates with 100 µg/ml 6-AU.
View larger version (30K):
[in a new window]
Fig. 6.
Detection of SSM1 mRNA. Total RNA
was extracted from TNY04 (wild type, left lane of each
sample) and TNY14 (S-II null mutant, right lane
of each sample) harvested at the culture times indicated. Northern
blotting analysis was performed using the coding sequence of the SSM1
gene as a probe (upper panel). A control experiment was
performed using ACT1 (the actin gene) (46) as a probe
(lower panel).
View larger version (40K):
[in a new window]
Fig. 7.
Expression of the SSM1 gene in transformants
overexpressing chimeric S-II molecules. A, schematic
structure of the chimeric S-II molecules used in these experiments, in
which the open region represents Ehrlich cell S-II and the
gray region represents yeast S-II. Y and
E are wild type yeast and Ehrlich cell S-II, respectively.
EYE and YEY are chimeric molecules of yeast and Ehrlich cell S-II. The
characteristics of these chemeric molecules have been reported
elsewhere (39). The numbers above yeast S-II indicate
positions starting from the first Met. B, expression of the
SSM1 gene in the transformants overexpressing chimeric S-II molecules
as detected by Northern blotting (upper panel). A control
experiment was performed using ACT1 (the actin gene) as a
probe (lower panel).
of that in the wild type strain. This level was
increased to the wild type strain level when Y or EYE was introduced,
but introduction of E or YEY did not change this level. These results
clearly indicate that the function of yeast S-II as a transcription
elongation factor is indispensable for enhanced expression of the SSM1
gene in TNY14.
Relative contents of SSM1 mRNA in chimeric S-II transformants
View larger version (53K):
[in a new window]
Fig. 8.
Identification of the transcription arrest
sites within the transcription unit of the SSM1 gene.
Transcription reactions were performed using 3'- deoxycytidine-extended
templates corresponding to four fragments of the SSM1 gene. The
fragments of the SSM1 gene used were as follows: lane 1,
163 to +227 (fragment 1); lane 2, +1 to +408 (fragment 2);
lane 3, +300 to +746 (fragment 3); lane 4, +514
to +917 (fragment 4), where +1 indicates the first letter of the first
Met codon in SSM1 cDNA. Positions of the run-off transcripts of 390 bases (lane 1), 407 bases (lane 2), 446 bases
(lane 3) and 403 bases (lane 4), and the arrested
transcripts of 105 and 115 bases are indicated by
arrowheads.
View larger version (39K):
[in a new window]
Fig. 9.
Substitution of the transcription arrest
sites in the fragment 1. A, the structure of the three
mutants (Mut 1, Mut 2, and Mut 3) of
fragment 1 used. Gray letters indicate substitutions.
B, in vitro transcription was performed using
3'-deoxycytidine-extended templates of the wild type and mutant
fragments. The positions of the arrested transcripts of 105 and 115 bases are indicated by arrowheads.
View larger version (25K):
[in a new window]
Fig. 10.
Transcription arrest relief by yeast
S-II. The transcription reaction was performed using
3'-deoxycytidine-extended fragment 1 as a template in the presence (+)
or absence ( ) of recombinant yeast S-II. The positions of the
arrested transcripts of 105 and 115 bases are indicated by
arrowheads.
DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
of wild type strain) was always detected in TNY14. Two
transcription arrest sites were identified only in the 5'-upstream
region of the ORF and not in other regions of the SSM1 gene. These
arrest sites were not T-rich, as reported with other arrest sites in
other genes (22). These arrest sites may be partly suppressed even in
the absence of S-II, resulting in a basal level of production of SSM1
mRNA in TNY14. This assumption was supported by an in vitro transcription experiment. A significant run-off product (read-through product) was detected when fragment 1 was transcribed in vitro in the absence of S-II. Thus, TNY14 should have a
basal level of SSM1 protein, although it is sensitive to 6-AU.
Possibly, the amount of SSM1 protein translated from the basal level of mRNA may not be sufficient to suppress the 6-AU sensitivity of TNY14.
| |
FOOTNOTES |
|---|
* This work was supported by a grant-in-aid from the Ministry of Education, Science, Sports and Culture of Japan and by Core Research for Evolutional Science and Technology of the Japan Science and Technology Cooperation.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EMBL Data Bank with accession number(s) D26043.
§ These authors contributed equally to this work.
To whom correspondence should be addressed. Tel.:
81-48-467-9437; Fax: 81-48-462-4693; E-mail:
natori@postman.riken.go.ap.
Published, JBC Papers in Press, June 16, 2000, DOI 10.1074/jbc.M910371199
| |
ABBREVIATIONS |
|---|
The abbreviations used are: 6-AU, 6-azauracil; PCR, polymerase chain reaction; ORF, open reading frame; bp, base pair(s).
| |
REFERENCES |
|---|
|
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
|
|---|
| 1. | Buratowski, S. (1994) Cell 77, 1-3 |
| 2. | Tjian, R., and Maniatis, T. (1994) Cell 77, 5-8 |
| 3. | Orphanides, G., Lagrange, T., and Reinberg, D. (1996) Genes Dev. 10, 2657-2683 |
| 4. | Roeder, R. G. (1996) Trends Biochem. Sci. 21, 327-335 |
| 5. | Spencer, C., and Groudine, M. (1990) Oncogene 5, 777-785 |
| 6. | Kerppola, T. K., and Kane, C. M. (1991) FASEB J. 5, 2833-2842 |
| 7. | Kane, C. M. (1993) in Transcription: Mechanisms and Regulation (Conaway, R. C. , and Conaway, J. W., eds) , pp. 279-296, Raven Press, Ltd., New York |
| 8. | Aso, T., Conaway, J. W., and Conaway, R. C. (1995) FASEB J. 9, 1419-1428 |
| 9. | Sekimizu, K., Nakanishi, Y., Mizuno, D., and Natori, S. (1979) Biochemistry 18, 1582-1588 |
| 10. | Natori, S. (1982) Mol. Cell. Biochem. 46, 173-187 |
| 11. | Bradsher, J. N., Jackson, K. W., Conaway, R. C., and Conaway, J. W. (1993) J. Biol. Chem. 268, 25587-25593 |
| 12. | Aso, T., Lane, W. S., Conaway, J. W., and Conaway, R. C. (1995) Science 269, 1439-1443 |
| 13. | Price, D. H., Sluder, A. E., and Greenleaf, A. L. (1989) Mol. Cell. Biol. 9, 1465-1475 |
| 14. | Kephart, D. D., Wang, B. Q., Burton, Z. F., and Price, D. H. (1994) J. Biol. Chem. 269, 13536-13543 |
| 15. | Gu, W., and Reines, D. (1995) J. Biol. Chem. 270, 11238-11244 |
| 16. | Marshall, N. F., and Price, D. H. (1995) J. Biol. Chem. 270, 12335-12338 |
| 17. | Marshall, N. F., Peng, J., Xie, Z., and Price, D. H. (1996) J. Biol. Chem. 271, 27176-27183 |
| 18. | Shilatifard, A., Lane, W. S., Jackson, K. W., Conaway, R. C., and Conaway, J. W. (1996) Science 271, 1873-1876 |
| 19. | Sekimizu, K., Kobayashi, N., Mizuno, D., and Natori, S. (1976) Biochemistry 15, 5064-5070 |
| 20. | Sekimizu, K., Yokoi, H., and Natori, S. (1982) J. Biol. Chem. 257, 2719-2721 |
| 21. | Ueno, K., Sekimizu, K., Mizuno, D., and Natori, S. (1979) Nature 277, 145-146 |
| 22. | Reines, D., Chamberlin, M. J., and Kane, C. M. (1989) J. Biol. Chem. 264, 10799-10809 |
| 23. | Reines, D., Ghanoumi, P., Li, Q., and Mote, J., Jr. (1992) J. Biol. Chem. 267, 15516-15522 |
| 24. | Reines, D., Conaway, J. W., and Conaway, R. C. (1996) Trends Biochem. Sci. 21, 351-355 |
| 25. | SivaRaman, L., Reines, D., and Kane, C. M. (1990) J. Biol. Chem. 265, 14554-14560 |
| 26. | Izban, M. G., and Luse, D. S. (1992) Genes Dev. 6, 1342-1356 |
| 27. | Izban, M. G., and Luse, D. S. (1993) J. Biol. Chem. 268, 12864-12873 |
| 28. | Reines, D. (1992) J. Biol. Chem. 267, 3795-3800 |
| 29. | Reines, D., and Mote, J., Jr. (1993) Proc. Natl. Acad. Sci. U. S. A. 90, 1917-1921 |
| 30. | Gu, W., Powell, W., Mote, J., Jr., and Reines, D. (1993) J. Biol. Chem. 268, 25604-25616 |
| 31. | Guo, H., and Price, D. H. (1993) J. Biol. Chem. 268, 18762-18770 |
| 32. | Kassavetis, G. A., and Geiduschek, E. P. (1993) Science 259, 944-945 |
| 33. | Nakanishi, T., Nakano, A., Nomura, K., Sekimizu, K., and Natori, S. (1992) J. Biol. Chem. 267, 13200-13204 |
| 34. | Nakanishi, T., Shimoaraiso, M., Kubo, T., and Natori, S. (1995) J. Biol. Chem. 270, 8991-8995 |
| 35. | Shimoaraiso, M., Nakanishi, T., Kubo, T., and Natori, S. (1997) J. Biol. Chem. 272, 26550-26554 |
| 36. | Hubert, J. -C., Guyonvarch, A., Kammerer, B., Exinger, F., Liljelund, P., and Lacroute, F. (1983) EMBO J. 2, 2071-2073 |
| 37. | Gietz, D., Jean, A. S., Woods, R. A., and Schiestl, R. H. (1992) Nucleic Acids Res. 20, 1425 |
| 38. | Strathern, J. N., and Higgins, D. R. (1991) Methods Enzymol. 194, 319-329 |
| 39. | Ohya, Y., Goebl, M., Goodman, L. E., Peterson-Bjorn, S., Friesen, J. D., Tamanoi, F., and Anraku, Y. (1991) J. Biol. Chem. 266, 12356-12360 |
| 40. | Baudin, A., Ozier-Kalogerropoulous, O., Denoubel, A., Lacroute, F., and Cullin, C. (1993) Nucleic Acids Res. 21, 3329-3330 |
| 41. | Amberg, D. C., Botstein, D., and Beasley, E. M. (1995) Yeast 11, 1275-1280 |
| 42. | Piper, P. W., and Curran, B. P. G. (1990) Curr. Genet. 17, 119-123 |
| 43. | Christie, K. R., Awrey, D. E., Edwards, A. M., and Kane, C. M. (1994) J. Biol. Chem. 269, 936-943 |
| 44. | Kadesch, T. R., and Chamberlin, M. J. (1982) J. Biol. Chem. 257, 5286-5295 |
| 45. | Hutchinson, C. A., Phillips, S., Edgell, M. H., Gillam, S., Jahnke, P., and Smith, K. (1978) J. Biol. Chem. 253, 6551-6560 |
| 46. | Ng, R., and Abelson, J. (1980) Proc. Natl. Acad. Sci. U. S. A. 77, 3912-3916 |
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati What's this?
This article has been cited by other articles:
|
|
 |
|
  H. Koyama, T. Ito, T. Nakanishi, and K. Sekimizu Stimulation of RNA polymerase II transcript cleavage activity contributes to maintain transcriptional fidelity in yeast Genes Cells, May 1, 2007; 12(5): 547 - 559. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Ito, N. Arimitsu, M. Takeuchi, N. Kawamura, M. Nagata, K. Saso, N. Akimitsu, H. Hamamoto, S. Natori, A. Miyajima, et al. Transcription Elongation Factor S-II Is Required for Definitive Hematopoiesis Mol. Cell. Biol., April 15, 2006; 26(8): 3194 - 3203. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 F. Malagon, M. L. Kireeva, B. K. Shafer, L. Lubkowska, M. Kashlev, and J. N. Strathern Mutations in the Saccharomyces cerevisiae RPB1 Gene Conferring Hypersensitivity to 6-Azauracil Genetics, April 1, 2006; 172(4): 2201 - 2209. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. Kawamura, K. Kurokawa, T. Ito, H. Hamamoto, H. Koyama, C. Kaito, and K. Sekimizu Participation of Rho-dependent transcription termination in oxidative stress sensitivity caused by an rpoB mutation Genes Cells, May 1, 2005; 10(5): 477 - 487. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. Saso, T. Ito, S. Natori, and K. Sekimizu Identification of a Novel Tissue-Specific Transcriptional Activator FESTA as a Protein That Interacts with the Transcription Elongation Factor S-II J. Biochem., April 1, 2003; 133(4): 493 - 500. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Ubukata, T. Shimizu, N. Adachi, K. Sekimizu, and T. Nakanishi Cleavage, but Not Read-through, Stimulation Activity Is Responsible for Three Biologic Functions of Transcription Elongation Factor S-II J. Biol. Chem., February 28, 2003; 278(10): 8580 - 8585. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. J. Shaw, N. D. Bonawitz, and D. Reines Use of an in Vivo Reporter Assay to Test for Transcriptional and Translational Fidelity in Yeast J. Biol. Chem., June 28, 2002; 277(27): 24420 - 24426. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Nakanishi and K. Sekimizu SDT1/SSM1, a Multicopy Suppressor of S-II Null Mutant, Encodes a Novel Pyrimidine 5'-Nucleotidase J. Biol. Chem., June 7, 2002; 277(24): 22103 - 22106. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. Kulish and K. Struhl TFIIS Enhances Transcriptional Elongation through an Artificial Arrest Site In Vivo Mol. Cell. Biol., July 1, 2001; 21(13): 4162 - 4168. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. L. Denis, Y.-C. Chiang, Y. Cui, and J. Chen Genetic Evidence Supports a Role for the Yeast CCR4-NOT Complex in Transcriptional Elongation Genetics, June 1, 2001; 158(2): 627 - 634. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Wind-Rotolo and D. Reines Analysis of Gene Induction and Arrest Site Transcription in Yeast with Mutations in the Transcription Elongation Machinery J. Biol. Chem., April 6, 2001; 276(15): 11531 - 11538. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. J. Shaw, J. L. Wilson, K. T. Smith, and D. Reines Regulation of an IMP Dehydrogenase Gene and Its Overexpression in Drug-sensitive Transcription Elongation Mutants of Yeast J. Biol. Chem., August 24, 2001; 276(35): 32905 - 32916. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| All ASBMB Journals | Molecular and Cellular Proteomics |
| Journal of Lipid Research | ASBMB Today |
