| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
J Biol Chem, Vol. 275, Issue 4, 2966-2972, January 28, 2000
From the The synaptic scaffolding molecule (S-SCAM)
has been identified as a protein interacting with
SAP90/PSD-95-associated protein (SAPAP) (also called guanylate
kinase-associated protein/hDLG-associated protein). S-SCAM has six PDZ
(we have numbered them PDZ-0 to -5), two WW, and one guanylate kinase
(GK) domains and interacts with N-methyl-D-aspartate (NMDA) receptor via PDZ-5
and SAPAP via the GK domain. We have identified here shorter isoforms
of S-SCAM that start at the 164th or 224th methionine, and we renamed
the original one, S-SCAM Neurotransmitter receptors need to be assembled at postsynaptic
membrane for efficient neurotransmission. Glutamate is the most
representative excitatory neurotransmitter in mammals, and recent
studies have revealed that PDZ domain-containing proteins are involved
in the assembly of glutamate receptors (reviewed in Refs. 1-3). The
PDZ domain is a protein-interacting module that has initially been
recognized as a repeat of about 80 amino acids in PSD-95/SAP90,
Drosophila Dlg-A, and ZO-1. The PDZ domain is composed of
two Construction of Expression Vectors--
Various expression
vectors were constructed by conventional molecular biology techniques
and PCR method using pCMV Myc, pClneo Myc, and pGex4T-1 (Amersham
Pharmacia Biotech). pCMV NMDAR1, pCMV NMDAR2A, pCMV SAPAP1, pClneo Myc
S-SCAM-1, -2, -3, and -4, pGex4T-1 S-SCAM-15, and -16 were described
previously (10, 17, 18). pClneo Myc PSD-95-4, -8, and pGex4T-1
PSD-95-24 contained the amino acid residues 1-495, 534-724, and
562-613 of PSD-95/SAP90, respectively. The following constructs
contain the following amino acids of S-SCAM: pClneo Myc S-SCAM-8,
568-992; pClneo Myc S-SCAM-10, 906-1261; pClneo Myc S-SCAM-12,
1134-1261; pGex4T-1 S-SCAM-17, 906-1221; and pGex4T-1 S-SCAM-22,
1-163. The eukaryotic expression constructs of S-SCAM are summarized
in Fig. 1B. pClneo S-SCAM Antibodies--
The rabbit polyclonal anti-S-SCAM antibody
against the WW domain was described previously (17). A rabbit
polyclonal antibody against PDZ-0 was raised using glutathione
S-transferase (GST)-S-SCAM-22 as an antigen. For simplicity,
in this paper we describe the former and latter antibodies as the
anti-WW and the anti-PDZ-0 antibodies, respectively. A rabbit
polyclonal anti-PSD-95 antibody was described (17). A mouse monoclonal
anti-Myc-tag antibody was obtained from American Type Culture
Collection. A rabbit polyclonal anti-NMDAR2A and a mouse monoclonal
anti-PSD-95 antibodies were obtained from Upstate Biotechnology, Inc.
Rhodamine-conjugated and fluorescein isothiocyanate-conjugated second
antibodies for dual labeling were purchased from Chemicon.
Preparation of COS Cell Extracts--
COS cells were cultured in
Dulbecco's modified Eagle's medium (DMEM) with 10% fetal bovine
serum under 10% CO2 at 37 °C and transfected with
various Myc-tagged constructs using the DEAE-dextran method (10). COS
cells of two 10-cm dishes were homogenized in 0.5 ml of 50 mM Hepes/NaOH, pH 7.4, containing 100 mM NaCl and 1% (w/v) Triton X-100 and centrifuged at 100,000 × g for 20 min. The supernatant was diluted with 2 volumes of
50 mM Hepes/NaOH, pH 7.4, and used as COS cell extracts.
Subcellular Fractionation of CHO Cells--
CHO cells were
cultured in DMEM with 10% fetal bovine serum and 40 µg/ml proline
under 10% CO2 at 37 °C and transfected with various
constructs using TransFast Transfection Reagent (Promega). The
subcellular fractionation of CHO cells was performed as described (19).
Briefly, cells of one 10-cm dish were collected after 48 h culture
and homogenized by sonication in 0.3 ml of 20 mM Hepes/NaOH, pH 7.4. 0.1 ml of the homogenate was kept for analysis, and
the remaining samples were centrifuged at 100,000 × g
for 30 min to separate the supernatant and the pellet. The pellet was
resuspended in 0.2 ml of 20 mM Hepes/NaOH, pH 7.4, containing 1% (w/v) Triton X-100, and 0.05 ml was kept as the first
pellet. The remaining sample was centrifuged at 16,000 × g for 10 min to separate the supernatant and the pellet. The
pellet was resuspended in 0.15 ml of 20 mM Hepes/NaOH, pH
7.4, containing 1% (w/v) Triton X-100.
Coimmunoprecipitation--
Each 0.5-ml aliquot of the extracts
of COS cells transfected with pClneo Myc S-SCAM Overlay Assay--
The overlay assay was performed as described
(17). Briefly, [35S]methionine-labeled probes were
prepared using TnT T7 quick-coupled transcription/translation system
(Promega) with pClneo Myc S-SCAM-1, -4, - In Vitro Binding Experiment Using GST Fusion Proteins and COS
Cell Extracts--
Each 0.5-ml aliquot of the extracts of COS cells
expressing various Myc-tagged constructs of S-SCAM was incubated with 1 nmol of various GST fusion proteins fixed on 20 µl of
glutathione-Sepharose 4B beads. After the beads were washed with 50 mM Hepes/NaOH, pH 7.4, containing 33 mM NaCl
and 0.33% (w/v) Triton X-100, the proteins on the beads were detected
with the immunoblotting using the anti-Myc antibody.
Immunocytostaining--
COS cells were transfected with 5 µg/3.5-cm dish of various pClneo Myc S-SCAM constructs in the
combination of 0.5 µg/3.5-cm dish of pCMV NMDAR1 and 4 µg/3.5-cm of
pCMV NMDAR2A and cultured in the presence of 0.5 mM
ketamine (Wako Chemicals, Osaka, Japan). After 48 h culture, cells
were fixed and immunostained. The images were obtained by a confocal
microscopy Bio-Rad MRC1024 (Bio-Rad).
Gel Filtration--
Gel filtration was performed using the SMART
system (Amersham Pharmacia Biotech). 10 nmol of the product of pGex4T-1
S-SCAM-17 (GST-PDZ-(4 + 5)) was treated of 20 units/ml thrombin in 500 µl of 20 mM Tris/HCl, pH 7.5, and 1 mM
CaCl2 to remove GST. 500 pmol of the cleaved product was
charged to a Sephadex 200 PC 3.2/30 column (0.32 × 30 cm)
pre-equilibrated with 20 mM Tris/HCl, pH 8.0, containing
150 mM NaCl, 1 mM EDTA, and 1 mM
dithiothreitol. Elution was performed with the same buffer for the
equilibration at a flow rate of 50 ml/min, and 48 fractions were collected.
Immunofluorescence Microscopy--
The immunofluorescence
microscopy of adult rat neural tissue was done as described (21).
Briefly, rats were perfused with 4% paraformaldehyde in PBS and
postfixed with 4% paraformaldehyde in PBS. Their tissues were
sectioned in a cryostat, mounted on glass slides, and then air-dried.
The samples were incubated for 12 h with either the rabbit
anti-WW, the anti-SAPAP, or the mouse anti-PSD-95 antibody, followed by
incubation for 12 h with the Texas Red-conjugated anti-rabbit or
anti-mouse antibody.
The anti-WW antibody recognized signals with molecular masses of
180 and 140 kDa and a very faint signal with a molecular mass of 155 kDa in the SPM fraction (Fig. 1A,
lane 5). The calculated molecular weight of S-SCAM is 141,068, but
the product of the eukaryotic expression construct containing
full-length S-SCAM migrated in SDS-PAGE at the same position as the
largest signal detected in the SPM fraction (Fig. 1A, lane
2). Therefore, we discussed in the previous report of S-SCAM (17)
that the smaller proteins might be degradation products or isoforms.
Among 74 clones from the original screening, we detected two
independent clones, p3205-4 and -32, which started at the 164th
methionine of S-SCAM preceded by the stopping codon and terminated at
the same site as the original S-SCAM (Fig. 1B). We named the
original S-SCAM, S-SCAM Because S-SCAM
Three Isoforms of Synaptic Scaffolding Molecule and Their
Characterization
MULTIMERIZATION BETWEEN THE ISOFORMS AND THEIR INTERACTION WITH
N-METHYL-D-ASPARTATE RECEPTORS AND
SAP90/PSD-95-ASSOCIATED PROTEIN*
,§,,,
, and¶**
Takai Biotimer Project, ERATO, Japan Science
and Technology Corporation, JCR Pharmaceuticals Company Limited,
2-2-10 Murotani, Nishi-ku, Kobe 651-2241, the § Department
of Medical Biochemistry, Tokyo Medical and Dental University,
1-5-45 Yushima, Bunkyo-ku, Tokyo 113-8519, the ¶ Department of
Molecular Biology and Biochemistry, Osaka University Graduate School of
Medicine/Faculty of Medicine, Suita 565-0871, and the
Department of Anatomy and Neurobiology, Graduate School, Kyoto
University, Kyoto 606-8315, Japan
ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
, the middle one, S-SCAM
, and the
shortest one, S-SCAM-
. S-SCAM and - have five PDZ (PDZ-1 to
-5), two WW, and one GK domains. S-SCAM interacted with S-SCAM
and - through the region containing PDZ-4 and -5. The region
containing both of PDZ-4 and -5 is sufficient for the clustering of
NMDA receptors and forms a dimer in gel filtration, suggesting that S-SCAM forms multimers via the interaction between the C-terminal PDZ
domains and assembles NMDA receptors into clusters. S-SCAM and -
also interacted with SAPAP, suggesting that the N-terminal region of
the GK domain is not necessary for the interaction. Finally, we have
identified the interaction of the PDZ domains of S-SCAM with the GK
domain of PSD-95/SAP90. S-SCAM, PSD-95/SAP90, and SAPAP are colocalized
at least in some part in brain. Therefore, S-SCAM, PSD-95/SAP90, and
SAPAP may form a complex in vivo.
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
helixes and six sheets, and the groove between the second
sheet and the second helix interacts with the C termini of
various proteins (4, 5). PSD-95/SAP90 has three PDZ domains, one SH3,
and one guanylate kinase
(GK)1 domains (6, 7).
PSD-95/SAP90 binds the C termini of
N-methyl-D-aspartate (NMDA) receptor subunits
via the first and second PDZ domains and SAP90/PSD-95-associated
protein (SAPAP) (also called guanylate kinase-associated
protein/DLG-associated protein) via the GK domains (8-11).
PSD-95/SAP90 has two cysteine residues at the N terminus and forms a
multimer via the disulfide linkage (12). NMDA receptors are conceivably
assembled through the multimerization of PSD-95/SAP90. PSD-95/SAP90
also binds kainate receptor subunits (13). The PDZ domain-containing
proteins interacting with
-amino-3-hydroxy-5-methylisoxazole-4-propionic acid (AMPA) receptors
include glutamate receptor-interacting protein (GRIP), AMPA
receptor-binding protein (ABP), and protein interacting with protein
kinase C (14-16). GRIP and ABP are composed of seven and six PDZ
domains, respectively, and form a heteromultimer via PDZ domains. We
have initially identified synaptic scaffolding molecule (S-SCAM) as a
protein interacting with SAPAP (17). S-SCAM has six PDZ, two WW, and
one GK domains, and we have numbered six PDZ domains, PDZ-0 to -5. S-SCAM interacts with NMDA receptors via the C-terminal PDZ-5 domain
and induces the clustering of NMDA receptors when coexpressed in
transfected cells. In our previous study, the antibody against S-SCAM
recognized multiple signals with various sizes in the synaptic plasma
membrane (SPM) fraction, suggesting that S-SCAM has isoforms (17). We
have searched for the isoforms and obtained two isoforms, S-SCAM
and-. In this paper, we have characterized these isoforms to show
that these short isoforms of S-SCAM induce the clustering of NMDA
receptors and interact with SAPAP, and revealed the interaction among
the isoforms of S-SCAM via PDZ domains. We have also indicated that S-SCAM interacts with PSD-95/SAP90.
MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
was constructed by ligating the
BamHI/SalI fragment from p3205-4. PCR was
performed with the sense primer, gcaacgcgtatggaattggagaaaagcggt, and
the antisense primer gctgcggccgctacttccggcaggcctggggcgg, on p3205-4,
and the product was ligated into pClneo Myc to construct pClneo Myc
S-SCAM. To obtain pClneo and pClneo Myc S-SCAM, PCR was performed
with the sense primer, gcacgcgtatggagaaagcaagtata, and the antisense
primer, gctgcggccgctacttccggcaggcctggggcgg, on p3205-4, and the
product was ligated into pClneo and pClneo Myc, respectively. TA
S-SCAM- was obtained by ligating the product of PCR into TA vector (Invitrogen).
and various
Myc-tagged constructs of S-SCAM was incubated with 2.5 µl of
anti-Myc ascites fixed on 10 µl of protein G-Sepharose Fast Flow
beads. After the beads were washed three times with 50 mM
Hepes/NaOH, pH 7.4, containing 33 mM NaCl and 0.33% (w/v)
Triton X-100, the proteins on the beads were detected by the
immunoblotting using the anti-Myc or the anti-WW antibody.
Immunoprecipitation from rat crude synaptosomes was performed (20).
Briefly, the urea/detergent extracts of rat crude synaptosomes were
prepared using 20 mM Hepes/NaOH, pH 8.0, containing 6 M urea, 100 mM NaCl, and 1% (w/v) Triton X-100 and centrifuged at 100,000 × g for 30 min. The
supernatant was dialyzed against 5 liters of 20 mM
Hepes/NaOH, pH 8.0, containing 100 mM NaCl, with one
exchange, and centrifuged at 100,000 × g for 30 min to
remove the precipitate. The aliquots of the extracts were incubated
with various antibodies fixed on 10 µl of protein G-Sepharose Fast
Flow beads. After the beads were washed three times with 20 mM Hepes/NaOH, pH 8.0, containing 33 mM NaCl
and 0.33% (w/v) Triton X-100, the proteins on the beads were detected by the immunoblotting using appropriate antibodies.
, or TA S-SCAM as a
template. The extracts of COS cells transfected with the mock or pCMV
SAPAP1 were transferred onto the nitrocellulose membrane, prehybridized
with Buffer A (phosphate-buffered saline (PBS) containing 0.2% (w/v)
Triton X-100 and 5% (w/v) skim milk), and then hybridized with Buffer
A containing each probe at 4 °C for 4 h. After the membranes
were rinsed with Buffer A twice and then Buffer A without skim milk
three times, the images were obtained using Fuji image analyzing
system, BAS2000.
RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
, and the shorter isoform, S-SCAM. We also
found two independent clones, p3205-25 and -27, starting at the
methionine at the 224th methionine preceded by the stopping codon,
although these clones did not contain the termination codon. We named
this shortest isoform, S-SCAM (Fig. 1B). The anti-WW
antibody recognized proteins with molecular masses of 155 and 140 kDa
in COS cells transfected with pClneo S-SCAM and-, respectively,
in support that S-SCAM and - actually encode proteins in
vivo (Fig. 1A, lanes 3 and 4).
COS cells transfected with pClneo S-SCAM also expressed a protein
with a molecular mass of 140 kDa (Fig. 1A, lane 3),
suggesting the 224th methionine functions as an initiation site in
S-SCAM, too. The anti-PDZ-0 antibody recognized the protein with a
molecular mass of 180 kDa but not the proteins with molecular masses of 155 and 140 kDa (Fig. 1A, lane 6). Therefore, the proteins
with molecular masses of 155 and 140 kDa in the SPM fraction lack PDZ-0 and may be S-SCAM and-, respectively.
View larger version (29K):
[in a new window]
Fig. 1.
Isoforms of S-SCAM. A,
immunoblot of the SPM fraction and the extracts of COS cells
transfected with various constructs of S-SCAM. The SPM fraction (15 µg of protein) and the extracts of COS cells transfected with pClneo
Myc S-SCAM-1 (S-SCAM ), pClneo S-SCAM, or - were immunoblotted
with the anti-WW or the anti-PDZ-0 antibody. Lane 1, COS
cells transfected with the mock; lane 2, with pClneo Myc
S-SCAM-1; lane 3, with pClneo S-SCAM; lane 4,
with pClneo S-SCAM; lanes 5 and 6, the SPM
fraction. Lanes 1-5, the immunoblot with the anti-WW
antibody; lane 6, the immunoblot with the anti-PDZ-0
antibody. Arrowheads 1-3 indicate the positions of the
proteins with molecular masses of 180, 155, and 140 kDa, respectively.
B, schematic description of the isoforms and various
eukaryotic expression constructs of S-SCAM. The numbers on
the left and right ends of each model indicate
the numbers of the first and last amino acids of each isoform or
construct.
and - started in the middle of the GK domain, we
tested whether S-SCAM and - interacted with SAPAP. SAPAP is
resistant to the extraction with Triton X-100 from either the SPM
fraction or CHO cells. S-SCAM was Triton X-100-soluble in CHO cells,
but became partially Triton X-100-insoluble, when coexpressed with
SAPAP1 (Fig. 2A). Similarly,
S-SCAM was Triton X-100-soluble and became partially Triton
X-100-insoluble in the presence of SAPAP1 in CHO cells (Fig.
2B). The similar result was obtained for S-SCAM (data not
shown). To confirm further the interaction of S-SCAM and - with
SAPAP1, we performed the overlay assay using
[35S]methionine-labeled S-SCAM and -. S-SCAM,
-, and - bound to SAPAP1 expressed in COS cells, whereas the
probe prepared from pClneo Myc S-SCAM-4 did not (Fig.
3). These findings suggest that the
N-terminal portion of the GK domain, which S-SCAM and - did not
contain, was not necessary for the interaction with SAPAP1.
View larger version (34K):
[in a new window]
Fig. 2.
Interaction of S-SCAM with SAPAP in CHO
cells. CHO cells were transfected with pClneo Myc S-SCAM or
- with or without pCMV SAPAP1 and were subfractionated. The
comparable amount of each fraction was immunoblotted with the anti-Myc
antibody. Aa, pClneo Myc S-SCAM alone. Ab,
pClneo Myc S-SCAM and pCMV SAPAP1. Ba, pClneo Myc
S-SCAM alone. Bb, pClneo Myc S-SCAM and pCMV SAPAP1.
Lane 1, homogenate; lane 2, cytosol fraction;
lane 3, membrane fraction; lane 4, Triton
X-100-soluble membrane fraction; and lane 5, Triton
X-100-insoluble membrane fraction.
View larger version (35K):
[in a new window]
Fig. 3.
Interaction between the isoforms of S-SCAM
and SAPAP1. The extracts of COS cells transfected with the mock or
pCMV SAPAP1 were overlaid with the
[35S]methionine-labeled probe prepared from either pClneo
Myc S-SCAM , pClneo Myc S-SCAM, TA S-SCAM, or pClneo Myc
S-SCAM-4. Lanes 1, 3, 5, and 7, COS cells
transfected with the mock; lanes 2, 4, 6, and 8, COS cells transfected with pCMV SAPAP1; lanes 1 and
2, the probe prepared from pClneo Myc S-SCAM; lanes
3 and 4, the probe prepared from pClneo Myc S-SCAM;
lanes 5 and 6, the probe prepared from TA
S-SCAM; and lanes 7 and 8, the probe prepared
from pClneo Myc S-SCAM-4.
PSD-95/SAP90 and PSD93/chapsyn-110 are reported to form a
heteromultimer via the disulfide linkage (12). GRIP and ABP also form a
heteromultimer (15). We tested whether the isoforms of S-SCAM formed
multimers. The anti-PDZ-0 antibody recognized only S-SCAM, but the
immunoprecipitate with the anti-PDZ-0 antibody contained not only
S-SCAM but also S-SCAM and - (Fig.
4A), in support that S-SCAM
interacted with S-SCAM and - in vivo. Next, to
determine the region involved in the interaction, COS cells were
transfected with pClneo S-SCAM and various Myc-tagged constructs of
S-SCAM. We immunoprecipitated each Myc-tagged product with the
anti-Myc antibody, and we checked whether S-SCAM was coimmunoprecipitated. S-SCAM bound the product of pClneo Myc S-SCAM-4 or -10 but not the product of pClneo Myc S-SCAM-2 or -3 (Fig.
4B), suggesting that S-SCAM interacts with the region containing PDZ-(4 + 5) of S-SCAM. The GST fusion protein containing PDZ-(4 + 5) of S-SCAM also interacted with the product of pClneo Myc
S-SCAM-1, -4, or -10 (Fig.
5A). Therefore, S-SCAM is
likely to form multimers via the self-association between PDZ-(4 + 5). We next tested which of PDZ-4 or -5 was involved in this interaction. PDZ-5 interacted with the product of pClneo Myc S-SCAM-10 containing PDZ-(4 + 5), whereas PDZ-4 did not (Fig. 5B). However, the
interaction of GST-PDZ-5 with the product of pClneo Myc S-SCAM-12
containing only PDZ-5 was not detected under the same conditions (data
not shown).
|
|
To estimate the stoichiometry of the self-association between PDZ-(4 + 5) of S-SCAM, GST-PDZ-(4 + 5) was treated with thrombin to remove the
GST tag and then subjected to gel filtration. The calculated molecular
weight of PDZ-(4 + 5) is approximately 33,000. In gel filtration,
PDZ-(4 + 5) appeared in fraction 30, which corresponded to 78 kDa, and
estimated to be a dimer (Fig. 6). Another
peak was detected in fraction 38, corresponding to 17 kDa. This peak
contained a degradation product. PDZ-(3 + 4), whose molecular weight
was 26,000 appeared in fraction 35, which corresponded to 30 kDa.
|
We tested whether S-SCAM and - had the ability to form clusters
of NMDA receptors. S-SCAM and - induced the clustering of NMDA
receptors, when coexpressed in COS cells (Fig.
7B and data not shown). We
tested which region of S-SCAM was required for the clustering of NMDA
receptors. NMDA receptors formed clusters in COS cells, when
cotransfected with pClneo Myc S-SCAM-4 or -10 (Fig. 7C and
data not shown) but not with either pClneo Myc S-SCAM-2, -3, or -12 (Fig. 7D and data not shown). The product of pClneo Myc
S-SCAM-8 lacking PDZ-5 did not induce the clustering of NMDA (Fig.
7E). These findings suggest that the region containing
PDZ-(4 + 5) is necessary and sufficient for the clustering of NMDA
receptors. The presence of SAPAP1 did not show any effect on the
S-SCAM-dependent clustering of NMDA receptors (data not
shown).
|
A recent study has revealed that the region containing three PDZ
domains of PSD-95/SAP90 intramolecularly interacts with the GK domain
(22). We first confirmed this interaction using the product of pGex4T-1
PSD-95-24 containing 52 amino acids from the GK domain (Fig.
8A). PDZ-(4 + 5) of S-SCAM did
not bind the product of pClneo Myc S-SCAM-2 containing the GK domain of
S-SCAM (data not shown). Unexpectedly, PDZ-(4 + 5) of S-SCAM interacted
with the GK domain of PSD-95/SAP90 (Fig. 8B). To detect the
interaction of S-SCAM with PSD-95/SAP90 in vivo, we
performed the immunoprecipitation of PSD-95/SAP90. S-SCAM were
coimmunoprecipitated with PSD-95/SAP90 from rat brain (Fig.
8C).
|
In the previous studies, we showed the colocalization of S-SCAM,
PSD-95/SAP90, and SAPAP in primary cultured rat hippocampal neurons
(10, 17), and here we examined whether S-SCAM, PSD-95/SAP90, and SAPAP
were colocalized in vivo. In rat retina, these proteins were
localized at inner and outer plexiform layers. In cerebellum, although
the localizations of these proteins were not identical, all of S-SCAM,
PSD-95/SAP90, and SAPAP were localized at the glomerulus in the
granular layer (Fig. 9). Therefore, these
three proteins were colocalized at least in some part.
|
| |
DISCUSSION |
|---|
|
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
|
|---|
In this paper, we have identified smaller isoforms of S-SCAM,
S-SCAM, and -. S-SCAM and - start at the 164th and 224th methionines, respectively. We previously reported that the region of
amino acids 138-185 was the domain involved in the interaction with
SAPAP (17). Although S-SCAM starts in the middle of this region and
S-SCAM starts after this region, both of them interact with SAPAP1.
The recent version of the simple modular architecture research tool
predicts that the region of amino acids 107-291 of S-SCAM is the GK
domain (23). Among them, the N-terminal 48 amino acids are rather
conserved between the GK domains of PSD-95/SAP90 and S-SCAM, whereas
the middle and C-terminal regions are diverged (Fig.
10), but the interaction of S-SCAM
with SAPAP suggests that the SAPAP-interacting region of S-SCAM is
mapped to the C-terminal region of the GK domain.
|
The GK domain of PSD-95/SAP90 is reported to interact with the PDZ domains intramolecularly (22). We prepared the GST fusion protein containing only 52 amino acids from the GK domain of PSD-95/SAP90 (Fig. 10, shaded), and we confirmed that this short GK domain still bound the PDZ domains. Interestingly, the putative SAPAP-interacting region of S-SCAM does not contain the amino acids corresponding to these amino acids (Fig. 10, underlined). Although the SAPAP-interacting region of PSD-95/SAP90 needs to be determined, the GK domain of PSD-95/SAP90 may include distinct PDZ-interacting and SAPAP-interacting subdomains.
The physiological significance of the presence of the isoforms of
S-SCAM is currently unknown. An unidentified ligand for PDZ-0 could
bind only to S-SCAM. Thus, when S-SCAM is dominant, such a ligand
is assembled with components interacting with other PDZ domains, and
when the expression of S-SCAM or - is enhanced, such a ligand is
switched off from other components. Such a mechanism might be involved
in synaptic plasticity.
The consensus motif for the interaction with PDZ domain was originally
known to be the C-terminal sequence Ser/Thr-X-Val (where X is any amino acid). Later, numerous exceptions for the
binding motif have been reported (23, 24), and the interactions between PDZ domains have been recognized (15, 25). The PDZ domain of neuronal
nitric-oxide synthase interacts with the PDZ domains of PSD-95/SAP90
and syntrophin (25). Recently, the crystal structures of the PDZ domain
of neuronal nitric-oxide synthase in complex with that of syntrophin
have been studied (26). The finger that extends beyond the PDZ
domain of neuronal nitric-oxide synthase docks into the carboxyl groove
of the PDZ domain of syntrophin. In this case, the interaction between
the PDZ domains of neuronal nitric-oxide synthase and syntrophin
conceivably competes with the binding of the C-terminal peptide to the
PDZ domain of syntrophin. GRIP and ABP form a heteromultimer via the
PDZ domains (15). It has not been concluded whether the interaction
between GRIP and ABP simultaneously occurs with the binding of AMPA
receptors to GRIP and ABP. PSD-95/SAP90 has two cysteine residues at
the N terminus and forms a tetramer via the disulfide linkage (12). We
have found that PDZ-(4 + 5) of S-SCAM also forms a dimer via the PDZ
domains. NMDA receptors form clusters when coexpressed with PDZ-(4 + 5)
of S-SCAM but not when coexpressed with PDZ-5, suggesting that both of
PDZ-4 and -5 are necessary in the interaction or that the insert
between PDZ-4 and PDZ-5 is involved in the interaction. S-SCAM also
uses PDZ-5 to bind NMDA receptors. We have not yet determined whether a
PDZ-(4 + 5) that binds NMDA receptors can still interact with the other
PDZ-(4 + 5).
The dimerization of S-SCAM may not be sufficient to induce the
clustering of NMDA receptors, because no more than two molecules of
NMDA receptors are assembled. In this study, we have detected that
PDZ-(4 + 5) of S-SCAM binds the GK domain of PSD-95/SAP90 in
vitro and that S-SCAM interacts with PSD-95/SAP90 in
vivo. The interaction between S-SCAM and PSD-95/SAP90 may be
involved in the clustering of NMDA receptors as well as that between
the isoforms of S-SCAM. S-SCAM, PSD-95/SAP90, and SAPAP are colocalized at least in some part in brain, and these proteins are
coimmunoprecipitated from rat brain, suggesting that these proteins
interact in vivo. We summarize the interactions proposed in
this study (Fig. 11). Although it
remains to be clarified whether these interactions take place
simultaneously, these interactions may be important to sustain the
architecture of the PSD.
|
| |
ACKNOWLEDGEMENT |
|---|
We thank Shigetada Nakanishi (Kyoto University) for cDNAs of NMDAR1 and NMDAR2A.
| |
FOOTNOTES |
|---|
* The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EMBL Data Bank with accession number(s) AF130819.
** To whom correspondence should be addressed. Tel.: 81-06-6879-3410; Fax: 81-06-6879-3419; E:mail: ytakai@molbio.med.osak-u.ac.jp.
| |
ABBREVIATIONS |
|---|
The abbreviations used are:
GK, guanylate
kinase;
NMDA, N-methyl-D-aspartate;
SAPAP, SAP90/PSD-95-associated protein;
AMPA, -amino-3-hydroxy-5-methylisoxazole-4-propionic acid;
GRIP, glutamate
receptor-interacting protein;
ABP, AMPA receptor-binding protein;
S-SCAM, synaptic scaffolding molecule;
SPM, synaptic plasma membrane;
GST, glutathione S-transferase;
DMEM, Dulbecco's modified
Eagle's medium;
and PBS, phosphate-buffered saline.
| |
REFERENCES |
|---|
|
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
|
|---|
| 1. | Sheng, M. (1996) Neuron 17, 575-578[CrossRef][Medline] [Order article via Infotrieve] |
| 2. | Craven, S. E., and Bredt, D. S. (1998) Cell 93, 495-498[CrossRef][Medline] [Order article via Infotrieve] |
| 3. | Hata, Y., Nakanishi, H., and Takai, Y. (1998) Neurosci. Res. 32, 1-7[CrossRef][Medline] [Order article via Infotrieve] |
| 4. | Doyle, D. A., Lee, A., Lewis, J., Kim, E., Sheng, M., and MacKinnon, R. (1996) Cell 85, 1067-1076[CrossRef][Medline] [Order article via Infotrieve] |
| 5. | Morais Cabral, J. H., Petosa, C., Sutcliffe, M. J., Raza, S., Byron, O., Poy, F., Marfatia, S. M., Chishti, A. H., and Liddington, R. C. (1996) Nature 382, 649-652[CrossRef][Medline] [Order article via Infotrieve] |
| 6. | Cho, K.-O., Hunt, C. A., and Kennedy, M. B. (1992) Neuron 9, 929-942[CrossRef][Medline] [Order article via Infotrieve] |
| 7. |
Kistner, U.,
Wenzel, B. M.,
Veh, R. W.,
Cases-Langhoff, C.,
Garner, A. M.,
Appeltauer, U.,
Voss, B.,
Gundelfinger, E. D.,
and Garner, C. C.
(1993)
J. Biol. Chem.
268,
4580-4583 |
| 8. |
Kornau, H.-C.,
Schenker, L. T.,
Kennedy, M. B.,
and Seeburg, P. H.
(1995)
Science
269,
1737-1740 |
| 9. |
Kim, E.,
Naisbitt, S.,
Hsueh, Y.-P.,
Rao, A.,
Rothschild, A.,
Craig, A. M.,
and Sheng, M.
(1997)
J. Cell Biol.
136,
669-678 |
| 10. |
Takeuchi, M.,
Hata, Y.,
Hirao, K.,
Toyoda, A.,
Irie, M.,
and Takai, Y.
(1997)
J. Biol. Chem.
272,
11943-11951 |
| 11. | Satoh, K., Yanai, H., Senda, T., Kohu, K., Nakamura, T., Okumura, N., Matsumine, A., Kobayashi, S., Toyoshima, K., and Akiyama, T. (1997) Genes Cells 2, 415-424[Abstract] |
| 12. | Hsueh, Y.-P., Kim, E., and Sheng, M. (1997) Neuron 18, 803-814[CrossRef][Medline] [Order article via Infotrieve] |
| 13. | Garcia, E. P., Mehtal, S., Blair, L. A. C., Wells, D. G., Shang, J., Fukushima, T., Fallon, J., Garner, C. C., and Marshall, J. (1998) Neuron 21, 727-739[CrossRef][Medline] [Order article via Infotrieve] |
| 14. | Dong, H., O'Brien, R. J., Fung, E. T., Lanahan, A. A., Worley, P. F., and Huganir, R. L. (1997) Nature 386, 279-284[CrossRef][Medline] [Order article via Infotrieve] |
| 15. | Srivastava, S., Osten, P., Vilim, F. S., Khatri, L., Inman, G., States, B., Daly, C., DeSouza, S., Abagyan, R., Valtschannoff, J. G., Weinberg, R. J., and Ziff, E. B. (1998) Neuron 22, 179-187 |
| 16. | Xia, J., Zhang, X., Staudinger, J., and Huganir, R. L. (1999) Neuron 22, 179-187[CrossRef][Medline] [Order article via Infotrieve] |
| 17. |
Hirao, K.,
Hata, Y.,
Ide, N.,
Takeuchi, M.,
Irie, M.,
Yao, I.,
Deguchi, M.,
Toyoda, A.,
Sudhof, T. C.,
and Takai, Y.
(1998)
J. Biol. Chem.
273,
21105-21110 |
| 18. | Ide, N., Hata, Y., Deguchi, M., Hirao, K., Yao, I., and Takai, Y. (1999) Biochem. Biophys. Res. Commun. 256, 456-461[CrossRef][Medline] [Order article via Infotrieve] |
| 19. |
Deguchi, M.,
Hata, Y.,
Takeuchi, M.,
Ide, N.,
Hirao, K.,
Yao, I.,
Irie, M.,
Toyoda, A.,
and Takai, Y.
(1998)
J. Biol. Chem.
273,
26269-26272 |
| 20. |
Yao, I.,
Hata, Y.,
Hirao, K.,
Deguchi, M.,
Ide, N.,
Takeuchi, M.,
and Takai, Y.
(1999)
J. Biol. Chem.
274,
27463-27466 |
| 21. |
Mizoguchi, A.,
Kim, S.,
Ueda, T.,
Kikuchi, A.,
Yorifuji, H.,
Hirokawa, N.,
and Takai, Y.
(1990)
J. Biol. Chem.
265,
11872-11879 |
| 22. |
Brenman, J. E.,
Topinka, J. R.,
Cooper, E. C.,
McGee, A. W.,
Rosen, J.,
Milroy, T.,
Ralston, H. J.,
and Bredt, D. S.
(1998)
J. Neurosci.
18,
8805-8813 |
| 23. |
Scultz, J.,
Milpetz, F.,
Bork, P.,
and Ponting, C. P.
(1998)
Proc. Natl. Acad. Sci. U. S. A.
95,
5857-5864 |
| 24. |
Songyang, Z.,
Fanning, A. S.,
Fu, C.,
Xu, J.,
Marfatia, S. M.,
Chishti, A. H.,
Crompton, A.,
Chan, A. C.,
Anderson, J. M.,
and Cantley, L. C.
(1997)
Science
275,
73-77 |
| 25. | Brenman, J. E., Chao, D. S., Gee, S. H., McGee, A. W., Craven, S. E., Santillano, D. R., Wu, Z., Huang, F., Xia, H., Peters, M. F., Froehner, S. C., and Bredt, D. S. (1996) Cell 84, 757-767[CrossRef][Medline] [Order article via Infotrieve] |
| 26. |
Hillier, B. J.,
Christopherson, K. S.,
Prehoda, K. E.,
Bredt, D. S,
and Lim, W. A.
(1999)
Science
284,
812-815 |
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati What's this?
This article has been cited by other articles:
|
|
 |
|
  H. Cui, A. Hayashi, H.-S. Sun, M. P. Belmares, C. Cobey, T. Phan, J. Schweizer, M. W. Salter, Y. T. Wang, R. A. Tasker, et al. PDZ Protein Interactions Underlying NMDA Receptor-Mediated Excitotoxicity and Neuroprotection by PSD-95 Inhibitors J. Neurosci., September 12, 2007; 27(37): 9901 - 9915. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. A. Al-Hallaq, T. P. Conrads, T. D. Veenstra, and R. J. Wenthold NMDA Di-Heteromeric Receptor Populations and Associated Proteins in Rat Hippocampus J. Neurosci., August 1, 2007; 27(31): 8334 - 8343. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Iida, H. Ishizaki, M. Okamoto-Tanaka, A. Kawata, K. Sumita, S. Ohgake, Y. Sato, H. Yorifuji, N. Nukina, K. Ohashi, et al. Synaptic Scaffolding Molecule {alpha} Is a Scaffold To Mediate N-Methyl-D-Aspartate Receptor-Dependent RhoA Activation in Dendrites Mol. Cell. Biol., June 15, 2007; 27(12): 4388 - 4405. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
F. Deng, M. G. Price, C. F. Davis, M. Mori, and D. L. Burgess Stargazin and other transmembrane AMPA receptor regulating proteins interact with synaptic scaffolding protein MAGI-2 in brain. J. Neurosci., July 26, 2006; 26(30): 7875 - 7884. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Kawata, J. Iida, M. Ikeda, Y. Sato, H. Mori, A. Kansaku, K. Sumita, N. Fujiwara, C. Rokukawa, M. Hamano, et al. CIN85 Is Localized at Synapses and Forms a Complex with S-SCAM via Dendrin. J. Biochem., May 1, 2006; 139(5): 931 - 939. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Lehtonen, J. J. Ryan, K. Kudlicka, N. Iino, H. Zhou, and M. G. Farquhar Cell junction-associated proteins IQGAP1, MAGI-2, CASK, spectrins, and {alpha}-actinin are components of the nephrin multiprotein complex PNAS, July 12, 2005; 102(28): 9814 - 9819. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. M. Gage, E. A. Matveeva, S. W. Whiteheart, and M. von Zastrow Type I PDZ Ligands Are Sufficient to Promote Rapid Recycling of G Protein-coupled Receptors Independent of Binding to N-Ethylmaleimide-sensitive Factor J. Biol. Chem., February 4, 2005; 280(5): 3305 - 3313. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. M. Hruska-Hageman, C. J. Benson, A. S. Leonard, M. P. Price, and M. J. Welsh PSD-95 and Lin-7b Interact with Acid-sensing Ion Channel-3 and Have Opposite Effects on H+-gated Current J. Biol. Chem., November 5, 2004; 279(45): 46962 - 46968. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
<
