|
|
|
|||||||
|
|||||||||
J. Biol. Chem., Vol. 275, Issue 40, 30957-30961, October 6, 2000
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
From the
Received for publication, June 6, 2000, and in revised form, July 28, 2000
A gene, SIT4, was identified as
corresponding to a serine/threonine protein phosphatase and when
overexpressed confers lithium tolerance in galactose medium to the
budding yeast Saccharomyces cerevisiae. This gene has been
previously identified as a regulator of the cell cycle and involved in
nitrogen sensing. It is shown that the transcription levels of
SIT4 are induced by low concentrations of Li+
in a time-dependent manner. Na+ and
K+ at high concentrations, but not sorbitol, also induce
transcription. As a response to Na+ or Li+
stress, yeast cells lower the intracellular K+ content.
This effect is enhanced in cells overexpressing SIT4, which
also increase 86Rb efflux after the addition of
Na+ or Li+ to the extracellular medium. Another
feature of SIT4-overexpressing cells is that they maintain
a more alkaline pH of 6.64 compared with 6.17 in the wild type cells.
It has been proposed that the main pathway of salt tolerance in yeast
is mediated by a P-type ATPase, encoded by PMR2A/ENA1.
However, our results show that in a sit4 strain, expression
of ENA1 is still induced by monovalent cations, and
overexpression of SIT4 does not alter the amount of
ENA1 transcript. These results show that SIT4
acts in a parallel pathway not involving induction of transcription of
ENA1 and suggest a novel function for SIT4 in
response to salt stress.
Lithium has been extensively used to treat manic bipolar disorder
(1, 2). Its antimanic and antidepressant effects require days to weeks
to appear, and several reports indicate that chronic administration of
lithium affects gene expression (3). In this work we have used the
yeast Saccharomyces cerevisiae as an eukaryotic cell model
to study new possible targets of lithium action. Homeostasis of
Li+ in yeast is maintained by multiple transport pathways
that also transport Na+. The route of entry of both cations
has not been clearly defined. It has been proposed to be through the
K+ transporter Trk1p (4). When yeast cells are subjected to
Na+ stress, its uptake is inhibited by increasing
K+ import through Trk1p. However, this does not inhibit
completely Na+ entry (4, 5). Two transport systems pump out
Na+ that has entered the cell as follows: a cluster of up
to five P-ATPases PMR2A/ENA1-4 (6, 7) and a
Na+/H+ antiporter, encoded by NHA1
(8, 9). From the cluster of P-ATPases, Ena1p is the most highly
expressed (6, 7). These two transport systems are differently
regulated. ENA1 is induced by osmotic stress, starvation, or
high extracellular pH (10). NHA1 increases sodium and
lithium tolerance at an acidic or neutral pH of the external medium
(11). The expression of PMR2A/ENA1 is regulated
by several protein phosphatases and kinases. Deletion of the genes
PPZ1 and PPZ2 coding for protein phosphatases
increases expression of ENA1 (12), whose expression, on the
contrary, is reduced by the deletion of the protein phosphatase
calcineurin, causing hypersensitivity to sodium and high accumulation
of lithium (13). Overexpression of a protein encoded by
SIS2/HAL3 suppresses salt sensitivity in a
calcineurin-deleted strain and stimulates transcription of the
PMR2A/ENA1 gene (14). Hal3p acts as an inhibitory
subunit of Ppz1p regulating its function on salt tolerance (15).
Deletion of two protein kinase homologs YCR101c/SAT4/HAL4 (16) and YJL165c/HAL5 causes salt and pH sensitivity
apparently as a result of deficient Trk1p and Trk2p activation (5).
Other regulatory pathways of ion homeostasis, which do not regulate
expression of ENA1, have recently been described. A mutant strain lacking the transcriptional activator Imp2p was described as
being hypersensitive to a variety of oxidative agents and also to
Na+ and Li+. Imp2p does not increases
ENA1 expression (17).
In this work we have searched for proteins that when overexpressed
confer lithium tolerance to S. cerevisiae. We have
identified SIT4, a type 2A/type 2A-related protein
phosphatase, involved in the cell cycle. SIT4 is required
for the late G1 expression of cyclins and transcription
factors essential for the execution of START and is also required for
bud emergence (18, 19). SIT4 is also involved in the
response to nitrogen starvation by controlling the ceramide-induced
Tor-signaling pathways (20-22). In this work we have assigned a novel
function to this protein. We demonstrate that its transcription is
induced by monovalent cations and that it affects K+
homeostasis and cytoplasmic pH when overexpressed.
Strains--
Escherichia coli strain
XL1-Blue was used for plasmid construction. S. cerevisiae strains R757 (MATa, his4-15,
ura3-52, lys9, hol1) and FY833 (MATa,
his3 Isolation of Genes That Confer Lithium Resistance--
Wild type
strain R757 was transformed with an expression cDNA library under
control of a galactose-inducible promoter (23). Transformed cells were
plated in minimal medium (YNB-gal) containing YNB 6.7 g/liter,
galactose 2%, His, Ura, Lys, and methionine 0.003% and 30 mM LiSO4. Only six recombinants expressing a
protein conferring lithium resistance were able to overcome the lithium
stress. The plasmid from the selected colonies was isolated, and the
DNA insert was subcloned in pBlueScript SK+ and sequenced
using AutoRead Sequencing Kit and ALF DNA Sequencer (Amersham Pharmacia
Biotech). The sequence was compared with the known open reading frames
from the SGData base.
Characterization of Clones Resistant to Lithium--
The DNA
insert of the selected clone was subcloned in the expression vector
pRN93 (kindly donated by Dr. C.W. Slayman from Yale University), which
contains a GAL4 promoter. This plasmid was named
pRN93-SIT4. Both pRN93 and pRN93-SIT4 were used
to transform strain FY833 by the lithium acetate method (24).
Disruption of SIT4--
Disruption of the entire coding region
of SIT4 in FY833 strain was carried out using the one-step
gene replacement using the HIS3MX6 module (25). Genomic DNA
from selected sit4 strain was examined for disruption by
PCR1 and Southern blot analysis.
Quantitative RT-PCR--
The relative quantity of mRNA was
determined by quantitative RT-PCR. Quantitative PCR analyses have been
used to study mRNA levels for different transcripts (26, 27). Yeast
cells were grown in the indicated media to exponential phase and
harvested. 10 µg of total RNA (28) were treated with 2.5 units of
DNase I (Amersham Pharmacia Biotech) for 10 min at 37 °C and further incubated at 65 °C for 10 min. First strand cDNA was synthesized using the First Strand cDNA synthesis kit from Amersham Pharmacia Biotech, and oligonucleotide NotI-(dT)18 was
used as primer. The cDNA was diluted 40 times. PCRs were performed
with 2.5 µl of the diluted cDNA, 1.25 units of Taq
polymerase, 0.2 mM dNTP, 0.5 µM of each
primer, 10 mM Tris-HCl (pH 8.3), 50 mM KCl, 1.5 mM MgCl2 in a total volume of 25 µl. cDNA
was amplified using the PCR program: 95 °C, 1 min; 53 °C, 1 min;
72 °C, 2 min; and a final step of 72 °C for 5 min. The primers
used were as follows: ACT1f, 5'TACGTTTCCATCCAAGCCGTT3'; ACT1r,
5'AACATACGCGCACAAAAGCAGA3'; SIT4f,
5'CGGGATCCATGCCTTACCCATACGATGTTCCAGATTACGCTGTATCTAGAGGCCCCGACGAA3'; SIT4r, 5'CGGAATTCTTATAAGAAATAGCCGGCTCT3'; ENA1f,
5'AATTTTCGATGGGCGAAGGA3'; and ENA1r,
5'ACCGACCTTCACCAGACAAAT3'.
The amplification of ACT1 mRNA was exponential
between 17 and 22 cycles, SIT4 between 23 and 29 cycles, and
ENA1 between 22 and 28 cycles. The optimal parameters used
for the PCR in our conditions were 20 cycles for ACT1, 25 for SIT4, and 25 for ENA1. The amplified DNA
samples were separated on a 1.2% agarose gel, stained with ethidium
bromide, and photographed. The DNA was quantified by scanning the
photograph using the Quantiscan software from Biosoft. Relative
quantities of SIT4 and ENA1 transcripts were calculated by using ACT1 PCR product as an internal standard.
Determination of Intracellular Concentration of
Cations--
Yeast cells were grown in minimal medium (YNB-gal) to
exponential phase (A600 nm 0.8-1.0) and
harvested. Cells were washed once with water and resuspended to a
concentration of 0.5 g of cells per ml of water. Yeast cells were
incubated for 30 min at room temperature. 50 mg of cells (wet weight)
were diluted in 1 ml of a medium containing 10 mM MES
buffer (pH 6.0) and the indicated concentrations of NaCl or LiCl. After
the indicated time cells were harvested immediately and resuspended at
4 °C in 1 ml of 20 mM MgCl2 and sorbitol to
the same osmolarity as the incubation medium. Cells were centrifuged at
3000 × g for 10 min two times in this medium.
Yeast cells were broken with 2 mM
cetyltrimethylammonium bromide for 10 min at room temperature and centrifuged at 3000 × g for 2 min. The supernatant
was diluted 1:10 in distilled water and analyzed in a flame photometer.
Determination of Intracellular pH--
Intracellular pH was
determined as described previously (29).
Measurement of Rubidium Efflux--
Yeast cells were grown in
minimal medium with galactose (YNB-gal) to the exponential phase
(A600 nm 1.0-1.4) and harvested. Cells were
washed twice with water and incubated for 18 h at 4 °C with
agitation in 50 mM 86RbCl (270 cpm/nmol) at
concentration of 0.1 g of cells per ml. Afterward cells were
washed twice with water and resuspended to a concentration of 0.5 g of cells/ml. 86RbCl-loaded cells (100 mg) were incubated
in 1 ml of a medium containing 10 mM
MES-triethanolamine buffer (pH 6.0) and 500 mM NaCl
or 500 mM LiCl. At the indicated time a sample of 100 µl was collected by vacuum filtration through a 0.45-µm pore size nitrocellulose filter (Millipore HAWP) and washed with 10 ml of 100 mM KCl by filtration. Filters were dried and transferred to a scintillation mixture, and radioactivity was monitored in a scintillation counter.
Measurement of Membrane Potential--
Changes in membrane
potential were estimated with the fluorescent dye dithiocarbocyanine
(DiSC3(3)) (30, 31), obtained from Molecular Probes. The
fluorescence of the molecule at a concentration of 0.25 µM was recorded at room temperature at 540-600 nm in a spectrofluorometer with a magnetic stirrer in the sample compartment.
ATPase Activity--
Plasma membrane of S. cerevisiae
and the vanadate-sensitive ATPase activity were measured as described
(32).
Screening for Recombinants with High Lithium
Resistance--
S. cerevisiae cells are able to adapt to a
salt stress in a medium containing glucose as the carbon source.
However, tolerance diminished when grown on galactose (Fig.
1). For strains R757 and FY833 the
Li+ lethal growth dosage was 250 mM in glucose,
and in galactose medium it was 30 mM. We took advantage of
this observation and screened an expression cDNA library under the
control of a galactose-inducible promoter for clones that conferred
lithium resistance in YNB galactose medium. Among six lithium-tolerant
clones from R757 strain, we identified the gene SIT4. This
gene is involved in progression of the cell cycle from G1
into S phase (19). It encodes the catalytic subunit of a
serine-threonine protein phosphatase (19) with homology to the Ser/Thr
protein phosphatase PP6 from mammalian cells (33).
We isolated the open reading frame SIT4 from the library
plasmid and subcloned it into plasmid pRN93 under control of the galactose promoter that was used to transform another wild type strain
named FY833. As shown in Fig.
2A, overexpressed
SIT4 also conferred resistance to lithium in this different
strain. A characteristic effect of Li+ is that at sublethal
concentrations growth is arrested after the first duplication. After a
period of adaptation of about 10 h cells recover growth. This
growth arrest was not seen when SIT4 was overexpressed (Fig.
2B).
The entire coding region of SIT4 was deleted to abolish
protein activity. Previous results showed that deletion causes a slow growth phenotype and larger cells (19). Our results showed that sit4 strain was able to grow on galactose, provided that
rich medium was used. The sit4 strain did not grow in
galactose nitrogen base minimal media. We tested if sit4
strain was able to adapt to Li+ stress. In contrast to
overexpression, sit4 strain (Fig. 2B) recovered
growth after the arrest period induced by lithium. This result
indicates that SIT4 is not essential for Li+
adaptation, and other genes might perform overlapping functions in
response to lithium stress. In Fig. 2C we show the results of comparing the growth rate of the wild type, sit4-deleted
cells and SIT4-overexpressing cells in the presence of
different LiCl concentrations after the arrest period induced by
Li+. We found that the latter is more resistant to
Li+. It is interesting that resistance induced by
overexpression of SIT4 was specific for Li+, as
overexpression did not increase tolerance to Na+,
K+, sucrose, or sorbitol (data not shown).
Expression of SIT4 Is Dependent on Monovalent
Cations--
SIT4 is situated on chromosome IV. Its
intergenic region contains 1558 base pairs, and a preliminary analysis
of this region for putative consensus with the STRE sequence shows that
it contains six STRE elements. This element mediates the activation of
transcription in response to a wide type of stresses such as osmotic
stress, heat shock, nitrogen starvation, oxidative stress, low external pH, and ethanol stress. Some of these responses are dependent on the
high osmolarity glycerol pathway, but some are independent (34).
We investigated whether SIT4 expression was induced by different monovalent cations. SIT4 was found to have a very
low basal level of expression, and it was induced upon a stress by Li+, Na+, K+, and to a lesser
degree by sorbitol (Fig. 3A).
In order to test the dependence on sublethal concentrations of LiCl, we
measured SIT4 induction in 15 mM LiCl. A 2-fold
induction was observed after 5 h of Li+ stress (Fig.
3C). This time period correlates with the arrest period of
growth. These results suggest that overexpression of SIT4
might be a physiological response to salt stress, and further work on
the SIT4 promoter is required to identify the motifs that are responsible for induction of expression by salt.
Overexpression of SIT4 Does Not Increase PMR2A/ENA1
Expression--
One of the main proteins controlling
Na+/Li+ resistance is the P-type ATPase encoded
by PMR2A/ENA1. The level of PMR2A/ENA1 transcription is modulated by a variety of phosphatases, and its promoter has been well studied (35). As shown in Fig. 3, A
and B, the levels of PMR2A/ENA1 transcript were
induced by Li+, Na+, K+, and to a
lower extent by sorbitol. These results agree with published results
(6, 7, 36). The comparison of A and B show that
SIT4 and PMR2A/ENA1 are concomitantly induced.
With the aim to investigate whether SIT4 is a part of the
mechanism by which PMR2A/ENA1 is induced, we measured by
RT-PCR the relative quantity of PMR2A/ENA1 transcript on a
strain where SIT4 is overexpressed and upon a
Li+ or Na+ stress on a sit4 strain
(Fig. 4). The relative quantity of
PMR2A/ENA1 transcript was not altered by overexpression of
SIT4 (Fig. 4B). However,
PMR2A/ENA1 transcription level is still induced after a
shock with 0.8 M NaCl or 0.8 M LiCl on a
sit4 strain (Fig. 4C). These results show that
induction of PMR2A/ENA1 expression by Li+,
Na+, and K+ is independent of
SIT4.
SIT4 Modulates K+ Homeostasis and pH--
When yeast
cells are subjected to a Na+ stress they undergo
accumulation of osmotically active solutes such as glycerol and trehalose (37, 38). To determine whether overexpression of SIT4 changes the intracellular concentrations of the
monovalent cations K+, Na+, and
Li+, we determined their concentration after incubation for
30 min with increasing concentrations of NaCl or LiCl. In Fig.
5 we show the total monovalent cationic
level; interestingly, overexpression of SIT4 leads to a
lower intracellular accumulation of monovalent cations. The level of
Na+ or Li+ uptake did not change under these
conditions by overexpression of SIT4 as shown in Fig.
6; however, the relative amount of
K+ inside the cell was diminished in relation to control
conditions. These results indicate that overexpression of
SIT4 causes a greater extrusion of K+ upon
Na+ or Li+ stress and that a K+
transport system might be involved. In order to test this hypothesis we
measured 86Rb+ efflux in cells that had been
previously starved and preloaded with 86RbCl. The results
showed that in SIT4-overexpressing cells
86Rb+ efflux in the presence of 500 mM NaCl or LiCl was highly increased (Fig.
7). sit4 strain showed the
same kinetics as the wild type strain (data not shown).
We explored if the change on K+ homeostasis induced by
overexpression of SIT4 could induce an alteration of the
membrane potential or internal pH. We observed that overexpression of
SIT4 did not alter the changes in membrane potential
produced by the addition of Na+ or Li+ (Fig.
8), but the intracellular pH changed from
6.17 (±0.04) in wild type cells to 6.64 (±0.03) in
SIT4-overexpressing cells. The sit4 strain did
not show any significant alteration in pH as compared with the wild
type strain. The alkalinization of the cytoplasm was not caused by an
altered function of the plasma membrane H+-ATPase, since
the specific activity of this enzyme in purified plasma membranes from
SIT4-overexpressing cells and wild type cells was the same
(0.338 and 0.373 nmol/min/mg of protein at pH 5.5, respectively).
Cellular processes are highly regulated by a wide variety of
signal transduction pathways. Protein kinases and phosphatases mediate
these events. SIT4 encodes a protein with homology to the
catalytic subunits of mammalian PP6 protein phosphatases (33) and
regulates the cell cycle (19). Our sit4 strains are viable and show an increased abundance of unbudded cells (21). However, sit4 is lethal in ssd1 (a gene of unknown
function) deletant, whereas temperature-conditional alleles of
SIT4 arrest in G1 when shifted to the
nonpermissive temperature (19). It has been recently reported that
sit4 mutants of the yeast Kluyveromyces lactis
regulate drug resistance (39). In this work we demonstrate for the
first time that SIT4 plays a role in monovalent cation
homeostasis. Our results show that growth was arrested by sublethal
Li+ concentrations, but after an adaptation period wild
type cells were able to recover growth. Diverse regulatory mechanisms
must be turned on during the period of adaptation to Li+
stress. Our results point out that induction of expression of SIT4 is a regulatory mechanism, because on
overexpression, lithium did not cause this growth arrest. This idea is
reinforced by the fact that SIT4 transcript is induced by
low lithium concentrations and that its time-dependent
expression correlates with the arrest period induced by lithium. The
results obtained with overexpression of SIT4 might represent
physiological changes during adaptation to Li+ stress.
ENA1 Is Induced by a SIT4-independent Pathway--
ENA1
is a P-type ATPase that has been proved to be involved in the main
pathway of Na+/Li+ tolerance (6, 7). A link has
been suggested between SIT4 and ENA1, mediated by
SIS2/HAL3. Ferrando et al. (14) reported that
SIS2/HAL3 suppressed salt sensitivity in a
calcineurin-deleted background by stimulating transcription of the
PMR2A/ENA1 gene. On the other hand, SIS2/HAL3 is
also a suppressor of the lethal sit4-ssd1 phenotype
described above (19). These results led us to test if SIT4
was essential for PMR2A/ENA1 induction of transcription. We
found that overexpression of SIT4 did not mimic the effect of SIS2/HAL3 as it does not increase PMR2A/ENA1
expression. We have also shown that PMR2A/ENA1 is still
induced by Na+ and Li+ in a sit4
strain. These data indicate clearly that transcription of
ENA1 is induced by salt in a pathway independent of
SIT4.
Overexpression of SIT4 Stimulates Rb+ Efflux Induced by
Salt and Alters the Intracellular pH--
To date the role of
internal monovalent cations in cellular physiology is not known.
K+ and Na+ regulate the activity of many
enzymes, but the effect of altered monovalent cation homeostasis has
not been studied. On the other hand, it has been shown that high
extracellular K+ concentrations alleviate
Na+/Li+ stress (5). Upon Na+ stress
yeast cells undergo accumulation of solutes to overcome turgor pressure
(37, 38) and also undergo an increase of intracellular Na+
and a decrease of intracellular K+ (40, 41). The fact that
SIT4 regulates total cation content upon an Na+
or Li+ stress by lowering the intracellular content of
K+ indicates that the regulation of homeostasis by
SIT4 is mediated via a K+ efflux transporter.
The increased K+ loss does not lead to a change of the
electrical membrane potential, but it maintains the total monovalent
cation content low after a Na+ or Li+ stress.
One intriguing physiological response of overexpression of
SIT4 is the elevated cytoplasmic pH. Further work is
necessary to test if this effect leads to altered K+
homeostasis or if it is involved in another function regulated by
SIT4, as cell cycle control (19). However, it is possible that the efflux may proceed through one of the cation/H+
exchange systems reported before (8, 42, 43)
Two homologs of SIT4 have been found in mammalian tissues.
PP6 expression was preferentially found in the human testis, heart, and
skeletal muscles, whereas in the mouse PPV was found in the brain (33).
Our work in yeast leads to the proposal that the involvement of these
mammalian genes during lithium treatment should be studied.
We thank Dr. Leopoldo de Meis from
Universidade Federal do Rio de Janeiro who supported part of this work
with grants from FINEP/Pronex and FAPERJ.
*
This work was supported in part by grants from
Fundaçao de Amparo a Pesquisa do Rio de Janeiro (FAPERJ),
Conselho de Ciência e Tecnologia (CNPq), PADCT-Brazil (to
M. M.-L.), and Grant 400346-5 from Consejo Nacional de Ciencia y
Tecnología (Conacyt) México to Dr. Antonio Peña.The costs of publication of this
article were defrayed in part by the
payment of page charges. The article must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
§
Recipient of a fellowship from CNPq.
Published, JBC Papers in Press, July 31, 2000, DOI 10.1074/jbc.M004869200
The abbreviations used are:
PCR, polymerase
chain reaction;
RT-PCR, reverse transcriptase-PCR;
MES, 4-morpholineethanesulfonic acid;
DiSC3, dithiocarbocyanine.
Regulation of Monovalent Ion Homeostasis and pH by the Ser-Thr
Protein Phosphatase SIT4 in Saccharomyces
cerevisiae*
§,§
Departamento de Bioquímica
Médica, ICB-CCS, Universidade Federal do Rio de Janeiro, Rio de
Janeiro, R.J. 21941-590, Brazil and ¶ Departamento de
Genética Molecular, IFC, Universidad Nacional Autónoma de
México, Mexico City 04510, Mexico
ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
200, ura3-52, leu21,
lys2202, trp163, GAL2+),
kindly provided by Dr. M. Ghislain, were used.
RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
View larger version (13K):
[in a new window]
Fig. 1.
Growth inhibition of S. cerevisiae
by LiCl. Liquid YNB-glu ( 
) or YNB-gal (
) medium with
different concentrations of LiCl was inoculated with strain FY833.
Growth was recorded by measurement of the absorbance at 600 nm, and the
growth rate (growth/h) was calculated. This is a representative
result of three different experiments.
View larger version (42K):
[in a new window]
Fig. 2.
Overexpression of SIT4
confers lithium resistance. A, S. cerevisiae strains FY833, FY833-pRN93, and FY833-SIT4
were grown in YNB-gal medium to mid-log phase. 5 µl of a diluted
culture (A600 ~0.03) was plated onto YNB-gal
medium containing different concentrations of LiCl. Growth was recorded
after 4 days in plates without LiCl or with 5 mM LiCl and
for 6 days with 30 mM LiCl. B, growth of FY833
( ), FY833-SIT4 (), and FY833-sit4 (
) was
recorded in YP-gal medium containing 12 mM LiCl.
C, growth rate of the above strains on increasing
concentrations of LiCl.
View larger version (38K):
[in a new window]
Fig. 3.
Dependence of SIT4 expression on
Li+, Na+, K+, and sorbitol.
FY833 was incubated for 2 h in YP-gal medium without (lane
1) or with the addition of 0.8 M Na+,
Li+, K+, or sorbitol (lanes 2-5,
respectively). SIT4 (A) and ENA1
(B) mRNA were quantified by RT-PCR. SIT4
(C) mRNA was quantified after incubation for the time
indicated in YP-gal medium with 15 mM LiCl. Lane
c presents the results of RT-PCR with no addition of cDNA. The
numbers below each panel represent the relative
quantity of SIT4 PCR product. ACT1 was used as an
internal standard, and SIT4 and ENA1 PCR products
were normalized with respect to levels of the control condition
(lane 1).
View larger version (44K):
[in a new window]
Fig. 4.
Expression of ENA1 is
independent of SIT4. FY833 (lane 1),
FY833-pRN93 (lane 2), and FY833-SIT4 (lane
3) strains were grown in YNB-gal medium, and SIT4
(A) and ENA1 (B) mRNA were
quantified by RT-PCR. FY833-sit4 (C) was grown in
YP-gal medium and stressed for 2 h with 0.8 M NaCl or
LiCl, and ENA1 mRNA was quantified by RT-PCR.
ACT1 was used as an internal standard, and SIT4
and ENA1 PCR products were normalized with respect to levels
of the control condition (lane 1).
View larger version (15K):
[in a new window]
Fig. 5.
Intracellular K+,
Na+, and Li+ under salt stress. The total
amount of K+ and Na+ (left panel) or
K+ and Na+ and Li+ (right
panel) were estimated after incubating yeast strains FY833 ( ),
FY833-pRN93 (
), and FY833-SIT4 (
) with increasing
concentrations of NaCl or LiCl for 30 min. The percent of total cation
increment was calculated with respect to the value obtained in medium
without added salt. Data represent mean values and S.D. of three
independent experiments.
View larger version (24K):
[in a new window]
Fig. 6.
Effect of overexpression of SIT4
on K+, Na+, and Li+ content
under salt stress. FY833 ( ), FY833-pRN93 (), and
FY833-SIT4 () were incubated with increasing
concentrations of NaCl or LiCl for 30 min. The relative amount of
K+ and the total amount of Na+ or
Li+ entry were calculated by determination of internal
cation concentrations. Data represent mean values and S.D. of three
independent experiments.
View larger version (13K):
[in a new window]
Fig. 7.
Effect of overexpression of SIT4
on 86Rb+ efflux under salt stress.
FY833 (left panel) and FY833-SIT4 (right
panel) were preloaded with 86Rb+, and
efflux was measured in the presence of 500 mM NaCl ( ),
LiCl (), or without addition of cations (). Data represent mean
values and S.D. of three independent experiments.
View larger version (22K):
[in a new window]
Fig. 8.
Fluorescence changes of DiSC3(3)
induced by the addition of Na+ or Li+ to
strains FY833 (A), FY833-PRN93 (B),
and FY833-SIT4 (C). Starved
cells (25 mg) were preincubated for 2 min in 10 mM
MES-triethanolamine buffer (pH 6.0), 100 mM glucose,
100 µM CaCl2, and 10 µM
carbonyl cyanide p-chlorophenylhydrazone. 0.25 µM DiSC3(3) was added, and fluorescence was
recorded at room temperature at 540-600 nm. Where indicated 100 mM NaCl or LiCl was added.
DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
ACKNOWLEDGEMENT
FOOTNOTES
To whom correspondence should be addressed: Dept. de
Bioquímica Médica, ICB/CCS, Universidade Federal do Rio
de Janeiro, C.P. 68041, Rio de Janeiro, R.J. 21941-590, Brazil. Tel.:
55-021-590-4548; Fax: 55-021-270-8647; E-mail:
montero@server.bioqmed.ufrj.br.
ABBREVIATIONS
REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
1.
Schou, M
(1997)
Arch. Gen. Psychiatry
4,
9-13
2.
Jope, R. S.
(1999)
Mol. Psychiatry
2,
117-128
3.
Manji, H. K.,
Potter, W. Z.,
and Lenox, R. H.
(1995)
Arch. Gen. Psychiatry
52,
531-543
4.
Gómez, M. J.,
Luyten, K.,
and Ramos, J.
(1996)
FEMS Microbiol. Lett.
135,
157-160
5.
Mulet, J. M.,
Leube, M. P.,
Kron, S. J.,
Rios, G.,
Fink, G. R.,
and Serrano, R.
(1999)
Mol. Cell. Biol.
19,
3328-3337
6.
Haro, R.,
Garcíadeblas, B.,
and Rodríguez-Navarro, A.
(1991)
FEBS Lett.
291,
189-191
7.
Wieland, J.,
Nitsche, A. M.,
Strayle, J.,
Steiner, H.,
and Rudolph, H. K.
(1995)
EMBO J.
14,
3870-3882
8.
Prior, C.,
Potier, S.,
Souciet, J. L.,
and Sychrová, H.
(1996)
FEBS Lett.
387,
89-93
9.
Sychrová, H.,
Ramírez, J.,
and Peña, A.
(1999)
FEMS Microbiol. Lett.
171,
167-172
10.
Garcíadeblas, B.,
Rubio, F.,
Quintero, F. J.,
Bañuelos, M. A.,
Haro, R.,
and Rodríguez-Navarro, A.
(1993)
Mol. Gen. Genet.
236,
363-368
11.
Bañuelos, M. A.,
Sychrová, H.,
Bleykasten-Grosshans, C.,
Souciet, J. L.,
and Potier, S.
(1998)
Microbiology
144,
2749-2758
12.
Posas, F.,
Camps, M.,
and Arino, J.
(1995)
J. Biol. Chem.
270,
13036-13041
13.
Mendoza, I.,
Rubio, F.,
Rodríguez-Navarro, A.,
and Pardo, J. M.
(1994)
J. Biol. Chem.
269,
8792-8796
14.
Ferrando, A.,
Kron, S. J.,
Ríos, G.,
Fink, G. R.,
and Serrano, R.
(1995)
Mol. Cell. Biol.
15,
5470-5481
15.
de Nadal, E.,
Clolet, J.,
Posas, F.,
Serrano, R.,
Gomez, N.,
and Ariño, J.
(1998)
Proc. Natl. Acad. Sci. U. S. A.
95,
7357-7362
16.
Skala, J.,
Purnelle, B.,
Crouzet, M.,
Aigle, M.,
and Goffeau, A.
(1991)
Yeast
7,
651-655
17.
Masson, J. Y.,
and Ramotar, D.
(1998)
Genetics
149,
893-901
18.
Arndt, K. T.,
Styles, C. A.,
and Fink, G. R.
(1989)
Cell
56,
527-537
19.
Sutton, A .,
Immanuel, D.,
and Arndt, K. T.
(1991)
Mol. Cell. Biol.
11,
2133-2148
20.
Di Como, C. J.,
and Arndt, K. T. N.
(1996)
Genes Dev.
10,
1904-1916
21.
Jiang, Y.,
and Broach, J. R.
(1999)
EMBO J.
18,
2782-2792
22.
Beck, T.,
and Hall, M. N.
(1999)
Nature
402,
689-692
23.
Liu, H.,
Krizek, J.,
and Bretscher, A.
(1992)
Genetics
132,
665-673
24.
Ito, H.,
Fukuda, Y.,
Murata, K.,
and Kimura, A.
(1983)
J. Bacteriol.
153,
163-168
25.
Wach, A.,
Brachat, A.,
Pohelmann, R.,
and Philippsen, P.
(1994)
Yeast
10,
1793-1808
26.
Chelly, J.,
Kaplan, J. C.,
Maire, P.,
Gautron, S.,
and Kahn, A.
(1988)
Nature
333,
858-860
27.
Wang, A. M.,
Doyle, M. V.,
and Mark, D. F.
(1989)
Proc. Natl. Acad. Sci. U. S. A.
86,
9717-9721
28.
Schmitt, M. E.,
Brown, T. A.,
and Trumpower, B. L.
(1990)
Nucleic Acids Res.
18,
3091-3092
29.
Peña, A.,
Ramírez, J.,
Rosas, G.,
and Calahorra, M.
(1995)
J. Bacteriol.
177,
1017-1022
30.
Peña, A.,
Uribe, S.,
Pardo, J. P.,
and Borbolla, M.
(1984)
Arch. Biochem. Biophys.
231,
217-225
31.
Peña, A.,
and Ramírez, J.
(1991)
Biochim. Biophys. Acta
1068,
237-244
32.
Masuda, C. A.,
and Montero-Lomelí, M.
(2000)
Biochem. Cell Biol.
78,
51-58
33.
Bastians, H.,
and Ponstingl, H.
(1996)
J. Cell Sci.
109,
2865-2874
34.
Varela, J. C. S.,
and Mager, W. H.
(1996)
Microbiology
142,
721-731
35.
Proft, M.,
and Serrano, R.
(1999)
Mol. Cell. Biol.
19,
537-546
36.
Marquez, J. A.,
and Serrano, R.
(1996)
FEBS Lett.
382,
89-92
37.
Reed, R. H.,
Chudek, J. A.,
Foster, R.,
and Gadd, G. M.
(1987)
Appl. Environ. Microbiol.
53,
2119-2123
38.
Blomberg, A.,
and Adler, L.
(1989)
J. Bacteriol.
171,
1087-1092
39.
Chen, X. J.,
Bauer, B. E.,
Kuchler, K.,
and Clark-Walker, G. D.
(2000)
J. Biol. Chem.
275,
14865-14872
40.
Norkrans, B.,
and Kyklin, A.
(1969)
J. Bacteriol.
100,
836-845
41.
Sunder, S.,
Singh, A. J.,
Gill, S.,
and Singh, B.
(1996)
Mol. Cell. Biochem.
158,
121-124
42.
Ramírez, J.,
Peña, A.,
and Montero-Lomelí, M.
(1996)
Biochim. Biophys. Acta
1285,
175-182
43.
Ramírez, J.,
Ramírez, O.,
Saldaña, C.,
Coria, R.,
and Peña, A.
(1998)
J. Bacteriol.
180,
5860-5865
Copyright © 2000 by The American Society for Biochemistry and Molecular Biology, Inc.
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati What's this?
This article has been cited by other articles:
|
|
 |
|
  A. Ruiz and J. Arino Function and Regulation of the Saccharomyces cerevisiae ENA Sodium ATPase System Eukaryot. Cell, December 1, 2007; 6(12): 2175 - 2183. [Full Text] [PDF]
|
|
|
|
 |
|
 J. J. Tate and T. G. Cooper Stress-responsive Gln3 Localization in Saccharomyces cerevisiae Is Separable from and Can Overwhelm Nitrogen Source Regulation J. Biol. Chem., June 22, 2007; 282(25): 18467 - 18480. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. Stefansson and D. L. Brautigan Protein Phosphatase 6 Subunit with Conserved Sit4-associated Protein Domain Targets I{kappa}B{epsilon} J. Biol. Chem., August 11, 2006; 281(32): 22624 - 22634. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. M. A. Manlandro, D. H. Haydon, and A. G. Rosenwald Ability of Sit4p To Promote K+ Efflux via Nha1p Is Modulated by Sap155p and Sap185p Eukaryot. Cell, June 1, 2005; 4(6): 1041 - 1049. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. M. Munson, D. H. Haydon, S. L. Love, G. L. Fell, V. R. Palanivel, and A. G. Rosenwald Yeast ARL1 encodes a regulator of K+ influx J. Cell Sci., May 1, 2004; 117(11): 2309 - 2320. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Bro, B. Regenberg, G. Lagniel, J. Labarre, M. Montero-Lomeli, and J. Nielsen Transcriptional, Proteomic, and Metabolic Responses to Lithium in Galactose-grown Yeast Cells J. Biol. Chem., August 22, 2003; 278(34): 32141 - 32149. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Montero-Lomeli, B. L. B. Morais, D. L. Figueiredo, D. C. S. Neto, J. R. P. Martins, and C. A. Masuda The Initiation Factor eIF4A Is Involved in the Response to Lithium Stress in Saccharomyces cerevisiae J. Biol. Chem., June 7, 2002; 277(24): 21542 - 21548. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. A. Masuda, M. A. Xavier, K. A. Mattos, A. Galina, and M. Montero-Lomeli Phosphoglucomutase Is an in Vivo Lithium Target in Yeast J. Biol. Chem., October 5, 2001; 276(41): 37794 - 37801. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. L. Crespo, K. Daicho, T. Ushimaru, and M. N. Hall The GATA Transcription Factors GLN3 and GAT1 Link TOR to Salt Stress in Saccharomyces cerevisiae J. Biol. Chem., September 7, 2001; 276(37): 34441 - 34444. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| All ASBMB Journals | Molecular and Cellular Proteomics |
| Journal of Lipid Research | ASBMB Today |