HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

J. Biol. Chem., Vol. 275, Issue 40, 31178-31182, October 6, 2000

This Article Abstract Full Text (PDF) All Versions of this Article: 275/40/31178    most recent M001622200v1 Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Nowotny, M. Articles by Kuznicki, J. Search for Related Content PubMed PubMed Citation Articles by Nowotny, M. Articles by Kuznicki, J. Social Bookmarking                      What's this?

Characterization of the Interaction of Calcyclin (S100A6) and Calcyclin-binding Protein^*

Marcin Nowotny, Shibani Bhattacharya^§, Anna Filipek, Andrzej M. Krezel^¶, Walter Chazin^§, and Jacek Kuznicki

From the  Department of Molecular and Cellular Neurobiology, Nencki Institute of Experimental Biology, 3 Pasteur Street, 02-093 Warsaw, Poland and the ^§ Department of Biochemistry and the ^¶ Department of Molecular Biology, Vanderbilt University, Nashville, Tennessee 37232-0146

Received for publication, February 28, 2000, and in revised form, May 24, 2000

	ABSTRACT

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Calcyclin (S100A6) is an S100 calcium-binding protein whose expression is up-regulated in proliferating and differentiating cells. A novel 30-kDa protein exhibiting calcium-dependent calcyclin-binding (calcyclin-binding protein, CacyBP) had been identified, purified, and cloned previously (Filipek, A., and Kuznicki, J. (1998) J. Neurochem. 70, 1793-1798). Here, we have defined the calcyclin binding region using limited proteolysis and a set of deletion mutants of CacyBP. A fragment encompassing residues 178-229 (CacyBP-(178-229)) was capable of full binding to calcyclin. CacyBP-(178-229) was expressed in Escherichia coli as a glutathione S-transferase fusion protein and purified. The protein fragment cleaved from the glutathione S-transferase fusion protein was shown by CD to contain 5% -helix, 15%  -sheet, and 81% random coil. Fluorescence spectroscopy was used to determine calcyclin dissociation constants of 0.96 and 1.2 µM for intact CacyBP and CacyBP-(178-229), respectively, indicating that the fragment can be used for characterization of calcyclin-CacyBP interactions. NMR analysis of CacyBP-(178-229) binding-induced changes in the chemical shifts of ¹⁵N-enriched calcyclin revealed that CacyBP binding occurs at a discrete site on calcyclin with micromolar affinity.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Calcyclin (S100A6) is a calcium-binding protein that belongs to the family of S100 proteins (reviewed in Refs. 2 and 3). Its gene was discovered on the basis of its cell cycle-dependent expression (4). This gene is expressed at its maximal level during the transition between G₀ to S phase of the cell cycle, but its expression is deregulated in acute myeloid leukemia (5). The protein was first purified and characterized from Ehrlich ascites tumor (EAT)¹ cells (6, 7). Later calcyclin was found to be expressed at high levels in fibroblasts and epithelial cells, in cells with high proliferating activity, and those undergoing differentiation (8-11).

Several possible protein targets of calcyclin have been identified. Calcyclin has been shown to interact in vitro in a Ca²⁺-dependent manner with glyceraldehyde-3-phosphate dehydrogenase, annexin II (12), annexin VI (13), annexin XI (14), caldesmon (15), and CacyBP (calcyclin-binding protein) (1, 16). Although the three-dimensional structures of calcyclin in the absence and presence of calcium have been determined (17, 18), the structural basis for target interactions and its putative role as a calcium sensor in the cell remain unclear.

CacyBP was initially identified, purified, and characterized from EAT cells (16). Amino acid sequencing of chymotryptic fragments suggested that it was a novel protein, so CacyBP was cloned from a mouse brain cDNA library and sequenced (1). Except for a recently submitted hypothetical protein, which is apparently a human homologue of CacyBP, the nucleotide sequence of CacyBP reveals no homology to any other sequence deposited in standard data bases. Recombinant CacyBP was expressed in Escherichia coli, and its interaction with calcyclin was shown to occur at physiological calcium concentration (1). Recent studies revealed that CacyBP is present at high level in the mouse and rat brain, particularly in the neuronal cells (19).

Since little is known about the functional role of calcyclin in the cell and CacyBP is one of the primary putative targets, we set out to identify the region of CacyBP responsible for binding to calcyclin and characterize the corresponding complex. To achieve this goal we first subcloned, expressed, and purified CacyBP. Then, we carried out a series of limited proteolysis experiments to search for evidence of CacyBP domain structure and probe the calcyclin-binding site. Deletion mutagenesis was used next to characterize the CacyBP-calcyclin interaction and further localize the binding site on CacyBP. NMR spectroscopy on ¹⁵N-enriched calcyclin was used to confirm that CacyBP has a specific binding site on calcyclin.

	EXPERIMENTAL PROCEDURES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Primer List-- Restriction enzyme recognition sites are in bold. The list is as follows: p30ATG-Bam, GGATCGGATCCATGGCTTCCGTTTTGGAAGAG; p30ATG-Eco, ATGTAGAATTCATGGCTTCCGTTTTGGAA; p30ATG-Nde, GAGAGCATATGGCTTCCGTTTTGGAA; p30TGA, GAGACGAATTCTCATCAAAATTCCGTGTCTTC; p30-(25C), GATAGGTCGACTCATCAGTCTCCGTCTTCATAAAT; p30-(50C), GAGAGGTCGACTCATCACTTTTCTTTCTCTTTGC; p30-(149N), GGCGTGGATATCACAGTAATTATTCTATGTAG; p30-(200N), GATAGCCATGGAAGACGGAGACGATGAT; p30-(1409-1391), GGTGGGAATTCTTTTTTTTTCATCTTTTAAG; p30-166f, CTCTCGGATCCTACTTAACACAGGTGGAA; p30-178f, GAGAGGGATCCGAAAAGCCTTCCTACGAC; and p30-206b, GAGAGGAATTCTCAATCATCGTCTCCGTCTTC.

Construction of Expression Vectors-- PCR was carried out with CacyBP cDNA in pBluescript vector (1) as template and primers: p30ATG-Nde and p30TGA for rCacyBP; p30ATG-Eco and p30-(25C) for 25C mutant; p30ATG-Eco and p30-(50C) for 50C; p30-(149N) and p30TGA for 149N; p30-(200N) and p30-(1409-1391) for 200N; p30-166f and p30TGA for GST-CacyBP-(166-229); p30-178f and p30TGA for GST-CacyBP-(178-229); and p30-178f and p30-206b for GST-CacyBP-(178-206) (see "Primer List"). Pfu DNA polymerase was used in 30 cycles of PCR. The PCR products were digested with appropriate restriction enzymes, gel-purified, and ligated with linearized pGEX-1 vector (Amersham Pharmacia Biotech) for GST fusion proteins and pET30a vector (Novagen) for all other constructs. The ligation reaction mixture was used to transform Escherichia coli cells (TOP10F'). Potential clones were screened with colony PCR, and the presence of the insert was confirmed by restriction analysis. The constructs were then introduced into BL21 strain of E. coli. Each construct was verified by DNA sequencing.

Protein Expression-- BL21 cells carrying appropriate constructs were grown in LB medium with kanamycin (30 µg/ml) for pET30 constructs and ampicillin (50 µg/ml) for pGEX constructs. When A₆₀₀ reached a value of 0.6, isopropyl-1-thio--D-galactopyranoside was added to final concentration of 1 mM (pET30) or 0.1 mM (pGEX), and the bacteria were further cultured for 3 h. The cells were pelleted by centrifugation at 5000 × g for 15 min, washed once with ice-cold buffer A (40 mM Tris, pH 7.5), and resuspended in buffer A with 0.25 mM PMSF. For cells expressing GST fusion proteins, Triton X-100 was added to final concentration of 1%. The suspension was sonicated 6 times for 20 s with tip sonicator (Branson Sonifier 250). The cell lysate was cleared by centrifugation at 15,000 × g for 15 min.

Protein Purification-- To purify rCacyBP, the cleared lysate was dialyzed overnight against buffer A with 0.25 mM PMSF. CaCl₂ was added to 1 mM final concentration, and the preparation was applied to a Sepharose-calcyclin affinity column.

Sepharose-calcyclin was prepared according to the procedure given by the manufacturer of the CNBr-activated Sepharose (Amersham Pharmacia Biotech). Sepharose-calcyclin affinity column was equilibrated with buffer B (40 mM Tris, pH 7.5, 2 mM CaCl₂, 0.25 mM PMSF), and cleared cell lysates or proteolytic digest reactions were applied. The column was then washed extensively with buffer B plus 0.5 M NaCl, and the bound fraction was eluted with buffer C (40 mM Tris, pH 7.5, 4 mM EGTA, 0.25 mM PMSF).

For the GST fusion proteins, the cleared lysates of BL21 cells carrying the appropriate constructs were applied to Sepharose-glutathione affinity column. The column was then washed extensively with buffer A, and the bound GST fusion protein was eluted with 10 mM reduced glutathione in 50 mM Tris, pH 8.0.

Proteolysis of CacyBP and Identification of Proteolytic Fragments-- 0.24 µg of protease XIV from Streptomyces griseus was added to 1.2 mg of purified rCacyBP in buffer A (w/w 1:5000). The reaction mixture was incubated for 40 min at room temperature. CaCl₂ was added to 1 mM final concentration, and the preparation was applied to a Sepharose-calcyclin affinity column. Unbound and EGTA-eluted fractions were analyzed on Tricine-SDS gel prepared according to the method of Schagger and von Jagow (20). For amino acid sequencing, the fragments were separated on SDS-15% PAGE and electroblotted on polyvinylidene (difluoride) membrane (Millipore) in 10 mM CAPS buffer with 10% methanol. Transferred peptides were stained with 0.1% Coomassie Brillant Blue R-250 in 40% methanol and 1% acetic acid and destained in 50% methanol. Three bands were excised from the membrane, and N-terminal amino acid sequence analysis was performed on a gas phase sequencer (model 491, Perkin-Elmer) at the BioCenter of Jagiellonian University (Cracow, Poland). The phenylthiohydantoin derivatives were analyzed by on-line gradient high performance liquid chromatography on a model 140C Microgradient Delivery System equipped with a model 785A Programmable Absorbance detection system (Perkin-Elmer).

Calcium-dependent Binding of CacyBP Deletion Mutants and GST Fusion Proteins to Calcyclin-- The binding of CacyBP deletion mutants and GST fusion proteins to calcyclin was characterized by calcyclin affinity chromatography and ligand blotting. For affinity chromatography experiments, unbound and EGTA-eluted fractions were analyzed on SDS-15% PAGE (21) and stained with Coomassie Brillant Blue R-250. Ligand blotting was carried out essentially as described (22); recombinant mouse calcyclin was ¹²⁵I-labeled with Amersham Pharmacia Biotech reagent. rCacyBP and CacyBP deletion mutants were analyzed on SDS-15% PAGE and electroblotted onto nitrocellulose membrane. After washing and blocking, the membrane was incubated for 1 h in a buffer containing 50 mM Tris-HCl, pH 7.5, 200 mM NaCl, 1% bovine serum albumin, 1 mM CaCl₂ (or 2 mM EGTA) with 10⁵ M calcyclin supplemented with ¹²⁵I-labeled calcyclin (3.7 10⁵ cpm in 5 ml of incubation buffer). The blots were washed, dried, and exposed for 4 days to x-ray film (Hyperfilm MP, Amersham Pharmacia Biotech).

Preparation of CacyBP-(178-229)-- A solution of 20 mg of GST-CacyBP-(178-229) eluted from the glutathione affinity column was brought to 100 mM in NaCl and 2.5 mM in CaCl₂. Biotinylated thrombin (Novagen) was added (20 units), and the protein was digested at room temperature for 24 h. 400 µl of 50% streptavidin-agarose slurry (Sigma) was then added, and the reaction was incubated for 30 min to bind the protease. Streptavidin-agarose was removed by centrifugation, and the supernatant was ultrafiltered in an Amicon concentrator using a YM10 (M_r 10,000 cut-off) membrane. The flow-through fraction was then concentrated using a YM3 (M_r 3,000 cut-off) membrane, and the protein concentration was measured from the absorbance at 280 nm using an extinction coefficient of 8250 M¹ cm¹.

CD Spectroscopy-- Circular dichroism spectra were recorded on a J-720 Jasco spectropolarimeter. The spectrum of 10 µM CacyBP-(178-229) in 5 mM Tris, pH 7.5, was collected from 180 to 260 nm, with a resolution of 0.2 nm and 1-s response time for each point. 14 scans were accumulated. The data were converted to mean residue ellipticity, and the secondary structure content was calculated according to the method of Chen and co-workers (23) using the Microsoft Dicroprot program.

Fluorescence Spectroscopy-- Protein concentration was measured from the absorbance at 280 nm using extinction coefficient of 3840 M¹ cm¹ for calcyclin and 26,150 M¹ cm¹ for CacyBP. Fluorescence spectra were recorded on a SPEX FLUOROMAX spectrofluorometer at 25 °C. Tryptophan fluorescence was excited at 284 nm for CacyBP and 287 nm for CacyBP-(178-229). Emission was scanned from 300 to 400 nm with excitation and emission band passes set to 5 nm. The emission spectra of 2 µM CacyBP and 2 µM CacyBP-(178-229) in 10 mM Tris, pH 7.5, with 1 mM CaCl₂ were recorded before and after addition of 10 µM calcyclin. For the titrations, 1.1 mM stock solution of calcyclin was added in 0.5-2-µl aliquots to 2.5 ml of 2 µM CacyBP and 2 µM CacyBP-(178-229). The fluorescence change F was monitored at 370 nm for the intact protein and at 382 nm for the fragment. The data were corrected for calcyclin fluorescence and dilution and then normalized and plotted against calcyclin concentration ([calcyclin]). The F versus [calcyclin] plots were then fitted using the KaleidaGraph program with Equation 1 as follows:

(Eq. 1)

where K_d is the dissociation constant and F_max the maximal fluorescence change.

NMR Spectroscopy-- The NMR experiments were conducted at 25 °C on a Bruker AVANCE-500 spectrometer equipped with a triple resonance, three-axis gradient probe. The production of ¹⁵N-enriched rabbit calcyclin by recombinant techniques has been described previously (18). The titration of calcyclin with CacyBP-(178-229) was carried out by adding 40-µl aliquots of a stock solution of 2.5 mM peptide in 150 mM NaCl to 450 µl of 0.5 mM ¹⁵N calcyclin in 50 mM Tris-d₁₁, 30 mM CaCl₂ at pH 7.1. The titration was followed by monitoring the chemical shift changes observed in two-dimensional ¹⁵N-¹H HSQC spectra (24). The two-dimensional spectra were recorded with a ¹H spectral width of 14 ppm centered at the water peak. The ¹⁵N spectral width of 30 ppm was centered at 119 ppm, and 160 experiments were collected with quadrature detection achieved using time proportional phase incrementation phase cycling. To maintain the sensitivity of the spectra during the titration, the number of transients were increased as the sample was diluted. All data sets were processed using FELIX 97.0 (Molecular Simulations Inc., San Diego). The FID was convoluted with a low order polynomial to remove the residual water signal followed by a shifted (45^o) sine-squared apodizing function. In the indirect dimension the FID was extended by linear predicting up to one-third the number of points before applying a shifted (54^o) sine-squared window function. Both dimensions were zero-filled to yield a transformed matrix of size 1024 × 1024 real points.

	RESULTS

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Expression and Purification of rCacyBP-- The expression of recombinant CacyBP (rCacyBP) was achieved by amplifying its cDNA in a PCR and subcloning into the pET30 vector. The construct was then introduced into E. coli strain BL21. After induction with isopropyl-1-thio--D-galactopyranoside, expression of soluble rCacyBP was obtained at the level of ~40 mg/liter of medium. Recombinant protein migrated on SDS-15% PAGE with apparent molecular mass of 30 kDa, the same as for native CacyBP. To purify rCacyBP we took advantage of its calcium-dependent binding to calcyclin. rCacyBP bound to the affinity column in the presence of Ca²⁺ and was eluted with buffer containing 4 mM EGTA (Fig. 1). The protein purity from visualization on SDS-PAGE was estimated to be around 95%.

View larger version (68K): [in this window] [in a new window]   Fig. 1.   Purification of rCacyBP. A lysate of E. coli expressing CacyBP supplemented with 2 mM CaCl2 (a). Calcyclin affinity column unbound fraction (b) and EGTA eluate (c). Arrow indicates rCacyBP.

Delineation of the Calcyclin Binding Region of CacyBP-- As the first step toward identifying the region of CacyBP responsible for calcyclin binding, limited proteolysis experiments were carried out with protease XIV from S. griseus. A fragment cleaved at residue 68 (residues 69-229) bound to calcyclin with an apparent affinity similar to that of the intact CacyBP, whereas a second fragment with the N terminus fully intact (i.e. cleaved at the C terminus) did not. Therefore, we concluded that the calcyclin binding domain(s) is located after residue 68 and likely in the C-terminal portion of CacyBP.

Four deletion mutants of CacyBP were constructed to delineate more precisely the calcyclin binding region. Two of these mutants (25C and 50C) were truncations of 25 and 50 amino acids from the C terminus of CacyBP, respectively. The other two mutants (149N and 200N) were truncations from the N terminus, leaving the last 80 and 30 C-terminal residues, respectively (Fig. 2A). Lysates of E. coli expressing CacyBP and fusions of these deletion mutants with histidine tag and S-tag were applied to a calcyclin affinity column. Both the unbound and bound fractions (eluted with 2 mM EGTA buffer) were analyzed on 15% SDS-PAGE. Fig. 2B shows that rCacyBP and the 149N mutant bound calcyclin, whereas the binding potential of 25C was reduced, and 50C and 200N did not bind. The binding of all deletion mutants to calcyclin was also assayed by ligand blotting. A nitrocellulose blot with rCacyBP and deletion mutants was probed with calcyclin labeled with ¹²⁵I, and the results were essentially the same (data not shown).

View larger version (55K): [in this window] [in a new window]   Fig. 2.   The deletion mutants of CacyBP described in this study (A) and their calcium-dependent binding to the calcyclin affinity column (B). The unbound fraction (U) and fraction eluted with buffer containing 2 mM EGTA (E) from calcyclin affinity column are shown.

View larger version (28K): [in this window] [in a new window]   Fig. 3.   The fusion proteins of GST with CacyBP fragments (A) and their calcium-dependent binding to the calcyclin affinity coulmn (B). The unbound fraction (U) and fraction eluted with buffer containing 2 mM EGTA (E) from the column are shown. The amino acid sequence of CacyBP-(178-229) fragment is given (C).

Additional constructs were then prepared in an effort to localize further the calcyclin binding region of CacyBP. DNA fragments corresponding to CacyBP residues 166-229, 178-229, and 178-206 were subcloned into pGEX vector (Fig. 3A). The GST fusion proteins of these three CacyBP fragments were expressed in E. coli and purified on a glutathione-Sepharose column. Their ability to bind calcyclin was probed using the affinity chromatography approach described above. Fig. 3B shows that GST-CacyBP-(166-229) and GST-CacyBP-(178-229) bound to calcyclin, but GST-CacyBP-(178-206) did not. Thus, the shortest fragment that retained calcyclin binding was CacyBP-(178-229) with sequence shown in Fig. 3C.

Purification and Spectroscopic Characterization of CacyBP-(178-229)-- The purification of GST-CacyBP-(178-229) by glutathione-Sepharose affinity was scaled up to produce mg quantities of protein. The purified fusion protein was cleaved with biotinylated thrombin, and the resulting mixture was ultrafiltered using a YM10 membrane (M_r 10,000 cut-off). The flow-through fraction contained pure CacyBP fragment (Fig. 4, lane e).

View larger version (44K): [in this window] [in a new window]   Fig. 4.   Purification of CacyBP-(178-229) on glutathione-Sepharose affinity column. A lysate of E. coli expressing GST-CacyBP-(178-229) (a), affinity column unbound fraction (b), and fraction eluted with 10 mM reduced glutathione (c) are shown. Purified fusion protein digested with biotinylated thrombin (d) and CacyBP fragment purified using ultrafiltration (e) are shown.

The circular dichroism spectrum of CacyBP-(178-229) (not shown) revealed that the fragment is largely unstructured. Secondary structure content calculated according to the method of Chen and co-workers (23) estimated 5% -helix, 15% -sheet, and 81% random coil.

Binding of CacyBP and CacyBP-(178-229) to calcyclin was next studied using fluorescence spectroscopy. Fig. 5, A and C, shows that calcyclin binding induces a 32% decrease of tryptophan fluorescence intensity for CacyBP and both a 20% decrease and a blue-shift of ~10 nm for CacyBP-(178-229). Fig. 5, B and D, shows that the quenching effect was dose-dependent, and the titration curves provided a K_d value of 0.96 µM for intact CacyBP and 1.2 µM for CacyBP-(178-229).

View larger version (33K): [in this window] [in a new window]   Fig. 5.   Fluorescence emission spectra of CacyBP (A) and CacyBP-(178-229) (C), before (open circles) and after (solid circles) addition of calcyclin. Fluorescence titration of CacyBP (B) and CacyBP-(178-229) (D) are shown. The squares represent titration points and the solid line the fit for binding equation (see Eq. 1, "Experimental Procedures").

NMR Spectroscopy-- The interaction of calcyclin and CacyBP was further characterized by using NMR spectroscopy to monitor a titration of the protein with CacyBP-(178-229). A sample of ¹⁵N-enriched calcyclin was titrated with unlabeled CacyBP-(178-229), and the chemical shift perturbations were monitored by acquiring ¹⁵N-¹H HSQC spectra. An overlay of the initial and final points of the titration is shown in Fig. 6. Addition of substoichiometric amounts of peptide led to broadening of selected resonances, indicative of a specific peptide-binding site on the protein. As the titration nears completion, the cross-peaks sharpen, and some reappear at different positions. The stoichiometry of the complex was determined to be 2 Eq of the peptide bound to the calcyclin homodimer. The observed changes in line shape and line width are typical of slow to intermediate exchange between the free and peptide-bound protein on the µs-ms time scale, which corresponds to a binding constant in the micromolar range. Thus, the results from NMR are fully consistent with parameters derived from the fluorescence experiments.

View larger version (24K): [in this window] [in a new window]   Fig. 6.   Changes in NMR chemical shifts of calcyclin induced by the binding of CacyBP-(178-229). Sections of the two-dimensional 1H-15N HSQC spectra of 15N-enriched calcyclin (Ca2+ bound) in the absence (red) and presence (black) of unlabeled CacyBP-(178-229) at pH 7.1 and 298 K. The final complex contained just over 2 Eq of the peptide per equivalent of calcyclin dimer.

	DISCUSSION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

In the present study we have identified the calcyclin binding domain of CacyBP and characterized its complex with calcyclin using various spectroscopic methods. Limited proteolysis of recombinant CacyBP expressed in E. coli produced a fragment that was approximately 1.5 kDa smaller than the wild type protein and whose affinity for calcyclin was lower than that of the whole protein. Since the N terminus was intact except for N-terminal methionine residue, we estimated that ~15 residues were cleaved off the C terminus of the protein. These residues appear to form a portion of the calcyclin binding region. To test this hypothesis, a series of CacyBP deletion mutants were constructed and investigated for binding to calcyclin by affinity chromatography and ligand blotting. Although the 50C mutant (residues 1-179) and 200N (residues 201-229) failed to bind calcyclin, the 25C mutant (residues 1-204) did retain some binding potential for calcyclin. The 149N (residues 150-229) mutant bound calcyclin with apparent high affinity.

We attempted to use the 149N mutant for more detailed analysis, but during purification we found it was impossible to cleanly remove the histidine and S-tags via the designed thrombin cleavage approach. Solubility problems, most likely caused by the presence of the highly charged tags, made the spectroscopic characterization of this mutant impossible. We then changed to a GST fusion strategy using the pGEX vector. Three fusion proteins of GST and CacyBP fragments were prepared encompassing residues 166-229, 178-229, and 178-206. The first two bound calcyclin, but the third failed to do so. These results indicated that the calcyclin binding domain was localized between residues 178 and 229. Since GST-CacyBP-(178-206) failed to bind calcyclin, we postulated that some or all of 23 C-terminal amino acid residues are required to obtain the full binding potential. We hypothesize that these residues are required to stabilize the actual calcyclin binding region, which is probably further upstream in the sequence.

Interactions between S100 proteins and their targets have been characterized in detail for several systems, but their physiological relevance is still largely unknown. Among them are annexin XI binding to calcyclin (25-27), Ca²⁺-independent association of S100A10 (p11) with annexin II (p36) in the calpactin heterotetramer (28, 29), and S100A11 interaction with annexin I (30, 31). Analysis of these interactions shows that S100 protein binding domains have high content of hydrophobic residues and have the potential to form amphipathic -helices. CacyBP-(178-229) also contains high proportion of hydrophobic residues, and secondary structure prediction using PSIpred (32) suggests that the fragment can have structure of amphipathic -helix.

CacyBP-(178-229) was the smallest fragment that retained calcyclin binding potential, and its interaction with calcyclin was characterized using spectroscopic methods. After the removal of GST from GST-CacyBP-(178-229) fusion protein, circular dichroism spectrum of the free fragment showed CacyBP-(178-229) to be largely unstructured. However binding to calcyclin appears to induce structure in the otherwise random coil fragment. Examples of such behavior have been noted for a wide variety of systems, including calmodulin target peptides (33, 34). The NMR data clearly show that the CacyBP-(178-229) binds to a specific site on calcyclin.

We next compared the calcyclin dissociation constant of the whole CacyBP and CacyBP-(178-229) fragment. Calcyclin contains no tryptophan residues, and CacyBP and CacyBP-(178-229) contain 3 and 1 tryptophan residue, respectively, which enabled the binding constant to be measured using fluorescence spectroscopy. Fluorescence emission spectra of CacyBP and CacyBP-(178-229) revealed a decrease of tryptophan fluorescence intensity. For CacyBP-(178-229) a blue shift of the fluorescence peak was also observed. This suggests the tryptophan residue is transferred into a more hydrophobic environment upon binding to calcyclin. Fluorescence tritrations allowed us to determine the calcyclin dissociation constant for the whole CacyBP (0.96 µM) and for CacyBP-(178-229) (1.2 µM). The great similarity of these values and the agreement with the results from NMR analysis support the use of the fragment to further characterize calcyclin-CacyBP interactions. Efforts to elucidate the details of the key interactions in the binding site and understand how these contribute to the affinity and specificity are currently underway in our laboratories.

	ACKNOWLEDGEMENT

We thank Professor Michael P. Stone for access to computer hardware and software for NMR data processing. M. N. thanks the Kronenberg Foundation for its fellowship

	FOOTNOTES

^* This work was supported by a State Committee of Scientific Research Grant 6P04A5415 (to A. F.), statutory funds for the Nencki Institute, and a National Institutes of Health Grant RO1 GM-62112 (to W. J. C.).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

To whom correspondence should be addressed. Tel.: 48 22 659 31 43: Fax: 48 22 822 53 42: E-mail: jacek@nencki.gov.pl.

Published, JBC Papers in Press, July 6, 2000, DOI 10.1074/jbc.M001622200

	ABBREVIATIONS

The abbreviations used are: EAT, Ehrlich ascites tumor; GST, glutathione S-transferase; CacyBP, calcyclin-binding protein; rCacyBP, recombinant calcyclin-binding protein; CAPS, 3-[cyclohexylamino]-1-propanesulfonic acid; PAGE, polyacrylamide gel electrophoresis; PMSF, phenylmethylsulfonyl fluoride; HSQC, heteronuclear single quantum coherence; Tricine, N-[2-hydroxy-1,1-bis(hydroxymethyl)ethyl]glycine.

	REFERENCES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

CiteULike

Complore

Connotea

Del.icio.us

Digg

Reddit

Technorati

This article has been cited by other articles:

				Y.-T. Lee, J. Jacob, W. Michowski, M. Nowotny, J. Kuznicki, and W. J. Chazin Human Sgt1 Binds HSP90 through the CHORD-Sgt1 Domain and Not the Tetratricopeptide Repeat Domain J. Biol. Chem., April 16, 2004; 279(16): 16511 - 16517. [Abstract] [Full Text] [PDF]

				M. Nowotny, M. Spiechowicz, B. Jastrzebska, A. Filipek, K. Kitagawa, and J. Kuznicki Calcium-regulated Interaction of Sgt1 with S100A6 (Calcyclin) and Other S100 Proteins J. Biol. Chem., July 11, 2003; 278(29): 26923 - 26928. [Abstract] [Full Text] [PDF]

				A. Filipek, B. Jastrzebska, M. Nowotny, and J. Kuznicki CacyBP/SIP, a Calcyclin and Siah-1-interacting Protein, Binds EF-hand Proteins of the S100 Family J. Biol. Chem., August 2, 2002; 277(32): 28848 - 28852. [Abstract] [Full Text] [PDF]

				A. Filipek, B. Jastrzebska, M. Nowotny, K. Kwiatkowska, M. Hetman, L. Surmacz, E. Wyroba, and J. Kuznicki Ca2+-dependent Translocation of the Calcyclin-binding Protein in Neurons and Neuroblastoma NB-2a Cells J. Biol. Chem., May 31, 2002; 277(23): 21103 - 21109. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) All Versions of this Article: 275/40/31178    most recent M001622200v1 Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Nowotny, M. Articles by Kuznicki, J. Search for Related Content PubMed PubMed Citation Articles by Nowotny, M. Articles by Kuznicki, J. Social Bookmarking                      What's this?