Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M004263200 on July 7, 2000

J. Biol. Chem., Vol. 275, Issue 40, 31233-31238, October 6, 2000
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
275/40/31233    most recent
M004263200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Nagasawa, K.-i.
Right arrow Articles by Nakanishi, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Nagasawa, K.-i.
Right arrow Articles by Nakanishi, M.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Identification and Characterization of Human DNA Polymerase beta 2, a DNA Polymerase beta -Related Enzyme*

Kei-ichi NagasawaDagger §, Kenzo Kitamura||, Akihiro Yasui§, Yuji Nimura, Kyoji IkedaDagger , Momoki Hirai**, Akio MatsukageDagger Dagger §§, and Makoto NakanishiDagger ||¶¶

From the Dagger  Department of Geriatric Research, National Institute for Longevity Sciences, Obu, Aichi 474-8522, § Department of Surgery, National Chubu Hospital, Obu, Aichi 474-8511,  Department of Surgery, Nagoya University Medical School, Nagoya, Aichi 466-8550, || Department of Biochemistry, Nagoya City University Medical School, Nagoya, Aichi 467-8601, ** Department of Biological Sciences, Graduate School of Science, University of Tokyo, Tokyo 113, and Dagger Dagger  Laboratory of Cell Biology, Aichi Cancer Center Research Institute, Nagoya, Aichi 464-8681, Japan

Received for publication, May 18, 2000, and in revised form, July 5, 2000

    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS AND DISCUSSION
REFERENCES

The BRCA1 COOH terminus (BRCT) motif is present in many nuclear proteins that contribute to cell cycle regulation or DNA repair. Polymerase chain reaction-based screening with degenerate primers targeted to the BRCT motif resulted in the isolation of a human cDNA for a previously unidentified DNA polymerase (designated DNA polymerase beta 2) that is closely related to DNA polymerase beta  (Pol beta ). The predicted Pol beta 2 protein contains a BRCT motif in its NH2-terminal region; its COOH-terminal region exhibits 33% sequence identity to a corresponding region of human Pol beta . The Pol beta 2 gene is expressed in a tissue-specific manner, with transcripts being most abundant in testis. A fusion construct comprising Pol beta 2 and green fluorescent protein exhibited a predominantly nuclear localization in transfected HeLa cells. Recombinant human Pol beta 2 from insect cells exhibited substantial DNA polymerase activity, but it did not possess terminal deoxyribonucleotidyl transferase activity. A truncated Pol beta 2 mutant lacking the BRCT motif retained substantial DNA polymerase activity, whereas a mutant Pol beta 2 with two alanine point mutations within the DNA polymerase active site did not. These results indicate that Pol beta 2 is a Pol beta -related DNA polymerase with a BRCT motif that is dispensable for its polymerase activity.

    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS AND DISCUSSION
REFERENCES

The human BRCA1 gene, which determines susceptibility to familial breast and ovarian cancer (1), encodes a predicted protein of 1863 amino acids whose NH2-terminal region contains a single RING finger, a domain present in various proteins that exhibit transactivation activity at the promoter of certain viral and cellular genes (1, 2). However, the observations that individuals who inherit a mutant BRCA1 gene containing a stop codon at codon 1853 develop early onset breast cancer (3) and that COOH-terminal truncation of the BRCA1 protein impairs its ability to inhibit the growth of breast cancer cells (4), suggest that the COOH-terminal portion of BRCA1 is essential for the normal function of this protein.

Computer analysis has identified a conserved domain within the COOH-terminal region of BRCA1 that contains a repeated motif, BRCA1 COOH terminus (BRCT)1 (5, 6). The BRCT motif comprises ~95 amino acids and occurs as a tandem repeat in the COOH-terminal region of various proteins; it has also been detected as a tandem repeat in the NH2-terminal region or as a single copy in some proteins. The BRCT motif is widespread from bacteria to mammals in nuclear proteins that are important in regulation of the cell cycle or in DNA repair, including p53BP1, RAD9, XRCC1, RAD4, Ect2, REV1, Crb2, RAP1, terminal deoxyribonucleotidyl transferase (TdT), and three eukaryotic DNA ligases (5, 6). Despite the functional diversity of these nuclear proteins, participation in checkpoints responsive to DNA damage appears to be a unifying theme. X-ray crystallographic analysis of the BRCT motif has suggested that it might mediate interaction between proteins that contain it (7).

DNA polymerase beta  (Pol beta ) plays an important role in base excision repair in mammals (8-11). The 39-kDa vertebrate protein is organized into a 31-kDa COOH-terminal domain that includes the polymerase active site (12) and an 8-kDa NH2-terminal domain that participates in binding to DNA and exhibits 5'-deoxyribose phosphodiesterase (lyase) activity (13). The presence of both polymerase and lyase activities suggests that Pol beta  functions in "short-patch" base excision repair by catalyzing both the removal of a 5'-deoxyribose phosphate intermediate and the subsequent filling of the resultant single-nucleotide gap (14, 15). Pol beta  is also implicated in "long-patch" base excision repair (14), suggesting functions in meiosis (16) and nucleotide excision repair (17, 18). However, Pol beta -deficient cells are sensitive to DNA-alkylating agents such as methylmethane sulfonate but not to other DNA-damaging agents such as ultraviolet radiation (19), suggesting that another unidentified Pol beta -like DNA polymerase might function in "long-patch" repair (including nucleotide excision repair). We have now isolated a human cDNA that encodes a Pol beta -like protein, designated DNA polymerase beta 2 (Pol beta 2). The predicted Pol beta 2 protein contains a BRCT motif in its NH2-terminal region, and we describe its characterization as a Pol beta -related DNA polymerase.

    EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS AND DISCUSSION
REFERENCES

Cloning of Human Pol beta 2 cDNA-- Degenerate primers, 5'-GTIGTI(T/C)TNACNAA(T/C)AT(A/T/C)GG and 5'-CG(A/G/T)AT(A/G/T)AT(A/G)TGNGTNAC(A/G)TC, were designed on the basis of the sequence homology shared by the BRCT motifs of Schizosaccharomyces pombe cut5 and human XRCC1 and were used to screen cDNAs from human MDAH041 cells with the use of the polymerase chain reaction (PCR). Sequence analysis of a resulting PCR product revealed an incomplete open reading frame that encoded an amino acid sequence homologous to the BRCT domains of S. pombe cut5 and human XRCC1. Additional 5' sequences of this cDNA were obtained by 5' rapid amplification of cDNA ends, and 3' sequences were obtained by screening a human fetal brain cDNA library (Stratagene).

Fluorescence in Situ Hybridization-- The chromosomal location of the human Pol beta 2 gene was determined by fluorescence in situ hybridization as described previously (20). A biotinylated human Pol beta 2 cDNA probe that specifies nucleotide positions was allowed to hybridize overnight at 37 °C with R-banded chromosomes prepared from phytohemagglutinin-stimulated lymphocytes of normal donors. The slides were washed first for 10 min at 37 °C in 2× standard saline citrate containing 50% formamide and then for 15 min at room temperature in 1× standard saline citrate. Hybridization signals were detected with the use of rabbit antibodies to biotin (Enzo) and fluorescein isothiocyanate-labeled goat antibodies to rabbit immunoglobulin G (Enzo). The chromosomes were counterstained with propidium iodide.

Northern Blot Analysis-- Polyadenylated RNA isolated from the indicated human tissues (CLONTECH) was subjected to Northern blot analysis. Hybridization was performed in 50% formamide at 42 °C for 24 h with a 32P-labeled probe corresponding to the NH2-terminal region of human Pol beta 2 cDNA ().

Expression of Recombinant Pol beta 2 Protein in Sf9 Cells-- Baculoviruses encoding Pol beta 2 tagged at its COOH terminus with the Myc epitope and six histidine residues (Pol beta 2-Myc-His6) were generated first by performing PCR with the 5' primer 5'-TTTGAATTCACCACCATGGATCCCAGGGGTATCTGAAG (5'-1), the 3' primer 5'-TTTCTCGAGCCAGTCCCGCTCAGCAGGTTCTCG (3'-1), and cDNA derived from human B cell leukemia (Raji) cells as template. The resulting PCR product was then digested with EcoRI and XhoI and ligated into pcDNA3.1/Myc-HisA (Invitrogen). The EcoRI-PmeI fragment of the resulting vector was subcloned into pVL1392 (Pharmingen) and introduced (1 µg) together with 2.5 µg of linearized baculovirus DNA (BaculoGold; Pharmingen) into Sf9 cells by transfection. The truncated Pol beta 2 cDNA lacking the BRCT motif was generated by PCR with the 5' primer TTTGAATTCACCACCATGTGTGCACAGCCCTCAAGCCAG, 3'-1, and pVL1392 hPol beta 2 cDNA as a template. The polymerase-inactive mutant (D427A-D429A) was generated by two-step PCR with 5'-1, 3'-1, the sense primer 5'-TGTGGTGCTGTCGCCGTGCTC, the antisense primer 5'-GAGCACGGCGACAGCACCACA, and pVL1392 hPol beta 2 cDNA as a template.

Immunoblot Analysis-- Cells were lysed in ice-cold IP buffer (50 mM Hepes-NaOH (pH 8.0), 150 mM NaCl, 2.5 mM EGTA, 1 mM EDTA, 0.1% Tween 20, 10% glycerol) containing a mixture of protease inhibitors (soybean trypsin inhibitor (20 µg/ml), aprotinin (2 µg/ml), leupeptin (5 µg/ml), phenylmethylsulfonyl fluoride (100 µg/ml)) and phosphatase inhibitors (50 mM NaF, 0.1 mM Na3VO4, phosphatase substrate (5 mg/ml) (Sigma)). Clear lysates were fractionated by SDS polyacrylamide gel electrophoresis on an 8% gel and then subjected to immunoblot analysis with antibodies to the Myc epitope or to the His6 tag (1:1000 dilution) (Medical and Biological Laboratory Co. Ltd., Nagoya, Japan and Invitrogen, respectively).

Assay of DNA Polymerase Activity-- Baculovirus-encoded wild-type Pol beta 2-Myc-His6, a truncation mutant of Pol beta 2 lacking the BRCT motif (Delta Pol beta 2), and a catalytically inactive mutant (D427A-D429A) were immunoprecipitated from Sf9 cells with antibodies to Myc (MBL) and subjected to an in vitro DNA polymerase assay. The reaction mixture (25 µl) contained 50 mM Tris-HCl (pH 8.8), 1 mM dithiothreitol, 0.5 mM MnCl2, (dT)12-18 (40 µg/ml), activated DNA or poly(rA) (40 µg/ml), 0.1 mM [3H]dTTP (60 cpm/pmol), 15% glycerol, bovine serum albumin (400 µg/ml), 100 mM KCl, and enzyme. After incubation at 30 °C, the radioactive DNA product was collected on a disc of DEAE-cellulose as described (21). One unit of DNA polymerase activity was defined as the incorporation of 1 nmol of [3H]dTMP into polymeric DNA per 60 min.

    RESULTS AND DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS AND DISCUSSION
REFERENCES

Cloning of Human Pol beta 2 cDNA-- To isolate human cDNAs for previously unidentified proteins that contain a BRCT motif, we performed PCR with degenerate primers based on the sequence homology apparent between the BRCT motifs of S. pombe cut5, also known as rad4 (22), and human XRCC1 (23). A 114-base pair PCR product was then used to isolate a corresponding full-length human cDNA, the nucleotide sequence of which encodes a protein of 575 amino acids with a calculated molecular mass of 63,421 Da (Fig. 1 


View larger version (40K):
[in this window]
[in a new window]
  		Fig. 1. Predicted amino acid sequence of human Pol beta 2 and its homology to other proteins. A, alignment of the amino acid sequences of human Pol beta 2 (hPol beta 2) and human Pol beta  (hPol beta ). Black and gray backgrounds indicate residues that are identical or conservative substitutions, respectively. Asterisks indicate a putative nuclear localization signal. Hyphens within the sequences represent gaps introduced to optimize alignment, and residue numbers are shown on the left. B, alignment of the amino acid sequences of BRCT motifs within human Pol beta 2, S. pombe cut5 (22), mouse ECT2 (36), human XRCC1 (23), and Saccharomyces cerevisiae Rev1 (37). R1 and R2 refer to repeats 1 and 2 of the BRCT motif. The consensus sequence for the BRCT motif is indicated at the bottom. Background shading and hyphens within sequences are as in A. C, domain structure of human Pol beta 2. Black and gray boxes represent the BRCT motif of Pol beta 2 and homologous regions shared by Pol beta 2, Pol beta , and TdT. Total amino acid numbers are shown on the right.
A). The predicted protein, which we have termed Pol beta 2, contains a BRCT motif in its NH2-terminal region (Fig. 1B). The COOH-terminal portion of the predicted protein exhibits 33 and 27% sequence identity to corresponding regions of human Pol beta  and human TdT, respectively (Fig. 1C).

Tissue Distribution of Pol beta 2 mRNA-- The distribution of Pol beta 2 mRNA among various normal human tissues was examined by Northern blot analysis. The Pol beta 2-specific probe recognized a 2.0-kilobase mRNA that was most abundant in testis and ovary and was present in smaller amounts in prostate, skeletal muscle, and pancreas (Fig. 2). The expression of Pol beta 2 in the testis suggests that, like Pol beta , this enzyme may contribute to meiotic cell division during spermatogenesis. In addition, Northern blot analysis revealed the cell cycle-dependent expression of Pol beta 2 mRNA with higher expression being observed in quiescent and S- to M-phase cells (data not shown).


View larger version (32K):
[in this window]
[in a new window]
  		Fig. 2.   Distribution of Pol beta 2 mRNA in human tissues. Polyadenylated RNA isolated from the indicated human tissues (CLONTECH) was subjected to Northern blot analysis with a 32P-labeled cDNA probe specific for human Pol beta 2 mRNA (upper panel) or with a human beta -actin cDNA probe as an internal control (lower panel). The arrows indicate the positions of molecular size standards (in kilobases). PBL, peripheral blood lymphocytes.

Subcellular Localization of Pol beta 2-- To determine the subcellular localization of Pol beta 2, we transfected HeLa cells with an expression vector for a fusion construct comprising Pol beta 2 and green fluorescent protein (GFP) and then examined the cells by ultraviolet microscopy. The Pol beta 2-GFP fusion protein was localized predominantly to the nucleus, whereas GFP alone was present in both the cytoplasm and nucleus (Fig. 3A). The nuclear localization of Pol beta 2 is thus consistent with the presence of a putative nuclear localization signal in the COOH-terminal region of the protein (Fig. 1A), as well as with its predicted function as a DNA polymerase.


View larger version (36K):
[in this window]
[in a new window]
  		Fig. 3.   A, nuclear localization of human Pol beta 2 protein. HeLa cells were transfected with an expression vector encoding either a Pol beta 2-GFP fusion protein (left panel) or GFP alone (right panel), and, after 48 h, the cells were fixed with 2% paraformaldehyde in phosphate-buffered saline and examined by ultraviolet microscopy. Magnification, × 400. B, chromosomal localization of the human Pol beta 2 gene. R-banded chromosomes from activated human lymphocytes were subjected to hybridization with a biotinylated human Pol beta 2 cDNA probe. The arrow indicates the locus of the Pol beta 2 gene (10q24.3-25.1).

Chromosomal Localization of the Human Pol beta 2 Gene-- Mutations in the Pol beta  gene that result in the loss of base excision repair have been frequently associated with certain types of cancer, including prostate (24), colon (25), bladder (26), kidney (27), lung (28), and stomach (29) tumors. To determine whether the human chromosomal region that contains the Pol beta 2 gene might also be associated with cancer, we determined the chromosomal localization of this gene. Fluorescence in situ hybridization analysis revealed that the Pol beta 2 gene is localized to human chromosome 10q24.3-25.1 (Fig. 3B). Loss of heterozygosity at this region has been associated with several cancers, including glioma (30), as well as lung (31), prostate (32), and bladder (33) tumors, suggesting that mutation or deletion of the Pol beta 2 gene may contribute to oncogenesis.

DNA Polymerase Activity of Recombinant Pol beta 2 and Its Regulation by the BRCT Motif-- To determine whether Pol beta 2 actually possesses DNA polymerase or TdT activities, we first generated recombinant Pol beta 2 proteins, tagged at their COOH termini with Myc and His6 epitope tags, in insect cells. Lysates of Sf9 cells expressing Pol beta 2-Myc-His6 proteins were subjected to immunoblot analysis with antibodies specific for the Myc or His6 tags. The tagged wild-type protein and a mutant protein (Delta Pol beta 2; amino acids 240-575) lacking the BRCT motif yielded immunoreactive bands corresponding to the expected sizes of ~68 and 48 kDa, respectively, with both types of antibodies (Fig. 4). The recombinant proteins were then immunoprecipitated with antibodies to the Myc tag and assayed for DNA polymerase activity with activated DNA or poly(rA) as templates. The activity of Pol beta  expressed in and purified from Escherichia coli as described previously (34) was also assayed. The specific activity of the recombinant enzymes was calculated from the measured activity and the amount of protein as determined by SDS polyacrylamide gel electrophoresis and densitometric scanning of the stained bands. The specific activity of Pol beta  was thus estimated as 2030 units/nmol with activated DNA and 57,800 units/nmol with poly(rA) (Table I). Pol beta  did not possess TdT activity. Wild-type Pol beta 2 also exhibited DNA polymerase activity, although its specific activity was less than that of Pol beta  (60 units/nmol with activated DNA and 2480 units/nmol with poly(rA)). Like Pol beta , Pol beta 2 did not possess TdT activity. As a control, a Pol beta 2 mutant (D427A-D429A) in which conserved aspartate residues (35) were replaced by alanine showed neither DNA polymerase nor TdT activities. In contrast, the Delta Pol beta 2 mutant that lacks BRCT motif retained substantial DNA polymerase activity (370 units/nmol with activated DNA and 7810 units/nmol with poly(rA)), indicating that the BRCT domain is dispensable for DNA polymerase activity.


View larger version (15K):
[in this window]
[in a new window]
  		Fig. 4.   Expression of recombinant wild-type Pol beta 2 and its mutant Delta Pol beta 2 in Sf9 cells. Sf9 cells were infected at a multiplicity of infection of 10 with baculoviruses encoding wild-type or mutant Pol beta 2 proteins tagged at their COOH termini with Myc and His6 epitopes. 48 h after infection, the cells were collected, lysed, and subjected (10 µg of protein per lane) to SDS polyacrylamide gel electrophoresis and immunoblot analysis with antibodies to the Myc epitope (alpha Myc) or His6 (alpha His) tags. The positions of molecular size standards (in kilodaltons) are shown on the left, and those of the recombinant Pol beta 2 proteins are indicated on the right.

                              
View this table:
[in this window]
[in a new window]
 
Table I
DNA polymerase activity of recombinant Pol beta 2
Purified human Pol beta  expressed in E. coli, as well as wild-type and mutant (Delta Pol beta 2 and D427A-D429A) Pol beta 2 proteins expressed in insect cells, were assayed for DNA polymerase activity with activated DNA or poly(rA) as templates. Purified recombinant TdT protein was purchased from Life Technologies, Inc. Data are means ± S.E. of values from three independent experiments. ND, not determined.

In summary, our results indicate that Pol beta 2 possesses DNA polymerase activity similar to that of Pol beta . Given that the BRCT motif is thought to mediate protein-protein interaction, it is possible that interaction of Pol beta 2 with an unidentified protein (or proteins), such as DNA ligase, through the BRCT motif may regulate its DNA polymerase activity. The identification of Pol beta 2 also raises the possibility that Pol beta  and Pol beta 2 may cooperatively regulate base excision repair or nucleotide excision repair.

    ACKNOWLEDGEMENTS

We thank Drs. Noboru Motoyama, Yuichiro Tojima, and Atsuhi Fujimoto for helpful discussion.

    FOOTNOTES

* This work was supported in part by a grant-in-aid for scientific research on priority areas from the Ministry of Education, Science, Sports, and Culture of Japan (to M. N.), by a grant-in-aid for scientific research from the Japan Society for the Promotion of Science (to M. N.), and by a health science research grant for research on the human genome and gene therapy from the Ministry of Health and Welfare of Japan (H10-genome-001 to K. I.).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EMBL Data Bank with accession number(s) AF283478.

§§ Present address: Chemical and Biological Sciences, Faculty of Science, Japan Women's University, 2-8-1 Mejirodai, Bunkyou-ku, Tokyo 112-8681, Japan.

¶¶ To whom correspondence should be addressed: Dept. of Biochemistry, Nagoya City University Medical School, 1 Kawasumi, Mizuho-cho, Mizuho-ku, Nagoya 467-8601, Japan. Tel.: 81-52-853-8145; Fax: 81-52-842-3955; E-mail: mkt-naka@med.nagoya-cu.ac.jp.

Published, JBC Papers in Press, July 7, 2000, DOI 10.1074/jbc.M004263200

    ABBREVIATIONS

The abbreviations used are: BRCT, BRCA1 COOH terminus; TdT, terminal deoxyribonucleotidyl transferase; Pol beta , DNA polymerase beta ; PCR, polymerase chain reaction; GFP, green fluorescence protein.

    REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS AND DISCUSSION
REFERENCES

1. Miki, Y., Swensen, J., Shattuck-Eidens, D., Futreal, P. A., Harshman, K., Tavtigian, S., Liu, Q., Cochran, C., Bennett, L. M., Ding, W., Bell, R., Rosenthal, J., Hussey, C., Tran, T., McClure, M., Frye, C., Hattier, T., Phelps, R., Haugen-Strano, A., Katcher, H., Yakumo, K., Gholami, Z., Shaffer, D., Stone, S., Bayer, S., Wray, C., Bodgen, R., Dayananth, P., Ward, J., Tonin, P., Narod, S., Bristow, P. K., Norris, F. H., Helvering, L., Morrison, P., Rosteck, P., Lai, M., Barrett, J. C., Lewis, C., Neuhausen, S., Cannon-Albright, L., Goldgar, D., Wiseman, R., Kamb, A., and Skolnick, M. H. (1994) Science 266, 66-71
2. Bienstock, R. J., Darden, T., Wiseman, R., Pedersen, L., and Barrett, J. C. (1996) Cancer Res. 56, 1539-1545
3. Friedman, L. S., Ostermeyer, E. A., Szabo, C. S., Dowd, P., Lynch, E. D., Rowell, S. E., and King, M.-C. (1994) Nat. Genet. 8, 399-404
4. Holt, J. T., Thompson, M. E., Szabo, C., Robinson-Benion, C., Aerteaga, C. L., King, M.-C., and Jensen, R. A. (1996) Nat. Genet. 12, 298-302
5. Bork, P., Hofmann, K., Bucher, P., Neuwald, A. F., Altschul, S. F., and Koonin, E. V. (1997) FASEB J. 11, 68-76
6. Callebaut, I., and Mornon, J.-P. (1997) FEBS Lett. 400, 25-30
7. Zhang, X., Morera, S., Bates, P. A., Whitehead, P. C., Coffer, A. I., Hainbucher, K., Nash, R. A., Sternberg, M. J. E., Lindahl, T., and Freemont, P. S. (1998) EMBO J. 21, 6404-6411
8. Wilson, S., Abbotts, J., and Widen, S. (1988) Biochim. Biophys. Acta 949, 149-157
9. Hammond, R. A., McClung, J. K., and Miller, M. R. (1990) Biochemistry 29, 286-291
10. Wiebauer, K., and Jiricny, J. (1990) Proc. Natl. Acad. Sci. U. S. A. 87, 5842-5845
11. Wilson, S. H. (1990) in The Eukaryotic Nucleus: Molecular Biochemistry and Macromolecular Assemblies (Strauss, P. R. , and Wilson, S. H., eds), Vol. 1 , pp. 199-234, Telford Press, Caldwell, NJ
12. Pelletier, H., Sawaya, M. R., Kumar, A., Wilson, S. H., and Kraut, J. (1994) Science 264, 1891-1903
13. Wilson, S. J., Singhal, R. K., and Kumar, A. (1992) in DNA Repair Mechanisms (Bohr, V. A. , Wassermann, K. , and Draemer, K. H., eds), Vol. 35 , pp. 343-360, Munksgaard, Copenhagen
14. Klungland, A., and Lindahl, T. (1997) EMBO J. 16, 3341-3348
15. Matsumoto, Y., and Kim, K. (1995) Science 269, 699-702
16. Plug, A. W., Clairmont, C. A., Sapi, E., Ashley, T., and Sweasy, J. B. (1997) Proc. Natl. Acad. Sci. U. S. A. 94, 1327-1331
17. Horton, J. K., Srivastava, D. K., Zmudzka, B. Z., and Wilson, S. H. (1995) Nucleic Acids Res. 23, 3810-3815
18. Oda, N., Saxena, J. K., Jenkins, T. M., Prasad, R., Wilson, S. H., and Ackerman, E. J. (1996) J. Biol. Chem. 271, 13816-13820
19. Sobol, R. W., Horton, J. K., Kuhn, R., Gu, H., Singhal, R. K., Prasad, R., Rajewsky, K., and Wilson, S. H. (1996) Nature 379, 183-186
20. Hirai, M., Suto, Y., and Kanoh, M. (1994) Cytogenet. Cell Genet. 66, 149-151
21. Lindell, T. J., Weinberg, F., Morris, P. W., Roeder, R. G., and Rutter, W. J. (1970) Science 170, 447-449
22. Saka, Y., and Yanagida, M. (1993) Cell 74, 383-393
23. Thompson, L. H., Brookman, K. W., Jones, J. J., Allen, S. A., and Carrano, A. V. (1990) Mol. Cell. Biol. 10, 6160-6171
24. Dobashi, Y., Shuin, T., Tsuruga, H., Uemura, H., Torigoe, S., and Kubota, Y. (1994) Cancer Res. 54, 2827-2829
25. Wang, L., Patel, U., Ghosh, L., and Banerjee, S. (1992) Cancer Res. 52, 4824-4827
26. Matsuzaki, J., Dobashi, Y., Miyamoto, H., Ikeda, I., Fujinami, K., Shuin, T., and Kubota, Y. (1996) Mol. Carcinogen. 15, 38-43
27. Yan, Z. J., and Roy, D. (1995) Biochem. Mol. Biol. Int. 37, 175-183
28. Bhattacharyya, N., Chen, H. C., Comhair, S., Erzurum, S. C., and Banerjee, S. (1999) DNA Cell Biol. 18, 549-554
29. Iwanaga, A., Ouchida, M., Miyazaki, K., Hori, K., and Mukai, T. (1999) Mutat. Res. 435, 121-128
30. Albarosa, R., Colombo, B. M., Roz, L., Magnani, I., Pollo, B., Cirenei, N., Giani, C., Conti, A. M., DiDonato, S., and Finocchiaro, G. (1996) Am. J. Hum. Genet. 58, 1260-1267
31. Kim, S. K., Ro, J. Y., Kemp, B. L., Lee, J. S., Kwon, T. J., Hong, W. K., and Mao, L. (1998) Oncogene 17, 1749-1753
32. Ford, S., Gray, I. C., and Spurr, N. K. (1998) Cancer Genet. Cytogenet. 102, 6-11
33. Cappellen, D., Gil Diez de Medina, S., Chopin, D., Thiery, J. P., and Radvanyi, F. (1997) Oncogene 14, 3059-3066
34. Mizushima, Y., Tanaka, N., Kitamura, A., Tamai, K., Ikeda, M., Takemura, M., Sugawara, F., Arai, T., Matsukage, A., Yoshida, S., and Sakaguchi, K. (1998) Biochem J. 330, 1325-1332
35. Date, T., Yamamoto, S., Tanihara, K., Nishimoto, Y., and Matsukage, A. (1991) Biochemistry 30, 5286-5292
36. Miki, T., Smith, C. L., Long, J. E., Eva, A., and Fleming, T. P. (1993) Nature 362, 462-465
37. Larimer, F. W., Perry, J. R., and Hardigree, A. A. (1989) J. Bacteriol. 171, 230-237

Copyright © 2000 by The American Society for Biochemistry and Molecular Biology, Inc.
Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
 GENES CELLSHome page
T. Kubota, S. Maezawa, K. Koiwai, T. Hayano, and O. Koiwai
Identification of functional domains in TdIF1 and its inhibitory mechanism for TdT activity
Genes Cells, August 1, 2007; 12(8): 941 - 959.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
W. W. Duym, K. A. Fiala, N. Bhatt, and Z. Suo
Kinetic Effect of a Downstream Strand and Its 5'-Terminal Moieties on Single Nucleotide Gap-filling Synthesis Catalyzed by Human DNA Polymerase {lambda}
J. Biol. Chem., November 24, 2006; 281(47): 35649 - 35655.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
K. A. Fiala, W. W. Duym, J. Zhang, and Z. Suo
Up-regulation of the Fidelity of Human DNA Polymerase {lambda} by Its Non-enzymatic Proline-rich Domain
J. Biol. Chem., July 14, 2006; 281(28): 19038 - 19044.
[Abstract] [Full Text] [PDF]

Home page
 GENES CELLSHome page
N. Shimazaki, T. Yazaki, T. Kubota, A. Sato, A. Nakamura, S. Kurei, S. Toji, K. Tamai, and O. Koiwai
DNA polymerase lambda directly binds to proliferating cell nuclear antigen through its confined C-terminal region
Genes Cells, July 1, 2005; 10(7): 705 - 715.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
K. Bebenek, M. Garcia-Diaz, S. R. Patishall, and T. A. Kunkel
Biochemical Properties of Saccharomyces cerevisiae DNA Polymerase IV
J. Biol. Chem., May 20, 2005; 280(20): 20051 - 20058.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
E. K. Braithwaite, R. Prasad, D. D. Shock, E. W. Hou, W. A. Beard, and S. H. Wilson
DNA Polymerase {lambda} Mediates a Back-up Base Excision Repair Activity in Extracts of Mouse Embryonic Fibroblasts
J. Biol. Chem., May 6, 2005; 280(18): 18469 - 18475.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Respir. Cell Mol. Bio.Home page
M. Zariwala, W. K. O'Neal, P. G. Noone, M. W. Leigh, M. R. Knowles, and L. E. Ostrowski
Investigation of the Possible Role of a Novel Gene, DPCD, in Primary Ciliary Dyskinesia
Am. J. Respir. Cell Mol. Biol., April 1, 2004; 30(4): 428 - 434.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
K. Bebenek, M. Garcia-Diaz, L. Blanco, and T. A. Kunkel
The Frameshift Infidelity of Human DNA Polymerase {lambda}: IMPLICATIONS FOR FUNCTION
J. Biol. Chem., September 5, 2003; 278(36): 34685 - 34690.
[Abstract] [Full Text] [PDF]

Home page
 Sci Aging Knowl EnvironHome page
P. V. Shcherbakova, K. Bebenek, and T. A. Kunkel
Functions of Eukaryotic DNA Polymerases
Sci. Aging Knowl. Environ., February 26, 2003; 2003(8): re3 - 3.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Cell. Biol.Home page
Y. Kobayashi, M. Watanabe, Y. Okada, H. Sawa, H. Takai, M. Nakanishi, Y. Kawase, H. Suzuki, K. Nagashima, K. Ikeda, et al.
Hydrocephalus, Situs Inversus, Chronic Sinusitis, and Male Infertility in DNA Polymerase {lambda}-Deficient Mice: Possible Implication for the Pathogenesis of Immotile Cilia Syndrome
Mol. Cell. Biol., April 15, 2002; 22(8): 2769 - 2776.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
B. Bertocci, A. De Smet, E. Flatter, A. Dahan, J.-C. Bories, C. Landreau, J.-C. Weill, and C.-A. Reynaud
Cutting Edge: DNA Polymerases {micro} and {lambda} Are Dispensable for Ig Gene Hypermutation
J. Immunol., April 15, 2002; 168(8): 3702 - 3706.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
M. Garcia-Diaz, K. Bebenek, R. Sabariegos, O. Dominguez, J. Rodriguez, T. Kirchhoff, E. Garcia-Palomero, A. J. Picher, R. Juarez, J. F. Ruiz, et al.
DNA Polymerase lambda , a Novel DNA Repair Enzyme in Human Cells
J. Biol. Chem., April 5, 2002; 277(15): 13184 - 13191.
[Abstract] [Full Text] [PDF]

Home page
 Nucleic Acids ResHome page
S. Kimura, Y. Uchiyama, N. Kasai, S. Namekawa, A. Saotome, T. Ueda, T. Ando, T. Ishibashi, M. Oshige, T. Furukawa, et al.
A novel DNA polymerase homologous to Escherichia coli DNA polymerase I from a higher plant, rice (Oryza sativa L.)
Nucleic Acids Res., April 1, 2002; 30(7): 1585 - 1592.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
P. M. J. Burgers, E. V. Koonin, E. Bruford, L. Blanco, K. C. Burtis, M. F. Christman, W. C. Copeland, E. C. Friedberg, F. Hanaoka, D. C. Hinkle, et al.
Eukaryotic DNA Polymerases: Proposal for a Revised Nomenclature
J. Biol. Chem., November 16, 2001; 276(47): 43487 - 43490.
[Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
M. Garcia-Diaz, K. Bebenek, T. A. Kunkel, and L. Blanco
Identification of an Intrinsic 5'-Deoxyribose-5-phosphate Lyase Activity in Human DNA Polymerase lambda . A POSSIBLE ROLE IN BASE EXCISION REPAIR
J. Biol. Chem., September 7, 2001; 276(37): 34659 - 34663.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
275/40/31233    most recent
M004263200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Nagasawa, K.-i.
Right arrow Articles by Nakanishi, M.
Right arrow