|
Originally published In Press as doi:10.1074/jbc.M003041200 on July 20, 2000
J. Biol. Chem., Vol. 275, Issue 40, 31469-31479, October 6, 2000
Isolation and Characterization of Two Novel Phosphodiesterase
PDE11A Variants Showing Unique Structure and Tissue-specific
Expression*
Keizo
Yuasa,
Jun
Kotera,
Kotomi
Fujishige,
Hideo
Michibata,
Takashi
Sasaki, and
Kenji
Omori
From the Discovery Research Laboratory, Tanabe Seiyaku Co. Ltd.,
2-50, Kawagishi-2-chome, Toda, Saitama 335-8505, Japan
Received for publication, April 11, 2000, and in revised form, June 29, 2000
 |
ABSTRACT |
cDNAs encoding a novel phosphodiesterase,
phosphodiesterase 11A (PDE11A), were isolated by a combination of
reverse transcriptase-polymerase chain reaction using degenerate
oligonucleotide primers and rapid amplification of cDNA ends.
Their catalytic domain was identical to that of PDE11A1 (490 amino acids) reported during the course of this study. However, the
cDNAs we isolated had N termini distinct from PDE11A1, indicating
two novel N-terminal variants of PDE11A. PDE11A3 cDNA encoded a
684-amino acid protein including one complete and one incomplete GAF
domain in the N-terminal region. PDE11A4 was composed of 934 amino
acids including two complete GAF domains and shared 630 C-terminal
amino acids with PDE11A3 but had a distinct N terminus containing the
putative phosphorylation sites for cAMP- and cGMP-dependent
protein kinases. PDE11A3 transcripts were specifically expressed in
testis, whereas PDE11A4 transcripts were particularly abundant in
prostate. Recombinant PDE11A4 expressed in COS-7 cells hydrolyzed cAMP
and cGMP with Km values of 3.0 and 1.4 µM, respectively, and the Vmax
value with cAMP was almost twice that with cGMP. Although PDE11A3
showed the same Km values as PDE11A4, the relative
Vmax values of PDE11A3 were approximately one-sixth of those of PDE11A4. PDE11A4, but not PDE11A3, was
phosphorylated by both cAMP- and cGMP-dependent protein
kinases in vitro. Thus, the PDE11A gene undergoes
tissue-specific alternative splicing that generates structurally and
functionally distinct gene products.
 |
INTRODUCTION |
Cyclic nucleotide phosphodiesterases
(PDEs)1 metabolize cAMP and
cGMP, which are second messengers regulating many functions in various
cells and tissues. Based on their amino acid sequence homology,
biochemical properties, and inhibitor profiles, many kinds of PDEs have
been identified in mammalian tissues (1-3). The PDE1 family is
Ca2+/calmodulin-dependent and hydrolyzes both
cAMP and cGMP. PDE2 is stimulated by cGMP and hydrolyzes cAMP and cGMP,
while PDE3 is cGMP-inhibited. The cAMP-specific and rolipram-sensitive
PDEs belong to the PDE4 family. PDE5 is a cGMP-binding, cGMP-specific PDE. The photoreceptor cGMP PDEs are in the PDE6 family. PDE7 is
cAMP-specific and rolipram-insensitive. PDE8 is a cAMP-specific PDE,
and PDE9 is a cGMP-specific PDE (3-8). Recently, we revealed a new
member of the PDE group, PDE10A, which hydrolyzes both cAMP and cGMP
(9).
Some of these PDEs constitute subfamilies encoded by distinct genes. In
each PDE family, alternative splice variants have been reported (1, 10,
11). In many cases, different gene products and alternative splice
variants in each PDE family show different expression patterns in
tissues and different subcellular localization (1, 12-22). PDEs
encoded by alternatively spliced mRNAs have been reported to differ
in their regulation by some kinases including
cAMP-dependent protein kinase (cAK) and
cGMP-dependent kinase (cGK) and associated proteins (19,
23). Thus, cyclic nucleotide levels are controlled by a complex system.
Each PDE is involved in controlling cyclic nucleotide levels and
probably plays a distinct physiological role in different tissues and
cells. The hydrolysis of cyclic nucleotides is multiply controlled by
PDEs co-existing in the same cells. Therefore, the finding and
characterization of novel PDEs could lead to better understanding of
the complex regulatory mechanisms of cyclic nucleotide-mediated cellular functions. Novel PDEs may also be valuable as
pharmacologically significant targets. cDNA cloning of PDE8s,
PDE9A, and PDE10A was done by an approach using bioinformatics (4-9).
A search of data bases of expressed sequence tags was performed using
parts of PDE sequences, such as the catalytic domain. The approach was shown to be effective, but not always successful, for the cDNA cloning of a novel PDE. Only the sequences submitted in the expressed sequence tag data bases could be cloned by this procedure. To isolate
novel PDE cDNAs, which have not yet appeared in the expressed sequence tag data bases, we employed an approach using PCR (polymerase chain reaction) with degenerate primers designed from a conserved sequence in the PDE catalytic domain and rapid amplification of cDNA ends (RACE) for the isolation of full-length cDNAs. Unique N-terminal splicing variants of human PDE11A were obtained, and their
tissue-specific expression patterns were examined. The expression plasmids encoding two PDE11A variants were transfected into COS-7 cells, and the enzymatic properties of the recombinant proteins were
investigated in detail.
 |
EXPERIMENTAL PROCEDURES |
Materials--
Restriction endonucleases, DNA-modifying enzymes,
5'-Full RACE Core Set, and LA PCRTM Kit version 2.1 were obtained from
Takara Shuzo (Kyoto, Japan). [ -32P]dCTP,
[ -32P]ATP, [3H]cAMP,
[3H]cGMP, and Hybond-N+ nylon membrane were from Amersham
Pharmacia Biotech. The mammalian expression vector pcDNA4/HisMax
was purchased from Invitrogen. The GeneAmp RNA PCR Core kit was a
product of PE Biosystems. SMARTTM RACE cDNA amplification kit;
Marathon-ReadyTM cDNA (human prostate and testis); human
multiple-tissue expression (MTETM) array; human multiple-tissue
cDNA (MTCTM) panels I and II; Advantage 2 Polymerase Mix; and
human mRNAs from testis, thyroid, prostate, and hippocampus were
purchased from CLONTECH. Dipyridamole, 3-isobutyl-1-methylxanthine, erythro-9-(2-hydroxy-3-nonyl)-adenine, and
zaprinast were from Sigma. SCH51866, milrinone, rolipram, and E4021
were synthesized at Tanabe Seiyaku Co. Ltd., Japan.
Nucleotide Sequencing Analysis--
The nucleotide sequence was
determined by an automated DNA sequencer ABI PRISMTM 310 and a BigDye
terminator cycle sequencing reaction kit (PE Biosystems). Nucleotide
and amino acid sequence data were analyzed by the computer programs
GENETYX (Software Development, Tokyo, Japan).
PCR Amplification of Novel PDE cDNAs with Degenerate
Primers--
Two degenerate, oppositely oriented oligonucleotide PCR
primers were designed based on actual nucleic acid sequences deduced from the most probable codons for the amino acid sequences in two
highly conserved catalytic domains of a variety of PDEs (Fig. 1A). First-strand cDNA was prepared from the human
testis and hippocampus mRNAs according to the instructions of the
GeneAmp RNA PCR Core kit. PCR was carried out through 30 cycles of
denaturation at 94 °C for 30 s, annealing at 55 °C for
30 s, and extension at 72 °C for 30 s. The PCR products
were cloned into the TA cloning vector pGEM-T Easy (Promega), and the
nucleotide sequences were then determined and compared with those of
PDEs previously reported.
5'- and 3'-RACE of the Novel PDE cDNA--
5'-RACE was
performed using 5'-Full RACE Core Set and Marathon-ReadyTM cDNA
(human prostate and testis). First, PCR template was prepared with the
human testis mRNA, a specific antisense primer
(5'-CTGCTTCAAAAGCTG-3') designed from the nucleotide sequence of clone
t21, and 5'-Full RACE Core Set. PCR was carried out using the LA PCR
Kit and two primer sets, 5'-ATGATCCTTCAAAGTGAGGGTCAC-3' plus
5'-GGTAGCAGAGGTTCCATAGAGTTG-3' for first amplification and 5'-GGTCACAATATCTTTGCTAACCTG-3' plus 5'-CTTAGCTTGGAAGGCATTGTTGGT-3' for
second amplification. The PCR products were cloned and determined for the nucleotide sequence as described above. Further
5'-upstream regions were obtained using Marathon-ReadyTM cDNA
(human prostate and testis). For the amplification of the 5'-region of
PDE11A3 (nucleotides 45-468), Marathon-ReadyTM cDNA (human
testis) and primer sets A (AP1 primer plus
5'-GTCAGTCTGTTCTTCAAAGAGGTC-3' for first amplification and AP2 primer
plus 5'-TGAGGCAGCAAAGAGCTGAGCGTT-3' for second amplification) were
used. For the cloning of further 5'-upstream region (nucleotides 1-309
of PDE11A3), primer sets B (AP1 primer plus
5'-AGCGTTAGATATGGCGATTCCACA-3' for first amplification and AP2 primer
plus 5'-TGTCTTGTATCCAGTTAGCTTGTC-3' for second amplification) were
employed. For the amplification of the 5'-region of PDE11A4
(nucleotides 1-1524), Marathon-ReadyTM cDNA (human prostate) and
primer sets (AP1 primer plus 5'-TCTGACACCAGAGGGATGTTGGCT-3' for first
amplification and AP2 primer plus 5'-GTCAGTCTGTTCTTCAAAGAGGTC-3' for
second amplification) were used.
3'-RACE was performed using the SMARTTM RACE cDNA Amplification
kit with human thyroid mRNA according to the instructions. PCR was
performed with 3'-SMART cDNA, two primer sets (UPM primer plus
5'-ACCAACAATGCCTTCCAAGCTAAG-3' for first PCR and NUP primer plus
5'-TTCCAAGCTAAGAGTGGCTCTGCC-3' for second PCR), and Advantage 2 Polymerase Mix. Finally, two splice variants of PDE11A were obtained as
shown in Fig. 1B.
In all RACE, reaction cycles were as follows: 94 °C for 1 min; five
cycles of 94 °C for 30 s, 72 °C for 3 min; five cycles of
94 °C for 30 s, 70 °C for 30 s, 72 °C for 3 min; and
25 cycles of 94 °C for 30 s, 68 °C for 30 s, 72 °C
for 3 min. The PCR products were cloned into pGEM-T Easy and sequenced.
Reverse Transcriptase (RT)-PCR Analyses--
To detect the
mRNAs coding for PDE11A3 and PDE11A4 in human testis and prostate,
respectively, and to isolate the PCR error-free PDE11A
cDNAs, RT-PCR was performed. First strand cDNA was synthesized from human testis or prostate mRNAs using random hexamers at
42 °C for 60 min according to the manufacturer's instructions for the Gene Amp RNA PCR Core kit. The cDNA synthesized from human testis mRNAs and the primer set (the 5'-primer
5'-GCGCTTGCAGCCCAGGGC-3' and 3'-primer 5'-TCAGGCTGTAGTCATTTTGCAGC-3'
(covering nucleotides 1-2195 of PDE11A3 cDNA)) were used for PCR
of PDE11A3. The cDNA synthesized from human prostate mRNAs and
the primer set (the 5'-primer 5'-TGGCGCTGAACTGGGAATACTGGTG-3' and
3'-primer 5'-TCAGGCTGTAGTCATTTTGCAGC-3' (covering nucleotides 204-3164
of PDE11A4 cDNA)) were used for PCR of PDE11A4. PCR was carried out
with conditions of denaturation at 94 °C for 30 s, annealing at
55 °C for 30 s, and extension at 72 °C for 5 min. The
amplified DNA fragment was cloned into pGEM-T Easy. Six independent PCR
clones of PDE11A3 or PDE11A4 were sequenced to verify the correct
cDNA sequence. One of the clones, pGEM-PDE11A3F or pGEM-PDE11A4F,
was used for further experiments.
Northern Blot and Dot Blot Analyses--
Human MTETM Array
(CLONTECH) and Gene HunterTM (TOYOBO, Osaka,
Japan) were hybridized with a 32P-labeled DNA probe
prepared using cDNA encoding a common region of PDE11As
(nucleotides 1237-1801 of PDE11A4). Hybridization and washing were
performed as described previously (24). The membranes were exposed to
x-ray film at 80 °C for 3 days.
PCR and Southern Blot Analyses--
To examine expression
patterns of human PDE11A3 and PDE11A4 transcripts in human tissues, PCR
was performed using MTC panels (CLONTECH) as
templates and Advantage 2 Polymerase Mix. The cDNA fragments
encoding PDE11A3 (amino acid residues 21-272) were produced using the
5'-primer 5'-AAGGTGAAAATCACAAGACTGGTC-3' and the 3'-primer 5'-GTGGTTGCTATTCCAAATAGGGAC-3'. The cDNA fragments encoding human PDE11A4 (amino acid residues 271-522) were produced using the 5'-primer 5'-AGCACAGAGAACTCAAATGAGGTG-3' and the 3'-primer
5'-GTGGTTGCTATTCCAAATAGGGAC-3'. PCR was carried out through 32 or
27 cycles of denaturation at 95 °C for 30 s and extension at
68 °C for 1 min. The PCR products were subjected to 1.5% agarose
gel electrophoresis, and the fractions were transferred onto Hybond-N+
nylon membrane. To confirm that PCR products were derived from human
PDE11A transcripts, we detected both PCR products by Southern blot
analysis using a 32P-labeled DNA probe prepared from an
oligonucleotide (TGTGGAATCGCCATATCTAACGCT) coding for a common region
of the human PDE11A cDNAs. Hybridization was performed in 6× SSC,
0.5% SDS, 5× Denhardt's solution, 100 mg/ml salmon sperm DNA, and
the 32P-labeled probe at 55 °C for 2 h. All blots
were washed finally in 6× SSC and 0.5% SDS at 55 °C for 15 min.
The membranes were exposed to x-ray film at 80 °C for 1 day. All
of the PCR reactions were performed under conditions in which
each amplification did not reach saturation.
Construction of Expression Plasmids--
To generate an
expression plasmid of PDE11A3, PCR was performed using the
5'-primer 5'-GGATCCATGCTGAAGCAGGCAAG-3', the
3'-primer 5'-TTCATCATCTTCAGTAAATGG-3' (covering amino acid
residues 1-106 of PDE11A3), and pGEM-PDE11A3F as a template. The
amplified cDNA fragment was cloned into pGEM-T Easy, resulting in
pGEM-PDE11A3BM, and then confirmed by sequencing. The
SacI-EcoRV and EcoRV-SalI DNA fragments of pGEM-PDE11A3F, and the
BamHI-SacI DNA fragment of pGEM-PDE11A3BM were
subcloned into the BamHI and XhoI sites of
pcDNA4/HisMax (pHis), resulting in pHis-PDE11A3. To generate a
mammalian expression plasmid of human PDE11A4, PCR was performed using
the 5'-primer 5'-GGATCCATGGCAGCCTCC-3', the 3'-primer
5'-CCTTAGCTCTTTCTGAGAAGCTC-3' (covering amino acid residues 1-122 of
PDE11A4), and pGEM-PDE11A4F as a template. The amplified DNA fragment
was cloned into pGEM-T Easy, resulting in pGEM-PDE11A4BM, and then
confirmed by sequencing. The KpnI-SalI DNA
fragment of pGEM-PDE11A4F and the BamHI-KpnI DNA
fragment of pGEM-PDE11A4BM were subcloned into the BamHI and XhoI sites of the mammalian expression vector, the pHis,
resulting in pHis-PDE11A4.
Expression of Human PDE11A3 and PDE11A4 in COS-7
Cells--
COS-7 cells were grown in Dulbecco's modified Eagle's
medium (Life Technologies, Inc.) supplemented with 10%
heat-inactivated fetal bovine serum, 100 units/ml penicillin, and 100 µg/ml streptomycin at 37 °C with 5% CO2 and were
serially passaged before reaching confluence. The expression plasmid
pHis-PDE11A3 or pHis-PDE11A4 was transfected into COS-7 cells by
LipofectAMINE PLUS (Life Technologies, Inc.), according to the
manufacturer's instructions. 24 h after transfection, cells were
washed with ice-cold phosphate-buffered saline and scraped in ice-cold
homogenization buffer (40 mM Tris-HCl, pH 7.5, 15 mM benzamidine, 5 µg/ml pepstatin A, and 5 µg/ml
leupeptin). The cell suspension was disrupted by a sonicator (TOMY
Seiko, Japan) for 15 s (three times with 1-min intervals), and the
homogenates were centrifuged at 100,000 × g for 1 h. The resultant supernatant was added to a plastic tube containing
nickel nitrilotriacetate resin (QIAGEN), equilibrated with the
homogenization buffer, and incubated by rotation at 4 °C for 4 h. The nickel nitrilotriacetate resin was poured into a plastic column
(0.8 × 5 cm) and allowed to drain. The packed resin was washed
with wash buffer (40 mM Tris-HCl, pH 7.5, 15 mM
benzamidine, 200 mM NaCl, 5 mM imidazole, 5 µg/ml pepstatin A, and 5 µg/ml leupeptin), and the proteins were
then eluted by elution buffer (40 mM Tris-HCl, pH 7.5, 15 mM benzamidine, 200 mM NaCl, 200 mM
imidazole, 5 µg/ml pepstatin A, and 5 µg/ml leupeptin). After PDE
assay, the PDE11A fractions were diluted with glycerol at a final
concentration of 50% and stored at 25 °C until use.
PDE and Protein Assays--
The PDE assay was performed by the
radiolabeled nucleotide method as described previously (9). Relative
Vmax values were determined according to the
methods of McPhee et al. (14). Relative concentrations of
PDE11A proteins expressed in COS-7 cells were calculated by
immunoblotting with anti-Xpress polyclonal antibody (Santa Cruz
Biotechnology, Inc., Santa Cruz, CA), as we described previously (25).
The membranes were incubated with ECL reagents at room temperature for
1 min and then exposed to x-ray film for 2-10 s, under conditions in
which each exposure to x-ray film did not reach saturation. The
resultant films were scanned by ARCUS II (Agfa-Gevaert), and
quantitated using the Quantity One program (PDI, Inc.). The optical
densities versus the amount of pHis-encoded protein were
plotted to measure the relative concentrations of PDE11A proteins.
Relative Vmax values were calculated from Lineweaver-Burk plots (26), using proteins that provided relatively equal enzymatic activity. The protein concentration of the cytosolic fractions of transfected COS-7 cells was determined by a protein assay
kit (Bio-Rad) using bovine serum albumin as a standard.
In Vitro Kinase Assay--
The full-length bovine cGK I
cDNA was a gift from Dr. Thomas M. Lincoln (University of Alabama
at Birmingham). The full-length human cGK I cDNA and mouse cAK
catalytic subunit cDNA were obtained by standard PCR protocol
as we described previously (25) and subcloned into pHis. To prepare
truncated and constitutively active cGK I (cGK I ) (27), the
PstI-SalI DNA fragment of human cGK I
(covering amino acid residues 322-685) was subcloned into the
PstI and XhoI sites of pHis. Site-directed
mutagenesis was performed using the QuickChangeTM site-directed
mutagenesis kit (Stratagene) according to the protocol of the
manufacturer. To introduce the desired mutations, the following primers
were used: 5'-CTGCAGCGGAGAGCTGCTCAGAAAGAGCTAAGG-3' plus
5'-CCTTAGCTCTTTCTGAGCAGCTCTCCGCTGCAG-3' (PDE11A4 S117A); and
5'-CTTCTCCGGAAGGCAGCCTCCCTGCCCCCCACC-3' plus 5'-GGTGGGGGGCAGGGAGGCTGCCTTCCGGAGAAG-3' (PDE11A4 S162A). In each case, the mutation was confirmed by DNA sequencing analysis.
The full-length cGK I , cGK I , cAK, or truncated cGK I cDNAs
in the expression vector pHis were transiently expressed in COS-7
cells. 24 h after transfection, cells were washed with ice-cold phosphate-buffered saline twice and scraped in an ice-cold TNE buffer
(10 mM Tris-HCl at pH 7.5, 1% Nonidet P-40, 0.15 M NaCl, 1 mM EDTA, 10 mg/ml aprotinin, 10 mM leupeptin, and 1 mM dithiothreitol). Cell
extracts were centrifuged at 16,000 × g for 15 min at
4 °C to remove cellular debris. The supernatants were incubated with anti-Xpress antibody and protein G-Sepharose overnight at 4 °C by
rotation. The beads were washed three times with TNE buffer, and the
immunoprecipitated samples were used for the in vitro kinase
assay. Likewise, cell extracts of COS-7 cells transfected with either
pHis-PDE11A3 or pHis-PDE11A4 were immunoprecipitated with anti-Xpress
antibody. In vitro kinase assays were performed as described
previously (25). Reactions were performed in the presence or absence of
cGMP (5 µM final concentration). Phosphorylation by cAK
was performed in the same buffer but in the presence or absence of 5 µM PKI (5-24).
Cyclic Nucleotide Binding Assay--
The cyclic nucleotide
binding assay was performed in a total volume of 200 µl by a modified
version of the methods described previously (10, 28). 100 µl of the
cytosolic extract of COS-7 cells transfected with pHis-PDE11A4 was
mixed with 100 µl of a cyclic nucleotide binding assay buffer to a
final concentration of 10 mM sodium phosphate, pH 7.2, 4 mM EDTA, 25 mM 2-mercaptoethanol, and 2 µM [3H]cGMP or [3H]cAMP
(10,000,000 or 30,000,000 cpm/assay), followed by incubation at 0 °C
for 2 h. The reaction was stopped by the addition of 1 ml of
ice-cold wash buffer (10 mM sodium phosphate, pH 7.2, and 1 mM EDTA), and then applied to a Millipore HAWP filter (pore size 0.45 µm). The filters were washed three times with 5 ml of ice-cold wash buffer and then counted on a scintillation counter. As a
positive control, pHis-PDE5A, a human PDE5A1 cDNA (29) subcloned
into the EcoRI and NotI sites of the mammalian
expression vector pHis, was created and transfected into COS-7 cells.
In all experiments, nonspecific binding was measured by incubation in
the presence of 2 mM unlabeled cGMP or cAMP.
 |
RESULTS |
cDNA Cloning of a Novel Human PDE--
To isolate novel human
PDE cDNAs, PCR was performed using cDNA templates from several
human tissues with degenerate PCR primers designed from two highly
conserved regions in the catalytic domain (Fig.
1A). PCR products of the
appropriate size (approximately 200 base pairs) were detected,
subcloned into the TA-cloning vector pGEM-T Easy, and sequenced. Of 50 clones obtained from human testis PCR products, one clone, t21, was
revealed to contain deduced amino acid sequence similar to but distinct
from 10 PDE families previously described. It showed 52, 51, and 54%
identity in amino acid sequences with PDE2A, PDE5A, and PDE10A,
respectively. The insert DNA was used as a probe for human Northern
blot and mRNA dot blot analyses, and the preliminary data suggested
that the corresponding transcripts were rich in prostate, testis, and
thyroid (data not shown). To obtain a full-length cDNA, 5'- and
3'-RACE reactions were performed using human testis, prostate, and
thyroid mRNAs and primers designed from the clone t21 sequence. Two
kinds of extended products having distinct 5'-sequences were obtained. One was isolated from human prostate RT products, and the other was
from those of human testis. The nucleotide sequence analysis demonstrated that our clones contained a catalytic sequence identical to that of PDE11A1 (30), which was revealed during the course of this
study, but included two distinct N-terminal sequences, indicating two
novel N-terminal splice variants of PDE11A. As shown in Fig.
1B, the shorter clone obtained from human testis was
designated as PDE11A3 and the longer clone from prostate as PDE11A4,
according to the nomenclature of the 1994 American Society of
Pharmacology and Experimental Therapeutics Conference (31). PDE11A2,
which has an N-terminal sequence distinct from both PDE11A3 and
PDE11A4, was described by
others.2

View larger version (32K):
[in this window]
[in a new window]
|
Fig. 1.
Degenerate PCR primers and the PCR products
amplified. A, the nucleotide and the deduced amino acid
sequences of two highly conserved regions in the catalytic domain of
previously reported human PDEs are listed. Degenerate nucleotide
sequences are indicated below. The nucleotide sequence of
the novel PDE cloned by us (PDE11A), and its deduced amino acid
sequence are indicated below the nucleotide sequence.
Accession numbers of the human PDE sequences are as follows: PDE1A,
P54750; PDE1B, Q01064; PDE1C, Q14123; PDE2A, O00408; PDE3A, Q14432;
PDE4A, P27815; PDE4B, Q07343; PDE4C, Q08493; PDE4D, Q08499; PDE5A,
D89094; PDE6A, P16499; PDE7A, Q13946; PDE8A, AF056490; PDE8B, AF079529;
PDE9A, AF048837; PDE10A, AB020593. B, the structure and
cloning strategy of PDE11A3 and PDE11A4 variants are schematically
illustrated. The coding region is represented by a box. The
GAF domain is shown as a shaded box, and the catalytic
domain is indicated as a black box. The 5'- and
3'-untranslated regions are denoted by lines. cDNA
fragments isolated are represented by bars. Putative
phosphorylation sites of cAK and cGK are indicated by
arrows. The position of the PDE11A1 sequence start site is
shown with an arrow.
|
|
Sequence Analysis of Two Splice Variants of Human PDE11A--
The
nucleotide sequence of the full-length PDE11A4 cDNA (4476 base
pairs) is shown in Fig. 2A. An
open reading frame (ORF) of 2802 nucleotides spanned from the first
initiation codon ATG to the termination codon TGA (nucleotides
319-3120), and an in-frame stop codon was located 66 base pairs
upstream of the initiation codon. The complete ORF encoded a protein of
934 amino acids with a predicted molecular mass of 104,809 Da. The
first methionine is surrounded by a Kozak consensus sequence, ACCATGG
(32). A putative polyadenylation site, AATAAA (33), was found in the 3'-noncoding region of the cDNA (nucleotides 4165-4170). The
presence of the transcripts encoding the protein was confirmed by
RT-PCR, using specific primers for the sequence and human prostate
mRNA as a template (see "Experimental Procedures"). A specific
DNA fragment of 3 kb was amplified, and the length of the fragment agreed with that predicted (data not shown). The amplified DNA fragment
was cloned into pGEM-T Easy, and six independent PCR clones were
sequenced to verify the correct cDNA sequence for the full coding
region. The C-terminal moiety of PDE11A4
(Met445-Asn934) was identical to the entire
PDE11A1 sequence (Met1-Asn490).


View larger version (85K):
[in this window]
[in a new window]
|
Fig. 2.
Nucleotide and deduced amino acid sequences
of the human PDE11A cDNA. A, DNA and amino acid
sequences of human PDE11A4. The deduced amino acid sequences are shown
in three-letter designations below the nucleotide sequence.
The termination codon at the end of the ORF is represented by asterisks. Two GAF
domains (upper) and a catalytic domain (lower)
are boxed. The in-frame termination codon upstream of the
initiation codon of the ORF is double-underlined. The primer
sequences for RT-PCR are underlined. The boxed
AATAAA sequence represents a putative polyadenylation signal. The
position of the amino acid sequence in common with PDE11A3 is shown by
an arrow. The initiation Met of PDE11A1 is boxed.
B, DNA and amino acid sequences of the 5'-end of human PDE11A3.
The in-frame termination codon upstream of the initiation codon of the
ORF is double-underlined. The position of the amino acid
sequence in common with PDE11A4 is shown by an arrow.
|
|
The nucleotide sequence encoding the N-terminal region of PDE11A3 is
shown in Fig. 2B. The presence of the transcripts coding for
the PDE11A3 ORF was also confirmed by RT-PCR analysis, using the
specific primers for the PDE11A3 sequence and human testis mRNA as
a template. Specific PCR products of approximately 2.2 kb, which were
in good agreement with the length of the predicted product, were
obtained (data not shown). The amplified DNA fragment was cloned into
pGEM-T Easy and sequenced to confirm the PDE11A3 sequence. PDE11A3 was
composed of 684 amino acids with a predicted molecular mass of 78,713 Da. As shown in Fig. 1B, the C-terminal sequence (630 amino
acids) of PDE11A3 (Asp55-Asn684) was identical
to that of PDE11A4 (Asp305-Asn934), except for
the unique N-terminal portion. The PDE11A3 protein was 194 amino acids
longer than the PDE11A1 protein.
The deduced amino acid sequences of the ORFs were searched using SMART
(Simple Modular Architecture
Research Tool) (34), and compared with those of
human PDEs reported. PDE11A4 was revealed to contain two complete GAF
(cGMP binding and stimulated phosphodiesterases, Anabaena adenyl cyclases, and Escherichia
coli FhlA) domains (amino acid residues 217-380 and
402-568) (35) and a catalytic domain (amino acid residues 640-881),
whereas PDE11A3 was shown to include one complete (amino acid residues
152-318) and one incomplete (amino acid residues 1-130) GAF domain.
The complete GAF domains of PDE11A4 showed 19-47% identity with those
of PDEs including human PDE2A, PDE5A, PDE6s, and PDE10A (Fig.
3). The catalytic domain sequence of
PDE11As showed high identity (42-51%) with those of PDEs having GAF
domains (data not shown). We also found that PDE11A4, but not PDE11A3,
had typical phosphorylation sites (RRA117S and
RKA162S) for cAK
(RRXS) and cGK
(RKX(S/T)), respectively, in the N-terminal region (36).

View larger version (52K):
[in this window]
[in a new window]
|
Fig. 3.
Alignment of two GAF domains of PDE11A4 with
human PDEs. The sequence alignment of GAF domains is shown. The
region corresponding to a consensus GAF sequence (35) is shown by
bars above the sequences. Amino acid sequences
are shown in one-letter designations. The positions of amino acid
residue are shown at each side of the sequence.
Identical amino acid residues that are conserved over 50% among the
sequences are boxed in the alignment. Accession numbers of
the human PDE sequences are as follows: PDE2A, O00408; PDE5A, D89094;
PDE6B, P35913; PDE10A, AB020593.
|
|
Tissue Distribution of Human PDE11A Transcripts--
Dot blot
analysis of human mRNA was performed using a
32P-labeled PDE11A cDNA probe corresponding to the
common region of PDE11A3 and PDE11A4 transcripts (Fig.
4A). The amounts of the
mRNAs loaded were normalized using cDNAs for human ubiquitin
and major histocompatibility complex class Ic as probes (described in
the instructions from CLONTECH). PDE11A transcripts
were particularly abundant in prostate. Moderate expression was
observed in testis, salivary gland, pituitary gland, thyroid gland, and
liver. Northern blot analysis of multiple human tissues was performed
with the same 32P-labeled probe (Fig. 4B). A
band of approximately 3 kb was detected in testis, and a major band of
approximately 6 kb and minor bands of 2 and 10 kb were observed in
prostate.

View larger version (68K):
[in this window]
[in a new window]
|
Fig. 4.
Analysis of expression of human PDE11A
transcripts in various tissues by dot blot and Northern blot.
Hybridization was carried out with a 32P-labeled fragment
of human PDE11A cDNA under the conditions described under
"Experimental Procedures." A, dot blot of mRNAs from
various human tissues obtained from CLONTECH was
hybridized with the 32P-labeled probe. RNA sources are
shown in the diagram. B, Northern blot analysis
of mRNAs from several human tissues. The PDE11A transcripts were
detected using the same 32P-labeled probe. The sizes (in
kb) and positions of mRNA size markers are shown on the
left.
|
|
In some cases, alternative splice variants in each PDE family show
different expression patterns in tissues. The expression patterns of
each PDE11A3 and PDE11A4 transcript in human tissues were examined by a
combination of PCR and Southern blot analysis. To know the relative
amounts of PDE11A3 and PDE11A4 transcripts, the efficiency of PCR
amplification using specific primer sets for PDE11A3 and PDE11A4 was
first examined as follows. PCR was performed using the same amounts of
pHis-PDE11A3 and pHis-PDE11A4 DNAs as a template under the same
conditions, revealing that amplification using the primer set for
PDE11A3 was more efficient than that using the primer set for PDE11A4
(data not shown). Considering the degree of efficiency and the
condition that PCR did not reach saturation, PCR was carried out and
Southern blot analysis was performed using an oligonucleotide probe
from a common sequence. The ratio of the two PCR products amplified
using specific primer sets and MTC panels as templates reflects the
amounts of their transcripts. Interestingly, PDE11A3 transcripts were
specific in testis, whereas PDE11A4 transcripts were particularly
abundant in prostate (Fig. 5).

View larger version (20K):
[in this window]
[in a new window]
|
Fig. 5.
Detection of two spliced transcripts of human
PDE11A3 and PDE11A4 by PCR. PCR was performed using MTC panels
(CLONTECH) as templates. PCR amplification was
carried out through 32 cycles for human PDE11A3 (756 base pairs) and 27 cycles for human PDE11A4 (756 base pairs), under conditions in
which PCR amplification did not reach saturation. The PCR
products of PDE11As were subjected to Southern blot analysis using the
32P-labeled DNA probe to detect both PCR products. As a
control, PCR was performed using 0.01 ng/ml pHis-PDE11A3 or
pHis-PDE11A4 plasmid DNA. The same results have been obtained with two
separate PCR analyses.
|
|
Expression of Human PDE11A3 and PDE11A4 in COS-7 Cells--
To
produce recombinant human PDE11A3 and PDE11A4 proteins, full-length
cDNAs for these variants were subcloned into the N-terminal histidine tag mammalian expression vector pcDNA4/HisMax and
transfected into COS-7 cells. Cytosolic fractions were prepared from
COS-7 cells transfected with an expression vector encoding
histidine-tagged PDE11A3 or PDE11A4 (pHis-PDE11A3 or pHis-PDE11A4). The
proteins were analyzed by immunoblotting using anti-Xpress polyclonal
antibody, which reacts with histidine-tagged proteins. While no signal
was observed in the mock-transfected cells, specific bands of
approximately 78 and 100 kDa, which were in reasonable agreement with
the molecular masses predicted for the histidine-tagged PDE11A3 and
PDE11A4, were detected in cytosolic fractions of cells transfected with the expression plasmids pHis-PDE11A3 and pHis-PDE11A4, respectively (data not shown). The cytosolic fractions were assayed for cyclic nucleotide hydrolytic activities using either 1 µM cAMP
or 1 µM cGMP. Both cytosolic fractions from COS-7 cells
transfected with pHis-PDE11A3 or pHis-PDE11A4 exhibited ~20- and
~75-fold higher levels of cAMP and cGMP hydrolytic activities,
respectively, than those from the mock-transfected COS-7 cells (data
not shown).
Kinetic Properties of Human PDE11A Enzyme--
To determine
Km and Vmax values, the
histidine-tagged PDE11A3 and PDE11A4 proteins were partially purified
by using a nickel affinity column. The eluate prepared from
PDE11A-expressing cells, but not from mock-transfected cells, exhibited
cAMP and cGMP PDE activities. The relative concentrations of the
partially purified histidine-tagged PDE11A3 and PDE11A4 proteins were
measured by immunoblotting (Fig.
6A). The Km
values of PDE11A3 and PDE11A4 were derived from Lineweaver-Burk
plots (26) of activities using cGMP or cAMP as substrate (0.1-10
µM) for the partially purified histidine-tagged PDE11A3
and PDE11A4 proteins. The Km values of the human
PDE11A4 for cAMP and cGMP were 3.0 ± 0.26 and 1.4 ± 0.06 µM, respectively. Vmax values of PDE11A4 for cAMP and cGMP hydrolysis were 270 ± 28 and 120 ± 4.7 pmol/min/µg with the partially purified recombinant protein,
respectively. As shown in Table I, both
cAMP and cGMP Km values of PDE11A3 were almost the
same as those of PDE11A4 (cAMP and cGMP Km values of
PDE11A3 were 3.0 ± 0.28 and 1.5 ± 0.07 µM, respectively). Relative Vmax values were
calculated to compare the Vmax of PDE11A3 with
that of PDE11A4. The Vmax values of PDE11A3 relative to PDE11A4 (i.e. Vmax = 1.0)
were 0.16 ± 0.01 for cAMP and 0.17 ± 0.03 for cGMP.
However, the Vmax ratio (cAMP/cGMP) of PDE11A4
(2.2 ± 0.40) was very similar to that of PDE11A3 (2.4 ± 0.37).

View larger version (13K):
[in this window]
[in a new window]
|
Fig. 6.
Kinetic analysis of partially purified human
PDE11A4. A, expression of recombinant PDE11A3 and
PDE11A4 proteins was examined by immunoblot analysis. COS-7 cells were
transfected with either pHis-PDE11A3 or pHis-PDE11A4. After cytosolic
fractions of the transfected COS-7 cells were prepared, the
histidine-tagged PDE11A3 and PDE11A4 were partially purified by using a
nickel affinity column. Partially purified PDE11A3 and PDE11A4 were
separated by SDS-polyacrylamide gel electrophoresis and then
immunoblotted with anti-Xpress antibody. B, Lineweaver-Burk
plots at concentrations of 0.1-10 µM cAMP (closed
circles) and cGMP (open circles) are shown. Partially
purified PDE11A4 was prepared as described above. Km
and Vmax values are the means of triplicate
assays ± S.D. A plot typical of three independent experiments is
shown.
|
|
View this table:
[in this window]
[in a new window]
|
Table I
Km and relative Vmax values of PDE11A3 and PDE11A4
Km values for partially purified histidine-tagged
PDE11A3 and PDE11A4 proteins were determined from Lineweaver-Burk
plots. Relative Vmax values were calculated as
described under "Experimental Procedures". Data are the means of
three separate determinations ± S.D. All assays were performed in
duplicate.
|
|
The effects of various PDE inhibitors on PDE11A3 and PDE11A4 activities
were examined using the partially purified proteins described above
(Table II). The nonspecific PDE
inhibitor, 3-isobutyl-1-methylxanthine, showed a weak inhibitory effect
on PDE11A4 (IC50 values were 65 ± 13 µM
for cAMP and 81 ± 16 µM for cGMP). Vinpocetine,
erythro-9-(2-hydroxy-3-nonyl)-adenine, milrinone, and rolipram, which
are PDE1, PDE2, PDE3, and PDE4 inhibitors, respectively, were inactive
up to 100 µM. Compounds that inhibit PDE5 showed
inhibitory effects on PDE11A4. Zaprinast demonstrated moderate
inhibition (IC50 = 26 ± 6.8 µM for cAMP and 33 ± 5.3 µM for cGMP). SCH51866, a PDE1 and
PDE5 inhibitor (37), inhibited PDE11A4 with IC50 values of
22 ± 1.8 µM for cAMP and 25 ± 5.8 µM for cGMP. E4021, a more potent PDE5 inhibitor (38),
showed IC50 values of 1.8 ± 0.33 µM for
cAMP and 1.8 ± 0.25 µM for cGMP. Among the PDE
inhibitors tested, dipyridamole was the most effective antagonist for
PDE11A4, with IC50 values of 0.82 ± 0.28 µM for cAMP and 0.72 ± 0.08 µM for
cGMP. The inhibitory effects of PDE inhibitors on PDE11A3 activity were
2-3-fold more potent than those on PDE11A4.
View this table:
[in this window]
[in a new window]
|
Table II
Inhibitory effect of the various PDE inhibitors on human PDE11A
variants
Partially purified PDE11A3 and PDE11A4 produced in COS-7 cells were
used for the assay. The concentrations of cAMP and cGMP used were 3.5 and 1.3 µM, respectively. IC50 values were
calculated by linear regression. Data are the means of three separate
determinations ± S.D. All assays were performed in duplicate.
IBMX, 3-isobutyl-1-methylxanthine; EHNA,
erythro-9-(2-hydroxy-3-nonyl)-adenine; ND, not determined.
|
|
The inhibitory effects of cGMP on cAMP hydrolysis and vice
versa were also examined using the partially purified PDE11A3 and PDE11A4. cAMP hydrolysis was measured in the presence of 3.5 µM cAMP and a range of cGMP concentrations of 0.01-100
µM. The reverse was also performed in the presence of 1.3 µM cGMP and a range of cAMP concentrations of 0.01-100
µM. Neither cGMP nor cAMP stimulated hydrolytic activity
(data not shown). cAMP and cGMP inhibited the activities of cGMP and
cAMP hydrolysis of PDE11A4 with IC50 values of 9.0 ± 0.38 and 3.1 ± 0.16 µM, respectively (Table II).
Other Characteristics of PDE11A4: Phosphorylation by cAK and cGK
and Cyclic Nucleotide Binding--
Some PDEs have been reported to be
regulated by phosphorylation by kinases including cAK and cGK (1).
Human PDE11A4, but not PDE11A3, also contains typical phosphorylation
sites (RRA117S and
RKA162S) of both cAK
(RRXS) and cGK (RKX(S/T))
in its N terminus (36). To determine whether PDE11A4 is phosphorylated
by cAK, cGK, or both, an in vitro kinase assay was performed
using the recombinant histidine-tagged PDE11A4 protein. PDE11A4, but
not PDE11A3, was phosphorylated by cAK catalytic subunit (Fig.
7A), and its phosphorylation was almost completely inhibited by cAK inhibitor peptide (Fig. 7B). Phosphorylation of PDE11A4 by cGK I was examined using
a truncated form of cGK I , cGK I (amino acid residues 322-685 of
human cGK I ), because the molecular sizes of autophosphorylated cGK
I subunits are similar to that of PDE11A3. cGK I as well as cAK
phosphorylated PDE11A4 but not PDE11A3, although the phosphorylation levels of PDE11A4 by cGK I were lower than those by cAK. In
addition, both full-length cGK I and cGK I also phosphorylated
PDE11A4 in a cGMP-dependent manner. The phosphorylation of
potential residues Ser117 and Ser162 by cAK
and/or cGK was further examined using site-directed mutagenesis. The
mutant PDE11A4 S117A/S162A carrying double substitutions of Ser117 and Ser162 with Ala, showed significant
reduction in cAK- and cGK-mediated 32P incorporation
compared with wild type PDE11A4 (Fig. 7C).

View larger version (22K):
[in this window]
[in a new window]
|
Fig. 7.
Phosphorylation of PDE11A4 by cAK and
cGK. Phosphorylation of PDE11A3 and PDE11A4 variants by cAK
and cGK I was examined by an in vitro kinase assay. Whole
cell lysates of transfected COS-7 cells were mixed and
immunoprecipitated by anti-Xpress antibody, and the immunoprecipitates
were used for an in vitro kinase assay (see "Experimental
Procedures"). A, PDE11A4 but not PDE11A3 was
phosphorylated by both cAK and cGK I. The 32P incorporation
of the proteins was examined by SDS-polyacrylamide gel electrophoresis
and autoradiography (32P-ATP). To monitor the
expression levels of each protein, whole cell lysates were
immunoblotted with anti-Xpress antibody (IB:
-Xpress). B, phosphorylation of PDE11A4
by full-length cGK I and cGK I in a cGMP-dependent
manner. cGK activity was measured in the absence ( ) or presence (+)
of 5 µM cGMP, and cAK activity was measured with (+) or
without ( ) of 5 µM cAK inhibitor peptide
(PKI). C, phosphorylation of mutant PDE11A4
lacking potential phosphorylation sites. The 32P
incorporation of wild-type PDE11A4 (PDE11A4 WT) and PDE11A4
mutant (PDE11A4 S117A/S162A) was examined by an in
vitro kinase assay using cAK and cGK I . The samples were
separated by SDS-polyacrylamide gel electrophoresis and blotted onto
polyvinylidene difluoride membrane. The membrane was first exposed to
autoradiography (32P-ATP) and then analyzed
by immunoblotting with anti-Xpress antibody (IB:
-Xpress). All experiments were independently carried
out three times, and almost the same results were obtained.
|
|
Cyclic nucleotide binding activity was also examined using cytosolic
fractions from COS-7 cells transfected with pHis-PDE11A4. The
expression level of the histidine-tagged PDE11A4 protein in the
transfected COS-7 cells was shown to be equal to that of the histidine-tagged PDE5A1 used as a positive control by immunoblot analysis using anti-Xpress antibody. The cyclic nucleotide binding activity was performed at a concentration of 2 µM
[3H]cAMP or [3H]cGMP. Under these
conditions, the cGMP binding activity of PDE11A4 was not significant
compared with that of PDE5A1 used as a positive control (data not
shown). In regard to cAMP binding, no binding activity was
detected on either PDE11A4 or PDE5A1 protein.
 |
DISCUSSION |
Two kinds of full-length cDNAs of PDE11A were isolated by an
approach using PCR with degenerate primers designed from highly conserved regions in catalytic domains of PDE families and RACE. The
application of this strategy to cloning a novel PDE cDNA has already been reported (39), but by selecting the sequences for designing the PCR primer sets, it was also effective to isolate cDNA encoding a novel class of PDE. The two clones obtained
included a catalytic domain identical to PDE11A1, which was quite
recently isolated from a human skeletal muscle cDNA library during
the course of this study (30), but they had two distinct and unique N
termini, indicating two novel N-terminal splice variants of PDE11A.
PDE11A1 was composed of 490 amino acids, whereas PDE11A3 and PDE11A4
were 784 and 934 amino acids, respectively. It is intriguing that two
novel PDE11A variants have distinct N termini from PDE11A1. A search
using SMART revealed that PDE11A4 contains two complete GAF domains
(amino acid residues 217-380; E = 7.1 × 10 30 and amino acid residues 402-568,
E = 3.6 × 10 25),
whereas PDE11A3 has one complete (amino acid residues 152-318, E = 3.6 × 10 25) and one
incomplete GAF domain (amino acid residues 1-130, E = 7.4 × 10 7). On the other hand, PDE11A1
has an incomplete GAF domain, which lacks the N-terminal part of the
GAF consensus sequence (E = 2.0 × 10 6). Alterations of the calmodulin-binding
domain and upstream conserved regions have been reported in N-terminal
variants of PDE1 and PDE4. However, no report has described the
alteration of the GAF domain in splice variants of PDEs containing the
GAF domain, although many splice variants of PDEs containing the GAF
domain have been reported (10, 11, 40-43). Thus, PDE11A constitutes a
unique family distinct from other PDEs including the GAF sequence.
In PDE5A, the motif
N(K/R)XnFX3D in the GAF
domain has been known to be necessary for the support of cGMP binding (44, 45). PDE11A4 also contains all of four residues of this motif in
both GAF domains. However, unexpectedly, the cGMP binding activity of
PDE11A4, which was expressed as a histidine-tagged protein in COS-7
cells, was much lower than that of PDE5A1 under the conditions used in
this study (see "Experimental Procedures"). No significant cAMP
binding activity was observed under those conditions. Although PDE2A,
PDE5A, and PDE6s proteins show apparent cGMP binding function, that of
PDE10A has been reported to be insignificant (3, 9). As shown in the
case of PDE11A4, it is likely that cGMP binding is not the function of
the GAF domain in all cases. For example, E. coli FhlA, a
transcriptional regulatory protein, is shown to bind formate within the
N terminus, which contains two GAF domains (46). Further study will
elucidate the function of the GAF domain in PDE11A variants, including
PDE11A1 and PDE11A3.
The differences in the biochemical characteristics of the PDE11A
variants are intriguing. The first difference concerns enzymatic characteristics. The catalytic domain of PDE11As was the most homologous to that of PDE5A in the PDE families, and vice
versa. In addition, the structure of PDE11A4, including two
complete GAF domains, was very similar to that of PDE5A. Interestingly, although PDE5A is highly specific for cGMP, both PDE11A variants demonstrated hydrolytic activity not only for cGMP but also for cAMP
when expressed in COS-7 cells, indicating that PDE11As resemble PDE2A
and PDE10A. However, PDE11As were activated by neither cAMP nor cGMP,
and the Km values of PDE11A for cAMP and cGMP were
almost the same, being distinguishable from PDE2A and PDE10A. These
characteristics supported the position that PDE11A is a distinct family
from other PDEs containing the GAF domain. Patterns of the inhibitory
effects of PDE inhibitors used on PDE11A3 and PDE11A4 activities were
similar to those of PDE11A1. Dipyridamole was the most effective
against these PDE11A variants. We found differences in the relative
Vmax and in the sensitivity to PDE inhibitors of
PDE11A3 and PDE11A4, suggesting that the N-terminal region of PDE11A
affects the conformation of the protein, leading to the change of
enzymatic profile. Similar effects of N-terminal splicing variability
have been demonstrated for some PDEs including PDE1A, PDE1C, PDE4A,
PDE4B, and PDE7A (15, 16, 18, 20, 47). For example, rat PDE4A isoforms
have been reported to exhibit 2-5-fold differences in their
Vmax values and in their sensitivity to the
PDE4-specific inhibitor, rolipram (16). Distinct N termini derived from
alternative splicing may provide PDE11A variants with different
enzymatic profiles.
The second difference lies in the presence of phosphorylation sites.
PDE11A4, but not PDE11A3, contains typical phosphorylation sites
(RRA117S and RKA162S)
for cAK (RRXS) and cGK
(RKX(S/T)) in the N terminus (36). In
vitro kinase assays suggested that PDE11A4, but not PDE11A3, is a
good substrate for both cAK and cGK, although the phosphorylation by
cGK I was weaker than that by cAK. The double mutant (PDE11A4 S117A/S162A) was still phosphorylated by both cAK and cGK I, at a lower
level, indicating that additional phosphorylation sites may be present
in PDE11A4. However, its additional phosphorylation sites would be
located in the N terminus of PDE11A4, because no phosphorylation of
PDE11A3 by cAK and cGK I was observed. Modifications of PDE activity by
phosphorylation have been reported in some PDEs. For example, PDE1A is
phosphorylated by cAK, and thus its affinity for calmodulin is reduced
(48). PDE3 and PDE4 are actually phosphorylated by cAK and activated in
response to agents that increase cAMP levels in intact cells and by cAK
in vitro (49-51). Binding of cGMP to noncatalytic binding
sites in the regulatory domain of PDE5A enhances the phosphorylation of
PDE5A by cGK (52, 53). Further work is needed to determine whether
phosphorylation of PDE11A4 occurs in vivo and also to
determine what effect is brought out by the phosphorylation of
PDE11A4.
The third difference involves tissue expression patterns. In many
cases, alternative splice variants in each PDE family show different
expression patterns in tissues and different subcellular localization
(1, 12-20). Human PDE11A transcripts were highly expressed in prostate
and moderately in testis. PCR and Southern blot analyses demonstrated
that PDE11A variants also showed different tissue expression patterns,
although it is not yet known whether there is a difference in
subcellular localization. PDE11A3 transcripts were specifically
expressed in testis, whereas PDE11A4 transcripts were strongly
expressed in prostate. Testis-specific expression of PDE11A3 variants
implies the production of PDE11A3 transcripts under the control of a
testis-specific promoter. The genomic origin of PDE11A variants is
interesting from the view of the formation of multiple variants and
their specific regulation.
In regard to the physiological function of PDE11A, the following
factors should be considered. Many PDEs have been reported to
exist in the testis. Several works have focused on the cAMP-signaling pathway during sperm differentiation (54-58), whereas cGMP has been
shown to control the Ca2+ entry into sperm through a cyclic
nucleotide-gated channel, suggesting that the cGMP signaling pathway
may be involved in sperm motility (59, 60). In prostate, PDEs have been
little studied, but several reports have described the physiological
roles of cAMP and cGMP. The elevation of intracellular cAMP in human
prostate cancer cells has been demonstrated to induce neuroendocrine
differentiation (61-63). The PDE inhibitors,
3-isobutyl-1-methylxanthine and papaverine, also initiate morphologic
differentiation in human prostate cancer cells and inhibit the
proliferation and invasive potential of the cells (61, 62).
Furthermore, withdrawal of the agents that increase cAMP causes rapid
loss of the neuroendocrine phenotype, indicating that chronic cAMP
signaling is required to block the proliferation of prostate tumor
cells and to induce neuroendocrine differentiation (63). On the other
hand, nitric oxide, which produces cGMP via the activation of soluble
guanyl cyclase, has been shown to play a role in the regulation of the
contractile function of smooth muscle cells and the growth of several
types of cells. In prostate, nitric oxide has been reported to function as a mediator of prostate smooth muscle activity (64). In addition, a
recent study has demonstrated that both nitric oxide donors and cGMP
analogs exert antiproliferative actions in human prostatic smooth
muscle cells (65). These reports suggest that the involvement of a cAMP
and cGMP PDE, PDE11A, in controlling prostate or testis functions is
plausible. The precise localization of PDE11A in prostate and testis
and further analysis will clarify the physiological roles of PDE11A.
In conclusion, we revealed the structure and tissue-specific expression
patterns of transcripts of a novel human PDE, PDE11A. Presently, the
physiological role of this enzyme remains unknown. Analysis of tissue
distribution in detail by means of in situ hybridization and
immunohistochemical analyses will be informative in revealing the role
of this enzyme. Pharmacological analysis using selective inhibitors for
this enzyme will elucidate new physiological functions of cAMP or cGMP
in prostate and testis.
 |
ACKNOWLEDGEMENTS |
We thank Dr. T. M. Lincoln for the
generous gift of bovine cGK I cDNA. We are grateful to Drs. S. Komatsubara and N. Nakanishi for continuous interest and Dr. N. Yanaka
for helpful discussion. We also thank Dr. J. A. Beavo for kind
advice on the nomenclature of the PDE11A variants and for sharing
unpublished data.
 |
FOOTNOTES |
*
The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EMBL Data Bank with accession number(s) AB036704 and AB038041.
To whom correspondence should be addressed. Tel.: 81-48-433-8069;
Fax: 81-48-433-8159; E-mail: k-omori@tanabe.co.jp.
Published, JBC Papers in Press, July 20, 2000, DOI 10.1074/jbc.M003041200
2
Dr. J. A. Beavo, personal communication.
 |
ABBREVIATIONS |
The abbreviations used are:
PDE, phosphodiesterase;
PDE11A3, testis-specific type PDE11A;
PDE11A4, prostate-specific type PDE11A;
RACE, rapid amplification of cDNA
ends;
PCR, polymerase chain reaction;
RT, reverse transcriptase;
ORF, open reading frame;
cAK, cAMP-dependent protein
kinase;
cGK, cGMP-dependent protein kinase;
kb, kilobase
pairs.
 |
REFERENCES |
| 1.
|
Beavo, J. A.
(1995)
Physiol. Rev.
75,
725-748
|
| 2.
|
Burns, F.,
Zhao, A. Z.,
and Beavo, J. A.
(1996)
Adv. Pharmacol.
36,
29-48
|
| 3.
|
Soderling, S. H.,
and Beavo, J. A.
(2000)
Curr. Opin. Cell Biol.
12,
174-179
|
| 4.
|
Soderling, S. H.,
Bayuga, S. J.,
and Beavo, J. A.
(1998)
Proc. Natl. Acad. Sci. U. S. A.
95,
8991-8996
|
| 5.
|
Fisher, D. A.,
Smith, J. F.,
Pillar, J. S.,
St. Denis, S. H.,
and Cheng, J. B.
(1998)
Biochem. Biophys. Res. Commun.
246,
570-577
|
| 6.
|
Soderling, S. H.,
Bayuga, S. J.,
and Beavo, J. A.
(1998)
J. Biol. Chem.
273,
15553-15558
|
| 7.
|
Fisher, D. A.,
Smith, J. F.,
Pillar, J. S.,
St. Denis, S. H.,
and Cheng, J. B.
(1998)
J. Biol. Chem.
273,
15559-15564
|
| 8.
|
Hayashi, M.,
Matsushima, K.,
Ohashi, H.,
Tsunoda, H.,
Murase, S.,
Kawarada, Y.,
and Tanaka, T.
(1998)
Biochem. Biophys. Res. Commun.
250,
751-756
|
| 9.
|
Fujishige, K.,
Kotera, J.,
Michibata, H.,
Yuasa, K.,
Takebayashi, S.,
Okumura, K.,
and Omori, K.
(1999)
J. Biol. Chem.
274,
18438-18445
|
| 10.
|
Kotera, J.,
Fujishige, K.,
Akatsuka, H.,
Imai, Y.,
Yanaka, N.,
and Omori, K.
(1998)
J. Biol. Chem.
273,
26982-26990
|
| 11.
|
Kotera, J.,
Fujishige, K.,
Yuasa, K.,
and Omori, K.
(1999)
Biochem. Biophys. Res. Commun.
261,
551-557
|
| 12.
|
Yan, C.,
Bentley, J. K.,
Sonnenburg, W. K.,
and Beavo, J. A.
(1994)
J. Neurosci.
14,
973-984
|
| 13.
|
Reinhardt, R. R.,
Chin, E.,
Zhou, J.,
Taira, M.,
Murata, T.,
Manganiello, V. C.,
and Bond, C. A.
(1995)
J. Clin. Invest.
95,
1528-1538
|
| 14.
|
McPhee, I.,
Pooley, L.,
Lobban, M.,
Bolger, G.,
and Houslay, M. D.
(1995)
Biochem. J.
310,
965-974
|
| 15.
|
Yan, C.,
Zhao, A. Z.,
Bentley, J. K.,
and Beavo, J. A.
(1996)
J. Biol. Chem.
271,
25699-25706
|
| 16.
|
Bolger, G. B.,
McPhee, I.,
and Houslay, M. D.
(1996)
J. Biol. Chem.
271,
1065-1071
|
| 17.
|
Huston, E.,
Pooley, L.,
Julien, P.,
Scotland, G.,
McPhee, I.,
Sullivan, M.,
Bolger, G.,
and Houslay, M. D.
(1996)
J. Biol. Chem.
271,
31334-31344
|
| 18.
|
Han, P.,
Zhu, X.,
and Michaeli, T.
(1997)
J. Biol. Chem.
272,
16152-16157
|
| 19.
|
Degerman, E.,
Belfrage, P.,
and Manganiello, V. C.
(1997)
J. Biol. Chem.
272,
6823-6826
|
| 20.
|
Huston, E.,
Lumb, S.,
Russell, A.,
Catterall, C.,
Ross, A. H.,
Steele, M. R.,
Bolger, G. B.,
Perry, M. J.,
Owens, R. J.,
and Houslay, M. D.
(1997)
Biochem. J.
328,
549-558
|
| 21.
|
Scotland, G.,
and Houslay, M. D.
(1995)
Biochem. J.
308,
673-681
|
| 22.
|
Shakur, Y.,
Pryde, J. G.,
and Houslay, M. D.
(1993)
Biochem. J.
292,
677-686
|
| 23.
|
O'Connell, J. C.,
McCallum, J. F.,
McPhee, I.,
Wakefield, J.,
Houslay, E. S.,
Wishart, W.,
Bolger, G.,
Frame, M.,
and Houslay, M. D.
(1996)
Biochem. J.
318,
255-262
|
| 24.
|
Yuasa, K.,
Omori, K.,
and Yanaka, N.
(2000)
J. Biol. Chem.
275,
4897-4905
|
| 25.
|
Yuasa, K.,
Michibata, H.,
Omori, K.,
and Yanaka, N.
(1999)
J. Biol. Chem.
274,
37429-37434
|
| 26.
|
Lineweaver, H.,
and Burk, D.
(1934)
J. Am. Chem. Soc.
56,
658-666
|
| 27.
|
Gudi, T.,
Lohmann, S. M.,
and Pilz, R. B.
(1997)
Mol. Cell. Biol.
17,
5244-5254
|
| 28.
|
McAllister-Lucas, L. M.,
Sonnenburg, W. K.,
Kadlecek, A.,
Seger, D.,
Trong, H. L.,
Colbran, J. L.,
Thomas, M. K.,
Walsh, K. A.,
Francis, S. H.,
Corbin, J. D.,
and Beavo, J. A.
(1993)
J. Biol. Chem.
268,
22863-22873
|
| 29.
|
Yanaka, N.,
Kotera, J.,
Ohtsuka, A.,
Akatsuka, H.,
Imai, Y.,
Michibata, H.,
Fujishige, K.,
Kawai, E.,
Takebayashi, S.,
Okumura, K.,
and Omori, K.
(1998)
Eur. J. Biochem.
255,
391-399
|
| 30.
|
Fawcett, L.,
Baxendale, R.,
Stacey, P.,
McGrouther, C.,
Harrow, I.,
Soderling, S.,
Hetman, J.,
Beavo, J. A.,
and Phillips, S. C.
(2000)
Proc. Natl. Acad. Sci. U. S. A.
97,
3702-3707
|
| 31.
|
Beavo, J. A.,
Conti, M.,
and Heaslip, R. J.
(1994)
Mol. Pharmacol.
46,
399-405
|
| 32.
|
Kozak, M.
(1986)
Cell
44,
283-292
|
| 33.
|
Proudfoot, N. J.,
and Brownlee, G. G.
(1976)
Nature
263,
211-214
|
| 34.
|
Schultz, J.,
Milpetz, F.,
Bork, P.,
and Ponting, C. P.
(1998)
Proc. Natl. Acad. Sci. U. S. A.
95,
5857-5864
|
| 35.
|
Aravind, L.,
and Ponting, C. P.
(1997)
Trends Biochem. Sci.
22,
458-459
|
| 36.
|
Wang, X.,
and Robinson, P. J.
(1997)
J. Neurochem.
68,
443-456
|
| 37.
|
Vemulapalli, S.,
Watkins, R. W.,
Chintala, M.,
Davis, H.,
Ahn, H. S.,
Fawzi, A.,
Tulshian, D.,
Chiu, P.,
Chatterjee, M.,
Lin, C. C.,
and Sybertz, E. J.
(1996)
J. Cardiovasc. Pharmacol.
28,
862-869
|
| 38.
|
Saeki, T.,
Adachi, H.,
Takase, Y.,
Yoshitake, S.,
Souda, S.,
and Saito, I.
(1994)
J. Pharmacol. Exp. Ther.
284,
25-33
|
| 39.
|
Repaske, D. R.,
Swinnen, J. V.,
Jin, S.-L. C.,
Van Wyk, J. J.,
and Conti, M.
(1992)
J. Biol. Chem.
267,
18683-18688
|
| 40.
|
Yang, Q.,
Paskind, M.,
Bolger, G.,
Thompson, W. J.,
Repaske, D. R.,
Cutler, L. S.,
and Epstein, P. M.
(1994)
Biochem. Biophys. Res. Commun.
205,
1850-1858
|
| 41.
|
Rosman, G. J.,
Martins, T. J.,
Sonnenburg, W. K.,
Beavo, J. A.,
Ferguson, K.,
and Loughney, K.
(1997)
Gene (Amst.)
191,
89-95
|
| 42.
|
Fujishige, K.,
Kotera, J.,
and Omori, K.
(1999)
Eur. J. Biochem.
266,
1118-1127
|
| 43.
|
Lin, C. S.,
Lau, A.,
Tu, R.,
and Lue, T. F.
(2000)
Biochem. Biophys. Res. Commun.
268,
628-635
|
| 44.
|
McAllister-Lucas, L. M.,
Haik, T. L.,
Colbran, J. L,
Sonnenburg, W. K.,
Seger, D.,
Turko, I. V.,
Beavo, J. A.,
Francis, S. H.,
and Corbin, J. D.
(1995)
J. Biol. Chem.
270,
30671-30679
|
| 45.
|
Turko, I. V.,
Haik, T. L.,
McAllister-Lucas, L. M.,
Burns, F.,
Francis, S. H.,
and Corbin, J. D.
(1996)
J. Biol. Chem.
271,
22240-22244
|
| 46.
|
Korsa, I.,
and Bock, A.
(1997)
J. Bacteriol.
179,
41-45
|
| 47.
|
Snyder, P. B.,
Florio, V. A.,
Ferguson, K.,
and Loughney, K.
(1999)
Cell. Signal.
11,
535-544
|
| 48.
|
Florio, V. A.,
Sonnenburg, W. K.,
Johnson, R.,
Kwak, K. S.,
Jensen, G. S.,
Walsh, K. A.,
and Beavo, J. A.
(1994)
Biochemistry
33,
8948-8954
|
| 49.
|
Macphee, C. H.,
Reifsnyder, D. H.,
Moore, T. A.,
Lerea, K. M.,
and Beavo, J. A.
(1988)
J. Biol. Chem.
263,
10353-10358
|
| 50.
|
Sette, C.,
Iona, S.,
and Conti, M.
(1994)
J. Biol. Chem.
269,
9245-9252
|
| 51.
|
Sette, C.,
and Conti, M.
(1996)
J. Biol. Chem.
271,
16526-16534
|
| 52.
|
Thomas, M. K.,
Francis, S. H.,
and Corbin, J. D.
(1990)
J. Biol. Chem.
265,
14971-14978
|
| 53.
|
Turko, I. V.,
Francis, S. H.,
and Corbin, J. D.
(1998)
Biochem. J.
329,
505-510
|
| 54.
|
Nantel, F.,
Monaco, L.,
Foulkes, N. S.,
Masquilier, D.,
LeMeur, M.,
Henriksén, K.,
Dierich, A.,
Parvinen, M.,
and Sassone-Corsi, P.
(1996)
Nature
380,
159-162
|
| 55.
|
Blendy, J. A.,
Kaestner, K. H.,
Weinbauer, G. F.,
Nieschlag, E.,
and Schütz, G.
(1996)
Nature
380,
162-165
|
| 56.
|
Gautier-Courteille, C.,
Salanova, M.,
and Conti, M.
(1998)
Endocrinology
139,
2588-2599
|
| 57.
|
Salanova, M.,
Chun, S.-Y.,
Iona, S.,
Puri, C.,
Stefanini, M.,
and Conti, M.
(1999)
Endocrinology
140,
2297-2306
|
| 58.
|
Vijayaraghavan, S.,
Goueli, S. A.,
Davey, M. P.,
and Carr, D. W.
(1997)
J. Biol. Chem.
272,
4747-4752
|
| 59.
|
Weyand, I.,
Godde, M.,
Frings, S.,
Weiner, J.,
Müller, F.,
Altenhofen, W.,
Hatt, H.,
and Kaupp, U. B.
(1994)
Nature
368,
859-863
|
| 60.
|
Wiesner, B.,
Weiner, J.,
Middendorff, R.,
Hagen, V.,
Kaupp, U. B.,
and Weyand, I.
(1998)
J. Cell Biol.
142,
473-484
|
| 61.
|
Bang, Y.-J.,
Pirnia, F.,
Fang, W.-G.,
Kang, W. K.,
Sartor, O.,
Whitesell, L.,
Ha, M. J.,
Tsokos, M.,
Sheahan, M. D.,
Nguyen, P.,
Niklinski, W. T.,
Myers, C. E.,
and Trepel, J. B.
(1994)
Proc. Natl. Acad. Sci. U. S. A.
91,
5330-5334
|
| 62.
|
Goto, T.,
Matsushima, H.,
Kasuya, Y.,
Hosaka, Y.,
Kitamura, T.,
Kawabe, K.,
Hida, A.,
Ohta, Y.,
Simizu, T.,
and Takeda, K.
(1999)
Int. J. Urol.
6,
314-319
|
| 63.
|
Cox, M. E.,
Deeble, P. D.,
Lakhani, S.,
and Parsons, S. J.
(1999)
Cancer Res.
59,
3821-3830
|
| 64.
|
Takeda, M.,
Tang, R.,
Shapiro, E.,
Burnett, A. L.,
and Lepor, H.
(1995)
Urology
45,
440-446
|
| 65.
|
Guh, J.-H.,
Hwang, T.-L.,
Ko, F.-N.,
Chueh, S.-C.,
Lai, M.-K.,
and Teng, C.-M.
(1998)
Mol. Pharmacol.
53,
467-474
|
Copyright © 2000 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
K. Omori and J. Kotera
Overview of PDEs and Their Regulation
Circ. Res.,
February 16, 2007;
100(3):
309 - 327.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. T. Bender and J. A. Beavo
Cyclic Nucleotide Phosphodiesterases: Molecular Regulation to Clinical Use
Pharmacol. Rev.,
September 1, 2006;
58(3):
488 - 520.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Gross-Langenhoff, K. Hofbauer, J. Weber, A. Schultz, and J. E. Schultz
cAMP Is a Ligand for the Tandem GAF Domain of Human Phosphodiesterase 10 and cGMP for the Tandem GAF Domain of Phosphodiesterase 11
J. Biol. Chem.,
February 3, 2006;
281(5):
2841 - 2846.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. R. D'Andrea, Y. Qiu, D. Haynes-Johnson, S. Bhattacharjee, P. Kraft, and S. Lundeen
Expression of PDE11A in Normal and Malignant Human Tissues
J. Histochem. Cytochem.,
July 1, 2005;
53(7):
895 - 903.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Kotera, T. Sasaki, T. Kobayashi, K. Fujishige, Y. Yamashita, and K. Omori
Subcellular Localization of Cyclic Nucleotide Phosphodiesterase Type 10A Variants, and Alteration of the Localization by cAMP-dependent Protein Kinase-dependent Phosphorylation
J. Biol. Chem.,
February 6, 2004;
279(6):
4366 - 4375.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Zoraghi, J. D. Corbin, and S. H. Francis
Properties and Functions of GAF Domains in Cyclic Nucleotide Phosphodiesterases and Other Proteins
Mol. Pharmacol.,
February 1, 2004;
65(2):
267 - 278.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. E. Martinez, J. A. Beavo, and W. G.J. Hol
GAF Domains: Two-Billion-Year-Old Molecular Switches that Bind Cyclic Nucleotides
Mol. Interv.,
September 1, 2002;
2(5):
317 - 323.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Krohn and R. Paschke
Progress in Understanding the Etiology of Thyroid Autonomy
J. Clin. Endocrinol. Metab.,
July 1, 2001;
86(7):
3336 - 3345.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. W. Norton, M. R. D'Amours, H. J. Grazio, T. L. Hebert, and R. H. Cote
Mechanism of Transducin Activation of Frog Rod Photoreceptor Phosphodiesterase. ALLOSTERIC INTERACTIONS BETWEEN THE INHIBITORY gamma SUBUNIT AND THE NONCATALYTIC cGMP-BINDING SITES
J. Biol. Chem.,
December 1, 2000;
275(49):
38611 - 38619.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 2000 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|