| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
J. Biol. Chem., Vol. 275, Issue 41, 31567-31572, October 13, 2000
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
§¶,§
,§,,**, and§§§
From the Gladstone Institute of Cardiovascular
Disease, San Francisco, California 94141-9100 and the
§ Cardiovascular Research Institute and the
Department of Physiology, University of
California, San Francisco, California 94143
Received for publication, June 22, 2000
 |
ABSTRACT |
|---|
 TOP
 ABSTRACT
 INTRODUCTION
MATERIALS AND METHODS
RESULTS AND DISCUSSION
REFERENCES
|
|---|
Two distal enhancers that specify apolipoprotein
(apo) E gene expression in isolated macrophages and adipose tissue were
identified in transgenic mice that were generated with constructs of
the human apoE/C-I/C-I'/C-IV/C-II gene cluster. One of these enhancers, multienhancer 1, consists of a 620-nucleotide sequence located 3.3 kilobases (kb) downstream of the apoE gene. The second enhancer, multienhancer 2, is a 619-nucleotide sequence located 15.9 kb downstream of the apoE gene and 5.9 kb downstream of the apoC-I gene.
The two enhancers are 95% identical in sequence, and they are likely
to have arisen as a consequence of the gene duplication event that
yielded the apoC-I gene and the apoC-I' pseudogene. Both enhancer
sequences appear to have equivalent activity in directing apoE gene
expression in peritoneal macrophages and in adipocytes, suggesting that
their activity in specific cell types may be determined by common
regulatory elements.
Apolipoprotein (apo)1 E
is a Mr = 35,000 protein with multiple functions
in lipid metabolism (1). It is a component of large remnant
lipoproteins and large high density lipoproteins in plasma. ApoE has a
key role in the metabolism of plasma lipoproteins by serving as a
ligand for the low density lipoprotein (LDL) receptor family and
binding to heparan sulfate proteoglycans. These functions of apoE
mediate the clearance of remnant lipoproteins and apoE-rich large high
density lipoproteins from plasma, resulting in the redistribution of
cholesterol and triglycerides between peripheral tissues and the liver.
Three common variants, E2, E3, and E4 (2, 3), that affect the
properties of human apoE have been identified as a consequence of
having either arginine or cysteine at residues 112 and 158 (4-6). The
most abundant variant in the normolipidemic human population is E3 (7).
The E2 variant is defective in binding to receptors, and homozygosity
for apoE2 is sometimes associated with type III hyperlipidemia and
premature atherosclerosis (8). The E4 variant increases the formation
of amyloid plaques and neurofibrillary tangles that are characteristic
of Alzheimer's disease, making apoE4 a significant risk factor for
this neurodegenerative disorder (9-11). ApoE4 is also associated with
a moderate elevation in plasma cholesterol and an increased risk for
coronary artery disease (5, 7).
Macrophages have long been recognized as a source of apoE (12). ApoE is
a marker for the developmental state of macrophages; the culture of
mouse bone marrow cells in vitro shows that mature macrophages, but not their monocytic precursors, synthesize apoE (13).
Thioglycollate-elicited peritoneal macrophages synthesize and secrete
apoE. Bacterial endotoxin and other inflammatory agents decrease its
production (14). Resident macrophages in a variety of tissues,
including liver Kupffer cells (15) and brain microglia (16, 17), either
synthesize or can be induced to synthesize apoE. Dexamethasone, a
synthetic glucocorticoid, increases apoE mRNA levels in mature
macrophages up to 6-fold over basal levels (18). The uptake of
acetylated LDL or cholesterol ester-rich ApoE synthesis has been reported in both human and mouse adipose tissue
(25). ApoE mRNA has also been detected in confluent cultured mouse
fibroblasts that have been induced to become adipocytes by
dexamethasone and insulin. Undifferentiated fibroblasts do not contain
apoE mRNA (25). The level of apoE mRNA in differentiated adipocytes is increased further by raising the content of intracellular free cholesterol (25), a process that can be stimulated in adipocytes by the induction of LDL receptor-related protein by insulin (26). Thus,
the regulation of apoE production in both adipocytes and macrophages
has intriguing similarities; the gene is not expressed in cellular
precursors but is induced upon differentiation into mature cells and is
further induced in each cell type by intracellular cholesterol and by a
synthetic glucocorticoid. Consequently, it is likely these processes
are controlled by common regulatory elements that are active in
both cell types.
The human apoE gene is located on chromosome 19 at the 5' end of a
44-kilobase (kb) gene cluster that includes the apoC-I, apoC-IV, and
apoC-II genes and the apoC-I' pseudogene (27, 28). The apoE gene is
expressed in many tissues throughout the body (29), although 90% of
the apoE circulating in plasma is synthesized by the liver (30).
Cell-specific distal enhancers control the expression of the apoE gene
cluster in all tissues (31, 32). The promoters lack the ability to
direct gene transcription in vivo in any cell in the absence
of the distal enhancers (33). The locations of two enhancers, hepatic
control regions (HCR) 1 and 2, have been reported; HCR.1 is found 15 kb
3' of the apoE gene, and HCR.2 is located 11 kb farther downstream (34,
35). The two hepatocyte-specific enhancers have an 87% sequence
identity, and they apparently arose as a result of the recent
evolutionary gene duplication that yielded the apoC-I and apoC-I' genes
(28). We report here on the localization of two macrophage/adipocyte enhancers that are nearly identical in sequence, constituting the
second example of the regulatory impact of gene duplication on the
control of gene expression in the apoE gene cluster.
Constructs and Transgenic Mice--
The constructs employed for
these studies are illustrated in Fig. 1, A and B.
The preparations of the 70-kb 198.KK cloned genomic fragment and the
10-kb HEG1, HESS1, LE1, LE2, and LE6 subfragments have been described
(27, 34). The CLE1 clone (36) consists of the intact human apoE gene,
30 kb of 5'-flanking sequence, and 2.75 kb of 3'-flanking sequence. The
3' terminus of the genomic insert was determined by nucleotide
sequencing. The LE7, LE8, and LE9 DNA subfragments containing 672-, 597-, and 603-bp sequences, respectively, were generated by polymerase chain reaction (PCR) from the LE1 DNA subfragment. Oligonucleotide sequences for PCR were as follows: 1) LE7 5' end primer,
5'CCCAAGCTTCAACATGCGTTAGGAGGGACAT3'; 2) LE7 3' end primer,
5'GGACTAGTCCCTATCAGATGGGCGTCTTTA3'; 3) LE8 5' end primer,
5'CCCAAGCTTCACTGAGCCCTACTGGATGTTC3'; 4) LE8 3' end primer,
5'GGACTAGTCCTTCAGCTGCAAAGCTCTGAG3'; 5) LE9 5' end primer,
5'CCCAAGCTTAGTGTCCAGCTAAGGCGAC3'; 6) LE9 3' end primer, 5'GGACTAGTGCCCGCAGGACCTTTATCAG3'. The resulting PCR products were digested with HindIII and SpeI and ligated to
purified HEG1 to make transgene constructs (HEG.LE1 in Fig.
1A). Construct DNA was purified by standard methods
(35).
All transgenic animals for these studies were generated in the inbred
FVB/N mouse strain with constructs of the human apoE gene cluster (Fig.
1, A and B) as described previously (27). Construct DNA was microinjected into zygotes at a concentration of 2 ng/µl in 5 mM Tris-HCl, pH 7.4, 0.2 mM EDTA.
Transgenic founders and hemizygous offspring were identified by PCR
analysis of tail tip DNA, and genomic DNA was analyzed further to
confirm the presence of the LE7, LE8, and LE9 sequences in their
respective transgenes. Two to four independent transgenic lines were
analyzed for each construct, and cell or tissue samples from male and
female mice were examined independently.
Macrophage Isolation and Culture--
Mouse peritoneal
macrophages were collected 4 days after an intraperitoneal injection of
1.5 ml of sterile 4% thioglycollate broth (Difco). All subsequent
procedures were carried out under sterile conditions. The cells were
collected by intraperitoneal lavage with sterile Dulbecco's
phosphate-buffered saline (PBS). The lavage fluid from three mice was
pooled and centrifuged for 10 min at 800 × g. Pelleted
cells were resuspended in Dulbecco's minimal essential medium (DMEM)
and then centrifuged again. After a second resuspension in DMEM, the
cells were counted, and 3-10 × 106 cells were plated
in 35-mm culture dishes. Nonadherent cells were removed after 3 h
by two washes with DMEM, and the remaining macrophages were incubated
overnight in DMEM supplemented with 20% fetal bovine serum.
Preparation and Analysis of Total RNA--
Macrophage RNA was
extracted by using Trizol Reagent (Life Technologies, Inc.) following
the manufacturer's protocol. RNA hybridization probes for human apoE
mRNA were transcribed as described (34) by using bacteriophage T3
RNA polymerase in the presence of [ In Situ Hybridization--
Adipose tissues from retroperitoneal,
inguinal, and reproductive sites from control and transgenic mice were
fixed in 4% paraformaldehyde for 24-36 h and embedded in paraffin.
Sections (7 µm) were cut with a rotary microtome, mounted on
superfrost plus slides (Fisher), and stored at 4 °C until used.
Before hybridization, slides were warmed to room temperature and baked
at 55 °C for 30 min. Paraffin was removed from the slides by two
successive 10-min immersions in xylene. Tissue sections were hydrated
in a progression of 3-min washes in ethanol (100, 90, 70, 50, and 30%)
and by three successive 5-min immersions in 1× PBS (137 mM
NaCl, 2.7 mM KCl, 4.3 mM
Na2HPO4·7H2O, 1.4 mM
KH2PO4, pH 7.3). The sections were incubated
with 20 µg/ml proteinase K (Roche Molecular Biochemicals) in 50 mM Tris-HCl, pH 8.0, 5 mM EDTA, 150 mM NaCl for 15 min at room temperature. Proteolytic
activity was stopped by immersion for 10 min in 0.2% glycine in 1×
PBS. Tissues were successively rinsed in 1× PBS for 5 min, fixed in
4% paraformaldehyde in 1× PBS for 5 min, rinsed in 1× PBS for 5 min,
and acetylated with 0.25% acetic anhydride in 0.1 mM
triethanolamine buffer at pH 8.0 for 10 min. After a final 5-min rinse
in 1× PBS, tissue sections were dehydrated in a series of 3-min washes
in ethanol (30, 50, 80, 95, and 100%). An RNA probe complementary to
nucleotides 20-411 of human apoE mRNA was labeled with
[
Tissue sections were incubated for 14-18 h in a humidified chamber at
42 °C with probes diluted to 2.0 × 106 cpm per
slide in a buffer containing 50% formamide, 0.3 M NaCl, 20 mM Tris, pH 8.0, 5 mM EDTA, 1× Denhardt's
solution (0.2% polyvinylpyrrolidone, 0.02% Ficoll, 0.02% bovine
serum albumin), 10% dextran sulfate, 250 µg/ml sperm DNA, and 0.1 mg/ml tRNA. The sections were washed twice at room temperature in 2×
standard saline citrate solution (SSC), 1.0 mM EDTA for 10 min, and immersed in 20 µg/ml RNase A (Sigma) in 500 mM
NaCl, 10 mM Tris, pH 8.0, and 10 units/ml of T1 RNase
(Roche Molecular Biochemicals) for 1 h at 37 °C. Tissue sections were washed at 55 °C in six changes of 0.1× SSC with 1.0 mM EDTA for 4 h, rinsed twice for 10 min each in 0.5×
SSC, dehydrated, and exposed at Nucleotide Sequence Analysis--
Nucleotide sequences of
intergenic regions in the human apoE gene cluster were determined by
standard methods (27). ApoE gene cluster sequences are also available
in the GenBankTM data base (accession number AF050154). The
nucleotide sequences were analyzed by Pustell DNA matrix and ClustalW
alignment algorithms contained in the MacVector software suite (Oxford
Molecular, Madison WI), and by sequence comparison algorithms in the
Vector NTI (Informax, North Bethesda, MD) suite of programs. Additional
analysis of nucleotide homologies was made by searching the
GenBankTM and TRANSFAC (38) data bases.
To determine the location of regulatory sequences that direct apoE
gene expression in macrophages, peritoneal macrophages were isolated
from transgenic mice that had been generated with the p198.KK, CLE1,
and HEG1 genomic fragments (Fig.
1A). Total RNA was extracted
and analyzed by RNase protection analysis. Macrophages from p198.KK
transgenic mice contained human apoE mRNA, whereas cells from CLE1
and HEG1 did not react with the human antisense RNA probe (Fig.
2). No RNA samples from any tissues of
these mice hybridized to the apoE sense RNA probe (data not shown).
These initial results suggested that no macrophage-specific regulatory activity was located in the proximal promoter or within 30 kb upstream
of the apoE gene and that macrophage enhancer activity was located more
than 1.7 kb downstream of the gene.
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS AND DISCUSSION
REFERENCES
-migrating very low density
lipoproteins into peritoneal macrophages stimulates apoE synthesis and
secretion by 3-8-fold (12). The response of macrophages to cholesterol
is due to increased apoE gene transcription and higher apoE mRNA
levels (19). Lipid-loaded, macrophage-derived foam cells in aortic
atherosclerotic lesions of cholesterol-fed rabbits synthesize and
secrete apoE and appear to be the major source of apoE in the
atherosclerotic arterial wall (20, 21). The transfer of apoE-secreting
macrophages into apoE-deficient mice by either bone marrow
transplantation (22, 23) or cross-breeding with transgenic lines (24)
reduces the incidence of vascular lesions, and the animals become
resistant to dietary cholesterol-induced atherosclerosis.
MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS AND DISCUSSION
REFERENCES
-32P]UTP (10 mCi/ml, Amersham Pharmacia Biotech) from cDNA fragments that had
been cloned in Bluescribe vectors (Stratagene, La Jolla, CA). A mouse
actin mRNA probe (m-actin 79) that was transcribed by using SP6 RNA
polymerase was used to estimate the levels of RNA present in each
sample. Human apoE and mouse actin protected 192 and 80 nucleotides,
respectively, of their respective probes. RNase protection analysis was
performed as described (37) with 5 µg of total cellular RNA per
sample. Protected fragments were resolved by electrophoresis in 6%
polyacrylamide gels containing 7 M urea and detected by
autoradiography of the dried gels.
-33P]UTP to a specific activity of at least 2 × 104 Ci/mmol by using an RNA transcription kit (Stratagene).
Labeled probes were purified through Micro Bio-Spin 30 chromatography columns (Bio-Rad).
20 °C to -max film (Amersham
Pharmacia Biotech) for 4 days. Slides were dipped in NTB2 nuclear track emulsion (Eastman Kodak Co.), incubated at 4 °C for 5 days, and developed with D19 developer (Kodak). Sections were stained for 2 min
with hematoxylin (Fisher), washed in Scott's Tap Water Substitute (Fisher) for 3 min, placed in 80% ethanol for 1 min, and then restained with eosin (Fisher) for 3 min. After dehydration in a graded
series of ethanol (80, 95, and 100%), the sections were rinsed in
xylene three times and overlaid with coverslips.
RESULTS AND DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS AND DISCUSSION
REFERENCES
View larger version (32K):
[in a new window]
Fig. 1.
Transgenic constructs of the human
apoE gene cluster. A, transcription of each gene is in
the 5' to 3' orientation. The apoE gene cluster is drawn to scale, and
the scale in kb is shown. The horizontal lines represent
construct lengths. Apolipoprotein genes in the cluster are illustrated
as solid vertical lines for exons and open boxes
for introns. Hepatic control regions, HCR.1 and HCR.2, and
multienhancer domains, ME.1 and ME.2, are indicated by shaded
ovals. Enhancer testing was performed by ligating distal fragments
to the 3' terminus of construct HEG1, as illustrated here for LE1, and
then generating transgenic mice for analysis. B, the LE1
domain of the apoE gene cluster is illustrated. Shaded boxes
show full and partial members of the Alu repeated sequence
family. The 5' portion of the apoC-I' pseudogene is depicted, with
vertical solid boxes indicating exons and open
boxes indicating introns. The region that we have shown to have
full HCR.1 activity is also indicated (shaded bar), although
we (53) and others (54) have demonstrated that shorter segments of
HCR.1 have liver enhancer properties. The lengths of fragments
(shaded bars) that were prepared and ligated to the 3' end
of HEG1 (as illustrated for LE1 in Fig. 1A) for generating
transgenic mice are given in bp. The ME.2 domain is indicated; its
enhancer activity is given by all fragments that contain this
sequence.
View larger version (71K):
[in a new window]
Fig. 2.
Expression of apoE mRNA in control and
transgenic mouse macrophages. Total RNA from isolated peritoneal
macrophages was examined by RNase protection analysis using antisense
probes for human apoE (upper panel) and actin (lower
panel). Transgenic lines examined are indicated. Control
macrophage RNA was derived from nontransgenic mice. All of the
transgenic lines are expressed in kidney proximal tubule epithelia as a
consequence of endogenous enhancer activity in the 5'-flanking region
of the human apoE gene (34); therefore, kidney RNA was examined to
verify the activity of the human apoE probe. A typical result with
kidney and liver RNA from HEG1 transgenic mice is shown. Only 198.KK,
HEG.LE1, HEG.LE2, and HEG.LE6 are expressed in the liver (data not
shown).
Previous studies indicated that the HCR.1 domain had unique enhancer properties with a potential nuclear matrix attachment sequence and nucleosome organizing capability (39).2 Therefore, we examined transgenic mice generated with constructs that covered this region of the apoE gene cluster to determine if macrophage expression activity might be located near HCR.1 (Fig. 1, A and B). Human apoE mRNA was detected in macrophage RNA from transgenic mice generated with HEG.LE1 and HEG.LE2 but not with HEG.LE6 (Fig. 2). To confirm the site of macrophage enhancer activity, additional constructs were generated that had the LE7, LE8, or LE9 portion of the LE1 domain. The HEG.LE8 construct expressed the apoE gene in macrophages, and only constructs that contained the LE8 sequence yielded human apoE mRNA in these cells (Fig. 2).
A previous report (40) indicated that activation of apoE gene expression in vitro during macrophage differentiation of cultured transformed THP-1 cells is associated with a regulatory element in the proximal promoter of the apoE gene that binds the transcription factor activator protein-1. This element was mapped to ~600 nucleotides upstream of the transcription start site of the apoE gene, which places the regulatory element within a member of the Alu family of repeated sequences (41). Although this regulatory element is present in the HEG1 genomic fragment, our results show that HEG1 is not expressed in macrophages in vivo without the presence of the downstream multienhancer domain (Fig. 2).
The similarities in the control of apoE production reported for both
macrophages and adipocytes suggested that the same regulatory domain
might contain enhancer activity for apoE gene expression in both cell
types. Therefore, adipose tissue was collected from adipose fat pads at
three different sites from transgenic mice generated with various
constructs (Fig. 1, A and B) and was examined by
in situ hybridization. ApoE mRNA was detected in
adipocytes from HEG.LE2 but not HEG.LE6 transgenic mice (Fig.
3, A and B). No
difference in apoE expression was observed in adipose tissue excised
from any of the three sites examined (data not shown). Human apoE
mRNA was also found in adipose tissue from p198.KK, HEG.LE1,
and HEG.LE8 transgenic mice, but not in adipose tissue from CLE1,
HEG.LE7, HEG.LE9, or HEG1 transgenic mice (data not shown). The
in situ hybridization results were verified by examining apoE mRNA in abdominal adipose tissue by RNase protection (Fig. 4). These data confirmed that the LE8
portion, but not the LE7 or LE9 portion, of the LE1 domain directed
transgene expression to adipose tissue. Thus, both adipose enhancer
activity and macrophage enhancer activity co-localized to the same LE8
intergenic region.
|
|
The sequence of the LE8 region was compared with the nucleotide
sequence of the human apoE gene cluster to determine if there were
homologous sequences present elsewhere within this genomic domain. A
620-nucleotide region of homology was identified in the apoE/C-I
intergenic region, located 3.3 kb downstream of the apoE gene. A
comparison of the entire LE8 sequence and its upstream homologous
sequence is shown in Fig. 5. The two
regions are 95% identical in sequence, having a random distribution of
nucleotide differences. A single nucleotide deletion located near the
5' terminus of LE8 accounts for their difference in length. This sequence identity is greater than that of HCR.1 and HCR.2 (28), suggesting that enhancer function was likely to be preserved in both
domains. Analysis of macrophage RNA from HESS1 (Fig. 1A) transgenic mice supported the likelihood that the apoE/C-I intergenic element had full enhancer activity (Fig. 2). Similarly, adipose tissue
from HESS1 transgenic mice was positive for apoE mRNA as determined
by in situ hybridization (data not shown). We termed the
upstream sequence multienhancer 1 (ME.1) and the downstream sequence
multienhancer 2 (ME.2).
|
Our identification of the multienhancer domains depended on the expression of human genomic fragments in transgenic mice. To minimize the possibility that our results might reflect potential position effects from neighboring sequences at the sites of transgene integration in the host mouse genome, we examined at least two independent founder lines for each construct. In addition, transgenic lines were generated with several different constructs containing the multienhancer domains (Fig. 1, A and B). The same pattern of expression was observed in each case, making it unlikely that artifactual position effects contributed to the cell specificity of transgene expression.
To understand the regulatory activity of the ME.1 and ME.2 domains, we
examined their nucleotide sequences for transcription factor binding
motifs. Several high affinity binding motifs for the glucocorticoid
receptor (GR) and members of the CAAT element binding protein (C/EBP)
transcription factor family were found throughout both multienhancer
domains, as illustrated for ME.1 in Fig.
6. Although the transcriptional
activities of these motifs remain to be evaluated by direct functional
tests, their presence in ME.1 and ME.2 is consistent with the roles of
GR and C/EBP factors in macrophage and adipocyte function. For example,
C/EBP and C/EBP play obligatory roles in adipocyte
differentiation, a process that is further modulated by glucocorticoids
(42, 43). In addition, C/EBP is required for full activity of the promoters of several genes that are expressed in mature macrophages (44-46). Furthermore, both C/EBP and C/EBP appear to play
critical roles in macrophage maturation (47).
|
The possibility that widely employed transcription factors like GR and
C/EBP mediate ME.1 and ME.2 function suggests that interactions with
specific cofactors are likely to be critical to achieving
tissue-specific enhancer action. This mechanism has been suggested to
account for the cell-specific activity of the peroxisome
proliferator-activated receptors (PPARs) (48), another transcription
family that is important for gene expression in macrophages,
adipocytes, and other tissues (49). Cofactor interactions and protein
modifications, including phosphorylation, appear to be important in
mediating PPAR binding to low affinity binding sites in regulatory
domains of responsive genes (48). Consequently, our finding of high
affinity binding motifs for GR and C/EBP, and the apparent lack of high
affinity binding sites for PPAR in ME.1 and ME.2 (Fig.
7, legend), will require
direct functional tests to evaluate their role in enhancer activity for
the apoE gene. Clarification of these mechanisms is beyond the scope of this report, and we will test them in future studies.
|
The finding of one copy of a duplicate enhancer element in the 5'-flanking region of the apoC-I' gene (ME.2) and a second copy in the apoE/C-I intergenic region (ME.1) was unexpected. Our previous sequence analysis indicated that homology between the two apoC-I genes ended 259 nucleotides upstream of the apoC-I gene. However, Pustell DNA matrix analysis of the apoE gene cluster sequence compared with itself revealed an additional region of internal homology located 467 nucleotides further upstream of the apoC-I promoter. This upstream sequence was strikingly similar to sequences within the LE1 fragment where the apoC-I' 5'-flanking region is located (Fig. 7). The 5' region of sequence duplication extends 12 nucleotides into the adjacent Alu repeated sequence member, at which point nucleotide similarities diverge sharply (data not shown). Within the duplicated region, sequence identities are remarkably high, consistent with a conserved regulatory function for these regions.
A comparison of the ec7 and cc13 Alu sequences (locations indicated in Fig. 7) reveals a 94% sequence identity (data not shown). This degree of sequence conservation is significantly greater than the 87% average identity found for ~500 members of a major Alu subfamily (50) and the 86% identity for Alu sequences at large in the human genome (51). The relatively high conservation of the ec7 and cc13 Alu sequences is consistent with the recent evolutionary duplication of the apoC-I genes (52). Finding that the sequence identity between these particular Alu family members is comparable to that of the adjacent enhancer domains suggests that they may have a functional contribution to the apoE gene cluster, a possibility that remains to be determined.
Our previous studies indicated that a 10-kb segment of the human apoE gene cluster had undergone a duplication event that resulted in the appearance of two copies of the apoC-I gene (27). We determined by nucleotide sequence analysis that the distal downstream end of the duplicated segment was located at the 3' end of HCR.2 (28). In the current study, both matrix analysis and direct sequence comparisons show that the upstream 5' end of the duplicated genomic segment is at the 5' end of the ME.1 domain and extending 12 nucleotides into the adjacent Alu sequence (Fig. 7). Thus, the upstream duplicated segment containing the functional apoC-I gene is 12 kb in length, and the downstream duplicated segment containing the inactive apoC-I' pseudogene is 11 kb in length.
The studies presented here show that the gene recombination events that
resulted in the modern day human apoE gene cluster yielded duplicated
enhancers, HCR.1 and HCR.2, for hepatocyte expression and duplicated
enhancers, ME.1 and ME.2, for macrophage and adipocyte expression. The
enhancer HCR.2 is located at the extreme 3' end of the recombinant
portion of the cluster, and ME.1 is located at the extreme 5' end of
the recombinant region (Fig. 1). Additional studies are underway to
determine if distinct regulatory elements within ME.1 and ME.2 can be
distinguished for the control of gene expression in macrophages and adipocytes.
| |
ACKNOWLEDGEMENTS |
|---|
We thank David Walker for help with constructs and Sid Espineda and Heather Oakley for generating transgenic mice. We also thank Stephen Ordway and Gary Howard for editorial assistance, John Carroll and Stephen Gonzalez for graphics, and Kerry Humphrey for manuscript preparation.
| |
FOOTNOTES |
|---|
* This work was supported in part by National Institutes of Health Grant HL37063 (to J. M. T.).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
¶ Current address: University of California, Davis Cancer Center, Sacramento, CA 95817.
Current address: Dept. of Medicine (DO6), University of
Sydney, Sydney, New South Wales 2006, Australia.
** Current address: Dept. of Pharmacology, National University of Ireland, Galway, Ireland.
§§ To whom correspondence should be addressed: The J. David Gladstone Institutes, P. O. Box 419100, San Francisco, CA 94141-9100. Tel.: 415-826-7500; Fax: 415-285-5632; E-mail: jtaylor@gladstone.ucsf.edu.
Published, JBC Papers in Press, July 11, 2000, DOI 10.1074/jbc.M005468200
2 Q. Dang and J. Taylor, unpublished observations.
| |
ABBREVIATIONS |
|---|
The abbreviations used are: apo, apolipoprotein; C/EBP, CAAT element binding protein; DMEM, Dulbecco's modified Eagle's medium; GR, glucocorticoid receptor; HCR, hepatic control region; LDL, low density lipoproteins; ME, multienhancer; PBS, phosphate-buffered saline; PPAR, peroxisome proliferator-activated receptor; kb, kilobase pair; PCR, polymerase chain reaction; bp, base pair.
| |
REFERENCES |
|---|
|
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS AND DISCUSSION
REFERENCES
|
|---|
| 1. | Mahley, R. W. (1988) Science 240, 622-630 |
| 2. | Zannis, V. I., and Breslow, J. L. (1981) Biochemistry 20, 1033-1041 |
| 3. | Sing, C. F., and Davignon, J. (1985) Am. J. Hum. Genet. 37, 268-285 |
| 4. | Rall, S. C., Jr., Weisgraber, K. H., and Mahley, R. W. (1982) J. Biol. Chem. 257, 4171-4178 |
| 5. | Weisgraber, K. H. (1994) Adv. Protein Chem. 45, 249-302 |
| 6. | Weisgraber, K. H., Newhouse, Y. M., Seymour, J. L., Rall, S. C., Jr., and Mahley, R. W. (1985) Anal. Biochem. 151, 455-461 |
| 7. | Mahley, R. W., and Huang, Y. (1999) Curr. Opin. Lipidol. 10, 207-217 |
| 8. | Mahley, R. W., and Rall, S. C., Jr. (1995) in The Metabolic and Molecular Bases of Inherited Disease (Scriver, C. R. , Beaudet, A. L. , Sly, W. S. , and Valle, D., eds), 7th Ed. , pp. 1953-1980, McGraw-Hill Inc., New York |
| 9. | Roses, A. D. (1994) Curr. Neurol. 14, 111-141 |
| 10. | Weisgraber, K. H., Pitas, R. E., and Mahley, R. W. (1994) Curr. Opin. Struct. Biol. 4, 507-515 |
| 11. | Masliah, E., Mallory, M., Veinbergs, I., Miller, A., and Samuel, W. (1996) Prog. Neurobiol. (New York) 50, 493-503 |
| 12. | Basu, S. K., Brown, M. S., Ho, Y. K., Havel, R. J., and Goldstein, J. L. (1981) Proc. Natl. Acad. Sci. U. S. A. 78, 7545-7549 |
| 13. | Werb, Z., and Chin, J. R. (1983) J. Cell Biol. 97, 1113-1118 |
| 14. | Werb, Z., and Chin, J. R. (1983) J. Exp. Med. 158, 1272-1293 |
| 15. | Dawson, P. A., Lukaszewski, L. M., Ells, P. F., Malbon, C. C., and Williams, D. L. (1989) J. Lipid Res. 30, 403-413 |
| 16. | Nakai, M., Kawamata, T., Taniguchi, T., Maeda, K., and Tanaka, C. (1996) Neurosci. Lett. 211, 41-44 |
| 17. | Stone, D. J., Rozovsky, I., Morgan, T. E., Anderson, C. P., Hajian, H., and Finch, C. E. (1997) Exp. Neurol. 143, 313-318 |
| 18. | Zuckerman, S. H., Evans, G. F., and O'Neal, L. (1993) Atherosclerosis 103, 43-54 |
| 19. | Mazzone, T., Basheeruddin, K., and Poulos, C. (1989) J. Lipid Res. 30, 1055-1064 |
| 20. | Rosenfeld, M. E., Butler, S., Ord, V. A., Lipton, B. A., Dyer, C. A., Curtiss, L. K., Palinski, W., and Witztum, J. L. (1993) Arterioscler. Thromb. 13, 1382-1389 |
| 21. | Salomon, R. N., Underwood, R., Doyle, M. V., Wang, A., and Libby, P. (1992) Proc. Natl. Acad. Sci. U. S. A. 89, 2814-2818 |
| 22. | Linton, M. F., Atkinson, J. B., and Fazio, S. (1995) Science 267, 1034-1037 |
| 23. | Boisvert, W. A., Spangenberg, J., and Curtiss, L. K. (1995) J. Clin. Invest. 96, 1118-1124 |
| 24. | Bellosta, S., Mahley, R. W., Sanan, D. A., Murata, J., Newland, D. L., Taylor, J. M., and Pitas, R. E. (1995) J. Clin. Invest. 96, 2170-2179 |
| 25. | Zechner, R., Moser, R., Newman, T. C., Fried, S. K., and Breslow, J. L. (1991) J. Biol. Chem. 266, 10583-10588 |
| 26. | Descamps, O., Bilheimer, D., and Herz, J. (1993) J. Biol. Chem. 268, 974-981 |
| 27. | Allan, C. M., Walker, D., Segrest, J. P., and Taylor, J. M. (1995) Genomics 28, 291-300 |
| 28. | Allan, C. M., Walker, D., and Taylor, J. M. (1995) J. Biol. Chem. 270, 26278-26281 |
| 29. | Elshourbagy, N. A., Liao, W. S., Mahley, R. W., and Taylor, J. M. (1985) Proc. Natl. Acad. Sci. U. S. A. 82, 203-207 |
| 30. | Linton, M. F., Gish, R., Hubl, S. T., Bütler, E., Esquivel, C., Bry, W. I., Boyles, J. K., Wardell, M. R., and Young, S. G. (1991) J. Clin. Invest. 88, 270-281 |
| 31. | Taylor, J. M., Simonet, W. S., Bucay, N., Lauer, S. J., and de Silva, H. V. (1991) Curr. Opin. Lipidol. 2, 73-80 |
| 32. | Taylor, J. M., Simonet, W. S., Lauer, S. J., Zhu, G., and Walker, D. (1993) Curr. Opin. Lipidol. 4, 84-89 |
| 33. | Simonet, W. S., Bucay, N., Pitas, R. E., Lauer, S. J., and Taylor, J. M. (1991) J. Biol. Chem. 266, 8651-8654 |
| 34. | Simonet, W. S., Bucay, N., Lauer, S. J., and Taylor, J. M. (1993) J. Biol. Chem. 268, 8221-8229 |
| 35. | Allan, C. M., Taylor, S., and Taylor, J. M. (1997) J. Biol. Chem. 272, 29113-29119 |
| 36. | Reardon, C. A., Lau, Y.-F., Paik, Y.-K., Weisgraber, K. H., Mahley, R. W., and Taylor, J. M. (1986) J. Biol. Chem. 261, 9858-9864 |
| 37. | Gilman, M. (1993) in Current Protocols in Molecular Biology (Ausubel, F. M. , Brent, R. , Kingston, R. E. , Moore, D. D. , Seidman, J. G. , Smith, J. A. , and Struhl, K., eds), Vol. 1 , pp. 4.7.1-4.7.8, John Wiley & Sons, Inc., New York |
| 38. | Heinemeyer, T., Chen, X., Karas, H., Kel, A. E., Kel, O. V., Liebich, I., Meinhardt, T., Reuter, I., Schacherer, F., and Wingender, E. (1999) Nucleic Acids Res. 27, 318-322 |
| 39. | Dang, Q., and Taylor, J. (1996) J. Biol. Chem. 271, 28667-28676 |
| 40. | Basheeruddin, K., Rechtoris, C., and Mazzone, T. (1994) Biochim. Biophys. Acta 1218, 235-241 |
| 41. | Paik, Y.-K., Chang, D. J., Reardon, C. A., Davies, G. E., Mahley, R. W., and Taylor, J. M. (1985) Proc. Natl. Acad. Sci. U. S. A. 82, 3445-3449 |
| 42. | Wu, Z., Bucher, N. L. R., and Farmer, S. R. (1996) Mol. Cell. Biol. 16, 4128-4136 |
| 43. | Wu, Z., Rosen, E. D., Brun, R., Hauser, S., Adelmant, G., Troy, A. E., McKeon, C., Darlington, G. J., and Spiegelman, B. M. (1999) Mol. Cell 3, 151-158 |
| 44. | van Dijk, T. B., Baltus, B., Raaijmakers, J. A. M., Lammers, J.-W. J., Koenderman, L., and de Groot, R. P. (1999) J. Immunol. 163, 2674-2680 |
| 45. | Iwama, A., Zhang, P., Darlington, G. J., McKercher, S. R., Maki, R., and Tenen, D. G. (1998) Nucleic Acids Res. 26, 3034-3043 |
| 46. | Petrovick, M. S., Hiebert, S. W., Friedman, A. D., Hetherington, C. J., Tenen, D. G., and Zhang, D.-E. (1998) Mol. Cell. Biol. 18, 3915-3925 |
| 47. | Valledor, A. F., Borràs, F. E., Cullell-Young, M., and Celada, A. (1998) J. Leukocyte Biol. 63, 405-417 |
| 48. | Juge-Aubry, C., Pernin, A., Favez, T., Burger, A. G., Wahli, W., Meier, C. A., and Desvergne, B. (1997) J. Biol. Chem. 272, 25252-25259 |
| 49. | Desvergne, B., and Wahli, W. (1999) Endocr. Rev. 20, 649-688 |
| 50. | Kapitonov, V., and Jurka, J. (1996) J. Mol. Evol. 42, 59-65 |
| 51. | Okada, N. (1991) Curr. Opin. Genet. & Dev. 1, 498-504 |
| 52. | Raisonnier, A. (1991) J. Mol. Evol. 32, 211-219 |
| 53. | Dang, Q., Walker, D., Taylor, S., Allan, C., Chin, P., Fan, J., and Taylor, J. (1995) J. Biol. Chem. 270, 22577-22585 |
| 54. | Shachter, N. S., Zhu, Y., Walsh, A., Breslow, J. L., and Smith, J. D. (1993) J. Lipid Res. 34, 1699-1707 |
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati What's this?
This article has been cited by other articles:
|
|
 |
|
  M. Kockx, W. Jessup, and L. Kritharides Regulation of Endogenous Apolipoprotein E Secretion by Macrophages Arterioscler. Thromb. Vasc. Biol., June 1, 2008; 28(6): 1060 - 1067. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. D. Atkinson, K. R. Coenen, M. R. Plummer, M. L. Gruen, and A. H. Hasty Macrophage-derived apolipoprotein E ameliorates dyslipidemia and atherosclerosis in obese apolipoprotein E-deficient mice Am J Physiol Endocrinol Metab, February 1, 2008; 294(2): E284 - E290. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. J. Hausman, C. R. Barb, and R. G. Dean Patterns of gene expression in pig adipose tissue: Transforming growth factors, interferons, interleukins, and apolipoproteins J Anim Sci, October 1, 2007; 85(10): 2445 - 2456. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 O. Belbin, J. L. Dunn, Y. Ling, L. Morgan, S. Chappell, H. Beaumont, D. Warden, D. A. Smith, N. Kalsheker, and K. Morgan Regulatory region single nucleotide polymorphisms of the apolipoprotein E gene and the rate of cognitive decline in Alzheimer's disease Hum. Mol. Genet., September 15, 2007; 16(18): 2199 - 2208. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. Lucic, Z. H. Huang, D. S. Gu, M. K. Altenburg, N. Maeda, and T. Mazzone Regulation of macrophage apoE secretion and sterol efflux by the LDL receptor J. Lipid Res., February 1, 2007; 48(2): 366 - 372. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Q. Xu, A. Bernardo, D. Walker, T. Kanegawa, R. W. Mahley, and Y. Huang Profile and Regulation of Apolipoprotein E (ApoE) Expression in the CNS in Mice with Targeting of Green Fluorescent Protein Gene to the ApoE Locus. J. Neurosci., May 10, 2006; 26(19): 4985 - 4994. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Huang Apolipoprotein E and Alzheimer disease Neurology, January 24, 2006; 66(1_suppl_1): S79 - S85. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. Yue, N. Rasouli, G. Ranganathan, P. A. Kern, and T. Mazzone Divergent Effects of Peroxisome Proliferator-activated Receptor {gamma} Agonists and Tumor Necrosis Factor {alpha} on Adipocyte ApoE Expression J. Biol. Chem., November 12, 2004; 279(46): 47626 - 47632. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. Wassef, L. Bernier, J. Davignon, and J. S. Cohn Synthesis and Secretion of ApoC-I and ApoE during Maturation of Human SW872 Liposarcoma Cells J. Nutr., November 1, 2004; 134(11): 2935 - 2941. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
F. M. Harris, I. Tesseur, W. J. Brecht, Q. Xu, K. Mullendorff, S. Chang, T. Wyss-Coray, R. W. Mahley, and Y. Huang Astroglial Regulation of Apolipoprotein E Expression in Neuronal Cells: IMPLICATIONS FOR ALZHEIMER'S DISEASE J. Biol. Chem., January 30, 2004; 279(5): 3862 - 3868. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Joyce, L. Freeman, H. B. Brewer Jr, and S. Santamarina-Fojo Study of ABCA1 Function in Transgenic Mice Arterioscler. Thromb. Vasc. Biol., June 1, 2003; 23(6): 965 - 971. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Fazio, V. R. Babaev, M. E. Burleigh, A. S. Major, A. H. Hasty, and M. F. Linton Physiological expression of macrophage apoE in the artery wall reduces atherosclerosis in severely hyperlipidemic mice J. Lipid Res., October 1, 2002; 43(10): 1602 - 1609. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. A. Mak, B. A. Laffitte, C. Desrumaux, S. B. Joseph, L. K. Curtiss, D. J. Mangelsdorf, P. Tontonoz, and P. A. Edwards Regulated Expression of the Apolipoprotein E/C-I/C-IV/C-II Gene Cluster in Murine and Human Macrophages. A CRITICAL ROLE FOR NUCLEAR LIVER X RECEPTORS alpha AND beta J. Biol. Chem., August 23, 2002; 277(35): 31900 - 31908. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Zhao, L. Yue, D. Gu, and T. Mazzone Regulation of Macrophage ApoE Expression and Processing by Extracellular Matrix J. Biol. Chem., August 9, 2002; 277(33): 29477 - 29483. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. L. Raffai and K. H. Weisgraber Hypomorphic Apolipoprotein E Mice. A NEW MODEL OF CONDITIONAL GENE REPAIR TO EXAMINE APOLIPOPROTEIN E-MEDIATED METABOLISM J. Biol. Chem., March 22, 2002; 277(13): 11064 - 11068. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. A. Laffitte, J. J. Repa, S. B. Joseph, D. C. Wilpitz, H. R. Kast, D. J. Mangelsdorf, and P. Tontonoz LXRs control lipid-inducible expression of the apolipoprotein E gene in macrophages and adipocytes PNAS, January 5, 2001; (2001) 21488798. [Abstract] [Full Text]
|
|
|
|
|
|
E. Salero, R. Perez-Sen, J. Aruga, C. Gimenez, and F. Zafra Transcription Factors Zic1 and Zic2 Bind and Transactivate the Apolipoprotein E Gene Promoter J. Biol. Chem., January 12, 2001; 276(3): 1881 - 1888. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. A. Laffitte, J. J. Repa, S. B. Joseph, D. C. Wilpitz, H. R. Kast, D. J. Mangelsdorf, a |
families was performed with the MacVector suite and the VectorNTI suite
using binding motifs summarized in C (48). No high affinity
binding motifs for either PPAR transcription factor family were
identified.
