|
Originally published In Press as doi:10.1074/jbc.M000621200 on May 26, 2000
J. Biol. Chem., Vol. 275, Issue 41, 31747-31754, October 13, 2000
Activation of Apolipoprotein AI Gene Expression by Protein
Kinase A and Kinase C through Transcription Factor, Sp1*
Xi-Long
Zheng §¶,
Shuji
Matsubara §,
Catherine
Diao §,
Morley D.
Hollenberg , and
Norman C. W.
Wong §**
From the Endocrine Research Group, Departments of
Medicine and § Biochemistry & Molecular
Biology and Pharmacology & Therapeutics, the Faculty of
Medicine, University of Calgary, Calgary, Alberta T2N 4N1, Canada
Received for publication, January 27, 2000, and in revised form, May 9, 2000
 |
ABSTRACT |
Our previous finding that insulin induces
apolipoprotein AI (apoAI) transcription points to the
participation of intracellular signaling. This finding prompted us to
ask whether two classical G-protein-coupled signaling pathways
requiring activated protein kinase A (PKA) or kinase C (PKC) may also
regulate apoAI. Therefore, human hepatoma, Hep G2 cells stably
transfected with pAI.474-CAT, a reporter construct spanning 474 to
7 of apoAI DNA fused to chloramphenicol acetyltransferase (CAT) were
treated with 10 µM forskolin (FSK) or 50 nM phorbol dibutyrate (PDBu) to activate PKA and PKC,
respectively. Results showed that the apoAI promoter activity increased
4-5-fold following 24 h of treatment with either FSK or PDBu.
Induction by either agent was blocked with actinomycin D but not the
protein synthesis inhibitor, cycloheximide. The PKA inhibitor, PKI
14-22 amide, abrogated induction by FSK, 100 µM
8-bromo-cAMP, or 100 ng/ml cholera toxin, but it had no effect on
activation via PKC. Similarly, PDBu induction was attenuated by 2 µM of the PKC inhibitor, GF109203X, but it did not affect FSK activity. Next we used deletional constructs to show that the
actions of FSK and PDBu required the insulin-responsive core element
(IRCE). This motif matched the consensus binding site for the
transcription factor, Sp1. The binding of Sp1 to the IRCE was confirmed
by gel-retardation and supershift analysis. Site-directed mutagenesis
of the IRCE eliminated Sp1 action and induction by FSK or PDBu. Whereas
overexpression of Sp1 enhanced basal and FSK or PDBu induced promoter
activity, transfection of an antisense oligomer against Sp1 mRNA
attenuated both parameters. In summary, activation of PKA or PKC
increases apoAI promoter activity. The activity of both signaling
pathways is mediated by the IRCE, a motif that binds the transcription
factor, Sp1.
 |
INTRODUCTION |
Apolipoprotein AI is the dominant and most important structural
protein component of the antiatherogenic high density lipoprotein (HDL)1 particles (1, 2). This
protein acts as a cofactor that enhances the activity of an enzyme,
lecithin cholesterol acyltransferase. Enhanced activity of this enzyme
augments a normal physiologic process, so called "reverse cholesterol
transport" (RCT), whereby cholesterol is transported from
extra-hepatic cells to the liver for excretion in the form of bile
salts or free cholesterol (3, 4). Increased RCT lowers total body
cholesterol, and therefore, it is not surprising that numerous
epidemiologic studies have shown an inverse relationship between plasma
concentrations of HDL and the risk of coronary heart disease (5-7).
Given the pivotal role of apolipoprotein AI, apoAI in the function of
HDL, and the antiatherogenic properties of these particles, the
identification of the mechanisms that increase levels of apoAI
synthesis and HDL is of great interest and potential therapeutic importance.
Hormonal control of apoAI expression is an attractive way to manipulate
apoAI gene activity, because the simple addition or removal of the
agent will regulate gene activity. Therefore, many laboratories,
including our own, have examined the ability of thyroid hormone,
glucocorticoids, estradiol, androgens, retinoic acid, and insulin to
modulate activity of the gene (8-11). Whereas the action of all of the
preceding hormones except for insulin (9) is triggered by ligand
binding to intracellular receptors that act within the nucleus, insulin
is different in that its activity is mediated by a membrane-bound
tyrosine kinase receptor. This latter finding (9) suggests new avenues
for controlling apoAI gene expression and prompted us to ask whether
other intracellular signal transduction pathways initiated from the
cell membrane might also affect apoAI expression. To investigate this
possibility, we examined the potential role of activated protein kinase
A (PKA) and kinase C (PKC). These kinases play critical roles in
separate classical intracellular signaling pathways regulated by
G-protein-coupled receptors. Unexpectedly, the stimulatory effects of
both pathways are mediated by a single transcription factor that
converges on the insulin-responsive core element, IRCE (9).
 |
EXPERIMENTAL PROCEDURES |
Plasmid Constructs--
Construction of the reporter,
pAI.474-CAT, was described previously (12). The deletional constructs;
pAI.425-, pAI.375-, pAI.325-, and pAI.235-CAT that contained rat apoAI
DNA spanning 425, 375, 325, and 235 to 7 were synthesized
using the parent pAI.474-CAT as template in separate PCR as described
previously (12). The wild-type IRCE ( 411 to 404), GAGGCGGG,
was mutated to TCTTATTT by using a primer containing these transverse
mutations in a PCR. The construct containing an internal deletional of
nucleotides 208 to 193 in the apoAI promoter was created by
digesting pAI.474-CAT with PstI (Amersham Pharmacia
Biotech), which deletes a 46-base pair insert followed by
ligation to circularize the large fragment. Expression plasmids for
Sp1, TR , HNF-3, or HNF-4 were kind gifts from Drs. R. Tjian
(University of California, Stanford, CA), M Phfal (Sidney
Kimmel Cancer Center, La Jolla, CA), R. Costa (University of Illinois,
Chicago, IL) and M. Sladek (University of California, Irvine,
CA), respectively.
Cell Culture--
The human hepatoma cells, Hep G2, were
maintained in Dulbecco's modified Eagle's medium (Life Technologies,
Inc.) supplemented with 10% bovine calf serum (Life Technologies,
Inc.) and penicillin/streptomycin at 37 °C. Cells were cultured
overnight in serum-free medium prior to adding the agent(s) of
interest. The Hep G2 cells have been used previously by ourselves and
others for studying both signaling pathways and apoAI expression (9,
13-15).
Transfection and Treatment of Cells--
Hep G2 cells were
transfected using LipofectAMINE (Life Technologies, Inc.). The amount
of plasmids transfected is indicated in the figure legends.
Transfection efficiency was monitored by cotransfecting 1 µg of the
plasmid, Rous sarcoma virus- -galactosidase (16). Stably
transfected Hep G2 cells were created by cotransfecting pAI.474-CAT
(12) and the plasmid, pRc/CMV2 (Invitrogen), that carried neomycin
resistance, at a ratio of 10:1, respectively. Colonies that grew in
media containing 400 µg/ml Geneticin, G418 were assayed for CAT
activity (9) and used for further studies.
Treatment with Sp1 Antisense and Sense Oligonucleotides--
The
Sp1 antisense (5'-CTGAATATTAGGCATCACTCCAGG-3') and sense
(5'-CCTGGAGTGATGCCTAATATTCAG-3') phosphorothioated
deoxynucleotides were commercially synthesized (IDT, Coraville, IA)
(17, 18). Oligodeoxynucleotides (2 µM) were transfected
into stable Hep G2 cells using LipofectAMINE. Transfected cells were
allowed to recover overnight in standard culture medium and then
exposed to serum-free media containing either 10 µM FSK
or 50 nM PDBu or both for 24 h. CAT activity was
measured in the cytosolic fraction, and Sp1 protein level was assayed
in whole cell extract as described below.
SDS-Polyacrylamide Gel Electrophoresis and Western
Immunoblotting--
Whole cell extract from control cells or those
transfected with Sp1 oligodeoxynucleotides were harvested and lysed in
buffer containing 2 mM orthovanadate, 1% Triton X-100,
0.1% SDS, 5 µg/ml each leupeptin and apoprotin, 1 mg/ml each
benzamidine and bacitracin, 600 mM dithiothreitol,
20 mM Tris (pH 7.4), 300 mM NaCl, 5 mM EDTA, 50 mM NaF, 40 mM sodium
pyrophosphate, 50 mM KH2PO4, and 10 mM sodium molybdate. An aliquot of each sample was
separated by electrophoresis in a 10% SDS-polyacrylamide gel,
transferred to polyvinylidene difluoride membrane (Millipore, Waters
Corp.), and then Sp1 protein was identified using a rabbit anti-human monoclonal antibody (PharMingen), and the signal was located using the
ECL detection system (Amersham Pharmacia Biotech). Western blot
analysis of apoAI protein in lysates from Hep G2 cells or culture media
was assessed using a monoclonal antibody (Calbiochem).
Nuclear Extracts and Electrophoretic Mobility Shift Assays
(EMSA)--
Nuclear extracts from Hep G2 cells were prepared as
described previously (9). Synthetic DNA duplexes spanning 419
to 388, ACTTTGAGGCGGGGATGTGAGT, or the recognition site for TFIID
(Promega) were radiolabeled at the 5'-ends by incubating each strand
separately with [ -32P]ATP and polynucleotide kinase
(Amersham Pharmacia Biotech) prior to annealing. Each binding reaction
of 20 µl contained 10 mM Tris-HCl, 50 mM
NaCl, 0.5 mM EDTA, 0.5 mM
dithiothreitol, 5% glycerol, 1.0 µg of poly(dI-dC), 1 fmol of
radiolabeled probe, and 10 µg of nuclear extract. In competition
studies, 200-fold M excess of unlabeled homologous
( 419 to 388 or Sp1 consensus, ATTCGATCGGGGCGGGGCGAG) or
nonhomologous competitor DNA (mutant IRCE,
ACTTTtcttatttGATGTGAGT, where bold letters indicate
mutated nucleotides) was present in the reaction prior to the addition
of nuclear extracts. Antibodies used in supershift experiments were
added to nuclear extracts at 4 °C for 60 min prior to their use in
EMSA. The antibodies against human Sp1, Sp2, and Sp3 were purchased
from Santa Cruz Biotechnology (Santa Cruz, CA). All reactions were
incubated at room temperature for 20 min and then separated on a 5%
polyacrylamide nondenaturing gel (9). Electrophoresis was performed at
10 volts/cm2 for 3 h at 4 °C. The gel was then
dried and exposed to Kodak XAR-5 film at 80 °C in the presence of
intensifying screens.
RNA Preparation and RT-PCR--
Total RNA from cells was
extracted using TRI®-reagent (Molecular Research Center, Cincinnati,
OH). The RNA was reverse-transcribed with a first strand cDNA
synthesis kit using pd(N)6 primer (Amersham Pharmacia
Biotech) according to manufacturer's protocol. 3 µl of this solution
was amplify using PCR primed with a forward primer 5'CCTGATGAATGCTCATCCG3' and reverse primer 5'AAGCATTCTGCCGACATGG3' homologous to the CAT gene. The RT-PCR signal from CAT mRNA
transcripts was normalized with the signal obtained from -actin
using the primer pair (forward: 5'-CGTGGGCCGCCCTAGGCACCA-3'; reverse:
5'-TTGGCCTTAGGGTTCAGGGGG-3') as described previously (19).
 |
RESULTS |
Activation of Either PKA or PKC Stimulates ApoAI Promoter--
The
following studies were facilitated by the creation of Hep G2 cells that
were stably cotransfected with pAI.474-CAT and a plasmid carrying
neomycin resistance. We isolated 14 colonies that were resistant to
neomycin, but only 6 of these had measurable CAT activity. All 6 colonies were tested for their response following exposure to either 10 µM FSK or 50 nM PDBu to activate PKA and PKC
pathways, respectively. CAT activity in all treated cells increased
4-5-fold in comparison with untreated cells (Fig.
1, A and B, shows
results of one colony). The -fold induction by either agent was similar
regardless of whether the cells had high or low basal CAT activity.
Furthermore, the abundance of apoAI protein in lysates of treated Hep
G2 cells was higher compared with control (Fig. 1A). ApoAI
is a secreted protein. Thus, abundance of the protein in culture media
from cells treated with FSK or PDBu (Fig. 1A, bottom
panel) were higher versus control. These findings show
that both FSK and PDBu increase not only activity of the promoter but
also endogenous expression of the apoAI protein.

View larger version (31K):
[in this window]
[in a new window]
|
Fig. 1.
Induction of apoAI promoter activity by
activating PKA and PKC. A (upper panel) shows an
autoradiograph of CAT activity in stable Hep G2 cells harboring the
pAI.474-CAT construct treated with 10 µM FSK and 50 nM PBDu for 24 h with or without the PKA or PKC
inhibitors: PKI and GF, respectively. A (lower
panel) shows Western blot analysis of apoAI protein in the lysates
and corresponding spent media from stably transfected Hep G2 cells
exposed to either FSK or PDBu as indicated below each lane.
B contains a graph of the mean ± S.E.,
n = 6 repeats of the same studies as in A. C shows a graph of the mean ± S.E., n = 6 separate studies of cells exposed to other PKA activators; 100 µM 8-bromo-cAMP (cAMP) or 100 ng/ml cholera
toxin (CTX) with or without the PKA inhibitor, PKI (2 µM). The ** denotes a significant (p < 0.01) decrease of induction in the presence of the inhibitor plus
activator compared with activator alone following analysis using
analysis of variance.
|
|
The effect of inhibitors and other activators (Fig. 1, A-C)
were tested to confirm further the role of both PKA and PKC pathways in
regulating apoAI activity. 8-Bromo-cAMP and cholera toxin (CTX) are two
additional activators of PKA. CAT activity (Fig. 1C) in stably transfected cells increased 4- and 3.5-fold following 24 h
of exposure to 100 µM 8-bromo-cAMP or 10 ng/ml CTX,
respectively (20). Induction by FSK, 8-bromo-cAMP, or CTX was inhibited
in the presence of 1 µM amount of a PKA inhibitor,
PKI (21, 22). Similarly, apoAI induction by PDBu was blocked in the
presence of 2 µM GFX (Fig. 1B), a specific
inhibitor of PKC (23). The inhibitors acted specifically on their
respective pathways, because PKI did not affect induction by PDBu, and
the actions of FSK were not inhibited by GF (data not shown).
Additionally, promoter activity in cells exposed to both 10 µM FSK plus 50 nM PDBu was no greater than
either one alone (Fig. 1, A and B). Together
these findings show that activation of signaling pathways, mediated by
PKA or PKC, increase apoAI promoter activity.
Rapid Induction of ApoAI Promoter by FSK and PDBu Is through
Transcription Events--
Next we examined the time course associated
with the induction by FSK and PDBu (Fig.
2A). The results showed a
significant increase in CAT activity within 3 h following exposure
to either 10 µM FSK or 50 nM PDBu. The
initial increase was followed by a progressive rise in CAT activity
that reached submaximal levels within 24 h (Fig.
2B).

View larger version (38K):
[in this window]
[in a new window]
|
Fig. 2.
Time course induction of CAT activity by FSK
and PDBu and effect of actinomycin D and cycloheximide. A
shows autoradiographs of CAT activity in stable Hep G2 cells treated
for varying periods of time with 10 µM FSK (upper
panel) or 50 nM PDBu (lower panel).
B shows a graph of the mean ± S.E., n = 5 separate studies at various time points. C shows an
autoradiograph of CAT activity (upper panel) following
induction by either 10 µM FSK or 50 nM PDBu
in the presence or absence of 1 µM actinomycin D
(ACTD) or 10 µM cycloheximide
(CHX), protein synthesis inhibitor. An ethidium bromide gel
reflecting abundance of CAT- and -actin mRNA as measured by
RT-PCR in the same cells appear in the middle and
lower panels, respectively. D shows a graph of
CAT- to -actin mRNA mean ± S.E., n = 5 repeats of the same studies in C.
|
|
The rapid induction of apoAI promoter activity by FSK and PDBu prompted
us to ask whether it required a transcriptional or post-transcriptional
process. The results (Fig. 2, C and D) showed that induction by FSK and PDBu was abrogated by 1 µM
actinomycin D, an inhibitor of transcription. As expected, induction of
CAT activity by either FSK or PDBu was completely abolished in the presence of 10 µM cycloheximide, a protein synthesis
inhibitor, because it blocked translation of CAT-mRNA. Therefore,
to assess activity of pAI.474-CAT in the presence of cycloheximide, we
used RT-PCR to measure the levels of CAT-mRNA. Whereas, actinomycin D blocked the induction of CAT-mRNA by either agent, cycloheximide had no effect on FSK or PDBu induction of CAT-mRNA (Fig.
2C, lower panel, and D). These
observations show that FSK and PDBu increases transcriptional activity
of the apoAI promoter.
Actions of FSK or PDBu Require the IRCE--
The preceding
observation raises the question of how two separate intracellular
signaling pathways enhance the activity of a single promoter? To
address this question, we used transient transfection to assay
deletional constructs containing from 474, 425, 375, 325, and
235 to 7 of the promoter fused to CAT. The results (Fig.
3A) showed that induction by
either FSK or PDBu decreased by 90% following removal of the 425 to
376 segment of the promoter. Furthermore, induction by either FSK or
PDBu was completely abolished upon deletion to nucleotide 235.

View larger version (67K):
[in this window]
[in a new window]
|
Fig. 3.
Induction by FSK and PDBu requires an intact
IRCE. A contains autoradiographs of CAT activity in Hep G2
cells transiently transfected with 2 µg of CAT-reporter containing
474, 425, 375, 325, or 235 to 7 of the apoAI promoter and
treated with 10 µM FSK (left panel) or 50 nM PDBu (right panel). B shows Hep G2
cells transiently transfected with 2 µg of pAI.474-CAT (lanes
1-4) or an identical construct containing a mutant of the IRCE
(lanes 5-8). The letters on top of each lane
represent various treatments: C, control; F, 10 µM FSK; or P, 50 nM, PDBu.
Lane S shows cotransfection with Sp1 cDNA.
|
|
In previous studies (9), we showed that the 425 to 375 segment of
the promoter contained an insulin-responsive core element, IRCE, which
mediated induction by insulin. Therefore, we postulated that the IRCE
may also mediate the actions of FSK or PDBu. To test this hypothesis,
we assayed activity of a construct that was identical to the
pAI.474-CAT, except for transverse mutations of the IRCE. Results (Fig.
3B) showed the expected induction of the parent construct by
FSK and PDBu, but these agents had no effect on activity of the mutated
motif. The studies in this section show that the stimulatory actions of
two separate signaling pathways are mediated by a common cis-acting
element, IRCE.
Sp1 Binds to the IRCE--
To understand further the mechanism by
which FSK and PDBu induces apoAI promoter activity, we want to identify
the transcription factor(s) that interacts with the IRCE. Two clues
that raised the possibility of the motif being a Sp1 binding site are:
1) it was GC-rich, and 2) it matched the consensus recognition site for
the protein (24). Therefore, we used EMSA to measure IRCE binding
activity in nuclear extract from Hep G2 cells following treatment with
FSK or PDBu. Results (Fig. 4A)
showed that binding to the IRCE increased in cells treated with either
agent but that bound to the TFIID motif was the same in control and
treated cells (Fig. 4A, lanes 4-9). The IRCE
binding activity was specific, because formation of the
protein-DNA complexes (Fig. 4B) was completely abolished by including either excess of nonradioactive IRCE or consensus Sp1 binding motif; but the mutant IRCE failed to affect formation of the complexes. There are at least three isoforms belonging
to the Sp family of proteins. To determine the specific isoform bound
to the IRCE, antibodies against Sp1, Sp2, and Sp3 were added to
separate EMSA reactions. Whereas, Sp1 antibody supershifted the
complexes, neither Sp2 nor Sp3 (data not shown) affected their mobility. The preceding studies show that the transcription factor, Sp1, binds to the IRCE.

View larger version (46K):
[in this window]
[in a new window]
|
Fig. 4.
Sp1 binds to IRCE in response to the
treatment with either FSK or PDBu. A shows an autoradiograph
of EMSA of binding activity to radiolabeled IRCE in Hep G2 cells
treated without (lane 1) and with 10 µM FSK
(lane 2) or 50 nM PDBu (lane 3).
TFIID binding activity in the same cells is shown in lanes
5-7, respectively. This binding is specific, because homologous
competitor inhibits (lane 8), but nonspecific DNA does
not displace binding to radiolabeled TFIID oligomer.
B shows an autoradiograph of competition analysis of binding
activity to radiolabeled IRCE (lane 2) in the presence
200-fold M excess of unlabeled IRCE (lane 3),
250-fold M excess of consensus Sp1
recognition motif (lane 4), and 200-fold
M excess of mutant IRCE (lane 5).
C shows an autoradiograph of EMSA analysis of binding
reactions in the presence of antibody against Sp1 (lane 4)
and immunoglobin IgG (lane 5). The arrow pointing
to the right shows position of Sp1 as identified by
supershift (SS) of the complex.
|
|
Sp1 Stimulates ApoAI Promoter and Augments Induction by FSK and
PDBu--
In addition to binding of Sp1 to the IRCE, it should also
exert a functional effect. To examine the functional role of Sp1, we
transfected an expression vector that overexpressed Sp1 into three
(numbers 2, 8, and 10) separate colonies of stable Hep G2 cells.
Enhanced Sp1 expression increased basal apoAI promoter activity in all
three clones by 2-fold (Fig. 5, data for
one clone) compared with cells transfected with empty vector. If Sp1
mediated the effects of FSK and PDBu, then enhanced expression of the
factor should augment apoAI induction by these agents. To test this
hypothesis, we treated stable Hep G2 cells that overexpressed Sp1 with
submaximal doses of FSK (2 µM) or PDBu (10 nM). Either agent alone caused a 2-2.5-fold increase of
CAT activity in stable cells without exogenous Sp1. In contrast, CAT
activity increased 6-7-fold in cells that overexpressed Sp1. These
findings show that Sp1 overexpression increases apoAI promoter activity
and augments its induction by FSK and PDBu.

View larger version (26K):
[in this window]
[in a new window]
|
Fig. 5.
Expression of Sp1 enhances basal, FSK, and
PDBu induction of apoAI activity. A shows an
autoradiograph of CAT activity in stable Hep G2 cells transiently
transfected with a vector that overexpresses Sp1 (lanes 4 and 7) compared with control or an empty vector (lanes
1 and 2). The overexpression of Sp1 alone increased CAT
activity and enhances induction of CAT activity by either PDBu (5 nM, lanes 3 and 5) or FSK (2 µM, lanes 6 and 8). B
shows a graph of relative CAT activity in cells treated with the
indicated conditions at the bottom of each bar
(mean ± S.E., n = 4). The ** denotes a
significant (p < 0.01) increase of PDBu + Sp1
versus either Sp1 or PDBu and FSK + Sp1 versus
either Sp1 or FSK.
|
|
Decreasing Sp1 Attenuates Induction by FSK or PDBu--
If Sp1
plays an important role in mediating the actions of FSK and PDBu, then
the converse of the above approach, i.e. decreasing levels
of Sp1, should attenuate the actions of these agents. To test this
hypothesis, we lowered intracellular levels of Sp1 using an antisense
approach (17, 18). Results showed that in the presence of antisense
Sp1, basal CAT activity in stably transfected cells decreased by 60%
relative to control cells (Fig. 6,
A and B). In contrast, the sense oligomer that
targets the same sequence in Sp1 mRNA had no effect on CAT
activity. Furthermore, induction of apoAI promoter activity by either
FSK or PDBu was abrogated in cells containing Sp1 antisense, but not
sense, oligonucleotides (Fig. 6, C and D).

View larger version (52K):
[in this window]
[in a new window]
|
Fig. 6.
Decreasing Sp1 reduces the actions of FSK and
PDBu. A shows an autoradiograph of CAT activity in stable
cells treated without (lane 1) and with an antisense
(lane 2) or sense (lane 3) Sp1
phosphoribonucleotide. B is a graph of relative CAT activity
in cells treated with conditions noted at the bottom of each
bar (mean ± S.E., n = 4; ** denotes a
significant difference: p < 0.01, between the group of
control cells and the group treated with antisense). C shows
an autoradiograph of CAT activity in the cells exposed to 50 nM PDBu (lanes 2-4) or 10 µM FSK
(lanes 5-7). Cells were pretreated with either an antisense
(lanes 3 and 6) or sense (lanes 4 and
7) Sp1 phosphoribonucleotide as indicated at the
top of each lane. D shows a graph of relative CAT
activity in cells treated with conditions noted at the
bottom of each bar (mean ± S.E.,
n = 4; ** indicates p < 0.01).
E shows a Western blot probed with a Sp1 antibody. The lanes
contain cell lysate from Hep G2 cells treated as per conditions noted
at the top. F is a graph of Sp1 protein in cells
treated with conditions noted at the bottom of each
bar (mean ± S.E., n = 4; ** indicates
p < 0.01).
|
|
Next we used Western blot analysis to confirm that Sp1 antisense
oligonucleotides did indeed reduce levels of the protein. Results (Fig.
6, E and F) showed a 65-68% reduction in the
level of Sp1 protein in cells containing Sp1 antisense but not sense oligonucleotides compared with nontransfected cells. Furthermore, neither FSK nor PDBu had a significant effect on the levels of Sp1
protein in these stably transfected cells. Together these findings show
that Sp1 plays a key role in mediating FSK and PDBu induction of apoAI
promoter activity.
IRCE Acts Independently--
The following studies examine whether
the actions of the IRCE may be linked to adjacent cis-acting elements.
To address this question we performed separate transfections with
vectors that enabled the stable cells to overexpress the thyroid
hormone receptor (TR ), HNF-3 , or HNF-4. These factors
modulate the actions of sites A, B, and C, respectively, in the apoAI
promoter (reviewed in Ref. 8). CAT activity in the transfected cells
was compared with the untreated control. Results (Table
I) showed that FSK and PDBu induction of
CAT activity in the transfected with TR , HNF-3 , or HNF-4 cells
were not different from that in the control cells exposed to these
agents (compare induced values in the "None" column with those in
adjacent three columns). This observation suggests that IRCE-mediated
induction by FSK and PDBu was not affected by adjacent elements A, B,
and C.
View this table:
[in this window]
[in a new window]
|
Table I
Effect of adjacent cis-acting sites on FSK and PDBu induction of the
apoAI promoter
Table I, shows FSK or PDBu induction of CAT activity in stably
transfected Hep G2 cells containing the reporter pAI.474-CAT following
the introduction of no additional plasmid (none) or ones that over
express TR , HNF-3 , or HNF-4, which are known to modulate the
function of sites A, B, and C, respectively. Each value in the table
shows the mean and S.D. for at least three repetitions of each
transfection and treatment group. A schematic diagram showing the
relative location of the sites appears in the map below the table.
|
|
Next we wondered whether the consensus Sp1 motif ( 220 to 211)
located 3' to the IRCE contributed to activity of the promoter. To
investigate this possibility, we created a construct that contained an
internal deletion from 208 to 193. CAT activity in cells transiently transfected with the deletional mutant was activated 5.6 ± 0.8- and 6.5 ± 0.9-fold by FSK or PDBu, respectively,
compared with control. This response is similar to that of the wild
type promoter ("None" column in Table I). Together these findings show that IRCE activity was not influenced by adjacent cis-acting elements A, B, and C. In addition, removal of the Sp1 site 3' to the
IRCE played an insignificant role in the FSK and PDBu induction of
apoAI promoter activity.
 |
DISCUSSION |
The pivotal role of apoAI in HDL particles, and their function in
mediating RCT (3, 4), underlies our interest to investigate the
expression of this gene. Increased abundance of apoAI enhances RCT,
thereby lowering the levels of cholesterol in the body. Decreased levels of cholesterol reduce the risk of cardiovascular disease. Therefore, a better understanding of the mechanism(s) underlying the
induction of the apoAI gene will help us find new ways to decrease
heart disease.
Our previous studies (9) show that insulin stimulates apoAI gene
transcription. Insulin regulation of the apoAI promoter differs from
previous reports that examine hormonal regulation of this gene. Whereas
most reports document the regulation of apoAI by a family of small
lipophilic ligands including thyroid/steroid hormones, which bind to a
nuclear receptor with transcriptional activity (reviewed in (8)), we
recently showed that insulin, a peptide hormone, also activates the
gene. This finding prompted us to ask whether other intracellular
signaling pathways may also regulate apoAI expression. Therefore, we
examined the potential involvement of two classical signaling pathways
mediated by PKA and PKC.
To perform these studies, we created Hep G2 cell stably transfected
with the apoAI reporter, pAI.474.CAT. CAT activity in these cells
increased up to 4-5-fold following treatment with FSK or PDBu to
activate PKA and PKC, respectively. In the same cells, endogenous
expression of apoAI protein was noted in both lysates and media (Fig.
1). That activation of PKA stimulates apoAI promoter activity is
supported by four independent lines of evidence (Fig. 1): 1) FSK, a
direct activator of adenylyl cyclase, raises cAMP levels thereby
activating PKA and enhances activity of the apoAI promoter; 2) CTX, an
irreversible activator of G s, also increases cAMP and
stimulates activity of the promoter and parallels the actions of FSK;
3) 8-bromo-cAMP, a direct activator of PKA via its binding to the
enzyme's regulatory subunit, like cAMP, increases apoAI activity and
mimics the actions of FSK or CTX; and 4) the PKA inhibitor, PKI (21,
22), reverses the effects of all three activators. PDBu specifically
activates PKC by binding directly to this enzyme. The ability of PDBu
to stimulate promoter activity was blocked by the PKC inhibitor,
GF109203X, that unlike staurosporin (often used for PKC inhibition)
does not affect tyrosine kinase activity. Moreover, it is important that the PKC inhibitor, GF109203X (23), did not diminish the stimulatory effect of activated PKA, nor does the PKA inhibitor, PKI,
affect stimulation of promoter activity by PKC activation. Additionally, the combined action of both FSK and PDBu was no greater
than either one alone. These observations clearly show that apoAI
promoter activity and endogenous expression of the protein are
stimulated by activated PKA or PKC. Furthermore, the specificity of the
inhibitors for their respective kinases suggests that these signaling
pathways operate in parallel to up-regulate apoAI gene expression.
Although the preceding results show that PKA and PKC increase apoAI
gene activity, the mechanism(s) underlying this induction remains
unknown. A variety of mechanism(s) may explain the stimulatory actions
of PKA and PKC. To address this question, we used actinomycin D or
cycloheximide to block gene transcription and translation, respectively, in the stable Hep G2 cells. The outcome of these studies
show that activated PKA or PKC enhances apoAI gene transcription. Therefore, the apoAI promoter should contain cis-acting element(s) that
mediate the action of PKA or PKC.
To identify the motif(s) that mediated the stimulatory actions of PKA
or PKC, we measured CAT activity in deletional mutants of the promoter
following exposure to FSK and PDBu, respectively. Results showed that a
critical element was situated between nucleotides 425 and 376 of
the gene. Our previous studies showed that the same fragment contained
the IRCE, a motif that mediated the stimulatory actions of insulin (9).
Therefore, we postulated that the actions of either or both FSK and
PDBu were mediated by the IRCE. This hypothesis was tested using a
reporter containing a mutated IRCE. Unexpectedly, neither FSK nor PDBu
stimulated activity of the mutant construct. This finding suggests that
the actions of both agents were mediated by a single cis-acting
element, the IRCE.
The pivotal role of the IRCE in mediating PKA and PKC activation of the
apoAI expression prompted us to identify the transcription factor(s)
that binds to this motif. There were two clues that helped us find a
potential candidate that interacted with the IRCE. The first one being
that the IRCE was GC-rich, and second, when the motif was scanned using
TFSEARCH program (25), it was identical to the recognition sequence
bound by the transcription factor, Sp1 (26, 27). To demonstrate the
binding of Sp1 to the IRCE, we performed EMSA analysis using nuclear
extract from Hep G2 cells. Results show that IRCE binding activity
increases in cells treated with FSK or PDBu. This binding is specific,
because formation of protein-IRCE complex is inhibited in the presence of excess unlabeled IRCE or authentic Sp1 recognition site but not IRCE
oligomer containing the mutated motif. That the IRCE binding activity
is indeed Sp1 comes from supershift studies. Whereas, Sp1 antibody
supershifted the protein-IRCE complex, neither Sp2 nor Sp3 antibody
affected mobility of the band. The role of Sp1 was examined by altering
levels of the protein in Hep G2 cells. Overexpression of Sp1 in stable
Hep G2 cells augmented the induction of apoAI promoter activity in the
presence of FSK or PDBu. Transfection of a Sp1 antisense
oligonucleotide into Hep G2 cells to reduce Sp1 protein caused a
decrease in the basal activity of the promoter and blocked its
induction by either FSK or PDBu. These studies show that Sp1 binds to
the IRCE, and this transcription factor mediates apoAI promoter
activation by two separate signaling pathways requiring either PKA or
PKC.
Over the last few years, several publications have described the
participation of Sp1 in the PKA or PKC regulation of specific genes.
For example, in doxorubicin-resistant HL-60 leukemia cells, activated
PKA phosphorylated Sp1 and enhanced its ability to bind DNA
(28). In addition, resistance of breast carcinoma cells to multiple
drugs caused by PKA induction of the MDR1 gene also required Sp1 (29).
Similarly, Sp1 also mediated the actions of PKC on specific genes. The
stimulation of Sp1-mediated vascular permeability factor/vascular
endothelial growth factor transcription required an interaction between
Sp1 and PKC- (30). More recently, Sp1 was shown to be
essential in the 12-O-tetradecanoylphorbol-13-acetate stimulation of human lysosomal acid lipase gene activity in monocytes (31). The preceding reports clearly set a precedent for the participation of Sp1 in the actions of either PKA or PKC. Moreover, these findings help us identify the novel aspects of our results. First, in the case of the apoAI gene, Sp1 is required for the actions
of both PKA and PKC pathways. We are unaware of any other models where
induction of gene activity by these separate signaling pathways is
mediated by the transcription factor, Sp1. Second, the ability of Sp1
to mediate actions of both PKA and PKC may be limited to liver cells,
because other reported studies were done in extra-hepatic models.
Together these novel aspects of our results suggest an increasing role
for Sp1 in signal transduction.
Sp1 is not the only transcription factor that can be regulated by both
PKA and PKC signaling pathways. Previous studies showed that the
transcription factor, AP-2, can also be activated by PKA and PKC
following exposure to FSK or phorbol ester, respectively (32, 33).
These findings have largely challenged the classical signaling model in
regard to specificity and interaction of intracellular signaling pathways.
The ability of Sp1 to mediate the actions of PKA and PKC raises the
possibility that this protein may have consensus amino acid motifs
recognized by both kinases. Therefore, we scanned the amino acid
sequence of Sp1 using the PhosphoBase program (34) for putative
phosphorylation motifs. This search revealed several potential
phosphorylation sites for a variety of protein kinases including cAMP-
or cGMP-dependent kinase, PKC, mitogen-activated protein kinase (Erk), casein kinase II, and many others. In
support of this idea, recent studies suggest that Sp1 is phosphorylated by Erk2 (35), PKC- (30), casein kinase (36), or PKA (29). The
phosphorylation modification of Sp1 protein may lead to either an
increase (e.g. Erk2) or decrease (e.g. casein
kinase II) in its DNA binding activity. Given the presence of PKA and
PKC target sites in Sp1, we speculate that the stimulatory effects of
these kinases on apoAI promoter may require phosphorylation of Sp1. This topic will be the focus of future studies.
There is increasing evidence to show that GC-rich sequences can bind to
more than one member of the Sp family (26, 27). The binding sequence
for Sp1 is highly homologous to the one for Sp3. In the case of the
IRCE, our studies show that it binds to only Sp1. Within the context of
the rat apoAI promoter, the IRCE is not the only motif that interacts
with Sp1. Previous studies (36) in the human apoAI promoter show a Sp1
binding site is located proximal to the IRCE. The corresponding motif
in the rat promoter spans 220 and 211 of the gene. However, this
latter site does not appear to mediate the actions of either PKA or PKC because deletion or mutation of the IRCE abolished the enhancing actions of Sp1 and a deletional mutant lacking the proximal Sp1 site
retained its response to FSK and PDBu. The question of why this 3' Sp1
site does not function in the same manner as the IRCE is beyond the
scope of this report.
It is of interest that hormones such as adrenalin and glucagon, which
activate hepatocyte adenylyl cyclase, and therefore potentially augment
apoAI gene transcription, are traditionally thought of as agents that
are "counter-regulatory" for insulin action. The implications of
our findings are that in the case of apoAI, the effects of insulin
would be in parallel or additive with the effects of glucagon and
adrenalin. Similarly, by activating G q, hormones such as
noradrenalin ( 1-adrenoreceptor) and angiotensin-II (AT1 receptor) would activate PKC and add yet a further
boost to apoAI expression. It is still an open question how the
signaling pathways initiated from G-protein-coupled receptors and
tyrosine kinase receptors and other hormones by binding intracellular
receptors modulate apoAI gene expression in hepatocytes under in
vivo physiological conditions.
In summary, our studies show that activation of PKA and PKC in the
human hepatoma cells, Hep G2 increases apoAI promoter activity and the
actions of these signaling pathways require the transcription factor,
Sp1. Sp1 induces apoAI promoter activity through its binding to the
IRCE in the apoAI promoter. These findings are not only novel for apoAI
regulation, but also for the transcription factor Sp1 in regards to its
pivotal role in mediating the actions of both the PKA and PKC.
 |
FOOTNOTES |
*
The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
¶
Recipient of a fellowship award from the Heart and Stroke
Foundation of Canada.
**
Recipient of scientist awards from the Medical Research Council and
Alberta Heritage Foundation for Medical Research. To whom correspondence should be addressed: Depts. of Medicine and Biochemistry and Molecular Biology, Faculty of Medicine, University of Calgary, Health Sciences Center, 3330 Hospital Dr. NW, Calgary, Alberta T2N
4N1, Canada. Tel.: 403-220-5212; Fax: 403-270-0979; E-mail: ncwwong@acs.ucalgary.ca.
Published, JBC Papers in Press, May 26, 2000, DOI 10.1074/jbc.M000621200
 |
ABBREVIATIONS |
The abbreviations used are:
HDL, high density
lipoprotein;
RCT, reverse cholesterol transport;
PKA, protein kinase A;
PKC, protein kinase C;
IRCE, insulin-responsive core element;
CAT, chloramphenicol acetyltransferase;
PDBu, phorbol dibutyrate;
RT-PCR, reverse transcription polymerase chain reaction;
FSK, forskolin;
EMSA, electrophoretic mobility shift assay;
CTX, cholera toxin;
PKI, PKA
inhibitor.
 |
REFERENCES |
| 1.
|
Andersson, L. O.
(1997)
Curr. Opin. Lipidol.
8,
225-228
|
| 2.
|
Brouillette, C. G.,
and Anantharamaiah, G. M.
(1995)
Biochim. Biophys. Acta
1256,
103-129
|
| 3.
|
Miller, N. E.,
La Ville, A.,
and Crook, D.
(1985)
Nature
314,
109-111
|
| 4.
|
Barter, P. J.,
and Rye, K. A.
(1996)
Curr. Opin. Lipidol.
7,
82-87
|
| 5.
|
Barter, P. J.,
and Rye, K. A.
(1996)
Atherosclerosis
121,
1-12
|
| 6.
|
De Backer, G.,
De Bacquer, D.,
and Kornitzer, M.
(1998)
Atherosclerosis
137 (suppl.),
S1-S6
|
| 7.
|
Luoma, P. V.
(1997)
Pharmacol. Toxicol.
81,
57-64
|
| 8.
|
Hargrove, G. M.,
Junco, A.,
and Wong, N. C.
(1999)
J. Mol. Endocrinol.
22,
103-111
|
| 9.
|
Murao, K.,
Wada, Y.,
Nakamura, T.,
Taylor, A. H.,
Mooradian, A. D.,
and Wong, N. C.
(1998)
J. Biol. Chem.
273,
18959-18965
|
| 10.
|
Ness, G. C.,
Lopez, D.,
Chambers, C. M.,
Newsome, W. P.,
Cornelius, P.,
Long, C. A.,
and Harwood, H. J., Jr.
(1998)
Biochem. Pharmacol.
56,
121-129
|
| 11.
|
Soyal, S. M.,
Seelos, C.,
Lin-Lee, Y. C.,
Sanders, S.,
Gotto, A. M., Jr.,
Hachey, D. L.,
and Patsch, W.
(1995)
J. Biol. Chem.
270,
3996-4004
|
| 12.
|
Romney, J. S.,
Chan, J.,
Carr, F. E.,
Mooradian, A. D.,
and Wong, N. C.
(1992)
Mol. Endocrinol.
6,
943-950
|
| 13.
|
Sakai, T.,
Jin, F.,
Kamanna, V. S.,
and Kashyap, M. L.
(2000)
Atherosclerosis
149,
43-49
|
| 14.
|
Wu, J. Y.,
Wu, Y.,
Reaves, S. K.,
Wang, Y. R.,
Lei, P. P.,
and Lei, K. Y.
(1999)
Am. J. Physiol
277,
C537-C544
|
| 15.
|
Herbomel, P.,
Bourachot, B.,
and Yaniv, M.
(1984)
Cell
39,
653-662
|
| 16.
|
Hata, Y.,
Duh, E.,
Zhang, K.,
Robinson, G. S.,
and Aiello, L. P.
(1998)
J. Biol. Chem.
273,
19294-19303
|
| 17.
|
Yoshida, S.,
Ono, M.,
Shono, T.,
Izumi, H.,
Ishibashi, T.,
Suzuki, H.,
and Kuwano, M.
(1997)
Mol. Cell. Biol.
17,
4015-4023
|
| 18.
|
Zheng, X. L.,
Gui, Y.,
Sharkey, K. A.,
and Hollenberg, M. D.
(1999)
J. Pharmacol. Exp. Ther.
289,
632-640
|
| 19.
|
Kahn, R. A.,
and Gilman, A. G.
(1984)
J. Biol. Chem.
259,
6228-6234
|
| 20.
|
Eichholtz, T.,
de Bont, D. B.,
de Widt, J.,
Liskamp, R. M.,
and Ploegh, H. L.
(1993)
J. Biol. Chem.
268,
1982-1986
|
| 21.
|
Glass, D. B.,
Cheng, H. C.,
Mende-Mueller, L.,
Reed, J.,
and Walsh, D. A.
(1989)
J. Biol. Chem.
264,
8802-8810
|
| 22.
|
Toullec, D.,
Pianetti, P.,
Coste, H.,
Bellevergue, P.,
Grand-Perret, T.,
Ajakane, M.,
Baudet, V.,
Boissin, P.,
Boursier, E.,
Loriolle, F.,
Duhamel, L.,
Charon, D.,
and Kirilovsky, J.
(1991)
J. Biol. Chem.
266,
15771-15781
|
| 23.
|
Courey, A. J.,
and Tjian, R.
(1988)
Cell
55,
887-898
|
| 24.
|
Heinemeyer, T.,
Chen, X.,
Karas, H.,
Kel, A. E.,
Kel, O. V.,
Liebich, I.,
Meinhardt, T.,
Reuter, I.,
Schacherer, F.,
and Wingender, E.
(1999)
Nucleic Acids Res.
27,
318-322
|
| 25.
|
Cook, T.,
Gebelein, B.,
and Urrutia, R.
(1999)
Ann. N. Y. Acad. Sci.
880,
94-102
|
| 26.
|
Philipsen, S.,
and Suske, G.
(1999)
Nucleic Acids Res.
27,
2991-3000
|
| 27.
|
Ungefroren, H.,
Gellersen, B.,
Krull, N. B.,
and Kalthoff, H.
(1998)
J. Biol. Chem.
273,
29230-29240
|
| 28.
|
Rohlff, C.,
and Glazer, R. I.
(1998)
Int. J. Oncol.
12,
383-386
|
| 29.
|
Pal, S.,
Claffey, K. P.,
Cohen, H. T.,
and Mukhopadhyay, D.
(1998)
J. Biol. Chem.
273,
26277-26280
|
| 30.
|
Ries, S.,
Buchler, C.,
Langmann, T.,
Fehringer, P.,
Aslanidis, C.,
and Schmitz, G.
(1998)
J. Lipid Res.
39,
2125-2134
|
| 31.
|
Imagawa, M.,
Chiu, R.,
and Karin, M.
(1987)
Cell
51,
251-260
|
| 32.
|
Luscher, B.,
Mitchell, P. J.,
Williams, T.,
and Tjian, R.
(1989)
Genes Dev.
3,
1507-1517
|
| 33.
|
Kreegipuu, A.,
Blom, N.,
and Brunak, S.
(1999)
Nucleic Acids Res.
27,
237-239
|
| 34.
|
Merchant, J. L.,
Du, M.,
and Todisco, A.
(1999)
Biochem. Biophys. Res. Commun.
254,
454-461
|
| 35.
|
Armstrong, S. A.,
Barry, D. A.,
Leggett, R. W.,
and Mueller, C. R.
(1997)
J. Biol. Chem.
272,
13489-13495
|
| 36.
|
Kilbourne, E. J.,
Widom, R.,
Harnisch, D. C.,
Malik, S.,
and Karathanasis, S. K.
(1995)
J. Biol. Chem.
270,
7004-7010
|
Copyright © 2000 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
S.-W. M. Koh, K. Chandrasekara, C. J. Abbondandolo, T. J. Coll, and A. R. Rutzen
VIP and VIP Gene Silencing Modulation of Differentiation Marker N-Cadherin and Cell Shape of Corneal Endothelium in Human Corneas Ex Vivo
Invest. Ophthalmol. Vis. Sci.,
August 1, 2008;
49(8):
3491 - 3498.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
X. Deng, C. Yellaturu, L. Cagen, H. G. Wilcox, E. A. Park, R. Raghow, and M. B. Elam
Expression of the Rat Sterol Regulatory Element-binding Protein-1c Gene in Response to Insulin Is Mediated by Increased Transactivating Capacity of Specificity Protein 1 (Sp1)
J. Biol. Chem.,
June 15, 2007;
282(24):
17517 - 17529.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
X.-L. Zheng and N. C W Wong
Cyclosporin A inhibits apolipoprotein AI gene expression.
J. Mol. Endocrinol.,
October 1, 2006;
37(2):
367 - 373.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. D. Mooradian, M. J. Haas, and N. C. W. Wong
The Effect of Select Nutrients on Serum High-Density Lipoprotein Cholesterol and Apolipoprotein A-I Levels
Endocr. Rev.,
February 1, 2006;
27(1):
2 - 16.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Matlhagela, M. Borsick, T. Rajkhowa, and M. Taub
Identification of a Prostaglandin-responsive Element in the Na,K-ATPase {beta}1 Promoter That Is Regulated by cAMP and Ca2+: EVIDENCE FOR AN INTERACTIVE ROLE OF cAMP REGULATORY ELEMENT-BINDING PROTEIN AND Sp1
J. Biol. Chem.,
January 7, 2005;
280(1):
334 - 346.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
O. L. Miakotina and J. M. Snyder
Signal transduction events involved in TPA downregulation of SP-A gene expression
Am J Physiol Lung Cell Mol Physiol,
June 1, 2004;
286(6):
L1210 - L1219.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|