HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

J. Biol. Chem., Vol. 275, Issue 41, 32003-32010, October 13, 2000

This Article Abstract Full Text (PDF) All Versions of this Article: 275/41/32003    most recent M004646200v1 Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Liang, J.-s. Articles by Ginsberg, H. N. Search for Related Content PubMed PubMed Citation Articles by Liang, J.-s. Articles by Ginsberg, H. N. Social Bookmarking                      What's this?

The Amino-terminal Domain of Apolipoprotein B Does Not Undergo Retrograde Translocation from the Endoplasmic Reticulum to the Cytosol

PROTEASOMAL DEGRADATION OF NASCENT APOLIPOPROTEIN B BEGINS AT THE CARBOXYL TERMINUS OF THE PROTEIN, WHILE APOLIPOPROTEIN B IS STILL IN ITS ORIGINAL TRANSLOCON^*

Jun-shan Liang^§, Xinye Wu^¶, Edward A. Fisher^¶, and Henry N. Ginsberg

From the  Department of Medicine, College of Physicians and Surgeons, Columbia University, New York, New York 10032 and the ^¶ Laboratory of Lipoprotein Research, Cardiovascular Institute, Mount Sinai School of Medicine, New York, New York 10029

Received for publication, May 30, 2000, and in revised form, July 27, 2000

	ABSTRACT

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS AND DISCUSSION CONCLUSIONS REFERENCES

We studied the sequential topology of the NH₂ and COOH termini of apoB during translocation by expressing, in Chinese hamster ovary (CHO) and HepG2 cells, an apoB42 construct with c-Myc and hemagglutinin (HA) tags at 2 and 41% (relative to apoB100) of its amino acid sequence. We conducted similar studies using monoclonal antibodies against the NH₂ and COOH termini of apoB100 in HepG2 cells. After radiolabeling, microsomes were immunoisolated from transfected CHO cells using anti-c-Myc or anti-HA antibodies. Throughout a 60-min chase in the presence of N-acetyl-leucyl-norleucinal, more than 90% of microsomes were isolated by anti-HA antibodies, whereas less than 10% were isolated by anti-c-Myc antibodies. Proteinase K digestion of total microsomes consistently generated two fragments (~70 and ~120 kDa) of apoB42 containing the NH₂ terminus throughout the chase; no fragments containing the COOH terminus were detected. Immunofluorescent studies of transfected CHO cells were consistent with results from the labeling studies. Essentially identical results were obtained from pulse-chase studies in both native and apoB42-transfected HepG2 cells. The present studies support a model in which, in the absence of adequate core lipid synthesis, there is partial translocation of apoB leading to cytosolic exposure, ubiquitination, and proteasomal degradation directly from the original translocation channel.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS AND DISCUSSION CONCLUSIONS REFERENCES

The endoplasmic reticulum (ER)¹ is the site of synthesis and maturation of proteins destined for secretion (1-3). It has also been recognized that the ER is able to target misfolded or otherwise defective proteins for degradation. This degradation was thought to occur in the ER. Studies in the past few years have, however, provided many examples of "ER degradation" that actually occur via the cytosolic ubiquitin-proteasome degradation pathway (3-7). Thus, a variety of proteins, which were believed to undergo ER degradation, have been identified as substrates for the cytosolic proteasome, including mutant carboxypeptidase ysc Y (CPY*) (8), -antitrypsin variant piZ (9), and the T cell receptor  subunit (10). The precise mechanism whereby these ER proteins make their way to the cytosolic proteasome has remained elusive. A post-translational retrograde translocation model, in which unfolded or misfolded proteins move from the ER lumen into the cytosol, has been proposed (4, 7, 12). The Sec61p translocation complex (or translocon) (6, 13), Ubc6p (14), a ubiquitin-conjugating enzyme that catalyzes the covalent attachment of ubiquitin to specific proteolytic substrates, and Cue1p (15), an ER membrane protein, have each been reported to participate in this retrograde translocation pathway.

Apolipoprotein B100 (apoB) is the major protein of atherogenic very low density and low density lipoproteins (16). Extensive studies of cultured primary hepatocyte and hepatoma cell lines have established that significant control over apoB secretion can be achieved at co- and post-translational levels by degradation of newly synthesized apoB and that this presecretory degradation is regulated by lipid availability and microsomal triglyceride transfer protein (MTP) activity (17-18). We and others (19-24) have shown that the degradation of apoB is mediated mainly by the cytosolic ubiquitin-proteasome pathway; apoB is ubiquitinated, and intracellular degradation of apoB can be prevented by various proteasomal inhibitors. How newly synthesized apoB becomes a substrate of the cytosolic ubiquitin-proteasome pathway remains unclear and controversial.

Evidence has accumulated from several laboratories indicating that the translocation of nascent apoB across the ER membrane is inefficient and incomplete in the absence of sufficient quantities of its core lipid ligands, triglyceride and cholesterol ester. This results in a bitopic orientation of apoB in which some domains are exposed to the ER lumen and some to the cytosol (24-30). It is in this bitopic orientation that ubiquitination and proteasomal degradation can begin co-translationally (20-21) (Fig. 1A, Case 1). However, other studies suggest that apoB undergoes complete and efficient co-translational translocation into the ER lumen without exposure of any domains to the cytosol (22, 31-34). The latter model suggests that either only fully translocated, full-length apoB is targeted for post-translational retrograde translocation, ubiquitination, and proteasomal degradation (Fig. 1A, Case 3) or that the NH₂ terminus of apoB can undergo ubiquitination and proteasomal degradation before translation of the COOH terminus is completed (Fig. 1A, Case 2). In Case 2, retrograde translocation of the NH₂ terminus would have to occur via a second nearby translocon. In either scenario, it would be very likely, or absolutely necessary, that exposure of the NH₂ terminus would occur post- (Case 3) or co-translationally (Case 2).

View larger version (36K): [in this window] [in a new window]   Fig. 1.   A, models of proteasomal degradation of nascent apoB. A model of co-translational degradation of apoB suggests that the translocation of nascent apoB across the ER membrane is inefficient and incomplete in the absence of sufficient quantities of its core lipid ligands, resulting in a bitopic orientation of apoB in which some domains are exposed to the cytosol (20-21, 24-30). It is in this bitopic orientation that ubiquitination and proteasomal degradation can begin co-translationally (Case 1). A model of post-translational degradation of apoB suggests that apoB undergoes complete and efficient co-translational translocation into the ER lumen without exposure of any domains to the cytosol (22, 31-34). The latter model suggests that either only fully translocated, full-length apoB is targeted for post-translational retrograde translocation, ubiquitination, and proteasomal degradation (Case 3) or that the NH2 terminus of apoB can undergo ubiquitination and proteasomal degradation before translation of the COOH terminus is completed (Case 2). B, sites of immunoreactivity of monoclonal antibodies (Mab). An apoB42 cDNA with c-Myc and HA sequences inserted at 2 and 41% of the amino acid sequences, respectively, was used to transfect CHO and HepG2 cells. Additionally, we studied the translocation of full-length apoB using anti-human apoB monoclonal antibodies 1D1 and 5E11, directed against the of NH2 and COOH termini of apoB as indicated.

In order to address this basic topological question, we determined the dynamic cytosolic exposure of NH₂ and COOH termini of a COOH-truncated apoB during translation and translocation, using a double epitope-tagged apoB42 construct with c-Myc and HA tags at 2 and 41% of the amino acid sequences, respectively (Fig. 1B). Additionally, we studied the translocation of full-length apoB using anti-human apoB monoclonal antibodies 1D1 and 5E11, which are directed against the of NH₂ and COOH termini of apoB (Fig. 1B). By using either system, we obtained ample evidence for cytosolic exposure of the COOH-terminal domain, but we never observed significant cytosolic exposure of the NH₂-terminal domain. Thus, our results support a model where partial translocation of apoB is followed by proteasomal degradation of the partially translocated protein. Our results do not support a model in which nascent apoB is fully translocated into the ER lumen before undergoing retrograde translocation to the cytosol or one in which forward and retrograde translocation occur simultaneously in parallel translocons.

	MATERIALS AND METHODS

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS AND DISCUSSION CONCLUSIONS REFERENCES

Reagents-- N-Acetyl-leucyl-norleucinal (ALLN), OA, Triton X-100, and protein A-Sepharose CL 4B were purchased from Sigma. ALLN was used at a concentration of 100 µM; OA was used at a concentration of 0.4 mM; Triton X-100 was used at 0.5%, and protein A-Sepharose CL 4B was used at 0.2%. Sheep anti-human apoB polyclonal antibody, mouse anti-HA, and mouse anti-c-Myc monoclonal antibodies were purchased from Roche Molecular Biochemicals. Mouse anti-human monoclonal antibodies 1D1 and 5E11 were kindly provided by Ross Milne of the Ottawa Heart Institute. LipofectAMINE was purchased from Life Technologies, Inc. L-[4,5-³H]Leucine was purchased from Amersham Pharmacia Biotech with a specific activity of 147 Ci/mmol and used at a concentration of 150 µCi/ml. [³⁵S]Methionine/cysteine was used at a concentration of 100 µCi/ml and was purchased from PerkinElmer Life Sciences as EXPRESS^TM Protein Labeling Mix (specific activity >1000 Ci/mmol).

Growth of Cells-- HepG2 cells and CHO cells obtained from the American Type Culture Collection were grown as described previously (26). Briefly, cells were maintained at 37 °C, 5% CO₂ in 0.1 mM nonessential amino acids, 1 mM sodium pyruvate, 100 units/ml penicillin, 100 µg/ml streptomycin, and 10% fetal bovine serum. The medium was changed every 3 days, and experiments were started after the cells reached 70-90% confluence. During the experiments, cells were maintained at 37 °C, 5% CO₂ in serum-free minimum Eagle's medium containing 1.5% bovine serum albumin with the indicated additions or treatments.

Construction of Double Epitope-tagged ApoB42-- The original apoB42 cDNA was provided by Dr. Zemin Yao. Two complementary strands of DNA coding for a c-Myc epitope tag (5'paagaggtagaacaaaaacttatttctgaagaagatctgtgcctga3' and 5'pttcaggcacagatcttcttcagaaataagtttttgttctacctct3'), flanked by two EcoNI sites at each end, and two complementary strands of the DNA coding sequence for an HA tag (5'cgattacccatacgacgtcccagactacgctat3' and 5'cgatagcgtagtctgggacgtcgtatgggtaat3'), flanked by two ClaI sites at each end, were purchased from Life Technologies, Inc. The adaptor duplex of cDNA coding for c-Myc epitope tag was first ligated into the apoB42 cDNA which was previously digested with EcoNI, and apoB42 clones with a c-Myc tag (mycB42) were isolated. Double epitope-tagged B42 clones were prepared by ligation of the adaptor duplex of cDNA coding for HA tag into a mycB42 cDNA which was previously digested with ClaI. Efficient expression of Myc/HA B42 fusion protein was confirmed by Western blotting and immunoprecipitation analysis.

Isolation and Fractionation of Microsomes-- Cell transfection was carried out, and microsomes were prepared according to methods described previously (26). Briefly, 36 h after transfection, cells were labeled with L-[4,5-³H]leucine or [³⁵S]methionine for 15 min, and cells were chased for 0-60 min in the presence of ALLN (40 µg/ml) to prevent proteasomal degradation of apoB. For puromycin treatment experiments, cells were pretreated with puromycin (10 µM) for 10 min before labeling. Microsomes were isolated by centrifugation at each chase time point as described (26). Microsomes were further fractionated by incubation with either anti-human apoB amino terminus antibodies 1D1/anti-c-Myc or anti-carboxyl terminus antibodies 5E11/anti-HA at 4 °C for 2 h. The microsome-apoB-antibody complexes were precipitated by an additional 2-h incubation with protein G-Sepharose CL-4B. The immunoaffinity-isolated microsomes were finally analyzed by immunoprecipitation with sheep anti-human apoB polyclonal antibodies.

Microsome Digestion with Proteinase K (26)-- Protease sensitivity of microsomal apoB was assessed as described previously (26). Briefly, the microsomes were incubated with or without proteinase K (PK) (50 µg/ml) or Triton X-100 (0.5%) for 30 min on ice. After digestion, phenylmethylsulfonyl fluoride (3 mM) was added, and the samples were incubated for another 5 min on ice. The samples were then recentrifuged, and the microsome pellets were dissolved in lysis buffer and analyzed by immunoprecipitation with either anti-human apoB amino terminus antibodies 1D1/anti-c-Myc or carboxyl terminus antibodies 5E11/anti-HA.

Immunoprecipitation-- Immunoprecipitation of apoB in medium and cell lysates was carried out as described (26). Briefly, after the samples were incubated on a shaker for 10 h at 4 °C with an excess amount of anti-apoB antiserum, the immune complex was precipitated by an additional 3-h incubation with protein A-Sepharose CL-4B. The samples were analyzed on either 3-15 or 4% SDS-polyacrylamide gels. Immunoprecipitates were subjected to SDS-polyacrylamide gel electrophoresis and further analyzed by densitometry using a Molecular Dynamics densitometer. Data were expressed as relative densitometric units.

Immunofluorescence Studies-- Immunofluorescent detection of apoB was described in our previous reports (20, 24). Briefly, CHO cells were transfected with the plasmid for double epitope-tagged apoB42 and were grown on collagen-coated coverslips in the presence or absence of ALLN. The cells were fixed using 3% paraformaldehyde in 1× phosphate-buffered saline. Fixed cells were permeabilized with 0.1% Triton and incubated with anti-HA or anti-c-Myc antibody (as the primary antibody) and then with Texas Red-conjugated anti-mouse IgG (Jackson ImmunoResearch Laboratories Inc.) as the secondary antibody. Images were visualized and digitized on a computer-interfaced confocal laser microscope. In control experiments, the same protocol was performed exactly as above, except for the following two variations: either CHO cells transfected with an apoB42 cDNA without epitope tags were used or the transfected cells were processed without the addition of primary antibody. In either case, the signals were low and were taken to be the background level of immunofluorescence.

	RESULTS AND DISCUSSION

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS AND DISCUSSION CONCLUSIONS REFERENCES

Based on studies by several laboratories including ours (20-21, 25-30), it appears that translocation of apoB across the ER membrane is inefficient and incomplete in the absence of either sufficient core lipids or MTP activity (35). However, other studies (31-34) suggest that apoB is efficiently and completely translocated even in the absence of MTP activity. If the latter scheme were correct, CHO cells, which lack MTP activity, would be a good model to study post-translational, retrograde translocation of apoB. Therefore, we transiently transfected CHO cells to express a double-tagged apoB42 construct with c-Myc and HA tags at 2 and 41% (relative to apoB100) of the amino acid sequences, respectively. Thirty six hours after transfection, cells were labeled for 15 min with [³H]leucine and chased for various times (5-60 min) in the presence of the proteasomal inhibitor, ALLN, to prevent intracellular apoB degradation (29, 36). Four experimental approaches were utilized to study the translocation of apoB42 in CHO cells.

In our first series of studies, total microsomes were isolated by ultracentrifugation after 5, 20, and 60 min of chase and then further fractionated by immunoaffinity isolation by incubation with either anti-c-Myc or anti-HA monoclonal antibodies at 4 °C for 2 h. The microsome-apoB-antibody complexes were precipitated by an additional 2-h incubation with protein G-Sepharose CL-4B. The immunoisolated microsomes were lysed and immunoprecipitated with sheep anti-human apoB polyclonal antibodies. Therefore, the final immunoprecipitated apoB in each immunoisolated microsomal fraction represented apoB that must have had either its NH₂ or COOH terminus exposed to the cytosolic side of the ER at the time of the initial total microsomal isolation. As demonstrated in Fig. 2A, the large majority of microsomes (represented by immunoprecipitable newly synthesized apoB in lanes 2, 4, and 6 at each time point) was consistently immunoisolated by anti-HA antibodies, whereas a very small proportion of microsomes (lane 1, 3, and 5 at each time point) was precipitated by anti-c-Myc antibodies during the 5-60-min chase. As a control, microsomes from CHO cells expressing apoB42 lacking the epitope tags were subjected to the same immunoisolation procedure. A small number of microsomes were nonspecifically isolated by either anti-HA (lane 8 in C1) or anti-c-Myc antibodies (lane 7 in C1). As an additional control to demonstrate comparable immunoreactivity, lysates of proteasome-inhibited cells were immunoprecipitated with either monoclonal antibody; the immunoreactivity of the two antibodies was similar (lanes 9 and 10 in C2). When the nonspecifically immunoisolated apoB (lanes 7 and 8 in C1) was subtracted from specifically immunoisolated apoB, the results showed that at each time point, about 90% of microsomes were isolated by the anti-HA antibody directed at the COOH terminus, while only about 10% of microsomes were isolated by the anti-c-Myc antibody directed at the NH₂ terminus (Fig. 2B). As expected for ALLN-treated CHO cells, no significant degradation of apoB42 was observed over the course of the chase period, and no significant apoB42 was detected in medium (data not shown). These results in CHO cells indicate that, in the presence of the proteasome inhibitor ALLN, apoB42 was partially translocated across the ER (as first reported by Du et al. (29) for apoB53) and that it remained in a stable, partially translocated state throughout the 60-min chase period. In particular, there was no evidence that COOH termini were translocating into the ER lumen or that NH₂ termini were undergoing retrograde translocation from the inside to the outside of the ER during the 60-min chase period.

View larger version (32K): [in this window] [in a new window]   Fig. 2.   The carboxyl terminus of apoB42 is consistently exposed to the cytosol during translocation in CHO cells. CHO cells were transiently transfected with double epitope-tagged B42 cDNA. Thirty six hours after transfection, cells were labeled for 15 min with [3H]leucine and chased for 5-60 min in the presence of a proteasome inhibitor, ALLN (40 µg/ml). At the end of each indicated chase time, total microsomes were isolated by centrifugation and further fractionated by immunoaffinity isolation using either anti-c-Myc or anti-HA antibodies as described under "Materials and Methods." The immunoprecipitated microsomes were finally analyzed by immunoprecipitation with sheep anti-human apoB polyclonal antibodies. A, anti-HA antibody, lanes 2, 4, 6, 8, and 10; anti-c-Myc antibody, lanes 1, 3, 5, 7, and 9. C1, CHO cells were transfected with apoB42 lacking epitope tags; C2, whole cell lysates were immunoprecipitated by anti-HA or anti-c-Myc antibody. B, after SDS-polyacrylamide gel electrophoresis, apoB bands were further analyzed by densitometry using a Molecular Dynamics densitometer. Data were expressed as relative densitometric units after subtraction of nonspecifically precipitated bands (C1, lanes 7 and 8). This figure represents the results from four experiments after normalization. Mcs, microsomes; anti-HA immunoisolated Mcs, closed circles; anti-c-Myc immunoisolated Mcs, closed squares.

To confirm the above observations, we carried out a second set of experiments in which PK digestion of total microsomes isolated from transfected CHO cells was used to determine the topology of apoB42. In this protocol, which also included ALLN treatment of the cells, domains of apoB42 that were exposed to the cytosol would be on the outside of the microsome and would be expected to be sensitive to PK digestion, whereas domains within the lumen of the ER would be inside the microsomes and protected from digestion. Loss of either the HA or c-Myc epitopes would indicate exposure of the COOH or NH₂ termini, respectively, on the outside of the microsomes. If apoB was partially translocated in only the forward direction (i.e. into the ER), protected fragments (representing the portion of apoB inside the ER lumen) would be seen with only the c-Myc antibody. In contrast, if apoB was partially translocated in both directions (indicating both forward and retrograde translocation of some apoB molecules), this assay would identify protected fragments with both epitope tag antibodies. After PK digestion, microsomes were lysed, and the lysates were subjected to immunoprecipitation by each monoclonal antibody. As indicated in Fig. 3, in the absence of PK, anti-HA (lanes 2, 6, and 10) and anti-c-Myc (lanes 1, 5, and 9) antibodies immunoprecipitated equal amounts of labeled apoB42 from the lysed microsomes at each time point. After PK digestion, two protected fragments of apoB42 (~70 and ~120 kDa), along with some full-length apoB42, were recognized by the NH₂-terminus-directed anti-c-Myc antibody throughout the 60-min chase period (lanes 3, 7, and 11). In contrast, no protected fragments were recognized by the COOH-terminus-directed anti-HA antibody during the 60-min chase period (lanes 4, 8, and 12). These data indicate convincingly that apoB42 was in a stable, partially translocated topology in CHO microsomes, with the COOH terminus exposed to the cytosolic side of ER and the NH₂ terminus inside the ER lumen. Importantly, we found no evidence during the 60-min chase period for ongoing retrograde translocation of apoB42, which would have required concomitant exposure of its NH₂ termini to the outside of ER. Such exposure would have resulted in the loss of the protected fragments seen with the anti-Myc antibody, a phenomenon we did not observe (Fig. 3). There appeared to be less full-length apoB42 recognized by the anti-HA antibodies compared with that recognized by anti-c-Myc antibodies (lanes 4, 8, and 12 versus lanes 3, 7, and 11). We believe that this was due to the continued association of ribosomes with the carboxyl-terminus of some molecules of nearly fully translocated apoB42, reducing antibody accessibility to the HA epitope.²

View larger version (40K): [in this window] [in a new window]   Fig. 3.   The amino terminus containing the c-Myc tag, but not the carboxyl terminus containing the HA tag of B42, is protected from PK digestion in microsomes isolated from CHO cells. Thirty six hours after transfection, cells were labeled for 30 min with [3H]leucine and then chased for 5-60 min in the presence of ALLN. Total microsomes were isolated by centrifugation. Equal amount of microsomes were incubated with (lanes 3, 4, 7, 8, 11, and 12) or without PK (50 µg/ml, lanes 1, 2, 5, 6, 9, and 10) for 30 min on ice. After digestion, phenylmethylsulfonyl fluoride (3 mM) was added, and the samples were incubated for another 5 min on ice. The samples were then recentrifuged, and the microsome pellets were dissolved in lysis buffer and analyzed by immunoprecipitation with either anti-HA (lanes 2, 4, 6, 8, 10, and 12) or anti-c-Myc antibodies (lanes 1, 3, 5, 7, and 9) as indicated.

Our finding in Fig. 2 that about 5-10% of microsomes were consistently immunoisolated by anti-c-Myc antibodies during the 60-min chase period raised the possibility that the amino termini of a small number of apoB molecules were exposed to the cytosol either co- or immediately post-translationally during the 15-min labeling period. To address this issue directly, we conducted a third series of experiments in which CHO cells were pretreated with puromycin for 10 min to release all incompletely synthesized polypeptides from their ribosomes (21) before the cells were labeled. After removal of puromycin, the cells were synchronously labeled for 2, 4, and 6 min with [³⁵S]methionine/cysteine. Microsomes were isolated at each time point and further fractionated by immunoaffinity isolation. If the NH₂ terminus of apoB were exposed to the cytosol co-translationally, we should have observed more microsomes isolated by the anti-c-Myc antibody than by anti-HA antibodies at very early labeling times (before translation of the COOH terminus had occurred). Similar amounts of microsomes associated with various lengths of partially synthesized apoB were isolated by both anti-c-Myc and anti-HA antibodies after 2 and 4 min of labeling (data not shown). By contrast, significantly more microsomes were immunoisolated by anti-HA antibody than that by anti-c-Myc after 6 min of labeling, a labeling period adequate for apoB42 to reach its full length. The finding that equal amounts of microsomes were immunoisolated by each monoclonal antibody before the COOH terminus of apoB42 was translated (at 2 and 4 min) was a further indication that most, if not all, of the immunoisolation of microsomes by the anti-c-Myc antibody in the experiment depicted in Fig. 2 was due to nonspecific interactions. More importantly, the fact that an increase in immunoisolated microsomes by anti-HA was observed concurrent with translation of the COOH terminus of apoB42, whereas immunoisolation by anti-c-Myc remained unchanged, is indicative of a lack of either co-translational or very early post-translational retrograde translocation of NH₂ termini.

In our final set of experiments with CHO cells we used indirect immunofluorescence to demonstrate the cytosolic exposure of the COOH- but not NH₂-terminal region of apoB42. Based on the above results (Fig. 3) that the NH₂-terminal region was protected from PK digestion because of an ER-lumenal location, we reasoned that in non-proteasome-inhibited cells, degradation would preferentially deplete the immunofluorescent signal corresponding to the COOH-terminal region and that this depletion would be reversed by inhibiting the proteasome. As shown in Fig. 4A, when CHO cells expressing apoB42 with both epitope tags are not treated with ALLN, the fluorescent signal obtained with the anti-HA antibody was appreciably lower (top left) than the signal obtained with the anti-c-Myc antibody (top right). Notably, when the cells were incubated with ALLN to inhibit proteasomal degradation, the fluorescent signals obtained with both the anti-HA (bottom left) and the anti-c-Myc antibodies (bottom right) became similar in intensity and distribution. When the same experiments were carried out in cells expressing apoB42 without either epitope tag (Fig. 4B), the presence of ALLN in the incubation media had no effect on the very low level, nonspecific immunofluorescence observed. Similar results were obtained with CHO cells expressing the double epitope-tagged apoB42 but studied without the addition of the primary antibodies (data not shown). The simplest interpretation of these results is that in these CHO cells, the COOH-terminal domain of apoB42 was exposed to the cytosol and was sensitive to proteasomal degradation, whereas the NH₂-terminal domain was shielded from the cytosol and insensitive to proteasomal degradation. This conclusion is fully consistent with the results from the other three types of experiments described above.

View larger version (30K): [in this window] [in a new window]   Fig. 4.   Immunofluorescence studies on the cytosolic exposure of the COOH- and NH2-terminal region of apoB42 in CHO cells. CHO cells transfected with plasmids containing cDNAs for double epitope-tagged apoB42 or apoB42 without epitope tags and were grown on collagen-coated coverslips in the presence or absence of ALLN. Immunofluorescent detection of apoB was described in our previous reports (20, 24). The cells were fixed using 3% paraformaldehyde in 1× phosphate-buffered saline. Fixed cells were permeabilized with 0.1% Triton and incubated with anti-HA (left panels) or anti-c-Myc antibodies (right panels) as the primary antibody, followed by Texas red-conjugated anti mouse IgG as the secondary antibody. Images were visualized and digitized on a computer interfaced confocal laser microscope. A, CHO cells transfected with double epitope-tagged B42 cDNA in the absence (top) or presence (bottom) of ALLN. B, CHO cells transfected with apoB42 cDNA without epitope tags in the absence (top) or presence (bottom) of ALLN.

The prior experiments were all done in CHO cells lacking both sufficient lipid synthesis and MTP activity. Therefore, to demonstrate that the topology we observed was not unique to these non-hepatic cells, we conducted further studies of both native and the tagged apoB species in HepG2 cells, a widely used hepatoma cell line that assembles and secretes apoB lipoproteins. In contrast to CHO cells, expression of double epitope-tagged apoB42 in HepG2 cells by transient transfection resulted in secretion of apoB42, which was detected in the medium by anti-HA antibodies (Fig. 5A, lane 4), anti-c-Myc antibodies (lane 3), and anti-apoB polyclonal antibodies (lane 2; lane 1 was an untransfected control). Translocational topology was then determined using the same protocol described in Fig. 2. Transfected cells were labeled for 15 min and chased for up to 60 min in the presence of ALLN, and total microsomes were isolated by ultracentrifugation; microsomal subpopulations were separated by immunoisolation with anti-HA or anti-c-Myc antibodies, and the microsomal subpopulations were lysed and immunoprecipitated with a polyclonal anti-apoB antibody. As indicated in Fig. 5B, more than 90% of microsomes were immunoisolated by anti-HA antibody directed at the COOH terminus of apoB42 (lanes 3, 6, and 9), whereas few microsomes were immunoisolated by anti-c-Myc antibody during a 60-min chase period (lanes 2, 5, and 8). Lanes 1, 4, and 7 represent microsomes immunoisolated by polyclonal anti-apoB antibodies. The presence of bands representing both apoB100 and apoB42 in all of the lanes is derived from the use of a polyclonal anti-apoB antibody to immunoprecipitate the lysates from immunoisolated microsomes. These results support completely our results in CHO cells. Additionally, the same protocol was carried out in untransfected, ALLN-treated HepG2 cells, using anti-human apoB monoclonal antibody 5E11, directed against the COOH terminus, at ~80% of full-length apoB, and anti-human apoB monoclonal antibody 1D1, directed against the NH₂ terminus, at ~11% of full-length apoB. The results, presented in Fig. 5C, parallel completely the results obtained with apoB42; nearly 90% of microsomes were immunoisolated by 5E11 (lanes 1, 3, and 5), whereas less than 10% of microsomes were immunoisolated by 1D1 (lanes 2, 4, and 6) throughout the chase period. Lanes 7 and 8 show that the monoclonal antibodies had equal immunoreactivity against apoB from whole cell lysates. Thus, in a cell model of lipoprotein assembly and secretion, we demonstrated that the NH₂ terminus of neither apoB42 nor full-length apoB undergoes retrograde translocation with exposure to the cytosolic side of the ER.

View larger version (31K): [in this window] [in a new window]   Fig. 5.   The carboxyl termini of apoB100 and apoB42 are consistently exposed to the cytosol during translocation in HepG2 cells. A, double epitope-tagged apoB42 is secreted from HepG2 cells. HepG2 cells were transiently transfected with double epitope-tagged B42 cDNA (lanes 2-4). Thirty six hours after transfection, cells were labeled for 2 h with [3H]leucine in the presence of ALLN cells. After labeling, the cultured medium was collected and immunoprecipitated by anti-apoB polyclonal antibodies (lanes 1 and 2), anti-c-Myc (lane 3), or anti-HA (lane 4) monoclonal antibodies. Lane 1 represents untransfected HepG2 cells. B, the carboxyl terminus of apoB42 is consistently exposed to the cytosol during translocation in HepG2 cells. HepG2 cells were transiently transfected with double epitope-tagged B42 cDNA. Thirty six hours after transfection, cells were labeled for 15 min with [3H]leucine and chased for 5-60 min in the presence of ALLN (40 µg/ml). At the end of each indicated chase time, microsomes were isolated by centrifugation and further fractionated by immunoaffinity isolation with anti-apoB polyclonal antibodies (lanes 1, 4, and 7), anti-c-Myc (lanes 2, 5, and 8), or anti-HA (lane 3, 6, and 9) monoclonal antibodies. The immunoisolated microsomal fractions were lysed and analyzed by immunoprecipitation with a polyclonal anti-human apoB antibody. C, the carboxyl terminus of apoB100 is consistently exposed to the cytosol during translocation in HepG2 cells. HepG2 cells were labeled for 15 min with [3H]leucine and chased for 5-60 min in the presence of ALLN (40 µg/ml). At the end of each indicated chase time, microsomes were isolated by centrifugation and further fractionated by immunoaffinity isolation with anti-human apoB monoclonal antibody 5E11 (lanes 1, 3, and 5) or 1D1 (lanes 2, 4, and 6) as described under "Materials and Methods." The immunoisolated microsomal fractions were finally analyzed by immunoprecipitation with a polyclonal anti-human apoB antibody. C, whole cell lysates were immunoprecipitated by 5E11 (lane 7) or 1D1 (lane 8) antibodies.

We next carried out PK digestion studies in untransfected, ALLN-treated HepG2 cells. The results in Fig. 6 demonstrate that monoclonal antibody 1D1, directed against the NH₂ terminus of full-length apoB, recognized two protected fragments (~70 and ~120 kDa), as well as a small quantity (compared with no PK) of full-length apoB (lanes 3, 7, and 11). There was a suggestion of the presence of a third protected fragment at ~220 kDa, but this was also present in the non-PK-treated microsomal lysates. In contrast, monoclonal 5E11, directed against the COOH terminus, did not detect any protected fragments (lanes 4, 8, and 12). However, 5E11 did detect a similar quantity of full-length apoB. Both the pattern and the intensities of the bands representing the protected fragments were constant throughout the 60-min time point. In contrast, the intensity of the full-length protected fragments diminished by the 60-min chase period. These results indicate that majority of nascent apoB was in a stable, translocation-arrested status in ALLN-treated HepG2 cells and that translocation appears to be arrested at two or three points, approximately 70, 120 (observed both with apoB42 and full-length apoB), and possibly 220 kDa (observed only with full-length apoB). Alternatively, the conformation of some partially translocated apoB molecules made them resistant to PK at a site equivalent to a 120-kDa protected fragment even though translocation had only proceeded to a point equivalent to a 70-kDa protected fragment. Additionally, the results show that the small fraction of nascent apoB that was fully translocated by 10 min of chase was mainly secreted by 60 min.

View larger version (55K): [in this window] [in a new window]   Fig. 6.   The amino terminus recognized by 1D1 antibodies, but not the carboxyl terminus recognized by 5E11 of apoB100, was constantly protected from PK digestion in isolated microsomes from HepG2 cells. Cells were labeled for 30 min with [3H]leucine in the presence of ALLN. At the end of each chase period, total microsomes were isolated by centrifugation, and equal amounts of microsomes were used for PK digestion as described in Fig. 3. After PK digestion, reisolated microsomes were lysed and analyzed by immunoprecipitation with either 1D1 monoclonal antibodies (lanes 1, 3, 5, 7, 9, and 11) or 5E11 monoclonal antibodies (lanes 2, 4, 6, 8, 10, and 12).

The molecular basis for the two or three discrete translocation arrest "sites" in apoB is not known. Although the putative "pause transfer sequences" (37-38) may lead to a transmembrane topology, our previous studies demonstrated clearly that the translocation efficiency of apoB100 can be significantly affected by the presence of hydrophobic -sheet domains independent of pause transfer sequence effects (26). Thus, the translocation of apoB16, apoB13,16, and apoB13,13,16, which contain numerous pause transfer sequences (39-40), is efficient and complete (26), unless a -sheet domain is present. It seems unlikely, therefore, that pause transfer sequences play significant roles in the translocation of apoB100 in cultured cells. However, it is clear that "stuttering" does occur during translation of apoB (41-42) including during translation of apoB in puromycin-treated cells (43). Because we would have expected decreasing intensity of the 70-kDa band and increasing intensity of the 120- and 220-kDa bands as translocation progressed, the finding in Fig. 6 that the relative intensity of the bands did not change over time suggests a lack of ongoing translocation after the first 10 min of chase. This is consistent with the very rapid early degradation of the majority of nascent apoB in cells not treated with proteasome inhibitors and the concomitant very low rate of secretion of full-length apoB from non-OA-treated HepG2 cells (11, 36). Thus, in the presence of ALLN (or other proteasome inhibitors), the apoB that would have otherwise been rapidly degraded remains in several partially translocated topologies unless core lipid synthesis is stimulated (24, 43).

To demonstrate directly that we could "rescue" apoB from translocation arrest and stimulate secretion by adding oleic acid to the media of proteasome-inhibited HepG2 cells during the chase period, we conducted experiments in which PK digestion was carried out on the total microsomal fraction in cells incubated with or without monensin (500 nM) and 0.4 mM oleic acid. Monensin at the concentration used inhibits the movement of secretory vesicles from the Golgi to the plasma membrane, allowing us to observe the accumulation of fully translocated apoB in the cells (25). Cells were labeled for 15 min and chased for 90 min before isolation of microsomes by ultracentrifugation. PK digestion was carried out as described above.

The results (Fig. 7) showed that in control cells (no oleic acid and no monensin), PK treatment generated protected fragments identified by both a polyclonal anti-apoB antibody (lane 4 versus lane 1) and by monoclonal antibody 1D1 (lane 5 versus lane 2). No protected fragments were observed with monoclonal antibody 5E11 (lane 6 versus lane 3). The addition of monensin alone did not affect the generation-protected fragments by PK digestion (lanes 10-12 versus lanes 4-6) but did result in cellular accumulation of fully translocated (and protected) apoB (lanes 10-12 versus lanes 4-6). The latter finding supports our conclusion that once an apoB molecule completes translocation, secretion is rapid, and therefore, this subset of apoB molecules is not normally detected during the chase period. Most importantly, when oleic acid was added to monensin-treated cells there was a disappearance of fragments (lanes 16 and 17 versus lanes 10 and 11) and a further increase in the intensity of the bands representing full-length apoB (lanes 16-18 versus lanes 10-12). These results are compatible with oleate-facilitated translocation of apoB and targeting of the protein for secretion.

View larger version (54K): [in this window] [in a new window]   Fig. 7.   Oleic acid stimulates the translocation of the carboxyl-terminal of apoB in HepG2 cells. HepG2 cells were labeled for 15 min with [3H]leucine and chased for 90 min in the presence of ALLN (40 µg/ml) alone (Control, lanes 1-6), ALLN + monensin (500 nM) (lanes 7-12), or ALLN + 500 nM monensin + 0.4 mM oleic acid (lanes 13-18). At the end of each chase period, total microsomes were isolated by centrifugation, and equal amount of microsomes were used for PK digestion as described in Fig. 3. Microsomes from PK digestion or undigestion control were re-isolated, dissolved in lysis buffer, and analyzed by immunoprecipitation with anti-apoB polyclonal antibodies (lanes 1, 4, 7, 10, 13, and 16), 1D1 monoclonal antibodies (lanes 2, 5, 8, 11, 14, and 17), or 5E11 monoclonal antibodies (lanes 3, 6, 9, 12, 15, and 18).

	CONCLUSIONS

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS AND DISCUSSION CONCLUSIONS REFERENCES

Recent studies have shown that misfolded secretory and transmembrane proteins can be exported from the ER to the cytosol for degradation by the proteasomal pathway (1-7, 12). Based on studies of the utilization of potential glycosylation sites, a post-translational retrograde translocation model for apoB has been proposed (22, 31-34). That model implies that translocation of apoB is efficient and complete and that fully translocated apoB targeted for proteasomal degradation must undergo retrograde translocation from the ER lumen to the cytosol. This post-translational retrograde translocation could possibly occur via either the same translocon involved in the original translocation into the ER or via a different translocon. It is also unclear, in that scheme, whether the NH₂ or COOH termini of the full-length protein would be the leading end of the retro-translocated molecule. Our present and recent studies do not, however, support a post-translational retrograde translocation model. For example, we demonstrated that newly synthesized apoB, which is both ubiquitinated and associated with Sec61 in the translocon, can still be rapidly targeted for secretion by the addition of oleic acid to the incubation media (24). This is consistent with a scheme in which apoB translocation is inefficient and incomplete and suggests that ubiquitination and proteasomal degradation of apoB can take place co-translationally while apoB is still in the original translocon (20, 21). Those studies, however, were not designed to detect a post-translational degradation pathway or to exclude definitively the possibility that co-translational degradation occurred via retrograde translocation of the NH₂ terminus of partially translated apoB through a parallel translocon.

The present studies, therefore, were designed to address these possibilities. By using a double epitope-tagged apoB42 species and anti-human apoB monoclonal antibodies 1D1 and 5E11, we were able to demonstrate that the majority of apoB in transfected CHO or HepG2 cells is incompletely translocated, with the COOH terminus exposed to the cytosol and NH₂ terminus inside of ER lumen. These results are consistent with unpublished experiments from our group³ that demonstrate a prolonged association of nearly completely translated apoB with the translocon, Hsp70, and the proteasome. Additionally, apoB remains in a stable, partially translocated topology in the translocon and with the COOH terminus exposed, even after dissociation of the ribosome by puromycin (data not shown). Furthermore, our results provide strong evidence that the amino terminus of native apoB does not undergo either co-translational or post-translational retrograde translocation into the cytosol. Overall, our current studies in both CHO cells and HepG2 cells provide direct topological evidence to support a model in which apoB is either fully translocated and rapidly secreted as a lipoprotein or is partially translocated and then targeted for rapid degradation while still associated with its original translocon. Thus, unlike other proteins that undergo ER-associated degradation, apoB does not complete translocation before entering the proteasomal pathway.

	FOOTNOTES

^* This work was supported by National Institutes of Health Grants HL55638, T32 HL07343, and HL58541.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

^§ To whom correspondence and reprints requests should be addressed: Dept. of Medicine, Columbia University College of Physicians and Surgeons, 630 W. 168th St., New York, NY 10032. Tel.: 212-305-3626; Fax: 212-305-5384; E-mail: jl698@columbia.edu.

Published, JBC Papers in Press, August 1, 2000, DOI 10.1074/jbc.M004646200

² J.-S. Liang, X. Wu, E. A. Fisher, and H. N. Ginsberg, unpublished observations.

³ R. Pariyarath, H. Wang, J. D. Aitchison, H. N. Ginsberg, A. E. Johnson, and E. A. Fisher, submitted for publication.

	ABBREVIATIONS

The abbreviations used are: ER, endoplasmic reticulum; apoB, apolipoprotein B; ALLN, N-acetyl-leucinyl-leucinyl-norleucinal; CHO, Chinese hamster ovary; MTP, microsomal triglyceride transfer protein; PK, proteinase K; OA, oleic acid; HA, hemagglutinin.

	REFERENCES

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS AND DISCUSSION CONCLUSIONS REFERENCES

CiteULike

Complore

Connotea

Del.icio.us

Digg

Reddit

Technorati

This article has been cited by other articles:

				J. Yamaguchi, D. M. Conlon, J. J. Liang, E. A. Fisher, and H. N. Ginsberg Translocation Efficiency of Apolipoprotein B Is Determined by the Presence of beta-Sheet Domains, Not Pause Transfer Sequences J. Biol. Chem., September 15, 2006; 281(37): 27063 - 27071. [Abstract] [Full Text] [PDF]

				L. Li, P. Stillemark-Billton, C. Beck, P. Bostrom, L. Andersson, M. Rutberg, J. Ericsson, B. Magnusson, D. Marchesan, A. Ljungberg, et al. Epigallocatechin gallate increases the formation of cytosolic lipid droplets and decreases the secretion of apoB-100 VLDL J. Lipid Res., January 1, 2006; 47(1): 67 - 77. [Abstract] [Full Text] [PDF]

				L. Asp, B. Magnusson, M. Rutberg, L. Li, J. Boren, and S.-O. Olofsson Role of ADP Ribosylation Factor 1 in the Assembly and Secretion of ApoB-100-Containing Lipoproteins Arterioscler. Thromb. Vasc. Biol., March 1, 2005; 25(3): 566 - 570. [Abstract] [Full Text] [PDF]

V. Gusarova, J. L. Brodsky, and E. A. Fisher