HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

J. Biol. Chem., Vol. 275, Issue 41, 32317-32324, October 13, 2000

This Article Abstract Full Text (PDF) All Versions of this Article: 275/41/32317    most recent M004847200v1 Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Wu, K. Articles by Pan, Z.-Q. Search for Related Content PubMed PubMed Citation Articles by Wu, K. Articles by Pan, Z.-Q. Social Bookmarking                      What's this?

Conjugation of Nedd8 to CUL1 Enhances the Ability of the ROC1-CUL1 Complex to Promote Ubiquitin Polymerization^*

Kenneth Wu, Angus Chen, and Zhen-Qiang Pan^§

From the Derald H. Ruttenberg Cancer Center, Mount Sinai School of Medicine, New York, New York 10029-6574

Received for publication, June 5, 2000, and in revised form, July 20, 2000

	ABSTRACT

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

The SCF-ROC1 ubiquitin-protein isopeptide ligase (E3) ubiquitin ligase complex targets the ubiquitination and subsequent degradation of protein substrates required for the regulation of cell cycle progression and signal transduction pathways. We have previously shown that ROC1-CUL1 is a core subassembly within the SCF-ROC1 complex, capable of supporting the polymerization of ubiquitin. This report describes that the CUL1 subunit of the bacterially expressed, unmodified ROC1-CUL1 complex is conjugated with Nedd8 at Lys-720 by HeLa cell extracts or by a purified Nedd8 conjugation system (consisting of APP-BP1/Uba3, Ubc12, and Nedd8). This covalent linkage of Nedd8 to CUL1 is both necessary and sufficient to markedly enhance the ability of the ROC1-CUL1 complex to promote ubiquitin polymerization. A mutation of Lys-720 to arginine in CUL1 eliminates the Nedd8 modification, abolishes the activation of the ROC1-CUL1 ubiquitin ligase complex, and significantly reduces the ability of SCF^HOS/-TRCP-ROC1 to support the ubiquitination of phosphorylated IB. Thus, although regulation of the SCF-ROC1 action has been previously shown to preside at the level of recognition of a phosphorylated substrate, we demonstrate that Nedd8 is a novel regulator of the efficiency of polyubiquitin chain synthesis and, hence, promotes rapid turnover of protein substrates.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Degradation of a protein substrate by the ubiquitin (Ub)¹-mediated proteasome pathway is dependent upon the coordinated action between the targeted substrate and components of the ubiquitination machinery that include the E1 activating enzyme, E2 conjugating enzymes, and E3 ligases (1). Recent studies have revealed an elegant mechanism by which the SCF-ROC1 E3 ligase complex specifically targets phosphorylated substrates for ubiquitination (2-8). However, little is known about regulation of the enzymatic mechanism through which a polyubiquitin chain is formed and attached onto a given substrate.

The ROC1-CUL1 complex was initially identified as a core subassembly within the SCF^HOS/-TRCP-ROC1 E3 ligase complex (4, 5, 8). A unique biochemical feature of the ROC1-CUL1 complex is its intrinsic ability to support the polymerization of Ub molecules in the presence of E1 and Cdc34 (4) or Ubc4/5 (5). The Ub conjugates formed appear to correspond to unanchored Ub polymers, suggesting that the Cdc34/ROC1-CUL1 ligase system catalyzes Ub self-ligation. This notion was strongly supported by the observation that (SCF^HOS/-TRCP-ROC1)/Cdc34 synthesized Ub polymers, ranging in size from dimers to octamers, migrated identically to those produced by E2-25K (9), which has been shown to catalyze the polymerization of Ub free chains (10). The mechanism and biological significance of this self-ligation reaction is presently unclear. However, this reaction obviates the requirement for a specific substrate, thus providing a sensitive assay to measure the capacity of Cdc34 and SCF^HOS/-TRCP-ROC1, or ROC1-CUL1, to support Ub polymerization.

It has been reported that, in yeast, Rbx1/Hrt1 (ROC1) complexed with either SCF or Cdc53 (CUL1 homologue) alone catalyzed the extensive auto-ubiquitination of Cdc34 (7, 8). It is possible that the high molecular weight Ub ligation products produced by the mammalian Cdc34/ROC1-CUL1 system also contains some auto-ubiquitinated Cdc34 species.

The ROC1-CUL1 mediated Ub ligase activity requires an intact ROC1 RING-H2 finger domain, in which eight conserved residues Cys-42, Cys-45, Cys-75, His-77, His-80, Cys-83, Cys-94, and Asp-97 have been identified as being essential for the ligase function (5-7, 11-13). Although there is some evidence suggesting that the RING finger plays a critical role in recruiting an E2 conjugating enzyme (14, 15), the precise role the RING finger plays in the mechanism of Ub ligation remains to be established (13, 16).

Wu et al. (9) have established CUL1 as a bipartite molecule with the C terminus required for interacting with ROC1 and, hence, responsible for the assembly of a core Ub ligase activity. Meanwhile, the N terminus is required for binding to Skp1 (9, 17), which recruits a substrate targeting F-box molecule, such as HOS/-TRCP. These distinct modules work in tandem to mediate the ubiquitination of the sequestered substrate protein.

It has previously been shown that Nedd8 or its orthologue Rub1, small Ub-like proteins, modify several members of the cullin/Cdc53 family (18, 19). Studies with budding yeast have shown that deletion of RUB1 alone had no significant growth defect (20). However, when mutations in Cdc34, Cdc53, or Skp1 were combined with the RUB1 deletion, the growth and cell cycle defects of the former group were enhanced significantly (20). Recently, Osaka and co-workers (21) have shown that the Nedd8-modifying pathway is essential for cell viability and function of CUL1 in fission yeast (21). Furthermore, inactivation of the SMC1 (APP-BP1 homologue) gene, encoding for a subunit of the Nedd8 activating enzyme, caused cells to undergo multiple S phases without intervening mitosis (22). These results suggest that Nedd8 plays an important regulatory role in cell proliferation and raise an intriguing question as to whether the Nedd8 pathway exerts its regulatory function through its conjugation to cullin/Cdc53 proteins.

In this report, we have provided compelling evidence demonstrating that Nedd8 is conjugated to CUL1 at residue Lys-720 and that this modification markedly stimulates the ability of ROC1-CUL1 to support Ub polymerization. These studies illustrate that, although phosphorylation triggers substrate targeting in the SCF-ROC1 pathway, Nedd8 modification provides a means to up-regulate the Ub polymerization activity, leading to efficient degradation of the targeted protein substrates.

	EXPERIMENTAL PROCEDURES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Plasmids

Construction of pGEX-4T3/pET-15b-(GST-HA-ROC1)-(His-Flag-CUL1(324-776))-- To construct a plasmid allowing for the simultaneous expression of GST-fused, HA-tagged ROC1 and the C-terminal CUL1 fragment (aa 324-776) tagged with both a six-histidine and a Flag epitopes, the following three cloning steps were used. First, the multi-restriction cloning site from the pET-15b vector (Novagen) was inserted into the pGEX-4T3 vector (Amersham Pharmacia Biotech). For this purpose, a pair of primers (GACGTCGATCGAGATCTCGATCCCGC (5') and CCACCTGACGTCTAAGAAACC (3'); with AatII sites in bold letters) were used to amplify the desired pET-15b cloning site-containing fragment, and this segment was then cloned into PCR2.1-TOPO (Invitrogen) using the procedure described previously (9). This was then followed by excising the pET-15b cloning site sequence by restriction digestion using AatII, and the resulting AatII fragment was subsequently inserted into pGEX-4T3 to create the hybrid vector, pGEX-4T3/pET-15b.

Second, HA-ROC1 was cloned into pGEX-4T3/pET-15b. To do this, the HA-ROC1 sequence was PCR-amplified using pcDNA-HA-ROC1 (5) as a template with primers GTCGACAGCCAAGCTATGTACCCATACG (5') and CTAGTGCCCATACTT TTGGAATTC (3') (with SalI site in bold letters). The PCR fragment was then cloned into the pCR2.1-TOPO vector, and the HA-ROC1 sequence was excised using SalI digestion and inserted into the pGEX-4T3 cloning site on the pGEX-4T3/pET-15b vector. In this manner, GST was fused with HA-ROC1 in frame. This vector is designated as pGEX-4T3/pET- 15b-(GST-HA-ROC1).

Finally, to clone the FLAG-CUL1(324-776) sequence into the pGEX-4T3/pET-15b-(GST-HA-ROC1) vector, the DNA was amplified by PCR using pcDNA FLAG-CUL1(324-776) plasmid (9) as a template with primers CATATGGATTACAAGGATGACGACG (5') and CATATGTTAAGCCAAGTAACTGTAGGT (3') (with NdeI sites in bold letters). The resulting PCR fragment was cloned into the pCR2.1-TOPO vector, and the FLAG-CUL1(324-776) sequence was excised using NdeI digestion followed by insertion into the pET-15b cloning site on the pGEX-4T3/pET-15b-(GST-HA-ROC1) vector. This insertion also added a six-histidine epitope at the N terminus of FLAG-CUL1(324-776). The final vector is designated as pGEX-4T3/pET-15b-(GST-HA-ROC1)-(His-Flag-CUL1(324-776)). For simplicity, throughout the text, the (GST-HA-ROC1)-(His-Flag-CUL1(324-776)) complex is named GST-ROC1-CUL1^324-776, while (HA-ROC1)-(His-Flag-CUL1(324-776)) is called ROC1-CUL1^324-776.

Construction of CUL1(K720R)^324-776, CUL1^K720R, and CUL1^324-719-- To construct mutant CUL1(K720R)^324-776or CUL1^K720R, the QuickChange^TM site-directed mutagenesis kit (Stratagene) was employed per manufacturer's instructions using pGEX-4T3/pET-15b-(GST-HA-ROC1)-(His-Flag-CUL1(324-776)) or pCDNA3.1 FLAG-CUL1 as a template with primers CTACTGATTCAGGCGGCGATCGTGAGAATCATGCGCATGAGGAAGGTTCTG and CAGAACCTTCCTCATGCGCATGATTCTCACGATCGCCGCCTGAATCAGTAG.

To construct CUL1^324-719, the QuickChange^TM site-directed mutagenesis kit (Stratagene) was employed using pGEX-4T3/pET-15b-(GST-HA-ROC1)-(His-Flag-CUL1(324-776)) as a template with primers CTACTGATTCAGGCGGCGATCGTGAGAATCATGTAGATGAGGAAGGTTCTG and CAGAACCTTCCTCATCTACATGATTCTCACGATCGCCGCCTGAATCAGTAG, which mutated the sequence coding Lys-720 to a stop codon.

Construction of pGEX-4T3 UBC12-- Human UBC12 sequence was amplified by PCR from pCDNA3 MYC-UBC12 (kindly provided by Y. Xiong) and inserted into pCR2.1 using the following primers (AGATCTATGATCAAGCTGTTCTCGCTG (5') and CTATTTCAGGCAGCGC TCAAAG) (with BglII site in bold letters). The UBC12 sequence was then excised using BglII and NotI and inserted into pGEX-4T3 (digested with BamHI and NotI) to create pGEX-4T3-GST-UBC12.

Protein Expression and Isolation

Preparation of GST-ROC1-CUL1^324-776 and ROC1-CUL1^324-776-- pGEX-4T3/pET-15b-(GST-HA-ROC1)-(His-FLAG-CUL1(324-776)) was transformed into BL21 (DE3) and grown in LB (0.5 liter) with 0.4% glucose in the presence of ampicillin at 37 °C. Cultures were then cooled to room temperature when the optical density at 600 nm reached 0.5. Isopropyl-1-thio--D-galactopyranoside at a final concentration of 0.2 mM was added to induce the culture overnight (12-14 h) at 25 °C. Cells were pelleted at 5,000 × g for 15 min at 4 °C.

The pellet was resuspended in 1/25 culture volume of lysis buffer (50 mM Tris-HCl, pH 8.0, 1% Triton X-100, 0.5M NaCl, 10 mM EDTA, 10 mM EGTA, 10% glycerol, 2 mM phenylmethylsulfonyl fluoride, 0.4 µg/ml antipain, 0.2 µg/ml leupeptin, and 5 mM DTT). The resuspended material was then sonicated (four repetitive 20-s treatments) and centrifuged at 17,000 rpm in an SS-34 rotor for 30 min, 4 °C. The supernatant was saved. For glutathione affinity purification, indicated amounts of extracts were adsorbed to the beads (20 µl) and excess bacteria proteins were removed by washing the beads three times with lysis buffer followed by two washes with buffer A (25 mM Tris-HCl, pH 7.5, 1 mM EDTA, 0.01% Nonidet P-40, 10% glycerol, 1 mM DTT, 0.2 µg/ml leupeptin, 0.2 µg/ml antipain, and 1 mM phenylmethylsulfonyl fluoride) plus 50 mM NaCl. Typically, 10 µl of GST-ROC1-CUL1^324-776-containing extracts yielded approximately 5 pmol of the complex bound to the glutathione beads.

To generate the ROC1-CUL1^324-776 complex, GST-ROC1- CUL1^324-776-containing extracts (10 ml) were bound to glutathione beads (0.5 ml). Thrombin (Amersham Pharmacia Biotech) cleavage was carried out on beads with 35 units in phosphate-buffered saline for 2 h at 12 °C. More than 95% of GST-ROC1 was cleaved. This procedure yielded 0.6 mg of ROC1-CUL1^324-776 with purity greater than 90% (Fig. 1A).

Enzymes-- Human E1 was isolated from cytosolic extracts of HeLa cells using a Ub affinity column as described previously (4). Cdc34 was purified from extracts derived from Sf9 cells infected with mCdc34-baculovirus using a Ni²⁺-nitrilotriacetic acid-based affinity column (Qiagen) followed by a Q-Sepharose chromatographic step (4).

Expression and Purification of GST-UBC12-- GST-UBC12 was transformed into BL21 (DE3) and grown in LB (100 ml) with 0.4% glucose in the presence of ampicillin at 37 °C. Cultures were induced for 3 h, with 0.4 mM isopropyl-1-thio--D-galactopyranoside added when the optical density at 600 nm reached 0.5. Extracts (4 ml) were made using the same method as for GST-ROC1-CUL1^324-776, mixed with glutathione beads (0.5 ml, Amersham Pharmacia Biotech), pre-equilibrated with lysis buffer, and the mixture was rocked for 1 h at 4 °C. The slurry was then loaded onto a column and washed three times with 2 ml of lysis buffer, followed by washing twice with 2 ml of buffer A-50. GST-UBC12 was eluted with 20 mM glutathione in buffer A-50. 7.5 mg of GST-Ubc12 was obtained with purity greater than 95%.

Expression and Purification of Nedd8-- The pET3a-Nedd8 plasmid (kindly provided by C. Pickart) was transformed into BL21 (DE3). It was then expressed and harvested using the same method as GST-UBC12 except the protein was found in the pellet. The protein was solubilized and purified using a published procedure (23) with modifications. The inclusion body pellet was resuspended and washed three times with lysis buffer, and two times with centrifugation buffer (50 mM Tris-HCl, pH 7.5, 1 mM EDTA, 2% sucrose, 1% Triton X-100, 2 mM phenylmethylsulfonyl fluoride, 0.4 µg/ml antipain, 0.2 µg/ml leupeptin). The pellet was solubilized in urea buffer (50 mM Tris-HCl, pH 7.5, 8 M urea, and 2 mM EDTA) by rocking at room temperature for 30 min. Solubilized material was then clarified using the ultracentrifuge at 100,000 × g for 1 h, 16 °C. The clarified material was thoroughly dialyzed against dialysis buffer (50 mM Tris-HCl, pH 7.5, 2 mM EDTA, 1 mM DTT, 5% glycerol, and 50 mM NaCl). The refolded protein was then concentrated using an M_r 5,000 cut-off filter (Millipore) and passed through Q- and SP-Sepharose (Amersham Pharmacia Biotech) columns, pre-equilibrated with dialysis buffer, consecutively. The flow-through from the SP column was then further purified on a Superdex-75 column using a fast protein liquid chromatograph. 3 mg of pure Nedd8 were obtained per 0.5 liter of induced culture.

Purification of APP-BP1/UBA3 from HeLa Extract-- Human APP-BP1/Uba3 was purified from extracts of HeLa cells using a Nedd8 affinity column. To pack a Nedd8 affinity column, Nedd8 protein (4 mg/ml, 3 ml), maintained in 0.1 M NaHCO₃ (pH 8.0), 0.5 M NaCl, was mixed with CH-Sepharose 4B (Amersham Pharmacia Biotech), which was prepared by swelling 0.2 g of dried beads in 2.5 ml of 1 mM HCl, followed by washing the beads with 50 ml of 1 mM HCl. The mixture was rocked at 4 °C for 5 h. The reaction was stopped by removing the supernatant and incubating the beads in 1 M ethanolamine at room temperature for 1 h. Beads were then washed with alternating washes of low and high pH buffers (low: 0.1 M sodium acetate, pH 4.0, 1 M NaCl; high: 0.1 M Tris-HCl, pH 8.0). The beads were stored in buffer A-50, 4 °C. The estimated capacity is 18 mg of Nedd8/ml of beads.

HeLa cell extracts (150 ml, 10 mg/ml), prepared as described previously (24), were extensively dialyzed against buffer A-50. Dialyzed extracts were then clarified by ultra centrifugation at 100,000 × g, 4 °C, for 1 h. The extracts were adjusted to contain 50 mM creatine phosphate, pH 7.7, 10 mM MgCl₂, 3 mM ATP, and 6.7 µg/ml creatine phosphokinase. This mixture was allowed to pass through the Nedd8-linked CH-Sepharose column by re-circulating overnight at 4 °C. The column was then washed with 100 ml of lysis buffer, followed by 100 ml of buffer A-50. Proteins were eluted by 20 mM DTT in buffer A-50 (15 ml). To separate APP-BP1/Uba3 from Ubc12, the 20 mM DTT-eluted material was passed on a Q-Sepharose column, pre-equilibrated with buffer A-50. The flow-through was found to contain Ubc12. After extensively washing the column with buffer A-50, the bound protein was eluted with a 10-ml gradient of 50-500 mM NaCl in buffer A. The peak of APP-BP1/Uba3 was eluted around 150 mM NaCl. Approximately 13 µg of APP-BP1/Uba3 were obtained.

To sediment APP-BP1/Uba3 by glycerol gradient, Q-Sepharose fraction 21 (130 µl) was loaded onto the top of a 15-30% glycerol gradient (5 ml) containing buffer A plus 0.15 M NaCl. The gradient was run at 45,000 rpm (SW50.1 rotor) for 22 h at 4 °C. 34 fractions were collected.

Assays

Ub Ligase Assay-- Recombinant GST-ROC1-CUL1^324-776, immobilized on glutathione-Sepharose, or ROC1-CUL1^324-776, bound to M2-matrix (Sigma), were added to a Ub ligation reaction mixture (30 µl) that contained 50 mM Tris-HCl, pH 7.4, 5 mM MgCl₂, 2 mM NaF, 10 nM okadaic acid, 2 mM ATP, 0.6 mM DTT, 5 µg of [³²P]Ub, 0.6 pmol of E1, and 10 pmol of Cdc34. The mixture was incubated at 37 °C for 60 min, or otherwise specified. The bound protein was released by boiling the beads with 20 µl of 4-fold concentrated Laemmli loading buffer for 3 min prior to 12.5% SDS-PAGE analysis, followed by autoradiography.

NEDD8 Conjugation-- For NEDD8 conjugation to CUL1^324-776 with HeLa extracts, glutathione bead-coupled GST-ROC1-CUL1^324-776 was incubated with 40 mM CrPO₄, pH 7.7, 0.5 mM DTT, 35 mM KCl, 0.4 mM EDTA, 3.4% glycerol, 7 mM MgCl₂, 2 mM ATP, 50 µg/ml creatine kinase (Sigma), and 92 µg of HeLa extract protein. The mixture was incubated at 37 °C for 60 min.

For NEDD8 conjugation to CUL1^324-776 with purified components, M2 bead-bound ROC1-CUL1^324-776 (1 µg) was incubated with 50 mM Tris-HCl, pH 7.4, 5 mM MgCl₂, 2 mM ATP, 0.6 mM DTT, 0.1 mg/ml bovine serum albumin, 5 ng of APP-BP1/Uba3 (Q-Sepharose fraction 19), 0.6 µg of NEDD8 and GST-Ubc12 in amounts indicated. The mixture was incubated at 37 °C for 60 min.

Activation of the Ub Ligase Activity of ROC1-CUL1 by HeLa Extracts or Purified NEDD8 Conjugation System-- To activate the Ub ligase activity of the ROC1-CUL1 complex, glutathione bead-coupled GST-ROC1-CUL1^324-776 was incubated with 40 mM CrPO₄, pH 7.7, 0.5 mM DTT, 35 mM KCl, 0.4 mM EDTA, 3.4% glycerol, 7 mM MgCl₂, 2 mM ATP, 50 µg/ml creatine kinase, and 92 µg of HeLa extract protein. After incubation at 37 °C for 60 min, the beads were washed three times with buffer B (50 mM Tris-HCl, pH 7.5, 0.5 M NaCl, 0.25% Nonidet P-40) and then were washed twice with buffer A-50. The resulting beads were then assayed for Ub ligation as described above.

To activate the Ub ligase activity of the ROC1-CUL1 complex with purified NEDD8 conjugation components, M2 bead-bound ROC1-CUL1^324-776 was modified by NEDD8 as described above. The treated beads were washed twice with buffer B and then twice with buffer A-50. The washed beads were then assayed for Ub ligation as described above.

	RESULTS

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Activation of the Ub Ligase Activity of the Bacterially Assembled ROC1-CUL1 Complex by HeLa Extracts-- We have shown recently that the RING-H2 finger protein ROC1 specifically binds to the C terminus of CUL1 (spanning amino acid residues 324-776) in transfected 293T cells and that the resulting ROC1-CUL1^324-776 complex is fully active in supporting Ub ligation (9). To identify factors that may regulate the Ub ligase activity of the ROC1-CUL1 complex, we co-expressed GST-ROC1 with CUL1^324-776 in E. coli. As shown in Fig. 1A, the two co-expressed proteins formed a complex that was co-purified from a glutathione affinity column (lane 2). The co-eluted ~33-kDa polypeptides were probably proteolyzed or prematurely terminated products of GST-ROC1 since they reacted with anti-GST antibodies (data not shown). Furthermore, the GST moiety can be removed by thrombin digestion, yielding the ROC1-CUL1^324-776 complex (lane 3).

View larger version (20K): [in this window] [in a new window]   Fig. 1.   Activation of the ROC1-CUL1 Ub ligase by HeLa extracts. A, Coomassie staining analysis of ROC1-CUL1 complexes. Lane 1 contains crude extracts from E. coli expressing both GST-HA-ROC1 and Flag-CUL1324-776. Lane 2 shows the glutathione-bead purified GST-HA-ROC1-Flag-CUL1324-776 complex (~2 µg). Lane 3 shows the HA-ROC1-Flag-CUL1324-776 complex (~1 µg) obtained following thrombin digestion. B, activation of the ROC1-CUL1 Ub ligase by HeLa extracts. Increasing amounts of GST-ROC1-CUL1324-776, immobilized on glutathione beads, were incubated with (lanes 7-11) or without (lanes 1-6) HeLa extracts (92 µg) in the presence of an ATP regenerating system. Following washing, the resulting beads were assayed for Ub ligase activity as described under "Experimental Procedures." Lane 1 does not contain the ROC1-CUL1 complex. Cdc34 was omitted from reactions shown in lanes 6 and 11. Quantitation of Ub ligation products (molecular mass greater than 70 kDa) is shown on the bottom panel.

The Ub ligase activity of GST-ROC1-CUL1^324-776 was measured by the previously established [³²P]Ub incorporation assay (4, 5, 9, 13). In this system, the bacterial-assembled GST-ROC1-CUL1^324-776 complex was coupled to glutathione-beads and the resulting matrix was incubated with E1, Cdc34, and [³²P]Ub. The results showed that GST-ROC1-CUL1^324-776 converted monomeric Ub molecules into high molecular mass Ub polymers in a concentration-dependent manner (Fig. 1B, lanes 1-5). This reaction depended on the presence of Cdc34 as its omission abolished the reaction (lane 6). This result demonstrates that ROC1 and the CUL1^324-776 fragment contain all of the essential elements that constitute a Ub polymerization activity.

To explore whether the unmodified GST-ROC1-CUL1^324-776 could be activated, the glutathione beads coupled with the GST-ROC1-CUL1^324-776 complex were incubated with HeLa cell extracts in the presence of an ATP regenerating system. Following a brief incubation, excess HeLa proteins were removed by extensively washing the beads. The treated-complex was then incubated with ubiquitination agents to initiate the Ub polymerization reaction. The results showed that the treated complex was significantly more active than the untreated complex in supporting Ub ligation (Fig. 1B, compare lanes 2-5 with lanes 7-10). As shown, the Ub ligase activity of the GST-ROC1-CUL1^324-776 complex was increased up to 10-fold when low levels of the complex were used (Fig. 1B, bottom panel). Of note, at the highest levels of GST-ROC1-CUL1^324-776 used, the majority of monomeric Ub had been consumed (lanes 9 and 10), thus limiting the production of high molecular weight Ub conjugates. The depletion of the Ub substrate may have significantly resulted in the underestimation of the degree of activation in the presence of high levels of GST-ROC1-CUL1^324-776. Additionally, the results from kinetic analysis indicated that the HeLa extract-treated GST-ROC1-CUL1^324-776 promoted the polymerization of Ub molecules more rapidly than the mock-treated complex (data not shown).

HeLa Extracts Catalyze the Conjugation of Nedd8 to the CUL1^324-776 Fragment-- Subsequent immunoblot analysis revealed that a fraction of CUL1^324-776 was conjugated with NEDD8 following incubation with HeLa extracts (Fig. 2, upper panel). In contrast, no detectable mobility changes were observed with GST-ROC1 (Fig. 2, bottom panel). Collectively, these results demonstrate that the HeLa extracts catalyze the conjugation of NEDD8 to the CUL1^324-776 subunit of the GST-ROC1-CUL1^324-776 complex and, concomitantly, enhance the ability of the complex to support Ub ligation.

View larger version (30K): [in this window] [in a new window]   Fig. 2.   NEDD8 modification of CUL1324-776. Increasing amounts of GST-ROC1/CUL1324-776, immobilized on glutathione beads, were incubated with (lanes 6-10) or without (lanes 1-5) HeLa extracts. Following washing, the resulting beads were assayed for Ub ligase activity as described in Fig. 1. Aliquots of the reaction mixture were analyzed by autoradiography (shown in Fig. 1B) and Western blotting using the indicated antibodies. Cdc34 was omitted from reactions shown in lanes 5 and 10.

Nedd8 Is Conjugated to CUL1 at Lys-720, and This Modification Is Required for the Activation of the Ub Ligase Activity of the ROC1-CUL1 Complex by HeLa Extracts-- To determine whether Nedd8 modification was responsible for the activation of the ROC1-CUL1 Ub ligase, a Lys  Arg mutation was introduced into CUL1^324-776 at residue 720. This residue has been implicated as the receptor site for NEDD8 (25, 26). GST-ROC1-CUL1^324-776 harboring this mutation exhibited similar Ub ligase activity as observed with the wild type complex that was not incubated with HeLa cell extracts (Fig. 3A, compare lanes 2 and 3 with lanes 4 and 5). However, in contrast to the wild type complex, the mutant complex was no longer activated following incubation with HeLa extracts (Fig. 3A, compare lanes 8 and 9 with lanes 10 and 11). Consistent with this, a complex formed by GST-ROC1 and a CUL1^324-719 deletion mutant, that lacked the Lys-720 NEDD8 receptor residue, was not significantly activated by HeLa extracts (Fig. 3A, lanes 6, 7, 12, and 13). Immunoblot analysis indicated that neither CUL1(K720R)^324-776 nor CUL1^324-719 was conjugated with NEDD8 following incubation with HeLa extracts (Fig. 3B), confirming that Lys-720 is the primary NEDD8 conjugation site. These results establish that the NEDD8 modification is required for the activation of the Ub polymerization activity of the ROC1-CUL1 complex by HeLa extracts. Furthermore, based on quantitation (shown on the bottom of Fig. 3A), the levels of Ub polymers formed by the GST-ROC1-CUL1(K720R)^324-776 complex in the presence of HeLa extracts were similar to those observed without extracts (Fig. 3A, compare lanes 4 and 5 with lanes 10 and 11). This suggests that the activation of ROC1-CUL1 by HeLa extracts is quantitatively dependent on Nedd8 conjugation.

View larger version (45K): [in this window] [in a new window]   Fig. 3.   Conjugation of NEDD8 to CUL1 is required for the activation of the Ub ligase activity of the ROC1-CUL1 complex. A, K720R mutation in CUL1 abolishes activation of ROC1-CUL1 Ub ligase. Wild type or mutant forms of GST-ROC1-CUL1324-776 complexes as indicated were treated with or without HeLa extracts as described in Fig. 1. The resulting beads were assayed for Ub ligase activity. The reaction products were analyzed by SDS-PAGE and quantitated by PhosphorImager analysis. The Ub ligase activities, expressed by arbitrary units, are shown below each lane. B, NEDD8 conjugates to CUL1324-776 at Lys-720. Wild type or mutant forms of GST- ROC1-CUL1324-776 complexes as indicated were treated with or without HeLa extracts as described under "Experimental Procedures." Following washing, the resulting beads were assayed for Ub ligase activity as described in Fig. 1B. Aliquots of the reaction mixture were analyzed by autoradiography (shown in A) and Western blotting using the indicated antibodies.

It should be noted that the immunoblot analysis of the anti-Flag immunoprecipitates of GST-ROC1-CUL1^324-776 detected a ~45-kDa polypeptide (Fig. 3B, lanes 2-5 and 8-11). This anti-Flag recognized protein was not detected in the reaction in which GST-ROC1-CUL1^324-776 was omitted (lane 1), suggesting that it is a proteolyzed or prematurely terminated product of CUL1^324-776. The presence of this polypeptide should not significantly influence Nedd8 modification analysis presented in this study. First, it was present in much less quantity than the CUL1^324-776 fragment. Second, this species migrated almost identically to, or slightly faster than, the CUL1^324-719 fragment (compare lanes 2-5 with lanes 6 and 7), suggesting that it may lack the Lys-720 residue as well.

We examined whether conjugation of NEDD8 to CUL1 affects the ability of CUL1 to support the ubiquitination of IB by introducing a K720R substitution into the full-length Flag-tagged wild type CUL1. In keeping with a recent observation by Read and co-workers (26), our co-transfection experiments revealed that, whereas the wild type SCF^HOS/-TRCP-ROC1 supported the ubiquitination of the IKK-phosphorylated GST-IB(1-54), the CUL1^K720R-containing complex was significantly less efficient in the ubiquitination reaction (data not shown). Immunoblot analysis indicated that both Flag-CUL1 and CUL1^K720R were able to form SCF ^HOS/-TRCP-ROC1 complexes with comparable efficiencies (data not shown). We, therefore, conclude that NEDD8 conjugation to CUL1 enhances the ability of SCF^HOS/-TRCP-ROC1 to support the ubiquitination of IB. This is most likely due to Nedd8 conjugation-mediated activation of the ROC1-CUL1 core Ub polymerization activity within the holo-E3 complex based on results presented in Figs. 1 and 3.

Covalent Linkage of NEDD8 to Lys-720 of CUL1 Is Sufficient to Activate the Ub Ligase of the ROC1-CUL1 Complex-- To determine whether the covalent linkage of NEDD8 to Lys-720 of CUL1 is sufficient to activate the Ub ligase, we reconstituted the NEDD8 modification on CUL1 with purified components. For this purpose, both recombinant human Nedd8 and the Ubc12 E2 conjugating enzyme were expressed and purified from bacteria, with the latter fused with GST. The human Nedd8 activating enzyme is a heterodimer of APP-BP1 and Uba3 (19, 27, 28) and was purified from HeLa cells using a Nedd8 affinity column (see "Experimental Procedures"). To conjugate NEDD8 to CUL1^342-776, ROC1-(Flag-CUL1^342-776), immobilized on anti-Flag antibody-linked protein A beads, was incubated with purified Uba3/(APP-BP1), Ubc12, and NEDD8. After extensive washing to remove excess NEDD8 modification agents, the resulting beads were added with ubiquitination components to initiate the Ub polymerization reactions. The results showed that the addition of Nedd8 conjugation agents resulted in more than a 6-fold stimulation of the complex's Ub polymerization activity (Fig. 4A, compare lanes 1 and 2). Omission of APP-BP1/Uba3 (lane 3), GST-Ubc12 (lane 5), or Nedd8 (lane 6) abolished the activation, demonstrating that each of the Nedd8 conjugation components is essential for activating the Ub polymerization activity of ROC1-CUL1^342-776. In addition, reducing the amount of GST-UBC12 from 100 to 30 ng resulted in a slight decrease in the extent of activation (compare lanes 2 and 4).

View larger version (33K): [in this window] [in a new window]   Fig. 4.   Conjugation of NEDD8 to CUL1 by the combined action of NEDD8, APP-BP1/Uba3, and Ubc12 is sufficient to activate the Ub ligase activity of the ROC1-CUL1 complex. A, NEDD8, APP-BP1/Uba3, and Ubc12 are required for the activation of the ROC-CUL1 Ub ligase activity. M2 bead-bound ROC1-CUL1324-776 was incubated with indicated NEDD8 conjugation components and other agents as described under "Experimental Procedures." The treated beads were then washed and assayed for Ub ligation activity. The reaction products were analyzed by SDS-PAGE and quantitated by PhosphorImager analysis. The Ub ligase activities, expressed by arbitrary units, are shown below each lane. In the absence of ROC1-CUL1324-776 but in the presence of all three NEDD8 conjugation components, 1.68 units of Ub polymer were formed. This blank value has been subtracted from the results presented above. B, NEDD8, APP-BP1/Uba3, and Ubc12 are required for the conjugation of NEDD8 to the CUL1324-776 fragment. Aliquots of the reaction mixture in panel A were analyzed by immunoblot for the presence of Flag-tagged CUL1324-776 derivatives and NEDD8 conjugates. C, the peak of APP-BP1/Uba3 coincides with maximal activity that activates the ROC1-CUL1 Ub ligase by glycerol gradient analysis. The glycerol gradient sedimentation analysis was carried out as described under "Experimental Procedures." Top panel, silver staining analysis of the glycerol gradient fractions. The indicated gradient fractions (15 µl) were separated by 12.5% SDS-PAGE and stained with silver. The sedimentation of aldolase (fraction 15) and bovine serum albumin (fraction 20) are indicated. The positions of APP-BP1 and Uba3 are marked. Bottom panel, Ub ligase activation assay of the gradient. Each gradient fraction was diluted 100-fold, and a 2-µl aliquot was incubated with M2 bead-bound ROC1-CUL1324-776 in the presence of NEDD8 and GST-Ubc12 (lanes 3-14). 5 ng of APP-BP1/Uba3 (Q-Sepharose fraction 21), was added to the reaction shown in lane 1. No APP-BP1/Uba3 fraction was used in lane 2. The treated beads were washed and assayed for Ub ligation activity. The reaction products were analyzed by SDS-PAGE and quantitated by PhosphorImager analysis. The Ub ligase activities, expressed by arbitrary units, are shown under each lane.

Immunoblot analysis showed that approximately 50% of the CUL1^324-776 were converted to Nedd8-conjugated forms (Fig. 4B). As shown, a small percentage of the CUL1^324-776 was conjugated with two NEDD8 molecules. It is presently unclear as to whether the second Nedd8 conjugation was due to an additional site other than Lys-720. It is also possible that, under the conditions used, the carboxyl-terminal glycine of the second Nedd8 forms an isopeptide bond with one of the lysine residues of the Lys-720-conjugated Nedd8, in a manner similar to the formation of Ub chains. The Nedd8 conjugation required APP-BP1/Uba3 (lane 3), GST-Ubc12 (lane 5), and Nedd8 (lane 6). A marginal, but detectable, decrease in the level of NEDD8 modification on CUL1^342-776 was noted when the amount of GST-UBC12 was reduced from 100 to 30 ng (compare lanes 2 and 4).

To confirm that Lys-720 is the primary site for NEDD8 conjugation in the purified reconstitution system, GST-ROC1-CUL1(K720R)^324-776, immobilized on glutathione beads, was tested for Nedd8 conjugation in the presence of APP-BP1/Uba3, GST-Ubc12, and NEDD8. No Nedd8 conjugation was observed (data not shown). These results suggest that the purified system modifies CUL1^324-776 at Lys-720, in keeping with the observations made with the HeLa extracts (Fig. 3B).

To rule out the presence of a human protein(s) co-purified with APP-BP1/Uba3 that may contribute to the activation of the ROC1-CUL1 Ub ligase activity, the APP-BP1/Uba3 preparation was fractionated by glycerol gradient sedimentation. Silver staining analysis revealed that APP-BP1/Uba3 migrated as a doublet (55 and 65 kDa in size) that peaked at fraction 19 (Fig. 4C, upper panel, lane 7). A major contaminating polypeptide of ~45 kDa peaked at fraction 25 (lane 9).

To assess the capacity of the glycerol gradient fractions to activate the ROC1-CUL1 Ub ligase, aliquots of the fractions were incubated with M2 bead-bound ROC1-CUL1^342-776 in the presence of bacterially expressed Nedd8 and GST-Ubc12. Following washing, the treated beads were then assayed for Ub ligation activity. The results showed that fraction 19, the peak of the APP-BP1/Uba3 doublet, contained the highest level of activity that stimulated the Ub ligase activity of the ROC1-CUL1^342-776 complex (Fig. 4C, bottom panel, lane 9). Taken together, these results unequivocally demonstrate that the conjugation of Nedd8 to CUL1 at Lys-720 by the combined action of NEDD8, APP-BP1/Uba3 and Ubc12 is sufficient to activate the Ub ligase activity of the ROC1-CUL1 complex.

	DISCUSSION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

The recent discovery of the ROC/APC11 RING-H2 finger protein family has helped uncover a superfamily of ROC/cullin-based Ub E3 ligases. These members each contain a common dimeric core element formed by combinatorial interactions between the ROC/APC11 and CUL/APC2 family proteins. The three best characterized of these, SCF-ROC1, anaphase-promoting complex, and the von Hippel-Lindau tumor suppressor complex, function to regulate the abundance of substrate proteins required for the control of the progression of the cell cycle, the activation of signal transduction pathways, and the execution of tumor suppressor activities (4-8). Within the multi-subunit E3 complex, the ROC/APC11-CUL/APC2 subassembly is likely to carry out a common ligase function that recruits a cognate E2 and facilitates the transfer of activated Ub from the E2 to the targeted substrates.

In this study, we provide unequivocal biochemical evidence demonstrating that the conjugation of NEDD8 to CUL1 at Lys-720 activates the ability of the ROC1-CUL1 complex to support Ub polymerization. First, incubation of HeLa extracts with the bacterially expressed, unmodified ROC1-CUL1 complex led to both the activation of the ROC1-CUL1-mediated Ub ligase activity and the conjugation of NEDD8 to the CUL1 protein (Figs. 1 and 2). Second, replacement of Lys-720 with arginine in CUL1 eliminated NEDD8 modification, confirming that Lys-720 is the primary site for NEDD8 conjugation (Fig. 3B). Third, in contrast to the wild type ROC1-CUL1 complex, ROC1-CUL1 harboring the K720R mutation was no longer activated by HeLa extracts (Fig. 3A). Fourth, the SCF-ROC1 complex containing CUL1^K720R was substantially less active than the wild type complex in supporting the ubiquitination of IB (data not shown; see Ref. 26). Finally, reconstitution of NEDD8 conjugation to the CUL1 subunit of the ROC1-CUL1 complex with purified components markedly stimulated the Ub ligase activity (Fig. 4).

Previous studies have shown that ROC1 binds five members of the cullin family (CUL1, CUL2, CUL3, CUL4A, and CUL4B), while ROC2 interacts with CUL5 (5). In addition to ROC1-CUL1, ROC1-CUL2 (29, 30) and APC11-APC2 (5) contain Ub ligase activity as well, implicating that the ROC-CUL complex commonly possesses an intrinsic ability to support Ub ligation. In light of the observation by Hori et al. (31), who have shown that all members of the human cullin family of proteins are modified by Nedd8, Nedd8 conjugation to CUL may be a general mechanism to activate the ROC-CUL-based core Ub ligase.

There is a body of evidence suggesting that NEDD8 modification plays a regulatory role in cell proliferation and development. In Saccharomyces cerevisiae, the Rub1 pathway is critical to cell growth when the function of the SCF is compromised by mutations in CDC34, CDC4, CDC53, or SKP1 (20). In fission yeast, the Nedd8-modifying pathway is essential for cell viability (21). The expression of Nedd8 is down-regulated during embryonic development, and, in adult mice, Nedd8 mRNA levels are high in heart and skeletal muscle (32). A dramatic cell cycle effect was observed in the ts41 hamster cell line where the Nedd8 pathway is defective (22). This cell harbors a temperature-sensitive allele of SMC1, a homologue of human APP-BP1. At a non-permissive temperature, the ts41 cell underwent multiple rounds of DNA replication without intervening mitoses. This suggests that, under this condition, a lack of Nedd8 conjugation leads to the limited degradation of a substrate(s), perhaps Cdc18 (33, 34), by the SCF-ROC1 pathway, whose sustained high levels initiate re-replication. Furthermore, in Arabidopsis thaliana, recessive mutations in the AXR1 gene (a homologue of APP-BP1) resulted in a decreased response to auxin, a hormone that regulates diverse developmental processes by promoting changes in cell division and elongation (35).

Read et al. (26) have recently reported that Nedd8 modification activates the SCF^-TRCP-dependent ubiquitination of IB. They further demonstrate that Nedd8 does not affect the K_m for SCF^-TRCP binding to IB, nor does it significantly alter the ability of CUL1 to form complexes with ROC1, Skp1 and -TRCP. In this study we have provided evidence that Nedd8 modification does not affect the ROC1-CUL1 interaction (Figs. 2 and 4). In addition, Podust et al. (36) and Morimoto et al. (37) have shown that the Nedd8 conjugation pathway is essential for proteolytic targeting of p27 by ubiquitination. Although our study is in accord with these papers, it provides unequivocal evidence that the conjugation of Nedd8 to CUL1 at Lys-720 by the combined action of NEDD8, APP-BP1/Uba3, and Ubc12 is sufficient to activate the Ub polymerization activity of the ROC1-CUL1 complex. These findings have led us to conclude that Nedd8 is a novel regulator of the efficiency of polyubiquitin chain synthesis and, hence, promotes rapid turnover of protein substrates.

Our studies have shown that the bacterially expressed, unmodified ROC1-CUL1 complex, when used in high levels, supported Ub ligation (Fig. 1B). Furthermore, elimination of NEDD8 modification by replacing Lys-720 with arginine reduced, but did not abolish, the ability of SCF^HOS/-TRCP-ROC1 to support the ubiquitination of IB (data not shown; see Ref. 26). These results demonstrate that the biochemical role of NEDD8 conjugation is to activate, but is not essential for, the Ub polymerization activity of the ROC1-CUL1 complex, which promotes the synthesis of polyubiquitin chains covalently attached onto substrates such as phosphorylated IB. These studies further imply that the effect of Nedd8 pathway depends on the intracellular levels of CUL1 (and/or other members of the cullin family proteins). It is thus possible that the Nedd8 modification is indispensable for cell growth where cullin concentrations are limiting.

Several questions arise from the results of this study. First, how is the Nedd8 conjugation to CUL1 regulated? Does the conjugation solely depend on the levels of Nedd8, whose expression is developmentally down-regulated and is high in selective tissues such as heart and skeletal muscles (32)? Second, is the SCF-ROC1 function down-regulated by removal of the Nedd8 conjugate from CUL1? Preliminary analysis suggests that there is an activity in HeLa extracts that cleaves Nedd8 from CUL1. If such an enzyme(s) does exist, what physiological role does it play in cell proliferation?

Third, how does NEDD8 activate the ROC1-CUL1 Ub ligase? It is possible that the NEDD8 molecule conjugated to the Lys-720 residue of CUL1 alters the ROC1-CUL1 structure in favor of promoting ubiquitination. Preliminary experiments using GST-based pull-down assays indicated that the HeLa extract-activated ROC1-CUL1 did not promote the formation of a stable complex between ROC1-CUL1 and Cdc34 more efficiently than the untreated complex (data not shown). However, this does not rule out the possibility that the Nedd8-conjugated ROC1-CUL1 may recognize Cdc34 or Cdc34-S-Ub more rapidly than the unmodified complex and that such an encounter instantly induces a conformational change that dissociates Cdc34 (or Cdc34-S-Ub), leading to the transfer of a thiol ester-bound Ub to a substrate or another Ub receptor molecule.

	ACKNOWLEDGEMENTS

We thank Y. Xiong for the Ubc12 and C. Pickart for the pET3a-Nedd8 plasmids, C. Gomez for technical assistance, and S. Santagata for critical reading of this manuscript. K. W. thanks Jose Trincao for expert assistance in fast protein liquid chromatography gel filtration analysis.

	FOOTNOTES

^* This work was supported in part by Public Health Service Grant GM55059 (to Z.-Q. P.).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Supported in part by a National Institutes of Health predoctoral training grant in cancer biology.

^§ An Irma T. Hirschl Scholar. To whom correspondence should be addressed: Derald H. Ruttenberg Cancer Center, Mount Sinai School of Medicine, One Gustave L. Levy Pl., New York, NY 10029-6574. Tel.: 212-659-5500; Fax: 212-849-2446; E-mail: zq_pan@smtplink.mssm.edu.

Published, JBC Papers in Press, July 31, 2000, DOI 10.1074/jbc.M004847200

	ABBREVIATIONS

The abbreviations used are: Ub, ubiquitin; E1, ubiquitin-activating enzyme; E2, ubiquitin carrier protein; E3, ubiquitin-protein isopeptide ligase; PAGE, polyacrylamide gel electrophoresis; GST, glutathione S-transferase; HA, hemagglutinin; PCR, polymerase chain reaction; DTT, dithiothreitol.

	REFERENCES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

CiteULike

Complore

Connotea

Del.icio.us

Digg

Reddit

Technorati

This article has been cited by other articles:

				H. Nishikawa, W. Wu, A. Koike, R. Kojima, H. Gomi, M. Fukuda, and T. Ohta BRCA1-Associated Protein 1 Interferes with BRCA1/BARD1 RING Heterodimer Activity Cancer Res., January 1, 2009; 69(1): 111 - 119. [Abstract] [Full Text] [PDF]

				M. L. Heuze, I. Lamsoul, M. Baldassarre, Y. Lad, S. Leveque, Z. Razinia, C. Moog-Lutz, D. A. Calderwood, and P. G. Lutz ASB2 targets filamins A and B to proteasomal degradation Blood, December 15, 2008; 112(13): 5130 - 5140. [Abstract] [Full Text] [PDF]

				A. Y. Kim, C. C. Bommelje, B. E. Lee, Y. Yonekawa, L. Choi, L. G. Morris, G. Huang, A. Kaufman, R. J. H. Ryan, B. Hao, et al. SCCRO (DCUN1D1) Is an Essential Component of the E3 Complex for Neddylation J. Biol. Chem., November 28, 2008; 283(48): 33211 - 33220. [Abstract] [Full Text] [PDF]

				K. Yamoah, T. Oashi, A. Sarikas, S. Gazdoiu, R. Osman, and Z.-Q. Pan Autoinhibitory regulation of SCF-mediated ubiquitination by human cullin 1's C-terminal tail PNAS, August 26, 2008; 105(34): 12230 - 12235. [Abstract] [Full Text] [PDF]

				J. L. DeHart and V. Planelles Human Immunodeficiency Virus Type 1 Vpr Links Proteasomal Degradation and Checkpoint Activation J. Virol., February 1, 2008; 82(3): 1066 - 1072. [Full Text] [PDF]

K. Huh, X. Zhou, H. Hayakawa, J.-Y. Cho, T. A. Libermann, J. Jin, J. Wade Harper, and K. Munger Human Papillomavirus Type 16 E7 Oncoprotein Associates with the Cullin 2 Ubiquitin Ligase Complex, Which Contributes to Degradation of the Retinoblastoma Tumor Suppressor J. Virol., September 15, 200