HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

J. Biol. Chem., Vol. 275, Issue 42, 32925-32930, October 20, 2000

This Article Abstract Full Text (PDF) All Versions of this Article: 275/42/32925    most recent M005015200v1 Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Cartwright, J. L. Articles by McLennan, A. G. Search for Related Content PubMed PubMed Citation Articles by Cartwright, J. L. Articles by McLennan, A. G. Social Bookmarking                      What's this?

The Saccharomyces cerevisiae PCD1 Gene Encodes a Peroxisomal Nudix Hydrolase Active toward Coenzyme A and Its Derivatives^*

Jared L. Cartwright, Lakhdar Gasmi, David G. Spiller^§, and Alexander G. McLennan^¶

From the  Cell Regulation and Signalling Group and ^§ Centre for Cell Imaging, School of Biological Sciences, University of Liverpool, Life Sciences Building, Liverpool L69 7ZB, United Kingdom

Received for publication, June 9, 2000, and in revised form, July 27, 2000

	ABSTRACT

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

The PCD1 nudix hydrolase gene of Saccharomyces cerevisiae has been cloned and the Pcd1p protein characterized as a diphosphatase (pyrophosphatase) with specificity for coenzyme A and CoA derivatives. Oxidized CoA disulfide is preferred over CoA as a substrate with K_m and k_cat values of 24 µM and 5.0 s¹, respectively, compared with values for CoA of 280 µM and 4.6 s¹ respectively. The products of CoA hydrolysis were 3'-phosphoadenosine 5'-monophosphate and 4'-phosphopantetheine. F ions inhibited the activity with an IC₅₀ of 22 µM. The sequence of Pcd1p contains a potential PTS2 peroxisomal targeting signal. When fused to the N terminus of yeast-enhanced green fluorescent protein, Pcd1p was shown to locate to peroxisomes by confocal microscopy. It was also shown to co-localize with peroxisomal thiolase by immunofluorescence microscopy. N-terminal sequence analysis of the expressed protein revealed the loss of 7 or 8 amino acids, suggesting processing of the proposed PTS2 signal after import. The function of Pcd1p may be to remove potentially toxic oxidized CoA disulfide from peroxisomes in order to maintain the capacity for -oxidation of fatty acids.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

The nudix¹ hydrolases are members of a phylogenetically widespread enzyme family that hydrolyze predominantly the diphosphate (pyrophosphate) linkage in a variety of nucleoside triphosphates, dinucleoside polyphosphates, nucleotide sugars, and related compounds having the general structure of a nucleoside diphosphate linked to another moiety, X (1, 2). They all possess the nudix box sequence signature motif GX₅EX₅(UA)XRE(UA)XEEXGU (where U is a hydrophobic amino acid), formerly known as the MutT motif (1, 3). The functions proposed for members of this protein family are to cleanse the cell of potentially deleterious endogenous nucleotide metabolites and to modulate the accumulation of metabolic intermediates by diverting them into alternative pathways in response to biochemical need (1).

Genome sequencing studies show that the number of nudix hydrolases varies from 0 in Mycoplasma genitalium (4) to 24 in Deinococcus radiodurans (5), whereas cDNA sequencing reveals at least 15 family members in mammalian cells. The budding yeast Saccharomyces cerevisiae has genes for five nudix hydrolases. YSA1 (ORF YBR111C) encodes a 26-kDa ADP-sugar diphosphatase² (1), NPY1 (ORF YGL067W) encodes a 43.5- kDa NADH diphosphatase³ (6), PSU1 (DCP2, ORF YNL118C) encodes a 109-kDa protein with an N-terminal nudix hydrolase domain whose enzymic activity is as yet undetermined but which may be involved in both transcriptional activation (7) and mRNA decapping (8), while DDP1 (ORF YOR163W) encodes a 21.5-kDa enzyme that is a member of a unique subgroup of nudix hydrolases that can hydrolyze both diadenosine polyphosphates and non-nudix diphosphoinositol polyphosphate substrates (9, 10). Here we show that the fifth S. cerevisiae nudix hydrolase gene, PCD1 (ORF YLR151C) on chromosome XII, encodes a protein with an entirely new enzyme activity: a peroxisomal coenzyme A diphosphatase, Pcd1p, that cleaves 3'-phosphoadenosine 5'-monophosphate (3',5'-ADP) from coenzyme A and CoA derivatives. Oxidized CoA disulfide (CoASSCoA) is preferred to CoA as a substrate. Pcd1p also appears to be only the second documented S. cerevisiae protein to have an N-terminal PTS2 peroxisomal targeting signal.

	EXPERIMENTAL PROCEDURES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Materials

S. cerevisiae strain INVSc1 (MAT, his3-D1, leu2, trp1-289, ura3-52) was from Invitrogen. All nucleotides and nucleotide derivatives were from Sigma. Calf intestinal alkaline phosphatase, yeast inorganic pyrophosphatase, and restriction enzymes were from Roche Molecular Biochemicals. The Escherichia coli expression vector, pET 17b(+) was from Novagen, and the pPGY1 yeast centromere vector was a gift from L.D. Barnes. Rhodamine B hexyl ester was from Molecular Probes. Rhodamine-conjugated goat anti-rabbit IgG was from Santa Cruz Biotechnology. The yeast-enhanced green fluorescent protein (yEGFP) fusion vectors pUG35 and pUG36 were a gift from J. H. Hegemann. A rabbit polyclonal antibody to yeast 3-oxoacyl-CoA thiolase (Fox3p) was kindly donated by W.-H Kunau.

Methods

Cloning of PCD1 from Genomic DNA-- The PCD1 coding region was amplified from genomic DNA using the polymerase chain reaction and the 36-mer oligonucleotide forward and reverse primers d(AGAAAAGAATTCATGATATTAAGTCAGAGGAGGATG) and d(ATCTCTCTCGAGTATTGTTAGGCAACGCATTATACC). The synthesized primers provided an EcoRI restriction site at the start of the amplified ORF and a XhoI site at the end. After amplification with Pfu DNA polymerase (Stratagene), the DNA was recovered by phenol/chloroform extraction, digested with EcoRI and XhoI, and the gel-purified restriction fragment ligated between the EcoRI and XhoI sites of both pET17b(+) and pPGY1. The resulting pET151C construct (from pET17b) yielded an N-terminal fusion of the T7 tag sequence and Pcd1p under the control of the T7 promoter while the pPGY151C construct (from pPGY1) generated the ATG initiator downstream of GAL1p, a galactose-inducible promoter, and yielded native Pcd1p when expressed in yeast. Both plasmids were used to transform E. coli XL1-Blue cells for propagation.

Expression of Pcd1p in E. coli and Preparation of Antibody-- E. coli strain BL21(DE3) was transformed with pET151C. A single colony was picked from an LB agar plate containing 60 µg/ml ampicillin and inoculated into 10 ml of LB medium containing 60 µg/ml ampicillin. After overnight growth, the cells were transferred to 1 liter LB medium containing 60 µg/ml ampicillin and grown to an A₆₀₀ of 0.6. Isopropyl-1-thio--D-galactopyranoside was added to 0.4 mM and the cells induced for 4 h. The induced cells (4.2 g) were harvested, washed, and resuspended in 50 ml of sonication buffer (50 mM Tris-HCl, pH 8.0, 2 mM EDTA, 0.1 M NaCl). The cell suspension was sonicated and the inclusion bodies recovered by centrifugation at 10,000 × g for 20 min. After washing by resuspension in sonication buffer containing 2.5 M urea, the inclusion bodies were dispersed in 27 ml of 25 mM Tris-HCl, pH 8.0, 8 M urea, 10 mM dithiothreitol (DTT) and the extract centrifuged at 100,000 × g for 1 h. The supernatant was applied in 1-ml aliquots to a Mono Q HR 5/5 anion exchange column (Amersham Pharmacia Biotech) previously equilibrated in Buffer A (25 mM Tris-HCl, pH 8.0, 6 M urea) and the protein eluted with a linear gradient from 0 to 0.5 M NaCl in Buffer A. Homogeneous Pcd1p eluted at 0.27 M NaCl. Fractions containing the protein were dialyzed extensively against phosphate-buffered saline and used to generate a rabbit anti-Pcd1p polyclonal antiserum by standard procedures.

Expression of Pcd1p in S. cerevisiae and Purification-- S. cerevisiae strain INVScI was transformed with pPGY151C. A single colony was picked from an SC-Ura (synthetic complete medium without uracil) agar plate and inoculated into 40 ml of SC-Ura medium supplemented with 5% glucose. After 36 h the cells were harvested by centrifugation and resuspended in 4 liters of SC-Ura + 5% glucose and grown for another 24 h. The cells were again recovered by centrifugation, resuspended in 4 liters of SC-Ura + 2% galactose, 1% raffinose, and grown for 24 h to fully induce expression of Pcd1p.

The induced cells (26.84 g) were harvested, washed, and resuspended in 50 ml of breakage buffer (50 mM Tris-HCl, pH 7.5, 2 mM EDTA, 50 mM NaCl, 10 mM 2-mercaptoethanol, 1 mM phenylmethylsulfonyl fluoride, 5 µM trans-epoxysuccinyl-L-leucylamido-(4-guanidino)butane, 1 mM benzamidine). The cells were disrupted in a French pressure cell and a crude soluble extract recovered by centrifugation at 100,000 × g, 4 °C for 1 h. The extract was then dialyzed against Buffer B (25 mM Tris-HCl, pH 7.5, 25 mM NaCl, 10 mM 2-mercaptoethanol) before application at 1.5 ml/min to a 25 × 250-mm column of DEAE-Sephacel (Amersham Pharmacia Biotech). After removal of unbound protein, a 450-ml linear gradient from 0 to 0.5 M NaCl in Buffer B was applied. Fractions containing Pcd1p were identified by immunoblotting and pooled (67 ml).

Solid (NH₄)₂SO₄ was added to the pooled fraction to a final concentration of 1 M and the sample was loaded at 1.5 ml/min on to a 15 × 50-mm column of Phenyl-Sepharose CL-4B (Amersham Pharmacia Biotech) previously equilibrated in Buffer C (50 mM Tris-HCl, pH 7.5, 5 mM 2-mercaptoethanol) containing 1 M (NH₄)₂SO₄. After removal of unbound protein, a 100-ml reverse linear gradient from 1 to 0 M (NH₄)₂SO₄ in Buffer C was applied. Fractions containing Pcd1p were identified by immunoblotting and pooled (52 ml) before dialysis against 10 mM sodium phosphate, pH 6.8, 10 µM CaCl₂.

The dialysate was applied at 1 ml/min to a 100 × 7.8-mm Bio-Gel HPHT column (Bio-Rad) and the protein eluted with a 30-ml linear gradient from 10 to 350 mM sodium phosphate, pH 6.8, containing 10 µM CaCl₂. Homogenous Pcd1p eluted at 300 mM sodium phosphate, and fractions containing the pure protein were dialyzed extensively against 25 mM Tris-HCl, pH 7.5, 50 mM NaCl prior to assay.

Pcd1p-GFP Fusion Constructs and Subcellular Localization-- Expression plasmids encoding C-terminal and N-terminal fusions of Pcd1p to yEGFP (11) were constructed by amplification of the PCD1 coding region from genomic DNA using the polymerase chain reaction and either the 36-mer oligonucleotide primers described above to give PCR product C, or the 36-mer forward and reverse primers d(AGAAAAGAATTCATGATATTAAGTCAGAGGAGGATG) and d(CAGTTTCTCGAGCCAAAGCGAGCGGCACTCCAGCAG) to give product N. After amplification with Pfu DNA polymerase, both DNA products were recovered by phenol/chloroform extraction and digested with EcoRI and XhoI. The digested and gel-purified PCR product C was ligated between the EcoRI and XhoI sites of pUG36 to give pyEGFP-PCD1 while PCR product N was ligated between the EcoRI and SalI sites of pUG35 to give pPCD1-yEGFP. Both plasmids were propagated by transformation of E. coli XL1-Blue cells.

For microscopy, S. cerevisiae strain INVScI was transformed with either pyEGFP-PCD1 or pPCD1-yEGFP and grown in liquid or solid SC-Ura medium containing 2% glucose. For staining of mitochondria in living cells, cultures of exponentially growing transformed INVScI were resuspended in 10 mM HEPES, pH 7.4, 5% (w/v) glucose, 100 nM rhodamine B hexyl ester and incubated at 20 °C for 30 min. For immunofluorescence microscopy, INVScI cells transformed with pPCD1-yEGFP were first grown in SC-Ura + 2% glucose to mid log phase followed by growth for 18 h in SC-Ura + 0.1% oleic acid, 0.02% Tween 40. Fixation and immunocytochemical staining were as described (12) using anti-3-oxoacyl-CoA thiolase (dilution 1:3000) followed by rhodamine-conjugated goat anti-rabbit IgG (1:50). Cells were viewed by conventional and confocal fluorescence microscopy on a Zeiss LSM510 confocal microscope with a 100 × 1.4 numeric aperture objective.

Enzyme Assays and Product Identification-- Potential substrates were screened by measuring the P_i released by co-incubation of nucleotides with Pcd1p and either inorganic pyrophosphatase or alkaline phosphatase as described previously (9, 13). Reaction products generated from substrates were identified by high performance anion-exchange chromatography. Reaction mixtures (100 µl) containing 50 mM 1, 3-bis[tris(hydroxymethyl)methylamino]propane-HCl, pH 7.0, 5 mM MgCl₂, 0.5 mM substrate, and 0.125 µg of Pcd1p were incubated for up to 10 min at 37 °C and applied to a 1-ml Resource-Q column (Amersham Pharmacia Biotech) at 2 ml/min in 5% buffer E. The elution system comprised Buffer D (0.045 M CH₃COONH₄, adjusted to pH 4.6 with H₃PO₄) and Buffer E (0.5 M NaH₂PO₄, adjusted to pH 2.7 with CH₃COOH) (14), with a gradient of 5-70% Buffer E over 10 min. Substrates requiring reducing conditions (CoA and 3'-dephospho-CoA) were pre-incubated for 5 min at 37 °C with DTT before addition to the assay. The final assay concentration of DTT was 1 mM. Peaks were identified with the aid of standards and quantified by area integration for kinetic analysis.

Other Methods-- Immunoblotting was performed as described previously (9). Protein concentrations were estimated by the Coomassie Blue binding method (15).

	RESULTS

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Cloning, Expression, and Purification of Pcd1p

The intronless PCD1 gene contains an open reading frame, YLR151C, that potentially encodes a 39,758-Da protein containing a nudix box (Fig. 1A). Initial and various attempts to express soluble Pcd1p to a high level in E. coli were unsuccessful, with all the recombinant protein being found in inclusion bodies. Resolubilization of this material also failed to produce protein with discernible enzyme activity. It was therefore decided to use the protein isolated from inclusion bodies to raise a polyclonal rabbit antibody that could then be used in an immunoassay for the purification of the overexpressed protein from yeast. The YLR151C ORF was amplified by PCR from genomic DNA and the PCR product inserted into the yeast centromere vector, pPGY1. The resulting plasmid, pPGY151C, was transformed into S. cerevisiae strain INVScI and expression of the insert induced by growth on galactose. By following the major immunoreactive species on Western blots of chromatographic fractions, the protein product of PCD1 was purified to homogeneity from extracts of the induced cells. The purified protein had a molecular mass of 38 kDa according to SDS-PAGE (Fig. 1B). Throughout the purification, the immunoblots revealed more clearly than the gels that the overexpressed Pcd1p actually comprised two species of very similar size (Fig. 1C). N-terminal sequencing of the two bands excised from these blots showed the upper and lower species to have the sequences MLSSKQLI and LSSKQLI, respectively, suggesting that Pcd1p may have undergone some N-terminal processing with the loss of either 7 or 8 amino acids (Fig. 1A).

View larger version (46K): [in this window] [in a new window]   Fig. 1.   Sequence features and SDS-PAGE analysis of Pcd1p. A, the predicted amino acid sequence of Pcd1p with the residues of the nudix box (MutT motif) shown in bold. The residues of the proposed PTS2 peroxisomal targeting signal (RRMLSSKQL) are underlined, and those of the predicted transmembrane segment are double underlined. The sequence has GenBankTM accession no. CAA97723 and SwissProt accession no. Q12524. B, SDS-PAGE analysis with molecular weight markers. C, immunoblot analysis of recombinant Pcd1p purified from yeast with detection by enhanced chemiluminescence.

Properties of the Protein

Substrates-- Nucleotides were tested as potential substrates for Pcd1p using a spectrophotometric assay. No activity was found with the following compounds: (deoxy)nucleoside 5'-triphosphates, nucleoside 5'-di- or monophosphates, diadenosine polyphosphates, nucleoside 5'-diphosphosugars, cytidine 5'-diphosphoalcohols, NAD⁺, NADH, or FAD. However, substantial activity was found with CoA and some CoA derivatives (Table I). HPLC analysis of the products of CoA hydrolysis showed that the enzyme was a CoA diphosphatase, cleaving the diphosphate linkage in CoA to give 3',5'-ADP and 4'-phosphopantetheine (Fig. 2A). Pcd1p is the first nudix hydrolase to be described with such a substrate specificity. The K_m and k_cat for CoA were 280 µM and 4.6 s¹, respectively, while the corresponding values for oxidized CoA disulfide (CoASSCoA) were 24 µM and 5.0 s¹, respectively. Thus, the enzyme has a 13-fold higher k_cat/K_m ratio for CoASSCoA compared with CoA. These kinetic parameters were calculated by non-linear regression analysis of the data in Fig. 3A. The reciprocal plots in Fig. 3B clearly show that the enzyme follows Michaelis-Menten kinetics with these two substrates. The initial products of CoASSCoA hydrolysis were 3',5'-ADP and what is presumed to be CoASSP, the mixed disulfide of CoA and 4'-phosphopantetheine, i.e. CoASSCoA lacking a single 3',5'-ADP moiety (Fig. 2B). Significant accumulation of this product was observed with time before it too was degraded, presumably to 3',5'-ADP and the dimer of 4'-phosphopantetheine, suggesting that CoASSP is not as efficient a substrate as CoASSCoA. When measured at a single fixed substrate concentration, moderate activity was also obtained with several short chain acyl-CoA esters while 3'-dephospho-CoA was a very poor substrate (Table I). Thus, the 3' phosphate on the adenosine moiety appears to be important for substrate recognition. Attempts to demonstrate enzyme activity in crude yeast extracts proved impossible due to 3' dephosphorylation of the CoA substrates. The mixed CoA-glutathione disulfide, which may exist in vivo but which is more usually found as an extraction artifact (16, 17), was also a relatively poor substrate. Therefore, recognition of CoASSCoA as a good substrate must involve more than just the disulfide bond.

View this table: [in this window] [in a new window]   Table I Substrate utilization by Pcd1p Activity with CoA and CoA derivatives was determined by high performance liquid chromatography at a fixed substrate concentration of 0.5 mM as described under "Experimental Procedures." Results are expressed as percentage of degradation rate obtained with CoASSCoA determined from progress curves with incubation times up to 10 min. 100% represents a rate of 7.5 µmol·min1·mg1.

View larger version (15K): [in this window] [in a new window]   Fig. 2.   Identification of reaction products from hydrolysis of CoA (A) and CoASSCoA (B). Assays containing 0.5 mM substrate were incubated with or without 0.125 µg of Pcd1p for 10 min then applied to a 1-ml Resource-Q anion exchange column as described under "Experimental Procedures." Positions of standards are indicated. ------, without enzyme; - - -, with enzyme; gradient (- - -).

View larger version (12K): [in this window] [in a new window]   Fig. 3.   Michaelis-Menten (A) and Lineweaver-Burk (B) plots for the hydrolysis of CoA () and CoASSCoA () by Pcd1p. Enzyme assays were performed and product peak areas quantified by ion-exchange chromatography as described under "Experimental Procedures."

Pcd1p was optimally active at pH 7.0 with 5 mM Mg²⁺ ions. Mn²⁺ at 300 µM supported 83% of the activity observed with 5 mM Mg²⁺ ions. Like all other nudix hydrolases tested, Pcd1p was very sensitive to inhibition by fluoride ions with an IC₅₀ of 22 µM using CoASSCoA as substrate (data not shown).

Subcellular Localization-- A likely subcellular location for an enzyme with the properties described would be the mitochondria or peroxisomes, as these contain the major cellular CoA pools. The latter organelle is the sole site of fatty acid -oxidation in yeast. The N-terminal 30-40 amino acids of Pcd1p are rich in Lys, Arg, Ser, and Thr, suggesting they may comprise a mitochondrial targeting signal (Fig. 1A) (18). Indeed, the PSORT algorithm suggests a possible mitochondrial location (19) while a hydrophobic transmembrane segment following the potential leader sequence that could anchor the imported protein in the inner mitochondrial membrane is predicted by the TMpred (20) and TMHMM (21) algorithms (Fig. 1A). The sequence of Pcd1p does not contain a typical C-terminal tripeptide peroxisomal targeting signal (PTS1) (22); however, the sequence RRMLSSKQL in the N-terminal region (Fig. 1A) is a close match to the PTS2 N-terminal peroxisomal matrix targeting signal consensus (R/K)(L/V/I)X₅(Q/H)(L/A) (22, 23). Thus, Pcd1p could be either mitochondrial or peroxisomal. The similarity in peroxisomal and mitochondrial N-terminal targeting signals has been noted before (24).

In order to determine the true subcellular location of Pcd1p, yeast cells were transformed with expression vectors encoding Pcd1p fused to either the C terminus (pyEGFP-PCD1) or the N terminus (pPCD1-yEGFP) of yeast-enhanced green fluorescent protein (yEGFP) (11) and then examined by confocal microscopy. Cells transformed with pyEGFP-PCD1 showed a diffuse cytoplasmic fluorescence with no clear subcellular localization (Fig. 4, A and B) while cells transformed with pPCD1-yEGFP showed a clear punctate fluorescence characteristic of peroxisomes (Fig. 4C). The same cells stained with the mitochondrial-specific dye rhodamine B hexyl ester revealed a quite distinct pattern of mitochondrial staining (Fig. 4D). Superimposition of the latter two images showed only limited coincidence of green and red emissions due to physical overlap of some organelles (Fig. 4E). The structural integrity of the cells was apparent under bright field conditions (Fig. 4F). The peroxisomal location of Pcd1p in cells transformed with pPCD1-yEGFP (Fig. 4G) was confirmed by indirect immunofluorescence microscopy using an antibody to 3-oxoacyl-CoA thiolase (Fox3p), a known peroxisomal enzyme (12, 25), and a rhodamine-conjugated second antibody (Fig. 4H). Both signals were clearly coincident (Fig. 4I). These results show that the N-terminal sequence of Pcd1p directs the enzyme to peroxisomes, most probably via the PTS2-like sequence RRMLSSKQL, but not to the mitochondria. Thus, Pcd1p is only the second protein identified in S. cerevisiae to be imported into peroxisomes by virtue of a PTS2 signal, the first being Fox3p (26). Interestingly, purified Fox3p has been reported to lack its 5 N-terminal amino acids (25) while purified Pcd1p appears to have lost 7 or 8 amino acids from its predicted sequence. This would lend support to the suggestion that the PTS2 signal in yeast may undergo specific proteolytic processing after import into the peroxisomes (25). Structure 1 shows the possible sites of proteolytic processing (arrowed) within the putative PTS2 sequences of Fox3p and Pcd1p (boxed).

View larger version (50K): [in this window] [in a new window]   Fig. 4.   Subcellular localization of Pcd1p by fluorescence confocal microscopy. A, yEGFP fluorescence of cells transformed with pyEGFP-PCD1; B, as panel A but superimposed on a bright field picture; C, yEGFP fluorescence of cells transformed with pPCD1-yEGFP; D, fluorescence of same cells as in panel C stained with rhodamine B hexyl ester; E, superimposition of panels C and D; F, bright field picture of cells in panels C-E; G, yEGFP fluorescence of cells transformed with pPCD1-yEGFP; H, fluorescence of cells in panel G incubated with an antibody to peroxisomal Fox3p and a rhodamine-conjugated second antibody; I, superimposition of panels G and H.

	DISCUSSION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

In addition to the nudix box, the sequence of Pcd1p contains a second, contiguous signature motif to the N-terminal side identified in the PROSITE data bank as UPF0035 (Fig. 5). This motif has the sequence LLTXR(SA)X₃RX₃GX₃FPGG and is present in a variety of related bacterial, fungal, animal, and plant putative protein sequences in the GenBank^TM/EMBL non-redundant and expressed sequence tag data bases, some examples of which are shown in Fig. 5. Animals (mouse, rat, human, and Caenorhabditis elegans) have pairs of related sequences. The mouse gene sequences, Nudt7 and Nudt8, encode two 26-kDa proteins that share 34% sequence identity with each other and 26% and 20% sequence identity with Pcd1p, respectively. The Nudt7 gene product is also a peroxisomal CoA diphosphatase with a C-terminal tripeptide targeting signal, SKL.⁴ Therefore, the UPF0035 motif may be a determinant of CoA substrate specificity among the nudix hydrolases. Since it overlaps with the predicted transmembrane segment, the latter may not be genuine. An additional sequence feature is the substitution of the usual glutamate residue in the nudix box (marked with * in Fig. 5) by either aspartate or glutamine and the inclusion of an extra amino acid in several cases between this residue and the invariant alanine (marked with  in Fig. 5). Thus, the consensus nudix box in this family of potential CoA diphosphatases is GX₅DX₆AXREXXEEXGU.

View larger version (51K): [in this window] [in a new window]   Fig. 5.   Multiple sequence alignment of Pcd1p and related sequences. A 44-amino acid section of the translated S. cerevisiae PCD1 sequence encompassing the UPF0035 signature motif and the nudix box was aligned using the ClustalW program with the following sequences (data base accession numbers in parentheses): Schizosaccharomyces pombe YDH5 (SwissProt Q92350), E. coli YEAB (SwissProt P43337), Mycobacterium tuberculosis Rv3672c (SPTREMBL O69640), mouse Nudt7 (GenBankTM AA674232), mouse Nudt8 (GenBankTM AI854862), C. elegans Y38A8.1 (SwissProt Q23236) and Y87G2A.14 (GenBankTM AL110500), and Arabidopsis thaliana (SPTREMBL O22951 and O23663). "Invariant" amino acids of the nudix box and the UPF0035 motif are highlighted as white on black. See "Discussion" for significance of residues marked * and .

Pcd1p represents a new class of nudix hydrolase and a new class of enzyme. The existence of such an activity has been inferred previously but it has not been isolated. In E. coli, and presumably in other cells, regulation of the concentration of CoA includes turnover to form 3',5'-ADP and 4'-phosphopantetheine, the latter being formed directly or by transfer to and removal from acyl carrier protein (27). The former route would require a CoA diphosphatase. CoA diphosphatase has also been proposed as an activity associated with the 400-kDa CoA synthesizing protein complex from S. cerevisiae in which it forms part of an alternative pathway for CoA biosynthesis that differs from the principal route of 3'-dephospho-CoA and CoA synthesis by this complex (28). This CoA/4'-phosphopantetheine cycle also includes hydrolysis of CoA to 3',5'-ADP and 4'-phosphopantetheine, which then reacts with ATP to give 3'-dephospho-CoA, and then CoA. At the moment we do not know if Pcd1p is responsible for this activity. A recent comprehensive two-hybrid analysis of protein-protein interactions in S. cerevisiae revealed no interacting partners for Pcd1p (29). However, stable interactions requiring three or more partners would not have been detected.

Alternatively, the high activity of Pcd1p toward oxidized CoA disulfide and its peroxisomal location suggest a function that may be more in keeping with the proposal that a major role of the nudix hydrolases is the elimination of toxic nucleotides. Oxidative stress generates increased levels of several of the substrates for nudix hydrolases, e.g. 8-oxo-dGTP for the MutT protein (30), diadenosine tetraphosphate (Ap₄A) for Ap₄A hydrolase (31, 32), and ADP-ribose for ADP-sugar diphosphatases (13). Many of the oxidative reactions in peroxisomes generate hydrogen peroxide and the resultant oxidizing environment would be expected to increase the CoA disulfide/CoA ratio (cf. the oxidized glutathione/glutathione ratio). Indeed, some organisms such as Staphylococcus aureus use a thiol/disulfide redox system based on CoA, CoA disulfide, and a CoA disulfide reductase instead of the more common glutathione system to maintain a reducing environment (33). In the probable absence of a specific CoA disulfide reductase to regenerate CoA within the yeast peroxisomes (33), accumulation of CoA disulfide could lead to a reduction in the ability to oxidize fatty acids, hence the need for Pcd1p. Since the S. cerevisiae NPY1 NADH diphosphatase is also peroxisomal,³ both enzymes may participate in the maintenance and protection of essential nucleotide pools for -oxidation. Although preliminary experiments with a yeast strain disrupted for PCD1 have failed to show any substantial deficiency in growth on oleic acid,³ more detailed investigations are under way to determine the precise function of Pcd1p and the consequences of PCD1 disruption.

In conclusion, a nudix hydrolase with a previously undescribed enzyme activity has been characterized in yeast. It is the first nudix hydrolase to be shown to be peroxisomal and only the second protein known in S. cerevisiae to be targeted by a PTS2 signal sequence. It will be of interest to determine if a deficiency in the human orthologue is associated with impaired peroxisomal function and disease.

	ACKNOWLEDGEMENTS

We thank M. C. Wilkinson for N-terminal sequencing and L. D. Barnes, J. H. Hegemann, and W.-H Kunau for the generous gift of materials.

	FOOTNOTES

^* This work was supported by Grant F25BJ from the Leverhulme Trust, by Grant 053038 from the Wellcome Trust, and by grants from Carl Zeiss Ltd. and the Higher Education Funding Council (to the Centre for Cell Imaging).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

^¶ To whom correspondence should be addressed. Tel.: 44-151-794-4369; Fax: 44-151-794-4349; E-mail: agmclen@liv.ac.uk.

Published, JBC Papers in Press, August 1, 2000, DOI 10.1074/jbc.M005015200

² The term "diphosphatase" is used here instead of "pyrophosphatase" in line with the expected recommendation of the IUPAC-IUB Commission on Biochemical Nomenclature.

³ S. R. Abdel Raheim and A. G. McLennan, unpublished observations.

⁴ L. Gasmi, J. L. Cartwright, and A. G. McLennan, unpublished observations.

	ABBREVIATIONS

The abbreviations used are: nudix, nucleoside diphosphate linked to another moiety, X; 3', 5'-ADP, 3'-phosphoadenosine 5'-monophosphate; CoASSCoA, coenzyme A disulfide; CoASSP, mixed disulfide of coenzyme A and 4'-phosphopantetheine; DTT, dithiothreitol; yEGFP, yeast-enhanced green fluorescent protein; , ORF, open reading frame; SC-Ura, synthetic complete medium without uracil; PCR, polymerase chain reaction.

	REFERENCES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

CiteULike

Complore

Connotea

Del.icio.us

Digg

Reddit

Technorati

This article has been cited by other articles:

				W. Xu, C. A. Dunn, S. F. O'Handley, D. L. Smith, and M. J. Bessman Three New Nudix Hydrolases from Escherichia coli J. Biol. Chem., August 11, 2006; 281(32): 22794 - 22798. [Abstract] [Full Text] [PDF]

				K. Okuda, H. Hayashi, and Y. Nishiyama Systematic Characterization of the ADP-Ribose Pyrophosphatase Family in the Cyanobacterium Synechocystis sp. Strain PCC 6803 J. Bacteriol., July 15, 2005; 187(14): 4984 - 4991. [Abstract] [Full Text] [PDF]

				S. M. J. Klaus, A. Wegkamp, W. Sybesma, J. Hugenholtz, J. F. Gregory III, and A. D. Hanson A Nudix Enzyme Removes Pyrophosphate from Dihydroneopterin Triphosphate in the Folate Synthesis Pathway of Bacteria and Plants J. Biol. Chem., February 18, 2005; 280(7): 5274 - 5280. [Abstract] [Full Text] [PDF]

				V. D. Antonenkov, R. T. Sormunen, and J. K. Hiltunen The rat liver peroxisomal membrane forms a permeability barrier for cofactors but not for small metabolites in vitro J. Cell Sci., November 1, 2004; 117(23): 5633 - 5642. [Abstract] [Full Text] [PDF]

				T. Nunoshiba, R. Ishida, M. Sasaki, S. Iwai, Y. Nakabeppu, and K. Yamamoto A novel Nudix hydrolase for oxidized purine nucleoside triphosphates encoded by ORFYLR151c (PCD1 gene) in Saccharomyces cerevisiae Nucleic Acids Res., October 8, 2004; 32(18): 5339 - 5348. [Abstract] [Full Text] [PDF]

				G. Ramaswamy, M. A. Karim, K. G. Murti, and S. Jackowski PPAR{alpha} controls the intracellular coenzyme A concentration via regulation of PANK1{alpha} gene expression J. Lipid Res., January 1, 2004; 45(1): 17 - 31. [Abstract] [Full Text] [PDF]

				W. Xu, J. Shen, C. A. Dunn, and M. J. Bessman A New Subfamily of the Nudix Hydrolase Superfamily Active on 5-Methyl-UTP (Ribo-TTP) and UTP J. Biol. Chem., September 26, 2003; 278(39): 37492 - 37496. [Abstract] [Full Text] [PDF]

				M. Dobrzanska, B. Szurmak, A. Wyslouch-Cieszynska, and E. Kraszewska Cloning and Characterization of the First Member of the Nudix Family from Arabidopsis thaliana J. Biol. Chem., December 20, 2002; 277(52): 50482 - 50486. [Abstract] [Full Text] [PDF]

				J. L. Cartwright, S. T. Safrany, L. K. Dixon, E. Darzynkiewicz, J. Stepinski, R. Burke, and A. G. McLennan The g5R (D250) Gene of African Swine Fever Virus Encodes a Nudix Hydrolase That Preferentially Degrades Diphosphoinositol Polyphosphates J. Virol., February 1, 2002; 76(3): 1415 - 1421. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) All Versions of this Article: 275/42/32925    most recent M005015200v1 Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Cartwright, J. L. Articles by McLennan, A. G. Search for Related Content PubMed PubMed Citation Articles by Cartwright, J. L. Articles by McLennan, A. G. Social Bookmarking                      What's this?