|
Originally published In Press as doi:10.1074/jbc.M006328200 on August 9, 2000
J. Biol. Chem., Vol. 275, Issue 42, 33059-33067, October 20, 2000
Central Leptin Regulates the UCP1 and ob
Genes in Brown and White Adipose Tissue via Different  -Adrenoceptor
Subtypes*
Scott P.
Commins ,
Patricia M.
Watson§,
Nancy
Levin¶,
Rudolph J.
Beiler§, and
Thomas W.
Gettys§
From the Departments of § Medicine and
Biochemistry and Molecular Biology, Division of
Gastroenterology and Hepatology, Medical University of South Carolina,
Charleston, South Carolina 29425 and ¶ Amgen Inc.,
Thousand Oaks, California 91320
Received for publication, July 17, 2000
 |
ABSTRACT |
The three known subtypes of  -adrenoreceptors
(1-AR, 2-AR, and
3-AR) are differentially expressed in brown and white
adipose tissue and mediate peripheral responses to central modulation of sympathetic outflow by leptin. To assess the relative roles of the
-AR subtypes in mediating leptin's effects on adipocyte gene
expression, mice with a targeted disruption of the
3-adrenoreceptor gene (3-AR KO) were
treated with vehicle or the 1/2-AR
selective antagonist, propranolol (20 µg/g body weight/day) prior to
intracerebroventricular (ICV) injections of leptin (0.1 µg/g body
weight/day). Leptin produced a 3-fold increase in UCP1 mRNA in
brown adipose tissue of wild type (FVB/NJ) and 3-AR KO
mice. The response was unaltered by propranolol in wild type mice, but
was completely blocked by this antagonist in 3-AR KO
mice. In contrast, ICV leptin had no effect on leptin mRNA in
either epididymal or retroperitoneal white adipose tissue (WAT) from
3-AR KOs. Moreover, propranolol did not block the
ability of exogenous leptin to reduce leptin mRNA in either WAT
depot site of wild type mice. These results demonstrate that the
3-AR is required for leptin-mediated regulation of
ob mRNA expression in WAT, but is interchangeable with
the 1/2-ARs in mediating leptin's effect
on UCP1 mRNA expression in brown adipose tissue.
| |
INTRODUCTION |
In mice the absence of leptin (ob/ob) or its functional
receptor (db/db) produces a complex metabolic syndrome
characterized by hyperphagia, endocrine abnormalities, and morbid
obesity (1). Deposition of excess body fat occurs even when food intake
is controlled, suggesting that an important function of leptin is to
regulate energy balance through modulation of metabolic efficiency. This view is supported by studies in ob/ob mice showing that
leptin-injected animals lose more weight than pair-fed vehicle-injected
littermates (2, 3). Of particular interest is the observation that
leptin-induced weight loss occurs specifically in adipose tissue with
little effect in other tissues (3, 4). The loss of adipose tissue is
associated with an increase in fat oxidation, and the associated shift
in fuel selection can be measured as a decrease in the respiratory quotient during leptin repletion (5, 6). Thus, adipose tissue is an
important target of leptin action and the primary effect is a shift
from fat storage to fat mobilization and oxidation.
This leptin-mediated shift in adipocyte function involves a coordinated
change in gene expression. Two mechanisms have been postulated and
include both centrally mediated effects and direct effects through
functional leptin receptors (Ob-Rb) on the adipocyte (7-9). It should
be noted, however, that although supraphysiologic levels of leptin are
capable of producing significant direct effects on adipose tissue (10,
11), increments of plasma leptin in the physiological range are thought
to act primarily through receptors in the hypothalamus (10). Occupancy
of hypothalamic leptin receptors promotes activation of the sympathetic
nervous system (12-15), and recent studies using surgical (16),
chemical (17), and transgenic approaches (18) have shown that
norepinephrine is required for leptin effects on gene expression in
both brown and white adipose tissue (19-22). Thus, several lines of
evidence support an emerging consensus that norepinephrine represents
the peripheral signal linking hypothalamic leptin receptors to
leptin-dependent changes in adipocyte gene expression.
Occupancy of each of the three known -adrenoreceptor
(-AR)1 subtypes leads to
activation of adenylyl cyclase in adipose tissue (23), but the
combination of unequal expression and differing affinities for
endogenous agonists has made it challenging to assess the relative
contributions of each receptor subtype in various physiological states.
Recent studies also demonstrate that -adrenoreceptor subtypes may be
differentially coupled to various functions within the adipocyte
(24-26). Therefore, we have attempted to identify the
-adrenoreceptor subtype(s) that mediate the effects of leptin on
gene expression in various adipose tissue depot sites. Using
intracerebroventricular injections of leptin in mice lacking
3-adrenoreceptors, we show that different complements of
-adrenoreceptor subtypes are required to transduce leptin's effects
on gene expression in white versus brown adipose tissue.
| |
EXPERIMENTAL PROCEDURES |
Experimental Animal Protocol--
Mice in each of the four
experiments described below were housed in pairs in solid-bottom cages
with continuous access to chow (Purina Mouse Chow, Ralston Purina, St.
Louis, MO) and water. Room temperature was maintained at 22-23 °C,
and the lights were on a 12-h light/dark cycle. The animals were
acclimated for 1-2 weeks prior to each study, and injected thereafter
with various agents according to protocols specified under each
experiment. All injections were given 2 h following the start of
the light cycle, and all mice were sacrificed 2 or 4 h after the
last injection in the series. Thereafter, interscapular BAT, as well as
epididymal, retroperitoneal, and inguinal WAT depots were carefully
removed, weighed, and used for preparation of total RNA or isolation of adipocytes.
Intracerebroventricular Injections--
Mice were anesthetized
by inhalation of isoflurane and a guarded, blank 27-gauge 0.5-inch
needle was used to create a guide injection site 0.7 mm posterior to
bregma and 1.0 mm lateral to midline at a depth of 4.0 mm (27). In the
experiments proper, a 10.0-µl Hamilton 1700 series gastight syringe
(Hamilton, Reno, NV) was used to inject artificial cerebrospinal fluid
(aCSF), murine leptin, or rat neuropeptide Y in a volume of 2-5 µl.
Correct positioning of the guide injection site was confirmed prior to the start of each experiment by monitoring feeding behavior following injection of neuropeptide Y (0.075 µg/g body weight). Mice failing to
respond to neuropeptide Y were removed from the experiment. aCSF,
consisting of 70 mM NaCl, 6 mM KCl, 0.7 mM CaCl2, 0.85 mM MgCl2, 0.75 mM Na2HPO4,
0.10 mM NaH2PO4, and 0.1%
untreated bovine serum albumin, was injected in a volume of 5 µl.
Thereafter, mice were monitored to ensure full recovery.
Experiment 1--
Seven-week-old male C57BL/6J mice were
obtained from Jackson Laboratories (Bar Harbor, ME) and acclimated for
2 weeks prior to the study. Thereafter, mice were injected ICV with
leptin (0.1 µg/g body weight/day) for 1, 2, or 3 days, and
representative mice were sacrificed 2 and 4 h following the
respective injections on each day. Separate groups of mice received
intraperitoneal injections of CL-316,243 (1 µg/g body weight/day) for
1 or 2 days, and were sacrificed 2 h after injection. Control mice
were injected ICV with aCSF. Interscapular BAT, as well as epididymal,
retroperitoneal, and inguinal WAT depots were removed, weighed, and
used to prepare total RNA as described previously (19).
Experiment 2--
Seven-month-old male FVB/NJ (WT) mice and
age-matched FVB/NJ male mice with a targeted disruption of the
3-adrenoreceptor (3-AR KO) gene (28) were
acclimated as described above and equal numbers of each phenotype were
randomly assigned to one of four treatment groups. The mice in group 1 received ICV injections of aCSF for 3 days, and food was provided
ad libitum. Mice in group 2 received ICV injections of mouse
leptin (0.1 µg/g body weight/day), while group 3 received ICV leptin
(0.1 µg/g body weight/day) in combination with intraperitoneal
injections of propranolol (20 µg/g body weight/day). Food was
provided ad libitum, and intake was measured. Mice in group
4 received intraperitoneal injections of propranolol (20 µg/g body
weight/day) for 3 days and were pair-fed to the mean intake of mice in
groups 2 and 3. Two h after the final injection, the mice were
sacrificed and tissues processed as described above.
Experiment 3--
Seven-month-old male FVB/NJ mice and
age-matched 3-AR KO male mice were acclimated as
described above. Thereafter, the WT and 3-AR KO mice
were sacrificed, and the adipose tissue depot sites were carefully
removed and used for cell isolation and membrane preparation as
described below.
Experiment 4--
Male C57BL/6J (ob/ob) mice and
their lean littermates (+/?) were obtained from Jackson
Laboratories at 6 weeks of age and randomly assigned to one of two
treatment groups. The mice were housed individually at 23 °C and
equilibrated for 4 days before beginning the experiment. On the morning
of the 5th day and for 2 mornings thereafter, half the mice in each
phenotype received intraperitoneal injections of recombinant mouse
leptin (20 µg/g body weight/day), while the remaining mice in each
phenotype received vehicle injections. Within each phenotype, the mice
receiving vehicle were pair-fed with the mice receiving leptin. Three h following the final injections on day 7, the mice were weighed, sacrificed, and adipose tissue processed as described previously.
Experiment 5--
Seven-month-old male FVB/NJ mice and
age-matched 3-AR KO male mice were acclimated as
described above. Thereafter, half of the WT and 3-AR KO
mice were moved to 4 °C environmental chambers while the remaining
mice in each group were maintained at 23 °C. After 4 h, all
mice were sacrificed, and the adipose tissue depot sites were carefully
removed and used for isolation of total RNA.
Ribonuclease Protection Assay--
RNA probes complementary to
UCP1 mRNA and leptin mRNA were prepared, labeled, and used as
described previously to assay the respective mRNA species (18, 19).
Using the same method, a 3-AR probe was produced by
reverse transcription-polymerase chain reaction (5' to 3'; forward,
accccagtgcagccaacacca; reverse, cgcaaccagtttcgcccaagg), purified, and
cloned into the pGEM-3Z riboprobe vector (Promega, Madison, WI). The
identity of the cloned fragment was confirmed by sequencing, and it
corresponded to nucleotides 630-890, producing a protected fragment of
261 base pairs. 1- and 2-AR probes
corresponding to nucleotides 534-971 and 789-971 of the rat
1- and 2-AR cDNAs, respectively, were
obtained from Dr. James Granneman (29). The concentration of UCP1,
leptin, and 1-, 2-, and
3-AR mRNA in each sample was determined by
comparison to known amounts of sense strand fragments for each gene
that were hybridized simultaneously in the ribonuclease protection
assay. After autoradiography and densitometry, standard curves were
constructed for each gene and used to estimate mRNA concentrations
in unknown samples as described previously (18).
Isolation of Adipocytes and Preparation of Plasma
Membranes--
White adipocytes were prepared from pooled epididymal,
retroperitoneal, and inguinal fat pads of 8-month-old WT FVB/NJ and 3-AR KO mice by collagenase treatment according to
Rodbell (30) with slight modification (31). The cells were washed and
resuspended in Krebs-Henseleit-HEPES buffer (pH 7.4), then broken in a
Dounce homogenizer in 10 mM TES (pH 7.0) containing 0.25 M sucrose. Crude membranes were collected following
centrifugation at 48,000 × g for 20 min and stored at
 80 °C. Interscapular brown adipose tissue was carefully dissected
free of surrounding tissue, finely minced with scissors, and washed in
Krebs-Henseleit-HEPES buffer (pH 7.4). Following centrifugation at
1000 × g, the infranatant was aspirated and the fat
cells resuspended in 10 mM TES (pH 7.0) containing 0.25 M sucrose. The brown fat cells were then broken using an
overhead stirrer and filtered through nylon mesh, and crude membranes
were collected following an initial low speed spin to remove unbroken
cells and nuclei. The crude membranes were resuspended and stored at
80 °C.
Competition Binding Assay for 1- and
2-AR--
Radioligand binding assays were conducted
with adipocyte membranes using our modification (32) of previously
described methods (32-34). Briefly, 20 µg of white and 40 µg of
brown adipocyte membranes were incubated at 37 °C for 1 h with
30 pM 125I-cyanopindolol (ICYP) in 25 mM HEPES buffer (pH 7.4) containing 12.5 mM
MgCl2, and increasing concentrations of the
1-AR-specific antagonist, CGP-20712A (RBI, Natick, MA).
Bound ICYP was collected on filters in a Skatron cell harvester
(Molecular Devices, Sunnyvale, CA), and the components of
1-AR and 2-AR binding of ICYP were resolved by fitting a two-site competition curve to the data by least
squares (Prizm; Graphpad Software, San Diego, CA) and analyzed as
described previously (32).
Adenylyl Cyclase Assay--
Adenylyl cyclase (AC) activity was
determined in adipocyte membranes using combinations of receptor
subtype selective agonists and antagonists to assess the functional
activity of each receptor subtype (31, 32, 35). The 3-AR
antagonist, SR 59230A (36) was obtained from Dr. Luciano Manara (Sanofi
Midy, Milan, Italy) and solubilized in ethylene glycol at 200 µg/ml.
The antagonist was used at a final concentration of 10 µM
as reported previously (36). Other agonists and antagonists were from
commercial sources.
Methods of Analysis--
One-way analysis of variance was used
to compare group means for UCP1 mRNA, leptin mRNA,
1-AR mRNA, 2-AR mRNA,
3-AR mRNA, adenylyl cyclase activity, and ICYP
binding in the respective experiments for each variable. The level of
protection against type I errors was set at 5%, and P
values for specific treatment comparisons are presented under
"Results."
Materials--
All reagents, except where noted, were obtained
from Sigma and were of the highest reagent grade. T1-RNase and Trizol
LS reagent were from Life Technologies, Inc. Oligonucleotide primers
and DNA sequencing were generated at the DNA Core Facility at the Medical University of South Carolina. [ -32P]CTP and
[125I]iodocyanopindolol were purchased from PerkinElmer
Life Sciences. 1-Chloro-2,2,2-trifluoroethyl difluoromethyl
ether (isoflurane) was from Ohmeda PPD (Liberty Corner, NJ). CL-316,243
was a gift from Wyeth Ayerst Research (Princeton, NJ). Recombinant
methionyl mouse leptin was kindly provided by Amgen (Thousand Oaks,
CA). The 3-adrenoreceptor antagonist SR59230A was kindly
provided by Dr. Luciana Manara (Sanofi, Italy). Breeding pairs of the
3-AR KO mice (28)were kindly provided by Dr. Brad Lowell
(Beth Israel Hospital, Boston, MA).
| |
RESULTS |
Time Course of Central Leptin Effects on BAT UCP1 in C57BL/6J
Mice--
To determine the time course for leptin's effects on UCP1
expression in BAT and distinguish between central versus
peripheral effects of the peptide, mice were given ICV injections of
leptin or artificial CSF and sacrificed 2 and 4 h later on
successive days. This protocol complemented our normal treatment
regimen of 3 days and revealed that leptin increased UCP1 mRNA 2 and 4 h after the initial injection on day 1 (Fig.
1). The ~2-fold increase was maximal
4 h after leptin injection and comparable to the increase produced
by the 3-adrenoreceptor selective agonist, CL316,243 (data not shown). Similar results were observed on day 2, but, because
a somewhat larger increase in UCP1 mRNA was seen on day 3, the
3-day injection protocol was adopted for subsequent studies (see Fig.
2). These results confirm that the effect
of leptin was both rapid and centrally mediated, and they are
consistent with our previous work showing that leptin regulates gene
expression in adipose tissue through a central site of action (18).
View larger version (74K):
[in this window]
[in a new window]
|
Fig. 1.
Ribonuclease protection assay of UCP1
mRNA from BAT of C57BL/6J mice. 0.5 µg of total RNA from BAT
was hybridized with an antisense probe for UCP1 mRNA (nucleotides
7-300) and 18 S rRNA (nucleotides 715-794). Mice were injected ICV
with either aCSF (5 µl) or leptin (Lep, 2 µg) for 1 day
and sacrificed either 2 or 4 h following injection as described
under "Experimental Procedures." The relative abundance of UCP1
mRNA was quantitated by comparing the densitometric intensities of
protected fragments from each treatment group to known amounts of sense
strand transcripts that were hybridized simultaneously. Individual RNA
samples from each animal were analyzed to calculate group means, and
representative samples are presented in the figure (aCSF, 1.71 ± 0.04 fmol of UCP1 mRNA/µg of RNA, n = 3; leptin
at 2 h, 2.32 ± 0.16 fmol of UCP1 mRNA/µg of RNA,
n = 6; leptin at 4 h, 2.94 ± 0.29 fmol of
UCP1 mRNA/µg of RNA, n = 6).
|
|
View larger version (58K):
[in this window]
[in a new window]
|
Fig. 2.
Ribonuclease protection assay of UCP1
mRNA from BAT of FVB/NJ (A) and
3-AR KO mice (B).
0.5 µg of total RNA from BAT was hybridized with an antisense probe
for UCP1 mRNA (nucleotides 7-300) and 18 S rRNA (nucleotides
715-794). Mice were injected ICV with either aCSF (5 µl) or leptin
(2 µg), in the presence and absence of intraperitoneally injected
propranolol (20 µg/g body weight/day) for 3 days and sacrificed
2 h following the final injection as described under
"Experimental Procedures." The relative abundance of UCP1 mRNA
was quantitated by comparing the densitometric intensities of protected
fragments from each treatment group to known amounts of sense strand
transcripts that were hybridized simultaneously. Individual RNA samples
from each animal were analyzed to calculate group means and
representative samples are presented in the figure. A, aCSF,
0.51 ± 0.1 fmol of UCP1 mRNA/µg of RNA, n = 3; leptin, 2.26 ± 0.21 fmol of UCP1 mRNA/µg of RNA,
n = 4; propranolol, 0.25 ± 0.06 fmol of UCP1
mRNA/µg of RNA, n = 4; propranolol + leptin,
1.1 ± 0.12 fmol of UCP1 mRNA/µg of RNA, n = 5. B, 3-AR KO aCSF, 0.51 ± 0.04 fmol of
UCP1 mRNA/µg of RNA, n = 3; 3-AR
KO leptin, 1.76 ± 0.26 fmol of UCP1 mRNA/µg of RNA,
n = 5; 3-AR KO propranolol, 0.70 ± 0.10 fmol of UCP1 mRNA/µg of RNA, n = 4;
3-AR KO propranolol + leptin, 0.89 ± 0.12 fmol of
UCP1 mRNA/µg of RNA, n = 5. Veh,
vehicle; Lep, leptin; Prop, propranolol;
P+L, propranolol + leptin.
|
|
Effect of Leptin on BAT UCP1 in 3-KO Mice--
The
purpose of experiment 2 was to determine whether the absence of the
3-AR in both BAT and WAT would compromise the ability of
centrally administered leptin to regulate gene expression in each depot
site. A secondary objective was to determine whether the
1/2-ARs could substitute for the missing
3-AR or whether -adrenoreceptors might also be
involved in mediating the response. WT age-matched FVB/NJ mice served
as positive controls and responded to ICV-injected leptin with a
4-5-fold increase in UCP1 mRNA in BAT (p < 0.01, Fig. 2A). Intraperitoneal injection of propranolol to block
1/2-ARs reduced basal expression of UCP1
mRNA in WT mice, but did not block leptin's ability to induce UCP1
mRNA expression by 4-fold (p < 0.01, Fig.
2A). These results suggest that the 1/2-ARs and 3-ARs are
interchangeable with respect to their ability to mediate central
effects of leptin on UCP1 expression. This conclusion is supported by
results from the 3-AR KO mice, which show that central
leptin produced a 3-4-fold increase in UCP1 mRNA
(p < 0.01, Fig. 2B), and the finding that
propranolol completely blocked the ability of leptin to increase UCP1
mRNA in BAT from these animals (p < 0.01, Fig.
2B). These findings also make the case that
-adrenoreceptors are not involved in the response and that
-adrenoreceptors are the primary adrenergic receptors mediating the
effects of leptin on UCP1 mRNA.
Effect of ICV Leptin on Leptin mRNA in WAT--
To test the
hypothesis that centrally administered leptin regulates its own
expression in WAT, we measured leptin mRNA in epididymal and
retroperitoneal depot sites from WT and 3-AR KO mice
treated with leptin. The two sites were chosen as being representative of WAT depots that respond differently to adrenergic stimulation (19).
In WT mice, ICV leptin produced a highly significant reduction (p < 0.01) of leptin mRNA in epididymal WAT from
0.021 ± 0.003 fmol of leptin mRNA/µg of RNA to 0.005 ± 0.002 fmol/µg of RNA (Fig.
3A). A similar reduction in
leptin mRNA (p < 0.001) was noted in the
retroperitoneal WAT depot of these mice (Fig.
4A). Figs. 3A and
4A show that propranolol produced a modest increase in basal
leptin mRNA in both depot sites of WT mice (p < 0.05), but did not impair leptin's ability to decrease expression of its own message in either site (Figs. 3A and 4A).
In contrast, ICV leptin failed to decrease leptin mRNA in
epididymal or retroperitoneal WAT from 3-KO mice (Figs.
3B and 4B). Propranolol alone produced a slight
increase in leptin mRNA in both depot sites of 3-AR KO mice (p < 0.05), and treating these mice with
propranolol and leptin produced no additional change in leptin mRNA
(Figs. 3B and 4B). The failure of ICV leptin to
down-regulate leptin mRNA in WAT from 3-KO mice
coupled with the inability of propranolol to block leptin's ability to
down-regulate leptin mRNA in WT mice indicates that the
3-adrenoreceptor is both necessary and sufficient for
mediation of this response.
View larger version (60K):
[in this window]
[in a new window]
|
Fig. 3.
Ribonuclease protection assay of leptin
mRNA from epididymal WAT of FVB/NJ (A) and
3-AR KO mice (B).
Total RNA from epididymal WAT of wild type (5.0 µg) and
3-AR KO (2.0 µg) mice, respectively, was hybridized
with an antisense probe for leptin mRNA (nucleotides 1-355) and 18 S rRNA (nucleotides 715-794). Mice were injected ICV with either aCSF
(5 µl) or leptin (2 µg), in the presence and absence of
intraperitoneally injected propranolol (20 µg/g body weight/day) for
3 days and sacrificed 2 h following the final injection as
described under "Experimental Procedures." The relative abundance
of leptin mRNA was quantitated by comparing the densitometric
intensities of protected fragments from each treatment group to known
amounts of sense strand transcripts that were hybridized
simultaneously. Individual RNA samples from each animal were analyzed
to calculate group means, and representative samples are presented in
the figure. A, aCSF, 0.021 ± 0.003 fmol of leptin
mRNA/µg of RNA, n = 3; leptin, 0.005 ± 0.002 fmol of leptin mRNA/µg of RNA, n = 4;
propranolol, 0.058 ± 0.013 fmol of leptin mRNA/µg of RNA,
n = 4; propranolol + leptin, 0.008 ± 0.003 fmol
of leptin mRNA/µg of RNA, n = 5. B,
3-AR KO aCSF, 0.072 ± 0.015 fmol of leptin
mRNA/µg of RNA, n = 3; 3-AR KO
leptin, 0.082 ± 0.017 fmol of leptin mRNA/µg of RNA,
n = 5; 3-AR KO propranolol, 0.123 ± 0.016 fmol of leptin mRNA/µg of RNA, n = 4;
3-AR KO propranolol + leptin, 0.099 ± 0.012 fmol
of leptin mRNA/µg of RNA, n = 5. Veh,
vehicle; Lep, leptin; Prop, propranolol;
P+L, propranolol + leptin.
|
|
View larger version (57K):
[in this window]
[in a new window]
|
Fig. 4.
Ribonuclease protection assay of leptin
mRNA from retroperitoneal WAT of FVB/NJ (A)
and 3-AR KO mice
(B). Total RNA from retroperitoneal WAT of wild
type (5.0 µg) and 3-AR KO (2.0 µg) mice was
hybridized with an antisense probe for leptin mRNA (nucleotides
1-355) and 18 S rRNA (nucleotides 715-794). Mice were injected ICV
with either aCSF (5 µl) or leptin (2 µg), in the presence and
absence of intraperitoneally injected propranolol (20 µg/g body
weight/day) for 3 days and sacrificed 2 h following the final
injection as described under "Experimental Procedures." The
relative abundance of leptin mRNA was quantitated by comparing the
densitometric intensities of protected fragments from each treatment
group to known amounts of sense strand transcripts that were hybridized
simultaneously. Individual RNA samples from each animal were analyzed
to calculate group means, and representative samples are presented in
the figure. A, aCSF, 0.012 ± 0.004 fmol of leptin
mRNA/µg of RNA, n = 3; leptin, 0.002 ± 0.001 fmol of leptin mRNA/µg of RNA, n = 4;
propranolol, 0.035 ± 0.008 fmol of leptin mRNA/µg of RNA,
n = 4; propranolol + leptin, 0.003 ± 0.001 fmol
of leptin mRNA/µg of RNA, n = 5. B,
3-AR KO aCSF, 0.070 ± 0.009 fmol of leptin
mRNA/µg of RNA, n = 3; 3-AR KO
leptin, 0.083 ± 0.017 fmol of leptin mRNA/µg of RNA,
n = 5; 3-AR KO propranolol, 0.103 ± 0.019 fmol of leptin mRNA/µg of RNA, n = 4;
3-AR KO propranolol + leptin, 0.096 ± 0.015 fmol
of leptin mRNA/µg of RNA, n = 5. Veh,
vehicle; Lep, leptin; Prop, propranolol;
P+L, propranolol + leptin.
|
|
Additional data that support the importance of the 3-AR
in regulating leptin expression can be found by comparing leptin mRNA and serum leptin in WT and 3-AR KO mice. If our
hypothesis is correct, the absence of the 3-AR should
lead to up-regulation of leptin mRNA. The data from epididymal WAT
support this conclusion by showing that leptin mRNA is ~3-fold
higher (p < 0.01) in the 3-AR KOs
compared with the WT mice (WT (0.021 ± 0.003 fmol of leptin
mRNA/µg of RNA) versus 3-AR KO
(0.072 ± 0.005 fmol/µg of RNA)). The difference was even more
striking in the retroperitoneal depot, where leptin mRNA was 5-fold
higher in 3-AR KO compared with WT mice (WT (0.012 ± 0.004 fmol/µg of RNA) versus 3-AR KO (0.070 ± 0.009 fmol/µg of RNA)). Circulating leptin levels were also higher (p < 0.05) in 3-AR KOs
(8.7 ± 0.4 ng/ml) compared with WT mice (5.6 ± 0.4 ng/ml),
although the magnitude of the difference was less than that noted with
leptin mRNA. Taken together, the results support the conclusion
that the absence of the 3-AR leads to up-regulation of
leptin expression.
Existence and Functionality of 1- and
2-AR in FVB/NJ and 3-AR KO Mice--
The
results from experiment 2 support the conclusion that there are
tissue-specific differences in the requirement for the 3-AR in mediating leptin effects on gene expression.
This interpretation is based on the assumption of comparable expression
patterns and functionality of the 1/2-ARs
in BAT and WAT between the WT and 3-AR KO mice. To
address this question, we compared 1- and
2-AR mRNA levels and ICYP binding to
1- and 2-ARs in adipose tissue from both
phenotypes. Fig. 5 shows that mRNA
levels of both 1- and 2-AR mRNA are
reduced ~2-fold (p < 0.01) in BAT of
3-AR KO mice compared with WT mice (1-AR
WT, 0.021 ± 0.003 fmol/µg of RNA; 3-AR KO,
0.009 ± 0.002 fmol/µg of RNA; 2-AR WT,
0.036 ± 0.008 fmol/µg of RNA; 3-AR KO,
0.013 ± 0.006 fmol/µg of RNA). In epididymal WAT (Fig. 5), a
similar 2-fold decrease (p < 0.05) in
1-AR mRNA was noted in 3-AR KOs
(0.019 ± 0.002 fmol/µg of RNA) compared with WT mice
(0.041 ± 0.003 fmol/µg of RNA). In contrast,
2-AR mRNA was significantly increased
(p < 0.05) in 3-AR KOs (0.178 ± 0.024 fmol/µg) compared with WT mice (0.009 ± 0.001 fmol/µg).
View larger version (75K):
[in this window]
[in a new window]
|
Fig. 5.
Ribonuclease protection assay of
1- and
2-AR mRNA from BAT and epididymal
WAT of FVB/NJ and 3-AR KO
mice. 15.0 µg of total RNA from BAT and EWAT of wild type and
3-AR KO mice was hybridized with antisense probes for
1-AR mRNA (nucleotides 534-971) and
2-AR mRNA (nucleotides 789-971), and 18 S rRNA
(nucleotides 715-794). The relative abundance of 1- and
2-AR mRNA was quantitated by comparing the
densitometric intensities of protected fragments from each treatment
group to known amounts of sense strand transcripts that were hybridized
simultaneously. Individual RNA samples from each animal were analyzed
to calculate group means and representative samples are presented in
the figure. BAT, 1-AR mRNA WT, 0.021 ± 0.003 fmol/µg of RNA, n = 3; 3-AR
KO, 0.009 ± 0.002 fmol/µg of RNA, n = 4;
2-AR mRNA WT, 0.036 ± 0.008 fmol/µg of RNA,
n = 4; 3-AR KO, 0.013 ± 0.006 fmol/µg of RNA, n = 3. WAT,
1-AR mRNA WT, 0.041 ± 0.003 fmol/µg of RNA,
n = 3; 3-AR KO, 0.019 ± 0.002 fmol/µg of RNA, n = 4; 2-AR mRNA
WT, 0.009 ± 0.001 fmol/µg of RNA, n = 4;
3-AR KO, 0.178 ± 0.024 fmol/µg of RNA,
n = 4).
|
|
To evaluate whether the observed changes in mRNA levels are
reflected by comparable changes in 1-AR and
2-AR binding capacity, we used a competition radioligand
binding approach with ICYP in the presence of the selective
3-AR agonist, CL316,243, to eliminate low affinity
binding of ICYP to 3-ARs (37). Then, using crude membrane preparations from brown and white adipocytes of each phenotype, the highly selective 1-AR antagonist,
CGP-20712A, which displays ~1000-fold selectivity for
1-AR over 2-AR (38), was used to resolve
ICYP binding into the components contributed by the 1-
and 2-AR subtypes (Fig. 6,
A and B). With ICYP at 30 pM (Fig.
6A), total ICYP bound by both 1- and
2- ARs in white adipocyte membranes was similar between
WT FVB/NJ (21.3 ± 0.5 fmol/mg of protein) and 3-AR
KO mice (19.7 ± 0.3 fmol/mg of protein). The high affinity
binding component of the curves, resolved by curve fitting and defined
as the 1-AR, accounted for 26% (5.6 ± 0.6 fmol/mg) of the total binding sites in membranes from WT FVB/NJ mice.
In 3-AR KO mice, the high affinity component accounted for 19% (3.8 ± 0.5 fmol/mg) of total ICYP binding (Fig.
6A). The second component of the curves represents ICYP
bound by the 2-AR and represents the remaining binding
sites (WT FVB/NJ, 74%; 3-AR KO, 81%). Although the
total ICYP bound to white adipocyte membranes did not differ between
the two groups, comparison of the respective binding curves using an
F test indicated that the proportion of binding sites
contributed by the 1- and 2-AR subtypes
in each group was significantly different (p < 0.01).
Thus, the modest decrease in 1-AR binding sites and
increase in 2-AR binding sites noted in the
3-AR KOs (Fig. 6A) are consistent with the observed changes in 1- and 2-AR mRNA
levels in this group (Fig. 5) compared with the WT mice.
View larger version (15K):
[in this window]
[in a new window]
|
Fig. 6.
Competition binding analysis to resolve
1- and
2-AR binding in adipocyte membranes
from FVB/NJ and 3-KO mice.
Adipocyte membranes (40 µg) were incubated for 1 h at 37 °C
with 30 pM 125I-CYP and increasing
concentrations of the 1-AR-specific antagonist,
CGP-20712A. Bound 125I-CYP was collected on filters in a
Skatron cell harvester and counted. The components of
125I-CYP binding were resolved by fitting a two-site
competition curve to the data by least squares as described under
"Experimental Procedures." Fitted curves are representative of
three experiments. A, binding from WAT membranes of WT ( )
and 3-AR KO ( ) mice. B, binding from BAT
membranes of WT () and 3-KO mice ().
|
|
In the case of BAT, total ICYP binding did not differ between WT FVB/NJ
(18.6 ± 0.3 fmol/mg) and 3-AR KO mice (17.5 ± 0.4 fmol/mg, Fig. 6B). The high affinity
1-AR component comprised 27% (5.0 ± 0.6 fmol/mg)
of total binding sites in WT FVB/NJ membranes and 28% (4.9 ± 0.4 fmol/mg) of total binding sites in the 3-AR KO group
(Fig. 6B). The remaining 2-AR binding sites
comprised 73% and 72% of total ICYP binding in BAT membranes from WT
and 3-AR KO mice, respectively. In contrast to WAT,
where subtle alterations were noted, we found no evidence of a change
in the proportion of 1- or 2-AR binding
sites in BAT between the groups (Fig. 6B). In contrast to
WAT, where binding and mRNA results were consistent, the similarity
in binding capacity was not reflective of the observed group
differences in BAT 1- and 2-AR mRNA
levels (Fig. 5).
Functionality of 1- and 2-ARs in
Adipocyte Membranes of FVB/NJ and 3-KO Mice--
The
third component of studies in experiment 3 was to assess the functional
coupling of 1- and 2-ARs to AC in
adipocyte membranes from the two groups. The goal of these studies was
to complement the binding studies by testing the hypothesis that expressed -adrenoreceptor subtypes are equivalently coupled to AC in
each group. Clarification of this point would rule out altered expression or effector coupling of 1- or
2-ARs as the basis for the differential requirements of
receptor subtypes in regulating gene expression between BAT and WAT
that was shown in experiment 2. To that end, combinations of
nonselective and selective receptor agonists and antagonists were used
in a systematic attempt to evaluate the relative contributions of the
1/2-ARs and 3-ARs in
activating AC in adipocyte membranes from each group. As shown in Table
I, basal AC activity in white and brown
adipocyte membranes did not differ between WT and 3-AR
KO mice. As judged by forskolin stimulation, total AC activity in BAT
and WAT was also unaffected by the absence of the 3-AR
(Table I). The selective 3-AR antagonist, SR59230A, and
the selective 1/2-AR antagonist,
propranolol, were used in combination with isoproterenol to show that
the 1/2-ARs accounted for between 10%
and 30% of the total AC activation elicited by isoproterenol in WAT
and BAT membranes from WT mice, respectively (Table I). A similar
assessment of receptor subtype contribution was reached with
epinephrine, which was used at 1 µM to fully activate the
1- and 2-ARs without significantly
activating the 3-AR (Table I). Using both strategies, AC
activation attributable to the 1/2-ARs in
membranes from WT mice was similar to the stimulation of AC activity in
3-AR KO mice that is solely attributable to the
1/2-ARs (Table I). Taken together, these
data establish the presence and functionality of 1- and
2-ARs on brown and white adipocytes in
3-AR KO mice at levels that are comparable to those in
WT mice.
View this table:
[in this window]
[in a new window]
|
Table I
Relative contributions of -adrenoceptor subtypes to activation of
adenylyl cyclase in brown and white adipocyte membranes from control
and 3-adrenoceptor knockout mice
BAT and WAT were isolated from control and 3-adrenoceptor
knockout mice as described under "Experimental Procedures." Crude
adipocyte membranes were obtained from each genotype and tissue type
and assayed for adenylyl cyclase activity under conditions designed to
assess the relative contribution of each receptor subtype to cyclase
activation. The means and their standard errors were from four
replicate assays on two separate membrane preparations.
|
|
Effect of Leptin on Leptin mRNA in ob/ob Mice--
A practical
test of our conclusion that the 3-AR is required for
leptin-dependent regulation of leptin mRNA in WAT can
be made with the ob/ob mouse. This follows from our previous
demonstration that expression of the 3-AR is severely
compromised in both brown and white adipocytes from ob/ob
mice (35). Ob/ob mice are also particularly well suited for
this purpose because of the absence of functional leptin and the
resulting sensitivity to leptin replacement. Results from experiment 4 show that treatment of ob/ob mice for 3 days with leptin
failed to reduce leptin mRNA in either retroperitoneal or
epididymal WAT (Fig. 7). Similar
treatment of lean mice produced a 6-7-fold reduction in leptin
mRNA in both sites (Fig. 7 and Table
II). The reduction in 3-AR
mRNA in WAT from the ob/ob mice used here was on the
order of 50-100-fold (Table II). These findings are consistent with
and support our conclusion that the 3-AR is required for
leptin-dependent regulation of leptin mRNA in WAT. To
test whether the requirement for the 3-AR is specific to
WAT or specific to the gene being regulated, we examined the effect of
leptin in BAT from the same mice. Expression of the 3-AR
is also compromised in BAT from ob/ob mice (Table II), so if
the effect is dependent on the 3-AR, regardless of site,
we would predict that leptin mRNA would not be reduced by leptin in
BAT. Quite the contrary, BAT from the same ob/ob mice showed a significant reduction in leptin mRNA following leptin treatment (vehicle, 0.020 ± 0.001 fmol/µg of RNA; leptin, 0.007 ± 0.001 fmol/µg of RNA). Collectively, these results indicate that
regulation of leptin expression requires the 3-AR in WAT
but is capable of using the 1/2-AR in
BAT.
View larger version (69K):
[in this window]
[in a new window]
|
Fig. 7.
Ribonuclease protection assay of leptin
mRNA from epididymal and retroperitoneal WAT of lean and
ob/ob mice. 2.0 µg of total RNA from epididymal
WAT (EWAT) and retroperitoneal WAT (RPWAT) of
lean and ob/ob mice was hybridized with an antisense probe
for leptin mRNA (nucleotides 1-355) and 18 S rRNA (nucleotides
715-794). The relative abundance of leptin mRNA was quantitated by
comparing the densitometric intensities of protected fragments from
each treatment group to known amounts of sense strand transcripts that
were hybridized simultaneously. Individual RNA samples from each animal
were analyzed to calculate group means presented in Table II.
|
|
View this table:
[in this window]
[in a new window]
|
Table II
3-Adrenoceptor and leptin mRNA from lean and ob/ob mice
treated with leptin
Lean and ob/ob mice received intraperitoneal injections of
vehicle or murine leptin (20 µg/g body weight/day) on each of three
successive days as described under "Experimental Procedures." 2.0 µg and 10.0 µg of total RNA from WAT and BAT, respectively, was
hybridized with an anti-sense probe for leptin mRNA (nucleotides
1-355) or 3-AR mRNA (nucleotides 630-890). A probe for
18 S rRNA (nucleotides 715-794) was included to correct for
differences in total RNA loaded. The relative abundance of mRNA was
quantitated by comparing the densitometric intensities of protected
fragments from each treatment group to known amounts of sense strand
transcripts that were hybridized simultaneously. Individual RNA samples
from each animal were analyzed to calculate group means, which are
presented in the table. The data were subjected to analysis of
variance. Mean values are expressed as femtomoles of protected
mRNA/µg of total RNA ± S.E. EWAT, epididymal WAT; RPAT,
retroperitoneal WAT; IBAT, interscapular BAT.
|
|
Effect of Cold Exposure on Adipocyte Gene Expression in
3-AR KO Mice--
A more general test of our hypothesis
that the sympathetic nervous system utilizes different complements of
-adrenoreceptors to mediate the effects of norepinephrine in white
versus brown adipose tissue can be made by exposing
3-AR KO mice to cold. In experiment 5, the
3-AR KOs adapted to cold exposure readily and increased
UCP1 mRNA to the same extent as their WT controls (data not shown).
This finding agrees with observations made by the original developers
of this transgenic mouse line (28), but of particular interest is our
finding that cold exposure does not reduce leptin mRNA in WAT of
3-AR KO mice (room temperature, 0.056 ± 0.009 fmol/µg RNA; 4 °C, 0.094 ± 0.015 fmol/µg RNA). In contrast, 4 h of cold exposure in WT mice reduced leptin mRNA to the detection limit of the assay (data not shown). Taken together, these studies show that the 3-AR is required to
transduce the effects of changes in sympathetic outflow on leptin
expression in WAT. As noted with ICV leptin, the
1/2-AR is capable of substituting for the
3-AR in mediating sympathetic effects of leptin on gene expression in BAT.
| |
DISCUSSION |
In the present study, we have used the ICV route of administration
to study centrally-mediated effects of leptin on gene expression in
adipose tissue. The technique was used with mice lacking
3-adrenoreceptors (3-AR KO) to evaluate
the involvement of this and other adrenoreceptor subtypes in mediating
peripheral effects of leptin. This experimental approach is based on an
emerging consensus that leptin regulates adipocyte function through
central modulation of the sympathetic nervous system. The initial
evidence came from a study showing that leptin increased norepinephrine
turnover in BAT (12), and was followed by studies mapping the neural
pathways within the sympathetic nervous system activated by leptin
(13-15). Subsequent studies have shown that surgical (16), chemical
(17, 39), or genetic (18) sympathectomy blocked leptin's effects on
gene expression in both BAT and WAT. The latter studies established a
requirement for the long form of the leptin receptor (Ob-Rb), but did
not distinguish between central versus peripheral sites of
action for leptin. The requirement of norepinephrine (18) suggested
that central leptin receptors were activated, but the involvement of
peripheral leptin receptors that communicate with the brain by afferent
autonomic nerves (40, 41) could not be excluded. Results from the
present study argue that peripheral leptin receptors are not required
for leptin's effects on adipocyte gene expression, and make the case
that central leptin receptors mediate the observed effects on UCP1
mRNA in BAT and leptin mRNA in WAT. Additionally, based on the
comparable magnitude of the effects produced by central
versus peripheral administration of leptin in our studies,
it seems reasonable to assume that peripherally injected leptin is
primarily working through central leptin receptors. Taken together, the
evidence is compelling that leptin regulates adipocyte gene expression
through central modulation of sympathetic nervous system outflow. The
premise that norepinephrine is the peripheral mediator of leptin action
is the basis for using the present experimental approach to deduce
which adrenoreceptor(s) mediate the respective responses in brown and
white adipose tissue.
Several recent studies have suggested the existence of a putative
4-AR based on interpretation of pharmacological profiles from adipocytes expressing the 3-AR at various levels
(42-44). The existence of a fourth -adrenoreceptor could complicate
interpretation of the present experiments, which assume the existence
of only three -adrenoreceptors. The evidence for a
4-AR centers around the observation that CGP12177A, a
partial agonist of the 3-AR and antagonist of
1/2-ARs, activates lipolysis in
adipocytes containing little or no 3-AR (42, 43).
Complementing this result is the observation that
1-AR-selective or nonselective -AR antagonists block
this response while the 3-AR-selective antagonist,
SR59230, does not (43). It should be noted, however, that the
documented heterogeneity in the relationship between binding affinity
and coupling efficiency with ligands for -adrenoreceptor subtypes
complicates interpretation of pharmacological approaches in adipoyctes
(45-49). Such seems possible with CGP12177 after the careful studies
of Konkar et al. (50) have systematically documented an
unexpected activation of the 1-AR by this ligand. Thus
it is unnecessary to invoke the existence of a 4-AR to
explain the results obtained with CGP12177 if its binding to the
1-AR results in partial activation. In the present
study, conclusions regarding requirements for specific -receptors in
WAT and BAT are not predicated on the existence of the putative
4-AR because of the adequacy of a model containing
1-, 2-, and 3-ARs in explaining the observed results.
The most significant finding from the present study is the differential
requirement for the 3-AR in mediating leptin's effects in brown versus white adipose tissue. The concept of
differential coupling of -adrenoreceptor subtypes to various
responses within the same cell is not new. The subject has received
significant attention in BAT, where densely innervated brown adipocytes
are stimulated by norepinephrine in response to environmental and physiological stimuli (12, 51). Using isolated brown adipocytes from
both Syrian hamsters (52) and rats (24, 53), Zhao et al.
addressed the role of 3-ARs versus
1-ARs in mediating catecholamine-stimulated oxygen
consumption. Based on analysis of Schild plots constructed from
propranolol-mediated inhibition of norepinephrine dose-response curves,
the authors concluded that the thermogenic response was coupled solely
to the 3-AR (24, 53). This conclusion is at odds with
results from experiments with 3-AR knockouts where thermogenic responses to norepinephrine, isoproterenol, and cold exposure were normal (28). Thus, the absence of the 3-AR
did not compromise the ability of BAT to respond to catecholamines. A
role for the 1-AR is also supported by the work of Atgie
et al. (25), who used isolated brown adipocytes to show that
a specific 1-AR antagonist effectively blocked the
effects of low concentrations of norepinephrine (25-100
nM) on respiration. The authors concluded that, within the
physiological range of norepinephrine concentrations, the
1-AR makes a significant contribution to activating
respiration. Chaudhry and Granneman (26) investigated the possibility
that 1-ARs and 3-ARs serve different
signaling functions in brown adipocytes. Supported by data showing the
predicted compartmentalization of phosphorylated proteins
(cAMP-responsive element-binding protein and perilipin), the authors
concluded that norepinephrine induced UCP1 expression preferentially
through the 1-AR and lipolysis primarily through the
3-AR (26). Our results extend these findings to the
intact animal and show for the first time that centrally mediated
effects of leptin on UCP1 expression in brown adipose tissue can be
transduced interchangeably by 1/2- or
3-ARs. Our results demonstrate that this conclusion is
not an artifact of altered expression or function of the
1/2-ARs in BAT from 3-AR
KO mice. The present findings are also consistent with the original
report with these mice showing comparable cold-induced increases in
UCP1 mRNA in BAT from wild type and 3-AR KO mice (28). A study by Revelli et al. (54) using C57BL/6J mice
with the 3-AR gene deleted by homologous recombination
found a positive correlation between UCP1 and 1-AR
mRNA, indicating a role for the 1-AR in the absence
of the 3-AR. It should also be noted that, despite
significant reductions in 3-AR expression in BAT from
ob/ob mice (35), they respond to leptin repletion with robust increases in BAT UCP1 expression (19). Taken together, the
evidence is internally consistent and supports our conclusion of
interchangeability of receptor subtypes in this tissue.
In contrast to BAT, where the 3-AR is sufficient but not
necessary to mediate leptin effects on gene expression, the present |
TOP
ABSTRACT
INTRODUCTION