Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M003655200 on August 3, 2000

J. Biol. Chem., Vol. 275, Issue 42, 33167-33175, October 20, 2000
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
275/42/33167    most recent
M003655200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Du, J.
Right arrow Articles by Platanias, L. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Du, J.
Right arrow Articles by Platanias, L. C.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Engagement of the CrkL Adapter in Interleukin-5 Signaling in Eosinophils*

Jian DuDagger §, Yazan M. Alsayed§||, Feng XinDagger , Steven J. AckermanDagger **, and Leonidas C. Platanias||

From the Dagger  Department of Biochemistry and Molecular Biology and the  Section of Hematology-Oncology, Department of Medicine, College of Medicine, University of Illinois at Chicago, Chicago, Illinois 60612 and the || West Side Veterans Affairs Medical Center, Chicago, Illinois 60607

Received for publication, April 28, 2000, and in revised form, July 11, 2000


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Interleukin-5 (IL-5) drives the terminal differentiation of myeloid progenitors to the eosinophil lineage; blocks eosinophil apoptosis; and primes eosinophils for enhanced functional activities in allergic, parasitic, and other eosinophil-associated diseases. Here we describe a novel signaling pathway activated by the IL-5 receptor in eosinophils involving the CrkL adapter protein. We determined whether IL-5 induces activation of CrkL and STAT5 in eosinophils using both the human eosinophil-differentiated AML14.3D10 cell line and purified peripheral blood eosinophils from normal donors. Stimulation of AML14.3D10 cells or blood eosinophils with IL-5 induced rapid tyrosine phosphorylation of the CrkL adapter and STAT5 and the association of CrkL and STAT5 in vivo as evidenced by the detection of STAT5 in anti-CrkL immunoprecipitates. The resulting CrkL·STAT5 complexes translocated to the nucleus and bound STAT5 consensus DNA-binding sites present in the promoters of IL-5-regulated genes, as shown in gel mobility and antibody supershift assays. IL-5 also induced marked activity of an 8X-GAS (interferon gamma -activated site)-luciferase reporter construct in transient transfections of AML14.3D10 eosinophils, demonstrating that these complexes play a functional role in IL-5 signaling. CrkL was also found to interact, via its N-terminal SH3 domain, with C3G, a guanine exchange factor for the small G-protein Rap1, which was also rapidly activated in an IL-5-dependent manner in these cells, establishing that CrkL mediates downstream activation of at least two signaling cascades in IL-5-stimulated eosinophils. Thus, the CrkL adapter plays an important role in IL-5 signaling in the eosinophil, acting as a nuclear adapter for STAT5 and as an upstream regulator of the C3G-Rap1 signaling pathway.


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Signaling through the eosinophil-specific interleukin-5 (IL-5)1 receptor (IL-5R) drives the terminal differentiation of committed myeloid progenitors to the eosinophil lineage (1-6), promotes eosinophil survival by blocking apoptosis (7, 8), primes eosinophils for enhanced functional responses in allergic and parasitic diseases (9-11), and induces eosinophil secretion of pro-inflammatory mediators (12). IL-5 is primarily a type 2 T cell-derived (13) and mast cell-derived (14) cytokine with actions restricted largely to the eosinophil lineage in humans (15-17), in contrast to eosinophil and B cell lineages in mice (1, 18). IL-5R has a heterodimeric high affinity structure composed of an eosinophil-specific IL-5-binding alpha  subunit and a beta c subunit that is shared with the receptors for IL-3 and GM-CSF (19-21). IL-5R expression is an early event in the eosinophil hematopoietic program (22, 23) and is a prerequisite for the development of eosinophilia, eosinophil activation, and prolonged survival of eosinophils in tissues (24, 25). Engagement of IL-5R is critical for entry of multipotential hematopoietic progenitors into the eosinophil developmental program, especially since IL-5 up-regulates expression of its own receptor on CD34+ hematopoietic progenitors (23, 26, 27) and induces a switch in alternative splicing of the alpha  subunit from the soluble to transmembrane form of the receptor (26). The alpha  subunit of the receptor is required both for high affinity ligand binding (28) and for optimal signal transduction (29, 30) and is therefore critical to all the lineage-specific actions of IL-5 on human eosinophils. Elucidation of IL-5 signaling pathways is therefore extremely pertinent to understanding the mechanisms involved in regulating both the normal physiologic and pro-inflammatory activities of the eosinophil in allergic and related immune responses (31).

The IL-5/IL-5R interaction propagates signals primarily via the JAK-STAT and the Ras-Raf1-MAPK pathways in eosinophils (31-40). Since neither subunit of IL-5R possesses inherent tyrosine kinase activity, its phosphorylation requires receptor-associated tyrosine kinases, including Lyn, JAK1, and JAK2 (33, 34, 37, 41). Stimulation of eosinophils with IL-5 rapidly induces the phosphorylation and activation of JAK1, JAK2, and Lyn (34, 37), which then phosphorylate both the alpha  and beta c subunits of the IL-5R, resulting in the recruitment and activation of Shc, Grb2, SHP-2, and the STAT proteins, primarily STAT1 and STAT5 (36, 42, 43). The Janus kinases serve to couple these STAT proteins to IL-5R activation. Previous work suggests that signaling through the cytoplasmic tail of the alpha  chain principally utilizes the JAK2-STAT5 pathway (42, 44, 45), whereas signaling through the beta c chain involves the preferential binding and activation of the phosphatase SHP-2 as well as Shc-Grb2, leading to activation of the Ras-Raf1-MEK-ERK-MAPK pathway (43). In addition, IL-5 induces the activation of ERK1/2 and p38 MAPK in eosinophils (46).

The functional relevance of the various IL-5 signaling pathways has recently been evaluated using both pharmacologic and peptide inhibitors as well as antisense oligonucleotide strategies (31). The Lyn and JAK2 kinases were shown to be important for eosinophil development from bone marrow-derived progenitors (47). These tyrosine kinases, along with the SHP-2 tyrosine phosphatase, were also shown to be required for the anti-apoptotic effects of IL-5 in terms of prolonged eosinophil survival (32, 47). In contrast, Lyn and JAK2 did not appear to play any role in eosinophil degranulation or expression of surface adhesion molecules, whereas the Raf1 kinase appears to be necessary for eosinophil activation, secretion, and up-regulation of adhesion molecule function (32).

In this study, we provide evidence for the existence of a novel signaling cascade activated by IL-5 in eosinophils involving the CrkL adapter. Our data demonstrate that CrkL is tyrosine-phosphorylated in an IL-5-dependent manner and forms a signaling complex with STAT5, which is also phosphorylated during IL-5 stimulation. We also demonstrate that IL-5 induces functionally active CrkL·STAT5 signaling complexes in the nucleus that bind a palindromic sequence present in the promoters of certain IL-5-inducible genes to regulate gene transcription. In addition, we establish that activation of CrkL by IL-5R ultimately results in activation of C3G and the small G-protein Rap1 to mediate IL-5 responses.

    EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Cell Lines, Cell Culture, and Reagents-- The IL-5R-positive, eosinophil-differentiated cell line AML14.3D10 (where AML refers to acute myeloid leukemia) (48) and its parental cell line, AML14 (49, 50), also IL-5R-positive, were maintained in RPMI 1640 medium supplemented with 8% fetal bovine serum, 2 mM L-glutamine, 1 mM sodium pyruvate, and 5 × 10-5 M beta -mercaptoethanol without any antibiotics. Cells were passaged every 3-4 days and maintained at a concentration between 3 × 105 and 1 × 106 cells/ml. The AML14.3D10 cell line is a fully differentiated, nearly mature eosinophil line that proliferates as a granulated cell (48). It contains eosinophil secondary (specific) granules and displays many of the characteristics of mature peripheral blood eosinophils, including expression of the major protein mediators of the eosinophil such as the granule cationic proteins major basic protein, eosinophil peroxidase, eosinophil-derived neurotoxin, and eosinophil cationic protein. In addition, it can be induced to express chemokine receptors (e.g. for eotaxins) (51) and expresses GM-CSF, which drives its proliferation, differentiation, and survival in culture (52). The mature nature of this cell line and its utility for studies of eosinophil biology were described in a recent review (53).

Recombinant human IL-5 was obtained from R&D Systems (Minneapolis, MN). Antibodies against STAT5a, STAT5b, and CrkL were purchased from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA). A neutralizing antibody to GM-CSF was obtained from Pharmingen (San Diego, CA). The antibody to STAT5 used for immunoprecipitations and Western blotting was obtained from Upstate Biotechnology, Inc. (Lake Placid, NY).

Purification of Human Eosinophils-- Blood (150 ml) from normal, non-allergic, healthy donors was used to isolate eosinophils following methods originally described by Hansel et al. (54). Informed consent was obtained according to the guidelines established by the Institutional Review Board of the University of Illinois (Chicago). Sedimentation of erythrocytes was performed at room temperature for 1 h by mixing 50 ml of peripheral blood with 10 ml of Macrodex (6% dextran 70 in 0.9% sodium chloride) and 200 µl of 0.5 M EDTA. The leukocyte-containing plasma fraction was harvested, diluted 1:1 with phosphate-buffered saline, and overlaid on Ficoll-Paque gradients (35 ml of cell mixture onto 15 ml of Ficoll-Paque 400, Amersham Pharmacia Biotech, Uppsala), followed by centrifugation for 30 min at room temperature. The granulocyte pellets were harvested and washed with phosphate-buffered saline; the remaining erythrocytes were lysed using brief exposure to distilled water; and the eosinophils were isolated using a MACS CD16 kit (Miltenyi Biotec, Auburn, CA) to remove neutrophils following the methods described by the manufacturer (55). Total cell counts and eosinophil counts were performed using Randolph's stain. Eosinophil purity was routinely >98% as assessed by differential counts of Wright's/Giemsa-stained cytocentrifuge slides, with eosinophil viability >95% as determined by trypan blue dye exclusion. Purified eosinophils were incubated for 30 min in the presence or absence of IL-5, and nuclear extracts for gel shift analysis were prepared immediately as described below.

IL-5 Induction of AML14.3D10 Cells-- AML14.3D10 cells were split and maintained at 1 × 106/ml 1 day before each experiment. A total of 2 × 107 AML14.3D10 cells were resuspended in 10 ml of fresh complete medium and stimulated with IL-5 (25 ng/ml) for the indicated times at 37 °C. The cells were collected at each time point by immediate centrifugation. In some experiments, the AML14.3D10 cells were first precultured with neutralizing anti-GM-CSF antibody for 2 days prior to stimulation with IL-5 to block autocrine signaling by GM-CSF produced by these cells in culture (52, 53).

Preparation of Cytoplasmic Extracts, Immunoprecipitations, and Immunoblotting-- Cell lysis using phosphorylation lysis buffer, immunoprecipitations, and immunoblotting using the enhanced chemiluminescence (ECL) method were performed as described previously (56, 57).

Preparation of Whole Cell and Nuclear Extracts-- Nuclear extracts were prepared using a rapid micropreparation technique for small numbers of cells (58) with minor modifications, including the use of protease inhibitor mixture tablets (Roche Molecular Biochemicals, Mannheim, Germany) and the addition of phenylmethylsulfonyl fluoride (0.5 mM) and diisopropyl fluorophosphate (1 mM) to the resuspension and lysis buffers (59, 60).

Electrophoretic Mobility Shift Assays-- Double-stranded oligonucleotide probes for electrophoretic mobility shift assays contained the STAT5-binding site of the beta -casein (5'-AGATTTCTAGGAATTCAAATC-3') and ntcp (5'-TGTCATTCTTGGAAAAATA-3') promoters. The oligonucleotides were synthesized and purified by Integrated DNA Technologies, Inc. (Coralville, IA). To generate probes for electrophoretic mobility shift assays, 10 pmol of the double-stranded oligonucleotides were end-labeled with [32P]ATP (PerkinElmer Life Sciences) using T4 polynucleotide kinase, and the double-stranded probes were purified on 15% polyacrylamide gels as described previously (60). For mobility shift assays, nuclear protein-DNA binding reactions were carried out at room temperature for 30 min in a final volume of 20 µl containing the labeled oligonucleotide probe (10,000 cpm), 3 µg of nuclear extract, and 2 µg of poly(dI·dC) in 20 mM HEPES (pH 7.9) containing 50 mM KCl, 3 mM MgCl2, 1 mM dithiothreitol, 0.5 mM EDTA, and 5% glycerol. Specificity of complex formation was assessed using competition with a 50-fold molar excess of unlabeled double-stranded oligonucleotide competitor added to the binding reaction 10 min prior to the addition of the labeled probe. For antibody supershift assays, 1 µg of antibody raised against STAT5a, STAT5b, or CrkL was preincubated with the nuclear extracts in gel shift binding buffer at room temperature for 30-60 min, followed by the addition of the labeled probe and further incubation for 30 min at room temperature. The entire binding reaction was loaded on a 5% polyacrylamide gel (acrylamide/bisacrylamide weight ratio of 19:1) that had been pre-electrophoresed for 1 h at 4 °C. Electrophoresis was carried out at 11 V/cm (1.5 h for a 10 × 10-cm gel and 2 h for a 16 × 12-cm gel) in a 4 °C cold room. Gels were dried and subjected to autoradiography using either a Molecular Dynamics Storm PhosphorImager or Kodak BioMax film.

Preparation of Glutathione S-Transferase Fusion Proteins and Binding Studies-- Expression constructs (pGEX-CrkL-N-SH3 and pGEX-CrkL-C-SH3) for the production of the GST-CrkL-N-SH3 and GST-CrkL-C-SH3 fusion proteins were kindly provided by Dr. Brian Druker (Oregon Health Sciences University, Portland OR) (61). Production of the glutathione S-transferase fusion proteins and binding experiments were performed as described previously (56).

Rap1 Activation Assays-- The activation state of Rap1 was determined essentially as described previously (62). The pGEX construct for the production of a GST-Ral GDS-RBD fusion protein was kindly provided by Dr. Johannes Bos (Utrecht University, Utrecht, The Netherlands). Briefly, AML14.3D10 cells were cultured with or without the addition of IL-5 for the indicated times and lysed in phosphorylation lysis buffer, and the cell lysates were incubated with the GST-Ral GDS-RBD fusion protein that had been precoupled to glutathione-Sepharose beads. Following incubation of the cell lysates with solid-phase GST-Ral GDS-RBD fusion protein, bound proteins were analyzed by SDS-PAGE. The proteins were transferred to Immobilon membranes, and the activated/GTP-bound form of Rap1 was detected by immunoblotting with a monoclonal anti-Rap1 antibody (Transduction Laboratories, Lexington, KY) using the ECL method.

    RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

IL-5 Induces Tyrosine Phosphorylation of CrkL and Formation of CrkL·STAT5 Complexes in Eosinophils-- We first sought to determine whether IL-5 treatment of the eosinophil-differentiated AML14.3D10 cell line would induce tyrosine phosphorylation of the CrkL adapter. AML14.3D10 eosinophils were cultured with 25 ng/ml IL-5 for 15 min at 37 °C; and after cell lysis, the lysates were immunoprecipitated with an anti-CrkL antibody and immunoblotted with an anti-phosphotyrosine antibody. CrkL was strongly phosphorylated on tyrosine residues in an IL-5-dependent manner (Fig. 1A). The presence of equal amounts of CrkL in the immunoprecipitates was confirmed by stripping the blots and reprobing them with the anti-CrkL antibody (Fig. 1B). In addition to CrkL, a tyrosine-phosphorylated protein migrating at ~97 kDa was co-immunoprecipitated by the anti-CrkL antibody from lysates of IL-5-treated cells (Fig. 1A). Since the molecular mass of this protein was similar to that of STAT5, we determined whether the 97-kDa phosphoprotein seen in anti-CrkL immunoprecipitates from IL-5-treated cells corresponds to STAT5. Reprobing the blot (Fig. 1A) with an anti-STAT5 antibody demonstrated that this protein was indeed STAT5 (Fig. 1C). Furthermore, the interaction of CrkL with STAT5 was IL-5-dependent (Fig. 1C), suggesting that it is mediated by binding of the CrkL SH2 domain to the tyrosine-phosphorylated form of STAT5. Thus, in response to activation of IL-5R on AML14.3D10 eosinophils, there is a rapid induction of tyrosine phosphorylation of CrkL and its interaction with STAT5. The formation of CrkL·STAT5 complexes in these cells was likewise induced in response to IL-3 or GM-CSF treatment (Fig. 2). Similar amounts of STAT5 were co-precipitated by the anti-CrkL antibody in response to IL-5 or IL-3/GM-CSF stimulation (Fig. 2), suggesting that the stoichiometry of the IL-5-induced CrkL/STAT5 interaction is similar to the stoichiometries of the CrkL/STAT5 associations occurring in response to cell activation with IL-3 or GM-CSF.


View larger version (20K):
[in this window]
[in a new window]
  		Fig. 1.   IL-5 induces tyrosine phosphorylation of CrkL and its interaction with STAT5. A, AML14.3D10 cells were stimulated with IL-5 for 15 min at 37 °C as indicated. The cells were harvested by centrifugation and lysed, and cell lysates were immunoprecipitated (IP) with an anti-CrkL antibody or a nonimmune rabbit immunoglobulin (RIgG) control as indicated. Immunoprecipitated proteins were analyzed by SDS-PAGE and immunoblotted with a monoclonal anti-phosphotyrosine antibody (anti-PTyr). B, the Western blot in A was stripped and reprobed with an antibody against CrkL to confirm equivalent loading of cell lysates. C, the same blot was stripped again and reprobed with an anti-STAT5 antibody.


View larger version (34K):
[in this window]
[in a new window]
  		Fig. 2.   Induction of CrkL/STAT5 interaction in AML14.3D10 eosinophils by IL-5, IL-3 and GM-CSF. A, AML14.3D10 cells were treated for 15 min at 37 °C with the indicated cytokines. The cells were lysed, and cell lysates were immunoprecipitated with an anti-CrkL antibody. Immunoprecipitated proteins were resolved by SDS-PAGE and immunoblotted with an anti-STAT5 antibody. B, the blot shown in A was stripped and reprobed with an antibody against CrkL to assure equal loading.

The kinetics of the IL-5-induced CrkL/STAT5 interaction were subsequently determined. The IL-5-induced formation of CrkL·STAT5 complexes was rapid, occurring within 1 min of adding the cytokine to the AML14.3D10 eosinophils (Fig. 3A). Complex formation was maximal at 5-30 min, with the signal declining at 60-90 min, although it was still clearly detectable at these time points (Fig. 3A). Thus, IL-5 induces the rapid and transient interaction of CrkL with STAT5 in the eosinophil-differentiated AML14.3D10 cell line, suggesting that this complex plays a role in the generation of IL-5 signals in human eosinophils.


View larger version (27K):
[in this window]
[in a new window]
  		Fig. 3.   Kinetics of IL-5-induced CrkL/STAT5 association. A, AML14.3D10 cells were stimulated with IL-5 for the indicated times at 37 °C. The cells were harvested and immediately lysed, and the cell lysates were immunoprecipitated (IP) with an anti-CrkL antibody. Immunoprecipitated proteins were resolved by SDS-PAGE and immunoblotted with an anti-STAT5 antibody. B, the Western blot shown in A was stripped and reprobed with an antibody against CrkL to demonstrate equal loading.

IL-5-dependent Nuclear Translocation of CrkL·STAT5 Complexes in Eosinophils-- In subsequent experiments, we sought to determine whether the IL-5-induced CrkL·STAT5 complexes translocate to the nucleus to regulate gene transcription via binding to specific elements in the promoters of IL-5-regulated genes. We first performed gel shift analyses using nuclear extracts from IL-5-stimulated AML14.3D10 eosinophils and peripheral blood eosinophils from normal donors, employing an oligonucleotide containing the STAT5-binding site (AGATTTCTAGGAATTCAAATC) derived from the beta -casein promoter. IL-5 stimulation of both AML14.3D10 eosinophils for 15 or 30 min (Fig. 4A) and normal peripheral blood eosinophils for 30 min (Fig. 4B) resulted in the induction of DNA-binding nuclear proteins that formed complexes with the beta -casein STAT5-binding site. The formation of these complexes was inhibited by the addition of the unlabeled STAT5-binding oligonucleotide probe as competitor (Figs. 4A, 5B, and 6), but not by an irrelevant oligonucleotide (Fig. 4A). In addition, these eosinophil nuclear complexes were supershifted in a dose-dependent manner by both an anti-STAT5a antibody (Figs. 5, A and B; and 6) and an anti-STAT5b antibody (Fig. 5B), further establishing the specificity of complex formation and the identity of the STAT5 proteins involved. To determine whether CrkL was also present in these STAT5 complexes, we performed supershift analyses using an anti-CrkL antibody (Figs. 5A and 6). The addition of the anti-CrkL antibody supershifted the complexes from both AML14.3D10 eosinophils (Fig. 5A) and normal peripheral blood eosinophils (Fig. 6), and such supershifting was dose-dependent. As supershift controls, the antibodies to STAT5a and CrkL did not produce any complexes in the absence of the AML14.3D10 nuclear extract (Fig. 5A). Identical electrophoretic mobility shift and antibody supershift results were obtained using an oligonucleotide probe containing the ntcp promoter STAT5-binding site (not shown). These data show that IL-5 induces CrkL·STAT5 complex formation in both the eosinophil-differentiated AML14.3D10 cell line and normal peripheral blood eosinophils.


View larger version (44K):
[in this window]
[in a new window]
  		Fig. 4.   Induction of nuclear STAT5 DNA-binding activity in AML14.3D10 eosinophils and peripheral blood eosinophils by IL-5. A, AML14.3D10 cells were cultured for 48 h with or without the addition of neutralizing anti-GM-CSF antibody as indicated prior to adding the IL-5 stimulus. Nuclear extracts were prepared 15 and 30 min after the addition of IL-5. Gel shift analysis was performed using the STAT5 consensus site in the beta -casein promoter as probe. A 50-fold molar excess of either the unlabeled beta -casein STAT5 oligonucleotide probe or an irrelevant oligonucleotide containing a CAAT/enhancer-binding protein-binding site (negative control) was added as competitor to show the specificity of the resulting nuclear protein-DNA complexes. In the absence of IL-5, AML14.3D10 nuclear extracts did not contain any STAT5 DNA-binding activity (lanes 1, 4, 5, and 8), regardless of whether the cells were first cultured for 48 h with anti-GM-CSF antibody. A specific STAT5 DNA-binding complex was induced by IL-5 stimulation for 15 and 30 min as indicated (arrow; lanes 2, 3, 6, 7, and 9). The complex was specific as shown by its inhibition by unlabeled STAT5 probe competitor (lane 10), but not by an irrelevant double-stranded oligonucleotide (lane 11). B, AML14.3D10 eosinophils (2 × 107 cells) (lanes 1 and 2) and peripheral blood eosinophils (2 × 107 cells) from two normal donors (Donor 1 (lanes 3 and 4) and Donor 2 (lanes 5 and 6)) were cultured with or without the addition of 5 × 10-10 M IL-5 for 30 min. Nuclear extracts were prepared immediately following IL-5 treatment, and gel shift analyses were performed using the beta -casein STAT5 consensus site probe and one-tenth of each nuclear extract. IL-5 stimulation of the peripheral blood eosinophils from both donors induced the formation of specific STAT5 DNA-binding complexes (lanes 4 and 6) that were equivalent in mobility to those induced by IL-5 in AML14.3D10 eosinophils (lane 2), whereas STAT5 complexes were not detected in the control, unstimulated cells (lanes 1, 3, and 5).


View larger version (64K):
[in this window]
[in a new window]
  		Fig. 5.   IL-5-induced STAT5 DNA-binding complexes contain the CrkL adapter protein, STAT5a, and STAT5b. Supershift analyses of STAT5 DNA-binding complexes were performed using nuclear extracts of IL-5-activated AML14.3D10 cells. The beta -casein STAT5 consensus site was used as probe, and 5 µg of nuclear extract prepared from AML14.3D10 cells activated with IL-5 for 15 min were used in each binding reaction. A, in the absence of antibody, a specific STAT5 DNA-binding complex was obtained (lane 1) as shown in Fig. 4. Antibodies to both STAT5a (lanes 2-5) and CrkL (lanes 6-9) induced a dose-dependent and nearly complete supershift of the STAT5 DNA-binding complex. The polyclonal antibody specific for STAT5a was added to the binding reactions in the amounts of 2, 0.2, 0.02, and 0.002 µg (lanes 2-5, respectively). The polyclonal antibody to CrkL was added to the binding reactions in the amounts of 0.2, 0.02, 0.002, and 0.0002 µg (lanes 6-9, respectively). These antibodies did not bind the beta -casein promoter STAT5 consensus site probe in the absence of nuclear extract (controls; lanes 10 and 11). B, supershift analysis was performed as described for A using STAT5a- and STAT5b-specific antibodies added in the same amounts as indicated for STAT5a in A. In the absence of antibody, a specific STAT5 DNA-binding complex was formed (lane 1) that was inhibited by a 50-fold molar excess of the unlabeled STAT5 consensus site probe (lane 2). The addition of antibodies to STAT5a (lanes 3-6) and STAT5b (lanes 7-10) both induced a dose-dependent and nearly complete supershift of the CrkL·STAT5 DNA-binding complexes.


View larger version (69K):
[in this window]
[in a new window]
  		Fig. 6.   CrkL and STAT5a are components of the STAT5 DNA-binding complexes induced by IL-5 activation of normal peripheral blood eosinophils. Antibody supershift and oligonucleotide competition analyses were performed using the same IL-5-induced eosinophil nuclear extract (IL-5 NE) shown in Fig. 4B (lane 6). In the absence of antibody, the CrkL·STAT5 DNA-binding complex was detected as indicated (lane 1) and inhibited by a 50-fold molar excess of the unlabeled beta -casein STAT5 consensus site probe (lane 2). The addition of antibodies to CrkL (lanes 3-5) and STAT5a (lanes 7-9) supershifted the CrkL·STAT5 DNA-binding complexes in a dose-dependent fashion.

In further studies, we sought to compare the activity of IL-5 with those of other cytokines that have been shown to induce CrkL/STAT5 interactions, specifically IL-3 and GM-CSF (63, 64), in terms of their ability to induce translocation of CrkL·STAT5 complexes to the nucleus of the eosinophil. For this purpose, AML14.3D10 cells were stimulated with IL-3, IL-5, or GM-CSF for 15 min, and nuclear extracts were immediately prepared. Gel shift analyses showed essentially equivalent induction of CrkL·STAT5 complex formation by these cytokines as assessed using both the beta -casein and ntcp promoter STAT5-binding site probes (Fig. 7A). We also assessed the activity of these eosinophil-active cytokines on the undifferentiated parental AML14 cell line, which expresses lower levels of the IL-5R (49, 53) compared with the differentiated AML14.3D10 cell line (Fig. 7B). The three cytokines showed differential activity in inducing the formation and nuclear translocation of CrkL·STAT5 complexes in the parental cell line, with GM-CSF acting as the strongest inducer and IL-5 as the weakest one, consistent with the decreased IL-5R expression in the parental AML14 cells (Fig. 7B).


View larger version (60K):
[in this window]
[in a new window]
  		Fig. 7.   Comparative activation of CrkL·STAT5 nuclear complexes by GM-CSF, IL-3, and IL-5 in the eosinophil-differentiated AML14.3D10 versus undifferentiated parental AML14 cells. A, gel shift analysis was performed as described in the legend to Fig. 5 using the beta -casein and ntcp STAT5 DNA-binding site probes as indicated. Nuclear extracts (NE) were prepared from AML14.3D10 cells that had been activated for 15 min at 37 °C with GM-CSF, IL-3, or IL-5 at 300 units/ml, 300 units/ml, and 25 ng/ml, respectively. Little or no CrkL·STAT5 complex was detected in the absence of cytokine induction (lanes 1 and 5), whereas the three cytokines induced equivalent amounts of CrkL·STAT5 DNA-binding complexes, regardless of the STAT5 DNA-binding site probe used for detection (lanes 2-4 and 6-8). B, gel shift analysis was performed using the beta -casein promoter STAT5 DNA-binding site and nuclear extracts from parental AML14 cells that had been activated for 15 min with GM-CSF, IL-3, or IL-5 as described for A. In the absence of cytokine, no CrkL·STAT5 complex was visible (lane 1). In contrast, CrkL·STAT5 DNA-binding complexes were induced by GM-CSF > IL-3 > IL-5 (lanes 2-4).

Altogether, these data establish that stimulation of IL-5R-positive eosinophils with IL-5 induces the formation of CrkL·STAT5 complexes that translocate to the nucleus and bind to the palindromic GAS element (TTCTAGGAA) in the promoters of IL-5-inducible genes. To obtain information on the functional consequences of IL-5-induced activation of STAT5 in AML14.3D10 eosinophils, we determined whether IL-5 treatment of these cells regulates gene transcription via GAS elements. AML14.3D10 cells were transiently transfected using electroporation with an 8X-GAS-luciferase construct (66), and the induction of promoter activity was measured in dual luciferase assays using a pRLtk-Renilla internal control for transfection efficiency. Stimulation of the transfected cells with IL-5 for 4-8 h post-electroporation strongly induced expression of luciferase reporter gene activity in these cells (Fig. 8), indicating that there is functional activation of STAT5 DNA-binding complexes in response to IL-5 stimulation.


View larger version (13K):
[in this window]
[in a new window]
  		Fig. 8.   Activation of the AML14.3D10 cell line with IL-5 induces functional activity of a STAT5-binding 8X-GAS-luciferase reporter gene construct in transiently transfected cells. AML14.3D10 cells were transfected by electroporation with 10 µg of a STAT5-responsive 8X-GAS-luciferase reporter plasmid and 1 µg of the pRLtk-Renilla luciferase control plasmid. After electroporation, the cells were cultured in the presence (black bars) or absence (hatched bars) of 25 µg/ml IL-5 for 2, 4, 6, or 8 h as indicated. Luciferase activity was analyzed at the indicated times post-addition of IL-5 using the dual luciferase detection method, and the results were normalized using the activity of the Renilla control. The mean ± S.D. relative promoter activity of the STAT5-responsive 8X-GAS-luciferase reporter plasmid is shown for three independent experiments. RLU, relative light units.

IL-5-dependent Engagement of CrkL Results in Activation of the C3G-Rap1 Pathway-- In addition to functioning as a nuclear adapter for STAT5, CrkL is known to interact constitutively with C3G (57, 62, 67-70), which is a guanine exchange factor for the small G-protein Rap1 (71). We sought to determine if, in IL-5-responsive AML14.3D10 eosinophils, CrkL also interacts with C3G and whether engagement of CrkL in IL-5 signaling results in the downstream activation of Rap1. AML14.3D10 cells were incubated in the presence or absence of IL-5, and cell lysates were immunoprecipitated with an anti-CrkL antibody. Immunoprecipitated proteins were analyzed by SDS-PAGE and immunoblotted with an anti-C3G antibody. The C3G guanine exchange factor was constitutively associated with CrkL in these cells prior to and after IL-5 stimulation (Fig. 9, A and B). To identify the domains in CrkL that mediate the constitutive interaction with C3G in eosinophils, we performed binding studies using glutathione S-transferase fusion proteins encoding the different motifs present in the CrkL protein. As shown in Fig. 9C, C3G bound to a GST fusion protein encoding the CrkL N-terminal SH3 domain, but not to GST fusion proteins with the C-terminal SH3 domain or the SH2 domain of CrkL (Fig. 9C). Thus, in eosinophil-differentiated AML14.3D10 cells, CrkL interacts constitutively with the guanine exchange factor C3G, and this interaction is mediated by the N-terminal SH3 domain in CrkL. As C3G functions as a guanine exchange factor for the Rap1 GTPase, we determined whether IL-5 activates Rap1. We performed Rap1 activation assays using lysates from the IL-5-treated AML14.3D10 eosinophils. Stimulation of AML14.3D10 eosinophils with IL-5 resulted in strong activation of Rap1 in a time-dependent manner (Fig. 10), strongly suggesting that this small G-protein is involved in IL-5 signaling in eosinophils. Thus, in addition to functioning as an IL-5-dependent nuclear adapter for STAT5, CrkL regulates a distinct IL-5-dependent cellular pathway involving activation of the small G-protein Rap1.


View larger version (27K):
[in this window]
[in a new window]
  		Fig. 9.   Interaction of CrkL with the guanine exchange factor C3G in AML14.3D10 eosinophils. A, cells were incubated with IL-5 for 15 min at 37 °C as indicated. The cells were lysed, and cell lysates were immunoprecipitated (IP) with an anti-CrkL antibody. Immunoprecipitated proteins were resolved by SDS-PAGE and immunoblotted with an anti-C3G antibody. B, the Western blot shown in A was stripped and reprobed with an antibody against CrkL. C, cells were incubated with IL-5 for 15 min at 37 °C as indicated. The cells were lysed, and cell lysates were incubated with either 1) glutathione S-transferase fusion proteins encoding the N-terminal SH3 (GST-N-SH3) or the C-terminal SH3 (GST-C-SH3) domains of CrkL or with 2) GST alone (specificity control). The SH3 domain-binding proteins were resolved by SDS-PAGE and immunoblotted with an anti-C3G antibody. RIgG, nonimmune rabbit immunoglobulin.


View larger version (27K):
[in this window]
[in a new window]
  		Fig. 10.   IL-5 induces activation of Rap1 in AML14.3D10 eosinophils. Cells were stimulated with IL-5 for the indicated times at 37 °C. Cell lysates prepared at each time point were incubated with a GST-Ral GDS-RBD fusion protein. Proteins binding to the GST-Ral GDS-RBD fusion protein were isolated using glutathione-Sepharose beads. The bound proteins were analyzed by SDS-PAGE and immunoblotted with an antibody against Rap1. The GTP-bound form of Rap1 is indicated.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

In this study, we provide the first evidence for an involvement of the CrkL adapter in IL-5 signaling in eosinophils and identify the activation of two IL-5-dependent cascades that involve this protein (Fig. 11). CrkL is a cellular homologue of the v-crk proto-oncogene (72) and contains one SH2 and two SH3 domains within its structure (73). CrkL and the other two members of the Crk family, CrkI and CrkII, have been previously shown to function as cellular adapters, linking tyrosine-phosphorylated receptors or their substrates to downstream signaling elements. Prior studies have established that CrkL interacts with several cellular proteins that play critical roles in the regulation of cell proliferation or differentiation, including the CBL proto-oncogene (57, 69, 74), the insulin receptor substrate-4 multisite docking protein (75), and the guanine exchange factor C3G (57, 62, 67-70). In addition, recent studies have disclosed a novel function of CrkL, acting as a nuclear adapter for STAT5 in response to interferon-alpha (76) and thrombopoietin (77) stimulation, providing evidence for interaction of this protein with elements of the JAK-STAT pathway. Furthermore, CrkL interacts with STAT5 in cells transformed by the BCR-ABL proto-oncogene (78), suggesting that this complex may be involved in the generation of mitogenic signals.


View larger version (26K):
[in this window]
[in a new window]
  		Fig. 11.   IL-5/IL-5R interaction activates multiple signal transduction pathways in eosinophils. Shown is a schematic of the alpha  and beta  subunits of IL-5R on the eosinophil illustrating known interactions of the cytoplasmic tails of each subunit with the JAK or Lyn kinases (31-36, 38, 39, 41, 42, 45). The two new pathways defined by this work are indicated by the large white arrow and are in boldface.

Our data establish that CrkL is rapidly phosphorylated during engagement of the IL-5R in eosinophils and interacts with the tyrosine-phosphorylated form of STAT5. The resulting complex translocates to the nucleus and binds to GAS elements, apparently to regulate IL-5-dependent gene transcription. The tyrosine kinase responsible for tyrosine phosphorylation and engagement of CrkL in IL-5 signaling remains to be determined. It is likely that CrkL phosphorylation by the IL-5R is regulated by receptor-associated JAK kinases, notably JAK1 and/or JAK2 (30, 33, 36, 39, 42, 45, 79), although it is possible that Lyn, which is also associated with the beta  subunit of the receptor (32, 37, 41, 47), may mediate such tyrosine phosphorylation.

The IL-5-dependent nuclear translocation and DNA binding of the CrkL·STAT5 complex to GAS elements raise the possibility that this CrkL/STAT5 interaction results in specific signals for the generation of IL-5 responses, possibly distinct from the ones mediated by the formation of STAT5·STAT5 homodimers (80, 81). Previous studies have demonstrated that, in other cytokine systems, there is selective formation of CrkL·STAT5 complexes (62), independent of the formation of STAT5 homodimers. For instance, both interferon-alpha (57) and interferon-gamma (62) induce tyrosine phosphorylation/activation of CrkL and STAT5, but CrkL·STAT5 complexes are induced only by interferon-alpha (62, 76), indicating that pathways downstream of CrkL are differentially regulated by different interferon subtypes (62). Independent of the precise mechanism directing IL-5-inducible gene transcription, our data provide strong evidence for a novel function of CrkL in IL-5 signaling as a nuclear adapter for STAT5. As IL-5 induces formation of both STAT5·STAT5 homodimers (38, 80, 81) and CrkL·STAT5 heterodimers, it is possible that gene transcription of certain IL-5-dependent genes is regulated by binding of STAT5 homodimers to their promoter, whereas others require the CrkL·STAT5 complex.

Our findings also establish that CrkL interacts constitutively, via its N-terminal SH3 domain, with the guanine exchange factor C3G in human eosinophils. In response to IL-5 binding to its receptor and IL-5-induced phosphorylation of CrkL, the guanine exchange activity of C3G is induced and regulates activation of Rap1, as evidenced by the strong IL-5-dependent activation of this GTPase. This is the first evidence for activation of Rap1 in IL-5-stimulated eosinophils. Rap1 is known to be a substrate for the guanine exchange activity of C3G (82) and has an effector domain very similar to the Ras effector domain, suggesting that it interacts with effectors similar to the ones for Ras (82). The IL-5-inducible activation of C3G and Rap1 strongly suggests that this pathway may exhibit regulatory effects on other known signaling cascades activated by the IL-5R. It is well established that IL-5 activates the Ras-Raf1-MEK pathway (33) and that Raf1 plays a critical role both in the generation of the anti-apoptotic effects of IL-5 (32) and in stimulation of eosinophil activation and secretion of inflammatory mediators (32). Also, most cytokines and growth factors that activate Rap1 also activate Raf1 (82, 83), although there is no direct evidence that Rap1 regulates Raf1 activation. There is evidence, however, that C3G regulates activation of MEK1 and B-Raf via Rap1 activation, and that the sustained activation of MAPK by nerve growth factor is mediated by Rap1 (84). Thus, a possible functional role for the C3G·Rap1 complex in IL-5 signaling may be regulation of the activation of the Raf1 kinase to mediate IL-5-induced anti-apoptotic and/or activation/secretion signals (32), but this remains to be demonstrated. Also, of interest in terms of possible effects of IL-5 signaling on eosinophil adhesion/migration, overexpression of CrkL and C3G has recently been shown to activate integrin-mediated hematopoietic (32D) cell adhesion to fibronectin, specifically by activating the VLA-4 (alpha 4beta 1) and VLA-5 (alpha 5beta 1) integrins in a process that required the C3G-binding N-terminal SH3 domain of CrkL and the guanine nucleotide exchange activity of C3G (85). It should also be noted that, in response to activation by the erythropoietin receptor, CrkL regulates activation of the Raf-ERK pathway via a Ras-dependent mechanism (65), further suggesting a possible role for CrkL in the IL-5-dependent activation of Raf1 and generation of anti-apoptotic, activation, migration, and degranulation signals (32).

Although the precise role of CrkL in the induction of IL-5 biological responses remains to be determined, our findings clearly indicate that the protein is involved in IL-5 signaling, and a proposed model for its signaling function in relationship to the previously characterized eosinophil signaling pathways is provided in Fig. 11. Our data clearly establish that CrkL participates in the transcriptional regulation of certain IL-5-responsive genes via complex formation with STAT5. They also raise the possibility that CrkL exerts regulatory effects on IL-5 activation of Raf1 via C3G·Rap1 complexes and suggest that CrkL plays an important role in the generation of the pleiotropic functional effects of IL-5 on eosinophil development, survival, activation, migration, and degranulation.

    ACKNOWLEDGEMENTS

We thank Drs. Michael Baumann and Cassandra Paul for providing the parental AML14 and AML14.3D10 eosinophil cell lines as well as advice on their use in these studies, Dr. Brian Druker for the GST-SH2/SH3 domain fusion protein constructs, Dr. Christopher Glass for the 8X-GAS-luciferase construct, Dr. Johannes Bos for the GST-Ral construct, the nursing staff of the University of Illinois Clinical Research Center for blood drawing, and Kim Hayden for administrative secretarial support.

    FOOTNOTES

* This work was supported by Grants AI33043 and AI25230 (to S. J. A.) and Grants CA77816 and CA73381 (to L. C. P.) from the National Institutes of Health and by a Merit Review grant from the Department of Veterans Affairs (to L. C. P.).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

§ These authors contributed equally to this work as joint first authors.

** To whom correspondence should be addressed: Dept. of Biochemistry and Molecular Biology, A-312 College of Medicine West, MC536, University of Illinois, 1819 West Polk St., Chicago, IL 60612. Tel.: 312-996-6149; Fax: 312-996-5623; E-mail: sackerma@uic.edu.

Published, JBC Papers in Press, August 3, 2000, DOI 10.1074/jbc.M003655200

    ABBREVIATIONS

The abbreviations used are: IL-5, interleukin-5; IL-5R, interleukin-5 receptor; GM-CSF, granulocyte-macrophage colony-stimulating factor; JAK, Janus kinase; STAT, signal transducer and activator of transcription; MAPK, mitogen-activated protein kinase; MEK, mitogen-activated protein kinase/extracellular signal-regulated kinase kinase; ERK, extracellular signal-regulated kinase; GST, glutathione S-transferase; GDS, guanine nucleotide dissociating stimulator; RBD, Rap binding domain; PAGE, polyacrylamide gel electrophoresis; GAS, interferon gamma -activated site; VLA, very late antigen.

    REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

1. Sanderson, C. J. (1990) Immunol. Ser. 49, 231-256
2. Dent, L. A., Strath, M., Mellor, A. L., and Sanderson, C. J. (1990) J. Exp. Med. 172, 1425-1431
3. Tominaga, A., Takaki, S., Koyama, N., Katoh, S., Matsumoto, R., Migita, M., Hitoshi, Y., Hosoya, Y., Yamauchi, S., Kanai, Y., Miyazaki, J-I., Usuku, G., Yamamura, K.-I., and Takatsu, K. (1991) J. Exp. Med. 173, 429-437
4. Takatsu, K., Takaki, S., and Hitoshi, Y. (1994) Adv. Immunol. 57, 145-190
5. Sanderson, C. J. (1991) Int. Arch. Allergy Appl. Immunol. 94, 122-126
6. Yamaguchi, Y., Suda, T., Suda, J., Eguchi, M., Miura, Y., Harada, N., Tominaga, A., and Takatsu, K. (1988) J. Exp. Med. 167, 43-56
7. Yamaguchi, Y., Suda, T., Ohta, S., Tominaga, K., Miura, Y., and Kasahara, T. (1991) Blood 78, 2542-2547
8. Her, E., Frazer, J., Austen, K. F., and Owen, W., Jr. (1991) J. Clin. Invest. 88, 1982-1987
9. Koenderman, L., van der Bruggen, T., Schweizer, R. C., Warringa, R. A., Coffer, P., Caldenhoven, E., Lammers, J. W., and Raaijmakers, J. A. (1996) Eur. Respir. J. 22 (suppl.), 119s-125s
10. Silberstein, D. S., Austen, K. F., and Owen, W., Jr. (1989) Hematol. Oncol. Clin. N. Am. 3, 511-533
11. Yamaguchi, Y., Hayashi, Y., Sugama, Y., Miura, Y., Kasahara, T., Kitamura, S., Torisu, M., Mita, S., Tominaga, A., and Takatsu, K. (1988) J. Exp. Med. 167, 1737-1742
12. Horie, S., Gleich, G. J., and Kita, H. (1996) J. Allergy Clin. Immunol. 98, 371-381
13. Takatsu, K., Tominaga, A., Harada, N., Mita, S., Matsumoto, M., Takahashi, T., Kikuchi, Y., and Yamaguchi, N. (1988) Immunol. Rev. 102, 107-135
14. Galli, S. J., Gordon, J. R., Wershil, B. K., Elovic, A., Wong, D. T., and Weller, P. F. (1994) in Eosinophils in Allergy and Inflammation (Kay, A. B. , and Gleich, G. J., eds), Vol. 2 , pp. 255-280, Marcel Dekker, Inc., New York
15. Lopez, A. F., Shannon, M. F., Chia, M. M., Park, L., and Vadas, M. A. (1992) Immunol. Ser. 57, 549-571
16. Huston, M. M., Moore, J. P., Mettes, H. J., Tavana, G., and Huston, D. P. (1996) J. Immunol. 156, 1392-1401
17. Baumann, M. A., and Paul, C. C. (1997) Methods 11, 88-97
18. Takatsu, K., Takaki, S., Hitoshi, Y., Mita, S., Katoh, S., Yamaguchi, N., and Tominaga, A. (1992) Ann. N. Y. Acad. Sci. 651, 241-258
19. Tavernier, J., Devos, R., Cornelis, S., Tuypens, T., Van der Heyden, J., Fiers, W., and Plaetinck, G. (1991) Cell 66, 1175-1184
20. Murata, Y., Takaki, S., Migita, M., Kikuchi, Y., Tominaga, A., and Takatsu, K. (1992) J. Exp. Med. 175, 341-351
21. Miyajima, A., Mui, A. L., Ogorochi, T., and Sakamaki, K. (1993) Blood 82, 1960-1974
22. Cameron, L., Christodoulopoulos, P., Lavigne, F., Nakamura, Y., Eidelman, D., McEuen, A., Walls, A., Tavernier, J., Minshall, E., Moqbel, R., and Hamid, Q. (2000) J. Immunol. 164, 1538-1545
23. Robinson, D. S., North, J., Zeibecoglou, K., Ying, S., Meng, Q., Rankin, S., Hamid, Q., Tavernier, J., and Kay, A. B. (1999) Int. Arch. Allergy Immunol. 118, 98-100
24. Kopf, M., Brombacher, F., Hodgkin, P. D., Ramsay, A. J., Milbourne, E. A., Dai, S. J., Ovington, K. S., Behm, C. A., Kohler, G., Young, I. G., and Matthaei, K. I. (1996) Immunity 4, 15-24
25. Foster, P. S., Hogan, S. P., Ramsay, A. J., Matthaei, K. I., and Young, I. G. (1996) J. Exp. Med. 183, 195-201
26. Tavernier, J., Van der Heyden, J., Verhee, A., Brusselle, G., Van Ostade, X., Vandekerckhove, J., North, J., Rankin, S. M., Kay, A. B., and Robinson, D. S. (2000) Blood 95, 1600-1607
27. Sehmi, R., Wood, L. J., Watson, R., Foley, R., Hamid, Q., O'Byrne, P. M., and Denburg, J. A. (1997) J. Clin. Invest. 100, 2466-2475
28. Tavernier, J., Cornelis, S., Devos, R., Guisez, Y., Plaetinck, G., and Van der Heyden, J. (1995) Agents Actions Suppl. 46, 23-34
29. Takaki, S., Murata, Y., Kitamura, T., Miyajima, A., Tominaga, A., and Takatsu, K. (1993) J. Exp. Med. 177, 1523-1529
30. Takaki, S., Kanazawa, H., Shiiba, M., and Takatsu, K. (1994) Mol. Cell. Biol. 14, 7404-7413
31. Adachi, T., and Alam, R. (1998) Am. J. Physiol. 275, C623-C633
32. Pazdrak, K., Olszewska-Pazdrak, B., Stafford, S., Garofalo, R. P., and Alam, R. (1998) J. Exp. Med. 188, 421-429
33. Pazdrak, K., Schreiber, D., Forsythe, P., Justement, L., and Alam, R. (1995) J. Exp. Med. 181, 1827-1834
34. van der Bruggen, T., Caldenhoven, E., Kanters, D., Coffer, P., Raaijmakers, J. A., Lammers, J. W., and Koenderman, L. (1995) Blood 85, 1442-1448
35. van der Bruggen, T., and Koenderman, L. (1996) Clin. Exp. Allergy 26, 880-891
36. Pazdrak, K., Stafford, S., and Alam, R. (1995) J. Immunol. 155, 397-402
37. Alam, R., Pazdrak, K., Stafford, S., and Forsythe, P. (1995) Int. Arch. Allergy Immunol. 107, 226-227
38. Caldenhoven, E., van Dijk, T. B., Tijmensen, A., Raaijmakers, J. A., Lammers, J. W., Koenderman, L., and de Groot, R. P. (1998) Stem Cells 16, 397-403
39. Raaijmakers, J. A., Lammers, J. W., Koenderman, L., and de Groot, R. P. (1997) FEBS Lett. 412, 161-164
40. Dijkers, P. F., van Dijk, T. B., de Groot, R. P., Raaijmakers, J. A., Lammers, J. W., Koenderman, L., and Coffer, P. J. (1999) Oncogene 18, 3334-3342
41. Adachi, T., Pazdrak, K., Stafford, S., and Alam, R. (1999) J. Immunol. 162, 1496-1501
42. Ogata, N., Kikuchi, Y., Kouro, T., Tomonaga, M., and Takatsu, K. (1997) Int. Arch. Allergy Immunol. 114 Suppl. 1, 24-27
43. Pazdrak, K., Adachi, T., and Alam, R. (1997) J. Exp. Med. 186, 561-568
44. Kouro, T., Kikuchi, Y., Kanazawa, H., Hirokawa, K., Harada, N., Shiiba, M., Wakao, H., Takaki, S., and Takatsu, K. (1996) Int. Immunol. 8, 237-245
45. Ogata, N., Kouro, T., Yamada, A., Koike, M., Hanai, N., Ishikawa, T., and Takatsu, K. (1998) Blood 91, 2264-3371
46. Bracke, M., Coffer, P. J., Lammers, J. W., and Koenderman, L. (1998) J. Immunol. 161, 6768-6774
47. Adachi, T., Stafford, S., Sur, S., and Alam, R. (1999) J. Immunol. 163, 939-946
48. Paul, C. C., Mahrer, S., Tolbert, M., Elbert, B. L., Wong, I. C., Ackerman, S. J., and Baumann, M. A. (1995) Blood 86, 3737-3744
49. Paul, C. C., Tolbert, M., Mahrer, S., Singh, A., Grace, M. J., and Baumann, M. A. (1993) Blood 81, 1193-1199
50. Paul, C. C., Ackerman, S. J., Mahrer, S., Tolbert, M., Dvorak, A. M., and Baumann, M. A. (1994) J. Leukocyte Biol. 56, 74-79
51. Zimmermann, N., Daugherty, B. L., Stark, J. M., and Rothenberg, M. E. (2000) J. Immunol. 164, 1055-1064
52. Paul, C. C., Mahrer, S., McMannama, K., and Baumann, M. A. (1997) Am. J. Hematol. 56, 79-85
53. Baumann, M. A., and Paul, C. C. (1998) Stem Cells 16, 16-24
54. Hansel, T. T., De Vries, I. J., Iff, T., Rihs, S., Wandzilak, M., Betz, S., Blaser, K., and Walker, C. (1991) J. Immunol. Methods 145, 105-110
55. Miltenyi, S., Muller, W., Weichel, W., and Radbruch, A. (1990) Cytometry 11, 231-238
56. Uddin, S., Yenush, L., Sun, X. J., Sweet, M. E., White, M. F., and Platanias, L. C. (1995) J. Biol. Chem. 270, 15938-15941
57. Ahmad, S., Alsayed, Y. M., Druker, B. J., and Platanias, L. C. (1997) J. Biol. Chem. 272, 29991-29994
58. Andrews, N. C., and Faller, D. V. (1991) Nucleic Acids Res. 19, 2499
59. Sun, Z., Yergeau, D. A., Wong, I. C., Tuypens, T., Tavernier, J., Paul, C. C., Baumann, M. A., Auron, P. A., Tenen, D. G., and Ackerman, S. J. (1996) Curr. Top. Microbiol. Immunol. 211, 173-187
60. Sun, Z., Yergeau, D. A., Tuypens, T., Tavernier, J., Paul, C. C., Baumann, M. A., Tenen, D. G., and Ackerman, S. J. (1995) J. Biol. Chem. 270, 1462-1471
61. Heaney, C., Kolibaba, K., Bhat, A., Oda, T., Ohno, S., Fanning, S., and Druker, B. J. (1997) Blood 89, 297-306
62. Alsayed, Y., Uddin, S., Ahmad, S., Majchrzak, B., Druker, B. J., Fish, E. N., and Platanias, L. C. (2000) J. Immunol. 164, 1800-1806
63. Oda, A., Sawada, K., Druker, B. J., Ozaki, K., Takano, H., Koizumi, K., Fukada, Y., Handa, M., Koike, T., and Ikeda, Y. (1998) Blood 92, 443-451
64. Barber, D. L., Mason, J. M., Fukazawa, T., Reedquist, K. A., Druker, B. J., Band, H., and D'Andrea, A. D. (1997) Blood 89, 3166-3174
65. Nosaka, Y., Arai, A., Miyasaka, N., and Miura, O. (1999) J. Biol. Chem. 274, 30154-30162
66. Horvai, A. E., Xu, L., Korzus, E., Brard, G., Kalafus, D., Mullen, T. M., Rose, D. W., Rosenfeld, M. G., and Glass, C. K. (1997) Proc. Natl. Acad. Sci. U. S. A. 94, 1074-1079
67. Ingham, R. J., Krebs, D. L., Barbazuk, S. M., Turck, C. W., Hirai, H., Matsuda, M., and Gold, M. R. (1996) J. Biol. Chem. 271, 32306-32314
68. Sawasdikosol, S., Ravichandran, K. S., Lee, K. K., Chang, J. H., and Burakoff, S. J. (1995) J. Biol. Chem. 270, 2893-2896
69. Reedquist, K. A., Fukazawa, T., Panchamoorthy, G., Langdon, W. Y., Shoelson, S. E., Druker, B. J., and Band, H. (1996) J. Biol. Chem. 271, 8435-8442
70. Smit, L., van der Horst, G., and Borst, J. (1996) J. Biol. Chem. 271, 8564-8569
71. Gotoh, T., Hattori, S., Nakamura, S., Kitayama, H., Noda, M., Takai, Y., Kaibuchi, K., Matsui, H., Hatase, O., Takahashi, H., Kurata, T., and Matsuda, M. (1995) Mol. Cell. Biol. 15, 6746-6753
72. Mayer, B. J., Hamaguchi, M., and Hanafusa, H. (1988) Nature 332, 272-275
73. ten Hoeve, J., Morris, C., Heisterkamp, N., and Groffen, J. (1993) Oncogene 8, 2469-2474
74. Ribon, V., Hubbell, S., Herrera, R., and Saltiel, A. R. (1996) Mol. Cell. Biol. 16, 45-52
75. Koval, A. P., Karas, M., Zick, Y., and LeRoith, D. (1998) J. Biol. Chem. 273, 14780-14787
76. Fish, E. N., Uddin, S., Korkmaz, M., Majchrzak, B., Druker, B. J., and Platanias, L. C. (1999) J. Biol. Chem. 274, 571-573
77. Ozaki, K., Oda, A., Wakao, H., Rhodes, J., Druker, B. J., Ishida, A., Wakui, M., Okamoto, S., Morita, K., Handa, M., Komatsu, N., Ohashi, H., Miyajima, A., and Ikeda, Y. (1998) Blood 92, 4652-4662
78. Rhodes, J., York, R. D., Tara, D., Tajinda, K., and Druker, B. J. (2000) Exp. Hematol. 28, 305-310
79. Ward, A. C., Touw, I., and Yoshimura, A. (2000) Blood 95, 19-29
80. Schulze, H., Ballmaier, M., Welte, K., and Germeshausen, M. (2000) Exp. Hematol. 28, 294-304
81. Ihle, J. N., and Kerr, I. M. (1995) Trends Genet. 11, 69-74
82. Bos, J. L. (1998) EMBO J. 17, 6776-6782
83. Zwartkruis, F. J., Wolthuis, R. M., Nabben, N. M., Franke, B., and Bos, J. L. (1998) EMBO J. 17, 5905-5912
84. York, R. D., Yao, H., Dillon, T., Ellig, C. L., Eckert, S. P., McCleskey, E. W., and Stork, P. J. (1998) Nature 392, 622-626
85. Arai, A., Nosaka, Y., Kohsaka, H., Miyasaka, N., and Miura, O. (1999) Blood 93, 3713-3722

Copyright © 2000 by The American Society for Biochemistry and Molecular Biology, Inc.
Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
 J. Immunol.Home page
J.-G. Wang, S. A. Mahmud, J. Nguyen, and A. Slungaard
Thiocyanate-Dependent Induction of Endothelial Cell Adhesion Molecule Expression by Phagocyte Peroxidases: A Novel HOSCN-Specific Oxidant Mechanism to Amplify Inflammation
J. Immunol., December 15, 2006; 177(12): 8714 - 8722.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
G. T. Wijewickrama, J.-H. Kim, Y. J. Kim, A. Abraham, Y. Oh, B. Ananthanarayanan, M. Kwatia, S. J. Ackerman, and W. Cho
Systematic Evaluation of Transcellular Activities of Secretory Phospholipases A2: HIGH ACTIVITY OF GROUP V PHOSPHOLIPASES A2 TO INDUCE EICOSANOID BIOSYNTHESIS IN NEIGHBORING INFLAMMATORY CELLS
J. Biol. Chem., April 21, 2006; 281(16): 10935 - 10944.
[Abstract] [Full Text] [PDF]

Home page
 Proc. Natl. Acad. Sci. USAHome page
G. J. DeYulia Jr., J. M. Carcamo, O. Borquez-Ojeda, C. C. Shelton, and D. W. Golde
Hydrogen peroxide generated extracellularly by receptor-ligand interaction facilitates cell signaling
PNAS, April 5, 2005; 102(14): 5044 - 5049.
[Abstract] [Full Text] [PDF]

Home page
 Proc. Natl. Acad. Sci. USAHome page
J. Chen, J. M. Carcamo, O. Borquez-Ojeda, H. Erdjument-Bromage, P. Tempst, and D. W. Golde
From the Cover: The laminin receptor modulates granulocyte-macrophage colony-stimulating factor receptor complex formation and modulates its signaling
PNAS, November 25, 2003; 100(24): 14000 - 14005.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
J. Du, M. J. Stankiewicz, Y. Liu, Q. Xi, J. E. Schmitz, J. A. Lekstrom-Himes, and S. J. Ackerman
Novel Combinatorial Interactions of GATA-1, PU.1, and C/EBPepsilon Isoforms Regulate Transcription of the Gene Encoding Eosinophil Granule Major Basic Protein
J. Biol. Chem., November 1, 2002; 277(45): 43481 - 43494.
[Abstract] [Full Text] [PDF]

Home page
 BloodHome page
J. M. Carcamo, O. Borquez-Ojeda, and D. W. Golde
Vitamin C inhibits granulocyte macrophage-colony-stimulating factor-induced signaling pathways
Blood, May 1, 2002; 99(9): 3205 - 3212.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
275/42/33167    most recent
M003655200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Du, J.
Right arrow Articles by Platanias, L. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Du, J.
Right arrow Articles by Platanias, L. C.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2000 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement