HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

J. Biol. Chem., Vol. 275, Issue 43, 33260-33266, October 27, 2000

This Article Abstract Full Text (PDF) All Versions of this Article: 275/43/33260    most recent M004764200v1 Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Seroz, T. Articles by Egly, J.-M. Search for Related Content PubMed PubMed Citation Articles by Seroz, T. Articles by Egly, J.-M. Social Bookmarking                      What's this?

p44/SSL1, the Regulatory Subunit of the XPD/RAD3 Helicase, Plays a Crucial Role in the Transcriptional Activity of TFIIH^*

Thierry Seroz, Christophe Perez, Etienne Bergmann, John Bradsher, and Jean-Marc Egly

From the Institut de Génétique et de Biologie Moléculaire et Cellulaire, CNRS/INSERM/ULP, B.P.163, 67404 Illkirch Cedex, C.U. de Strasbourg, France

Received for publication, May 31, 2000, and in revised form, July 31, 2000

	ABSTRACT

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

In order to unravel the mechanism that regulates transcription of protein-coding genes, we investigated the function of the p44 subunit of TFIIH, a basal transcription factor that is also involved in DNA repair. We have shown previously that mutations in the C terminus of the XPD helicase, another subunit of TFIIH, prevent its regulation by p44 (Coin, F., Bergmann, E., Tremeau-Bravard, A., and Egly, J. M. (1999) EMBO 18, 1357-1366). By using a site-directed mutagenesis approach within the p44 region from amino acids 66 to 200, we indicate how a decrease in the interaction between p44 and XPD results in a decrease of the XPD helicase activity and leads to a defect in the first steps of the transcription reaction, namely the first phosphodiester bond formation and promoter clearance. We thus provide some explanation for the transcriptional defect found in SSL1 mutated yeast (Wang, Z., Buratowski, S., Svejstrup, J. Q., Feaver, W. J., Wu, X., Kornberg, R. D., Donahue, T. F., and Friedberg, E. C. (1995) Mol. Cell. Biol. 15, 2288-2293). Moreover, this study shows how the activity of the the cyclin-dependent kinase-activating kinase associated with TFIIH complex in stimulating transcription is mediated in part by p44/XPD interaction.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

TFIIH is a multisubunit complex involved in two major DNA metabolism pathways, transcription and nucleotide excision repair (1). The transcriptionally active form of TFIIH, also called holo-TFIIH, includes core TFIIH, a five-subunit subcomplex constituted of XPB, p62, p52, p44, and p34, as well as XPD and the three subunits of the cyclin-dependent kinase (cdk)¹-activating kinase complex (known as CAK): cdk7, cyclin H, and MAT1. Mutations in XPB and XPD genes, encoding the two DNA-dependent ATPase-associated helicases (2-7), are responsible for several rare autosomal recessive human genetic disorders, including xeroderma pigmentosum (XP), Cockayne syndrome, and trichothiodystrophy (8-11).

Investigations on cells derived from XP-B and XP-D patients showed a significant decrease of both transcription and NER activities (12, 13). Many XP-B and XP-D patients suffer from a high UV sensitivity due to the inability of their NER machinery to remove DNA damage (14, 15). The NER reaction is dependent on both helicases, XPB and XPD, that play an essential role in the formation of an open complex structure necessary for the subsequent incisions on each side of the lesion by the site-specific endonucleases, ERCC1-XPF and XPG (1, 16-18).

In transcription, TFIIH is involved at different levels of the initiation step. A mutation in the ATP binding domain of XPB gives rise to a transcription defect due to an impaired promoter opening thus preventing the synthesis of the first phosphodiester bond by RNA polymerase II (RNA pol II) (19-22). The role of the XPD helicase, although rather elusive, appears to be less essential for the transcription initiation process. The XPD helicase activity is not required for both promoter opening and first phosphodiester bond synthesis; nevertheless, it significantly stimulates transcription. Indeed a mutation in the ATP-binding site of XPD strongly diminishes the in vitro RNA synthesis (4, 20, 23). In addition, the physical presence of XPD is required for an efficient promoter escape (22).

It has recently been shown that the p44 subunit of core TFIIH interacts with and strongly stimulates the XPD helicase activity (24). Although p44 does not possess any enzymatic activity, it has an essential role within TFIIH. In addition, the C-terminal end of p44 contains a zinc finger and RING finger-like domains, the role of which has not yet been elucidated. Unlike the case with XPD and XPB genes, no human genetic disorders have been associated with the gene encoding p44. However, large scale deletions found in the most severe type of spinal muscular atrophy (type I), known as Werdnig-Hoffmann disease, often implicate the telomeric p44 gene in addition to the SMN and NAIP genes (25). Only a few mutations of the SSL1 gene, the yeast counterpart of p44, have been found, pointing out the probable lethality of the large majority of ssl1 mutations (26, 27). These mutants can perform RNA pol II-dependent transcription at permissive temperatures, but this activity is abolished upon preincubation of yeast extracts at a restrictive temperature. Unlike transcription, an NER defect was observed even at permissive temperatures, explaining the constitutive UV sensitivity of these cells. The NER defect associated with UV sensitivity was also found in XP-D patients bearing a mutation in the C-terminal part of the XPD protein. This results in an absence of interaction between p44 and XPD and in an inhibition of the XPD helicase activity (24).

In the present study, we show that mutations in the N-terminal part of the human p44 prevent the XPD/p44 interaction leading to a significant diminution of transcription. We demonstrate that the recombinant TFIIH carrying such p44 mutations is deficient in the first steps of the transcription initiation reaction, the first phosphodiester bond formation and promoter clearance. The consequences of such mutations may explain the transcription defect observed in ssl1 mutant yeast.

	MATERIALS AND METHODS

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

Construction of Recombinant Baculoviruses Expressing TFIIH Subunits-- Baculovirus expressing a single TFIIH subunit were constructed in the pVL1392 or pACAB4 vectors (PharMingen). The cDNAs coding for XPB, XPD, XPDG675R, p62, p52, p34, cdk7, cyclin H, and MAT1 (Ménage-à-Trois) were inserted into the pVL1392-expressing vector as described previously (20, 24, 34). Each p44 mutant was obtained by PCR mutagenesis using pairs of oligonucleotides, GGAATTCCATGGATGAAGAACCTGAAAGAACT in combination with either GTATCTGTTATTCGATTGTCTGCAGAA, CTTACAACTTGCGCCCCATCTAATATT, CATACAAGTCGAGCAGTACTAATCATC, TTTGATCAAAATGCCATTAGTCAGATT, TATGTGGTAGTAGCCGGATCAAGAACA, or GGACATACAAGTGCCGAAGTACTAATC (to synthesize the 5' part of p44G200R, D178A, E166A, P100A, D66A, and R165A, respectively) and CGGATCCAACACCTGAAGGAGCTGGAATCTT in combination with either TCTGCAGACAATCGAATAACAGATAC, TATTAGATGGGGCGCAAGTTGTAAG, GATGATTAGTACTGCTCGACTTGTATG, AATCTGACTAATGGCATTTTGATCAAA, TGTTCTTGATCCGGCTACTACCACATA, or GATTAGTACTTCGGCACTTGTATGTCC (to synthesize the 3' remaining part of p44G200R, D178A, E166A, P100A, D66A, and R165A respectively). Wild type as well as mutant p44 cDNAs were inserted at EcoRI/BamHI sites. Both XPB and cyclin H are fused to a 6-histidine tag at their N-terminal extremity. The resulting vectors were recombined with baculovirus DNA (BaculoGold DNA, PharMingen) in Sf9 cells (Spodoptera frugiperda 9). The recombinant viruses were purified from isolated plaques, and viral stocks were prepared by a three-step growth amplification. The calculation of the multiplicity of infection of each virus stock solution as well as the determination of the best ratio between the expression of either subunit allowed us to optimize the co-production of the different proteins in a rather stoichiometric pattern.

Purifications of TFIIH Complexes-- For cobalt chelate affinity purification, Sf9 cells are infected with combinations of baculoviruses expressing the different subunits of TFIIH as described previously (20). 48 h after infection, cells were collected washed once and homogenized in lysis buffer (20 mM Tris-HCl, pH 7.8, 20% glycerol, 150 mM NaCl, 0.1% Nonidet P-40, 5 mM -mercaptoethanol, 0.5 mM phenylmethylsulfonyl fluoride, 1× protease inhibitor mixture). DNA as well as cell membranes were pulled down by centrifugation at 14,000 × g for 30 min (34). The supernatants were first applied on a heparin Ultrogel column. After a five-resin volume wash with buffer A containing 0.4 M NaCl, the proteins were eluted with 5 volumes of resin of the same buffer containing 0.5 M NaCl. After a 3-h dialysis against buffer B (50 mM Tris-HCl, pH 7.8, 20% glycerol, 300 mM KCl), fractions were incubated for 1 h at 4 °C with 1/40 fraction volume of cobalt chelate affinity resin (Talon, CLONTECH). After a 20-volume wash with buffer B containing 10 mM imidazole, proteins were eluted in buffer B containing 100 mM EDTA and dialyzed against buffer C (50 mM Tris-HCl, pH 7.8, 20% glycerol, 0.1 mM EDTA, 0.5 mM dithiothreitol, and 50 mM KCl).

For immunoaffinity purification, 0.5 M NaCl heparin fractions were dialyzed against buffer C and incubated with anti-p44 antibodies cross-linked to protein A-Sepharose beads for 12 h at 4 °C buffer C containing 0.1% Nonidet P-40. After three washes with buffer C containing 300 mM KCl in addition to 0.1% Nonidet P-40, proteins were eluted in one-bead volume of buffer C containing 2 mg/ml epitope peptide for 24 h.

Abortive Initiation Assays-- These reactions were carried out as described previously (22). Briefly, preinitiation complexes were assembled using adenovirus MLP template, TBP, TFIIB, TFIIE, TFIIF, TFIIH from various sources, and RNA polymerase II in the presence of 0.4 mg/ml bovine serum albumin and 5 mM MgCl₂ at 28 °C for 30 min. Phosphodiester bond synthesis was initiated by addition of CpA (0.5 mM), [-³²P]CTP, and dATP (4 µM) plus MgCl₂ to 6.5 mM. After 30 min for synthesis of the trinucleotide, the reactions were stopped by the addition of 100 mM EDTA and 0.5 mg/ml proteinase K. The samples were then applied on a 20% polyacrylamide 8.3 M urea gel and run at 20 watts.

Promoter Escape Reactions-- These reactions were carried out as described previously (22). Typically, preinitiation complexes were assembled in the same conditions as in the abortive initiation reaction but in the presence of a premelted adenovirus MLP (8/+2) heteroduplex template. In order to initiate transcription in the absence of ATP, priming dinucleotides ApG were used as initiating substrate. After 30 min of incubation for preinitiation complex formation, we started transcription by adding CTP and GTP to 5 µM, [-³²P]UTP, cordycepin to 100 µM, dATP to 4 µM, and MgCl₂ to 6.5 mM. After 30 min at 28 °C the reactions were stopped by the addition of 30 mM EDTA and 0.1 mg/ml proteinase K, and samples were applied on a 20% polyacrylamide gel, 8.3 M urea and run at 20 watts.

	RESULTS

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

Mutations in the N-terminal Part of p44 Abolish Its Regulatory Function toward the XPD Helicase-- By having previously shown that the N-terminal portion of p44 interacts with the C-terminal part of XPD (24), we investigated the consequences of mutations in p44 on TFIIH activities. We performed a multiple sequence alignment of the N-terminal part of p44 from different organisms to determine the localization of the most conserved regions (GenBank^TM accession numbers: human p44, Z30094, Drosophila, AC005720; Caenorhabditis elegans, Z30662; Schizosaccharomyces pombe, c1682; Saccharomyces cerevisiae, 1360294; and Arabidopsis thaliana, AC005322). Given that this region of p44 does not contain any consensus motif potentially essential for the function of the protein, we generated several mutated recombinant TFIIHs by introducing point mutations in the most conserved codons of the 5' end of p44. Five of the six designed recombinants contain mutations that correspond to a conversion of a conserved amino acid into an alanine (Fig. 1; D66A, P100A, R165A, E166A, and D178A). The sixth mutation mimics the glycine to arginine transversion already reported in the yeast SSL1 gene, the counterpart of the human p44 (27). These point mutations are expected to affect various types of predicted secondary structures of p44 (-sheet, D66A, R165E, and E166A; -helix, D178A; and coil, P100A and G200R) (29). The mutations have been generated by PCR, following a classical procedure of site-directed mutagenesis. PCR products were subcloned into pVL1392 vector and finally inserted into the baculovirus genome by recombination. The cDNAs coding for cyclin H and XPB have been fused to a His tag coding sequence at the 5' extremity. Sf9 insect cells were thereafter infected with the recombinant viruses in order to produce either p44 alone, TFIIH subcomplexes (IIH6, containing core TFIIH plus XPD), or holo-TFIIH (IIH9, containing the nine subunits) complexes that were then further purified by cobalt chelate affinity (20). Given that the recombinant p44 protein is not fused to a His tag, this subunit alone was purified by immunoaffinity and subsequently eluted using an epitope peptide (13).

View larger version (23K): [in this window] [in a new window]   Fig. 1.   Point mutations generated in the N-terminal half of p44. Point mutations have been introduced in the most conserved regions of the 5'-half of the p44 cDNA by PCR. These mutations result in a conversion of an original residue into an alanine for five of the six mutations, D66A, P100A, R165A, E166A, D178A, and G200R (the letters depict the considered residue and the numbers indicate the amino acid position). Position of mutations described in yeast is indicated in italic. The sequence alignments show the highly conserved amino acid through the evolution from yeast to human and plants (Hs, Homo sapiens; Dm, Drosophila melanogaster; Ce, C. elegans; Sp, S. pombe; Sc, S. cerevisiae; and At, A. thaliana). A RING finger-like motif is present between residues 345 and 385 and a zinc finger between residues 291 and 308.

To investigate if mutations within p44 are detrimental for XPD helicase activity, we first tested the ability of XPD to interact with p44. Therefore, we carried out immunoprecipitations on crude extracts of Sf9 cells infected with baculoviruses overexpressing XPDwt and either p44G200R, p44D178A, p44E166A, p44P100A, p44D66A, or p44165A using monoclonal antibodies raised against XPD. After extensive washing at 0.4 M KCl, the immunoadsorbed proteins were analyzed by SDS-polyacrylamide gel electrophoresis followed by Western blotting analysis. XPDwt exhibited an interaction with p44P100A and p44R165A as strong as with p44wt (Fig. 2A, compare lanes 6 and 8 with lane 1), whereas it did not bind p44G200R and p44D66A (lanes 3 and 7). As a control we used the recombinant XPD-G675R reproducing the transversion Gly to Arg of residue 675 of XPD that was reported in a human XP-D patient (30). As already shown (24), the overexpressed XPD-G675R subunit did not interact with p44wt (lane 2). Furthermore, we observed a weak interaction between either p44D178A or p44E166A and XPDwt polypeptides (lanes 4 and 5). It should be noticed, however, that the differential complex formation was not simply a result of variable steady state levels of expression of either wild type or mutant p44 (Fig. 2A, compare load and IP). In another set of experiments, we investigated the consequences of p44 mutations on the XPD helicase activity. XPD-p44 complexes immobilized by antibodies raised against XPD (see "Materials and Methods") were then tested for their ability to unwind the DNA using an assay in which the displacement of an oligonucleotide from the M13 single-stranded plasmid was measured. p44wt bound to XPD-stimulated XPD helicase activity up to 5-6-fold (Fig. 2B, lanes 2 and 3). We noticed that the XPD helicase activities are roughly proportional to the amount of p44 with which it coimmunoprecipitates. p44P100A and p44R165A interacted with XPD and stimulated its 5' to 3' helicase activity as observed with p44wt (Fig. 2B, compare lanes 7 and 9 with lane 3). On the contrary, although XPD was overexpressed with either p44G200R or p44D66A, it did not coimmunoprecipitate with these two recombinant p44 polypeptides and was not stimulated by any of them; in such cases, XPD displayed the same 5'  3' helicase activity as XPDwt alone (compare lanes 4 and 8 with lane 2). An intermediate pattern of helicase activity was repeatedly observed with the p44D178A and the p44E166A XPD partners (Fig. 2B, lanes 5 and 6). Interestingly, mutations affecting two successive residues of p44 (R165A and E166A) led to very different helicase activities. Indeed, the p44R165A-XPDwt heterodimer was fully active in helicase assays, whereas p44E166A-XPDwt exhibited a weak helicase activity. Together our data show that the 5'  3' XPD helicase activity and XPD/p44 interaction are qualitatively and quantitatively connected, pointing out the important role of p44 in the regulation of the XPD helicase activity.

View larger version (29K): [in this window] [in a new window]   Fig. 2.   Interactions between p44 mutants and XPD and XPD helicase activity. Lysates of Sf9 cells coinfected with wild type XPD baculovirus in addition to either of the p44 mutant baculoviruses (Load) were immunoprecipitated (IP) with anti-XPD antibodies. The same procedure was followed with coexpressed wild type p44 with either wild type XPD (positive control) or G675R XPD mutant and with wild type XPD alone (negative control). After extensive washing of beads by a 0.4 M KCl buffer containing 0.1% Nonidet P-40, half of the proteins remaining attached to the the beads were resolved on an SDS-polyacrylamide gel electrophoresis followed by immunoblotting (WB) using antibodies directed toward p44 and XPD (A). The second half were tested in an helicase assay (B). C, the same immunoprecipitated proteins as those described above were tested in an ATPase assay using in addition to proteins, [-32P]ATP as a substrate in the presence of DNA (lanes 3-10). The upper spots represent the released inorganic phosphate, whereas the lower spots indicate stands for non-hydrolyzed substrate (ATP). Endogenous HeLa TFIIH was used as a positive control (lane 2). The intrinsic instability of [-32P]ATP is represented on lane 1 and serves as a negative control. D, increasing amounts of proteins were immunoprecipitated with anti-XPD antibodies coupled to protein G-Sepharose beads before incubation with [-32P]ATP in a regular ATPase assay.

As we previously mentioned, the 5'  3' helicase activity of XPD is dependent on both the presence of DNA and the ATP hydrolysis. Assuming that the absence of XPD/p44 interaction might affect the XPD ATPase activity required for DNA unwinding, we were interested in measuring this activity when XPD is associated with p44. For this purpose, we ran an ATPase assay as described by Roy and co-workers (32), in which immunoprecipitated XPD containing fractions (i.e. XPD-p44 heterodimer) were incubated with [-³²P]ATP as a substrate, in the presence of DNA. We observed that none of the mutated recombinant p44s modulate the XPD ATPase activity. Whether p44 is present or not, the level of hydrolysis of ATP by XPD remains constant (Fig. 2C, compare lanes 5-10 with lanes 3 and 4). Moreover, incubation of the substrate with increasing amount of proteins revealed that the ATP hydrolysis has not gone to saturation and is not affected by mutations within p44 (Fig. 2D, compare lanes 2-4 with 5-7 and 8-10). Therefore, although the XPD helicase activity drops in the presence of some of the mutated p44 recombinants, the ATP hydrolysis remains unchanged, meaning that the ATPase activity is independent of the helicase even if the helicase requires ATP hydrolysis for its DNA unwinding activity.

Mutations in p44 Affect the Transcriptional Activity of TFIIH-- We then investigated the effect of p44 mutations on the transcriptional activity of the IIH6 recombinant complexes that contain 5 subunits of the "core TFIIH," including either the wild type or the mutated p44 subunit, in addition to XPDwt or XPDG675R. In this case, XPD was similarly expressed (Fig. 3A, compare the load, XPD and p62). The different complexes overexpressed in Sf9 cells were purified on a heparin Ultrogel column, and the 0.5 M KCl-eluted fraction was loaded subsequently on a cobalt chelate affinity column to retain the His-tagged XPB containing TFIIH complexes (20). p44 is a central protein in the core TFIIH complex and has been shown to interact with XPB, p62, and p34 (31).² We then tested by immunoprecipitation the interactions between each of these three polypeptides and the various p44 mutants. The three TFIIH subunits were able to coprecipitate with the different p44 mutants, meaning that the different designed mutations do not affect the interactions between p44 and its three partners within core TFIIH (data not shown). The composition of each recombinant IIH6 complex was analyzed by Western blotting (Fig. 3A). We noticed variations in the amount of XPD associated with the different complexes (Fig. 3A, compare lanes 3, 4, and 7 with lane 6). The quantity of XPD within the complex was roughly proportional to the strength of the interaction between p44 and XPD (compare lanes 3, 4, and 7 of Fig. 3A with lanes 3, 4, and 7 of Fig. 2A). Interestingly, II6/p44E166A and IIH6/XPDG675R mutated complexes, despite the absence of a direct strong interaction with p44, contained a substantial amount of XPD associated with the core complex (Fig. 3A, lanes 1 and 5). The presence of XPD within TFIIH might be due to additional weak interactions with XPB and p62 (31, 33).²

View larger version (47K): [in this window] [in a new window]   Fig. 3.   Run-off transcription assay with purified IIH6s and IIH9s. A, immunopurified IIH6 complexes (IP) from baculovirus-infected cell extracts (Load), as indicated at the top of the panels were submitted to SDS-polyacrylamide gel electrophoresis, and proteins were revealed by immunoblotting using antibodies raised against XPB, XPD, p62, and p44 subunits of TFIIH. B, equal amounts of purified IIH6 complexes were tested in an in vitro transcription assay. HeLa TFIIH has been used as a positive control, whereas the assay run without any TFIIH defines the negative control. C, transcription performed as described above in the presence of fixed amount of CAK (2 µl). The size of the RNA run-off transcript is 309 nucleotides (nt).

A run-off transcription assay was carried out using the adenovirus major late promoter (MLP) as a template, the basal transcription factors TBP, TFIIA, TFIIB, TFIIE, TFIIF, and RNA pol II, and as indicated the various IIH6 complexes. The amounts of TFIIHs were adjusted on the basis of p62 and XPB content. First, the transcriptional activity of both IIH6/p44P100A (Fig. 3B, lanes 13 and 14) and IIH6/p44R165A (lanes 17 and 18) was not affected by the mutations when compared with the recombinant wild type IIH6 (lanes 3 and 4). Second, transcription using either IIH6/p44G200R or IIH6/p44D66A was drastically diminished (Fig. 3B, lanes 7 and 8 and 15 and 16), reflecting on one hand the absence of interaction between XPD and the corresponding mutated p44 (Fig. 2A, lanes 3 and 7) and on the other hand the weak association of XPD with the core complex (Fig. 3A, lanes 3 and 7). The transcriptional activity of the IIH6/p44D178A complex did not exactly parallel the interaction between p44D178A and XPD and was lower than the expected level probably because of the low amount of XPD present in the IIH6 complex (Fig. 3A, lanes 9 and 10). Additionally, the IIH6/p44E166A and IIH6/XPDG675R complexes were moderately active despite the presence of a normal amount of XPD in both complexes (Fig. 3A, compare lanes 1 and 5 with lane 2).

CAK complex has been shown to stimulate the transcriptional activity when added to a reconstituted in vitro transcription assay (34). With the aim of knowing if the addition of CAK could circumvent any p44 defect, we carried out a run-off transcription experiment in which CAK was added to the various IIH6 complexes (Fig. 3C). p62 and XPB content were taken as a reference to adjust the amounts of TFIIH used in the run-off transcription assay. We observed that addition of CAK does not modify qualitatively the ability of the mutated IIH6 complexes to transcribe MLP. However, as previously observed the level of RNA synthesis was increased about 4-5-fold. This stimulation was even more pronounced when CAK is added to IIH6/p44E166A and IIH6/XPDG675R indicating that the CAK complex might stabilize XPD within TFIIH, through some interactions with other subunits of the core.³ Together these results show that mutations that affect the accurate p44/XPD interaction are detrimental for the transcriptional activity and that the effect of the CAK complex on transcription is mediated by this interaction.

Mutations in p44 Lead to a Defect in Both the First Phosphodiester Bond Synthesis and Promoter Escape-- It was recently demonstrated that the XPB helicase is responsible for the promoter opening and consequently facilitates the first phosphodiester bond formation (13, 20, 36) while XPD helps promoter clearance (22). Although XPD helicase activity seems to be dispensable for transcription initiation by RNA pol II, its role remains unclear, since clinical features of XP-D patients could not be explained only on the basis of NER defect (30). Nevertheless, XPD is absolutely required for CAK stimulation during transcription reaction likely because it anchors CAK to the core of TFIIH. The main question was to know whether the inhibition of transcription caused by mutations in p44 was due to an absence of stimulation of the XPD helicase activity and the impairment of CAK anchorage or to the inability of mutated p44 to fulfill a possible additional role in the transcription process.

We thus set up an abortive transcription initiation assay based on the detection of the synthesis of the first phosphodiester bond. Wild type IIH6 as well as mutated IIH6 were incubated with or without CAK in addition to the required general transcription factors, dinucleotides CpA, radiolabeled CTP, as well as dATP as a source of energy and in the presence of MLP as a template. IIH6/p44P100A and IIH6/p44R165A showed a capacity to synthesize the first phosphodiester bond comparable to the wild type complex (Fig. 4A, compare lanes 13 and 14 and 17 and 18 with lanes 3 and 4) as expected from the above transcription assay (Fig. 3, B and C, lanes 13 and 14 and 17 and 18). This observation also highlights the fact that the CAK complex enhances significantly the first phosphodiester bond synthesis level (Fig. 4A, compare lanes 3, 13, and 17 with 4, 14, and 18, respectively). On the contrary, IIH6/p44G200R, IIH6/p44D178A, and IIH6/p44D66A exhibited a very strong deficiency in participating in the first phosphodiester bond formation (lanes 7-10 and 15 and 16). Both IIH6/XPDG675R and IIH6/p44E166A presented an abortive initiation defect, despite the presence of the XPD protein within the complex, meaning that an accurate interaction between p44 and XPD is required to allow the anchorage and/or the stimulatory effect of the CAK complex (compare lanes 6 and 12 with lane 4).

View larger version (58K): [in this window] [in a new window]   Fig. 4.   Activity of wild type and mutated IIH6 in an abortive initiation and promoter escape assays. The immunopurified IIH6 complexes were tested for their ability to participate in the first phosphodiester bond formation (A, Abortive initiation) in the same conditions as a run-off transcription but in the presence of CpA and [-32P]CTP and dATP as a source of energy. The first phosphodiester bond formation is evaluated by the synthesis of a trinucleotide (3nt) as indicated. Their ability to participate in the elongation process (B, Promoter escape) was measured using a premelted promoter template in the presence of ApG which served as an initiator. Two major products with distinct lengths are synthesized as indicated.

We were further interested in evaluating the ability of each mutant to clear the promoter after initiation. We carried out a promoter escape assay, independent of the role of TFIIH in promoter opening and abortive initiation (21). We therefore used a pre-melted heteroduplex DNA (8/+2) as a template as described under "Materials and Methods." To allow the accumulation of products that escape the promoter, we employed the chain terminating ATP-analog cordycepin. These products are mainly two oligomers of 17 and 31 nucleotides length. All recombinant TFIIH mutants that have a transcriptional defect also presented an impairment of promoter clearance except IIH6/p44P100A. IIH6/p44G200R, IIH6/p44D178A, and IIH6/p44D66A showed a very strong inefficacy to perform the promoter escape (Fig. 4B, compare lanes 7-10 and 15 and 16 with 3 and 4). This defect can be attributed to the absence of XPD within the three mentioned IIH6s (see Fig. 3A) or the consequence of p44 mutations. Moreover, CAK slightly stimulated the exit of RNA pol II from the promoter when added to IIH6wt, IIH6/p44P100A, and IIH6/p44R165A (Fig. 4B, compare lanes 3, 13, and 17 with lanes 4, 14, and 18, respectively) but significantly increased the escape when added to either IIH6/XPDG675R or IIH6/p44E166A (Fig. 4B, compare lane 3 with 4 and lanes 5 and 11 with lanes 6 and 12, respectively). Nevertheless, the CAK complex increased the promoter clearance to a much lower extent than the first phosphodiester bond formation.

Together these observations highlighted the role of CAK in a very early step of transcription initiation reaction (for example compare Fig. 4, A and B, lanes 5 and 6, 13 and 14, and 17 and 18), whereas the physical presence of XPD (Fig. 4B, compare lane 3 with 7, 9 and 15) and an accurate interaction between p44 and XPD (Fig. 4B, compare lane 3 with lanes 5 and 11) seem to be of crucial importance for an efficient promoter escape reaction.

	DISCUSSION

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

Transcription of protein coding genes is a multistep and complex mechanism that involves a battery of factors whose function is not yet fully elucidated. The understanding of gene expression became more difficult when transcription appeared to be coupled to DNA repair. In this aspect, TFIIH is a key factor because of its various enzymatic activities that are absolutely required for both mechanisms. One of the main difficulties to unravel the exact role of this factor is that TFIIH has to be considered as a whole complex whose subunits may be selectively involved in defined steps of transcription. For instance, we know that XPB helicase activity is crucial for promoter opening, whereas XPD helicase activity is not. Nevertheless, the physical presence of XPD is required for an optimal transcriptional activity (20, 22). In the present study we focused our attention on the role of p44, in particular its ability to stimulate the XPD helicase activity and as a consequence its function in the first steps of the transcription reaction.

p44 Regulates the XPD Helicase Activity-- It was previously shown in our laboratory that mutations in the C-terminal domain of XPD perturb its interaction with p44, thus explaining at least in part the severe phenotypes observed in some XP-D patients (13, 24). To investigate further how such a contact was critical for the TFIIH activity, we undertook the analysis of the function of p44. Following a site-directed mutagenesis procedure, we generated several point mutations in various conserved regions of the N-terminal part of p44. We found that mutations leading to amino acid changes at positions 66 (D66E) and 200 (G200R) of p44 prevent its interaction with XPD and therefore do not allow an optimal XPD helicase activity (Table I). Amino acid changes at positions 166 and 178 (E166A and D178A, respectively) weaken this interaction and partially inhibit the helicase activity of XPD, thus pointing out the clear correlation that exists between the XPD/p44 interaction and the XPD helicase activity. This study therefore enlightens the regulatory role of p44 toward the XPD helicase activity. Despite the presence of all the signatures of a helicase protein, XPD works with p44, its regulatory subunit, to separate efficiently DNA strands. It thus clearly appears that the subsequent TFIIH activities are tightly related to the nature of the interaction between XPD and p44 (Table I). Indeed, the transcriptional activity of both IIH6/p44E166A and IIH6/XPDG675R complexes is weak and reflects the weakness of the interaction between the XPD and p44 subunits, despite the roughly normal TFIIH subunit stoichiometry. We can therefore assume that mutations of p44 that modify either its interaction with XPD or/and the proper architecture of TFIIH leads to the same defect as a mutation generated in the C-terminal domain of XPD (this study, see also Ref. 24). Moreover, this work delineates a p44 interacting domain in which amino acids Gly-200, Asp-178, Glu-166, and Asp-66 are crucial for an accurate interaction with XPD. It is also worthwhile to point out that although p44 regulates the DNA unwinding activity of XPD, it has no effect on its ATP hydrolysis activity. In other words, the helicase activity and the ATPase activity of XPD are differently regulated.

The Role of CAK in the Transcription Reaction-- The present work also sheds light on the CAK function. Indeed, the ability of CAK to stimulate the first phosphodiester bond formation depends on p44/XPD interaction. For example, we noticed that when p44 is mutated at position Asp-178 or Glu-166, the addition of CAK has a weak (if any) effect on the first phosphodiester bond reaction. In return, when p44 is mutated at position either Pro-100 or Pro-165, the stimulation by CAK is as high as for p44wt. In the absence of an accurate p44/XPD interaction the stimulatory effect of CAK is limited. It cannot be excluded that some p44 mutations diminish the efficiency of the first phosphodiester bond synthesis by affecting not only XPD binding but also the anchorage of the CAK complex to the core TFIIH. Indeed, despite the lack of interaction between p44 and XPD, this latter might still be part of the complex because of additional interactions of XPD with XPB but also p62 (31).² Such interactions have also been reported in the yeast in which Rad3 protein binds directly to both SSL2/Rad25 and SSL1 proteins (33). Similarly, CAK binding to the core TFIIH, which is essentially mediated by XPD, might be stabilized through secondary interactions with other subunits of the core TFIIH such as XPB or p34³ to maintain the whole TFIIH complex in an accurate conformation. We have noticed that some mutated IIH6 complexes that possess stoichiometric amounts of XPD exhibit a first phosphodiester bond synthesis activity much lower than the wild type complex, suggesting that this reaction requires not only the physical presence of XPD but also an accurate p44/XPD interaction.

Addition of CAK also increases promoter escape activity as a function of the interaction between p44 and XPD. Nevertheless, in the course of this study, we demonstrated that CAK has a much stronger stimulatory function during the first phosphodiester bond formation than during promoter escape. In the former case, the stimulation is up to 6-8-fold, whereas in the later case, enhancement is much weaker. This suggests that the role of CAK occurs essentially in the first steps of the transcription, promoter opening and first phosphodiester bond formation, and is dependent on an accurate p44/XPD interaction.

Moreover, according to the above observations and regarding the property of SSL1 in yeast, the role of p44 in human might not be restricted to transcription. Indeed, the G266R mutation in yeast (the counterpart of the G200R mutation in human) induces in addition to a transcriptional defect, a DNA repair defect, as well as a translational defect due to its incapacity to suppress the stem loops present in the mRNAs before translation (27). Furthermore, a T242I mutation in the yeast SSL1 is responsible for the stimulation of recombination between short repeats (<300 base pairs) (28, 35). This indicates that TFIIH may normally prevent these events, participating thus in the maintenance of the genome stability. Despite the pleiotropic effect of the modification of the p44 protein, these yeast mutants grow. Although SSL1 is an essential gene in yeast, nonlethal alleles, such as G266R, are temperature-sensitive for growth, indicating a defect in protein function for TFIIH. Despite our efforts, no human patient bearing a mutation in the p44 gene, the human homolog of SSL1, has been reported so far. This might be explained by the fact that in human, the p44 gene is duplicated in the region q13 of chromosome 5 (25) and that both genes are expressed, thus making unlikely to find patients with XPD phenotypes. Nonetheless, this study demonstrates that mutations in the human p44 gene, when tested in vitro, can cause a defect in TFIIH function, primarily resulting from defective assembly of the 9-subunit TFIIH complex.

It has to be pointed out that the contact domains that encompasses the C-terminal portion of Rad3/XPD as well as the N-terminal region of SSL1/p44 are highly conserved between yeast and human. This also strongly suggests that the XPD/Rad3 helicase regulatory function of p44/SSL1 was conserved during evolution and might, at least partially, explain the transcriptional defect of the SSL1 mutated yeast (26).

	ACKNOWLEDGEMENTS

We are grateful to D. Moras for fruitful discussions and to J. Auriol, F. Coin, and S. Fribourg for support and critical reading of the manuscript. We thank I. Kolb and J.-L. Weickert for providing baculovirus-infected cells. We also thank A. Fery for excellent technical expertise.

	FOOTNOTES

^* This work was supported by grants from the INSERM and National Research Service Award F32 GM20174-01) (to J. B.), the CNRS, the Ministère de la Recherche et de l'Enseignement Supérieur (to E. B.), the Ligue Contre le Cancer (to T. S.) by a Human Frontier grant, the Association de la Recherche Contre le Cancer, and the Hôpital Universitaire de Strasbourg.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

To whom correspondence should be addressed. Tel.: 33 3 88 65 34 47; Fax: 33 3 88 65 32 01; E-mail: egly@igbmc.u-strasbg.fr.

Published, JBC Papers in Press, August 2, 2000, DOI 10.1074/jbc.M004764200

² T. Seroz, C. Perez, E. Bergmann, J. Bradsher, and J.-M. Egly, unpublished results.

³ Busso, D., Kériel, A., Sandrock, B., Poterszman, A., Gileadi, O., and Egly, J. M. (2000) J. Biol. Chem. 275, 22815-22823.

	ABBREVIATIONS

The abbreviations used are: cdk, cyclin-dependent kinases; XP, xeroderma pigmentosum; NER, nucleotide excision repair; PCR, polymerase chain reaction; wt, wild type; CAK, cdk-activating kinase; pol, polymerase; MLP, major late promoter.

	REFERENCES

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

CiteULike

Complore

Connotea

Del.icio.us

Digg

Reddit

Technorati

This article has been cited by other articles:

				A. E. Escargueil, V. Poindessous, D. G. Soares, A. Sarasin, P. R. Cook, and A. K. Larsen Influence of irofulven, a transcription-coupled repair-specific antitumor agent, on RNA polymerase activity, stability and dynamics in living mammalian cells J. Cell Sci., April 15, 2008; 121(8): 1275 - 1283. [Abstract] [Full Text] [PDF]

				M. Matsuno, H. Kose, M. Okabe, and Y. Hiromi TFIIH controls developmentally-regulated cell cycle progression as a holocomplex. Genes Cells, November 1, 2007; 12(11): 1289 - 1300. [Abstract] [Full Text] [PDF]

				E. Kellenberger, C. Dominguez, S. Fribourg, E. Wasielewski, D. Moras, A. Poterszman, R. Boelens, and B. Kieffer Solution Structure of the C-terminal Domain of TFIIH P44 Subunit Reveals a Novel Type of C4C4 Ring Domain Involved in Protein-Protein Interactions J. Biol. Chem., May 27, 2005; 280(21): 20785 - 20792. [Abstract] [Full Text] [PDF]

				T. Watanabe, K. Hayashi, A. Tanaka, T. Furumoto, F. Hanaoka, and Y. Ohkuma The Carboxy Terminus of the Small Subunit of TFIIE Regulates the Transition from Transcription Initiation to Elongation by RNA Polymerase II Mol. Cell. Biol., April 15, 2003; 23(8): 2914 - 2926. [Abstract] [Full Text] [PDF]

				R. J. Bienstock, M. Skorvaga, B. S. Mandavilli, and B. Van Houten Structural and Functional Characterization of the Human DNA Repair Helicase XPD by Comparative Molecular Modeling and Site-directed Mutagenesis of the Bacterial Repair Protein UvrB J. Biol. Chem., February 7, 2003; 278(7): 5309 - 5316. [Abstract] [Full Text] [PDF]

				E. Botta, T. Nardo, A. R. Lehmann, J.-M. Egly, A. M. Pedrini, and M. Stefanini Reduced level of the repair/transcription factor TFIIH in trichothiodystrophy Hum. Mol. Genet., November 1, 2002; 11(23): 2919 - 2928. [Abstract] [Full Text] [PDF]

				A. Jawhari, J.-P. Laine, S. Dubaele, V. Lamour, A. Poterszman, F. Coin, D. Moras, and J.-M. Egly p52 Mediates XPB Function within the Transcription/Repair Factor TFIIH J. Biol. Chem., August 23, 2002; 277(35): 31761 - 31767. [Abstract] [Full Text] [PDF]

				F. Santagati, E. Botta, M. Stefanini, and A. M. Pedrini Different dynamics in nuclear entry of subunits of the repair/transcription factor TFIIH Nucleic Acids Res., April 1, 2001; 29(7): 1574 - 1581. [Abstract] [Full Text] [PDF]

				A. R. Lehmann The xeroderma pigmentosum group D (XPD) gene: one gene, two functions, three diseases Genes & Dev., January 1, 2001; 15(1): 15 - 23. [Full Text]

				A. Tremeau-Bravard, C. Perez, and J.-M. Egly A Role of the C-terminal Part of p44 in the Promoter Escape Activity of Transcription Factor IIH J. Biol. Chem., July 13, 2001; 276(29): 27693 - 27697. [Abstract] [Full Text] [PDF]

				B. Sandrock and J.-M. Egly A Yeast Four-hybrid System Identifies Cdk-activating Kinase as a Regulator of the XPD Helicase, a Subunit of Transcription Factor IIH J. Biol. Chem., September 14, 2001; 276(38): 35328 - 35333. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) All Versions of this Article: 275/43/33260    most recent M004764200v1 Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager