| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
J. Biol. Chem., Vol. 275, Issue 43, 33791-33797, October 27, 2000
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
From the Departments of
Received for publication, May 26, 2000, and in revised form, June 30, 2000
Archaeal RadA, like eukaryotic Rad51 and
bacterial RecA, promotes strand exchange between DNA strands with
homologous sequences in vitro and is believed to
participate in the homologous recombination in cells. The amino acid
sequences of the archaeal RadA proteins are more similar to the
eukaryotic Rad51s rather than the bacterial RecAs, and the N-terminal
region containing domain I is conserved among the RadA and Rad51
proteins but is absent from RecA. To understand the structure-function
relationship of RadA, we divided the RadA protein from Pyrococcus
furiosus into two parts, the N-terminal one-third (RadA-n) and
the residual C-terminal two-thirds (RadA-c), the latter of which
contains the central core domain (domain II) of the RecA/Rad51 family
proteins. RadA-c had the DNA-dependent ATPase activity and
the strand exchange activity by itself, although much weaker (10%)
than that of the intact RadA. These activities of RadA-c were restored
to 60% of those of RadA by addition of RadA-n, indicating that the
proper active structure of RadA was reconstituted in vitro.
These results suggest that the basic activities of the RecA/Rad51
family proteins for homologous recombination are derived from domain
II, and the N-terminal region may help to enhance the catalytic efficiencies.
Genetic recombination is important in generating genetic diversity
and in repairing DNA damage. The RecA protein of eubacteria and the
Rad51 protein of eukaryotes play a central role in homologous DNA
recombination by searching for sequence homology and exchanging the DNA
strands (reviewed in Refs. 1-4). Two genes, radA and radB, both of which encode RecA/Rad51 family proteins, have
been found in the genomes of archaeal organisms (5, 6). All of the
euryarchaeotic total genome sequences that have been determined to date
contain both RadA and RadB (7, 8). Biochemical analyses have shown that
the archaeal RadA proteins have functionally similar properties to the
RecA family proteins from other domains of life, and they probably play
a critical role in recombination and repair (9-12).
The N-terminal regions of eukaryotic Rad51-like proteins are highly
conserved, but the corresponding region is absent in bacterial RecA
proteins. Instead, RecA has an extra C-terminal region. The C-terminal
region of RecA possibly works by catching the double-stranded DNA with
the sequence homologous to the
ssDNA,1 which is complexed
with RecA protein (13, 14). Eukaryotic Rad51 is known to interact with
other proteins, including Rad52 (15-17), Rad54 (18, 19), Rad55/57
(20), p53 (21, 22), Brca1 (23), and Brca2 (24-28). The eukaryotic
Rad51 has a unique N-terminal region, which is therefore thought to
have important roles for the interactions with these proteins. On the
other hand, a recent mutational analysis indicated that the N-terminal
domain of the human Rad51 protein constitutes a DNA binding domain
(14). From this result, it has been proposed that the N-terminal domain of Rad51 could have the same function as the C-terminal domain of RecA,
although they have no structural homology to each other (14).
We cloned the two genes, radA and radB from the
hyperthermophilic archaeon, Pyrococcus furiosus, expressed
them in Escherichia coli, and characterized the gene
products, RadA and RadB (30). The amino acid sequences of RadA and RadB
are very similar to that of eukaryotic Rad51 (54 and 29% similarity,
respectively, to S. cerevisiae Rad51). RadA has a
DNA-dependent ATPase activity, D-loop formation activity,
and strand exchange activity, which are similar to the abilities of the
other RecA family proteins. On the other hand, RadB has a very weak
ATPase activity that is not stimulated by DNA. Little RadB strand
exchange activity could be detected with either a plasmid substrate or
an oligonucleotide substrate, even though the protein had very strong
DNA binding ability. An immunological analysis showed that the amount
of RadB protein in the P. furiosus cell was 200 times less
than that of RadA. RadA contains an N-terminal region like that of the
eukaryotic Rad51. On the other hand, RadB has only the central core
region of the RecA family proteins and has neither the N-terminal nor C-terminal extra domain.
To explore the structure-function relationship for the DNA pairing and
strand exchange activities of the RecA/Rad51 family proteins, we made
deletion mutant proteins, RadA-n and RadA-c, which contain only the
N-terminal and C-terminal (central core) regions of RadA, respectively.
The RadA-c had the strand exchange activity by itself, although it was
much weaker than that of intact RadA. The decreased activity of RadA-c
was restored by the addition of RadA-n, indicating that the appropriate
conformation of RadA was reconstituted.
Preparation of RadA, RadA-n, and RadA-c Proteins--
The
construction of the expression plasmid of the radA gene in
E. coli and the purification procedure of the RadA protein are described in the accompanying paper (30). The N-terminal- and
C-terminal truncated RadAs (RadA-n,
Met1-Arg107; RadA-c,
Ala108-Asp349) were prepared by expression of
each truncated gene in E. coli. The genes, radA-n
and radA-c were amplified by polymerase chain reaction using two sets of primers (RADAF,
ACATATGGCTGGTGAGGAAGTTAAGGAGAT, and RADANR,
CACGAGCTCGAGTTATTATCTCTTCTTGAGATATTC, or RADACF,
CACGAGCATATGGCTACAATAGGGAGAATTTC, and RADAR,
TCTCGAGTCTAATCCTCTATCCCTTTTTCA) and were
inserted into the NdeI-XhoI sites of the pET21a
expression plasmid. The resultant plasmids were designated pPFRADAN and
pPFRADAC, respectively. E. coli JM109 (DE3) carrying
pPFRADAN or pPFRADAC was cultivated, and the expression of the
radA-n or radA-c gene was induced under the same
conditions as for pPFRADA/JM109 (DE3). The heat-resistant fractions
were prepared from cells carrying either pFURADAC or pFURADAN, in
sonication buffer with or without 0.4 M NaCl by sonication and heat treatment. After treatment with 0.5% polyethylenimine, the
supernatant from each cell was precipitated with ammonium sulfate (80%
saturation). The RadA-n precipitate was resuspended in and dialyzed
against buffer A and was applied to a HiTrap Q column. The fractions
eluted at 0.12-0.36 M NaCl were mixed with four volumes of
buffer A and were applied to a heparin column. The protein fraction
(0.12-0.35 M NaCl) was combined with four volumes of
buffer C (buffer A, except at pH 8.8) and was applied to a Mono S HR
5/5 column. The pass fraction was applied to a HiTrap Q column, and the
RadA-n was eluted at 0.24-0.36 NaCl. The RadA-c precipitate was
resuspended in buffer A containing 1 M ammonium sulfate and
was applied to a phenyl-Sepharose column. The RadA-c protein was eluted
at 0.7-0.3 M ammonium sulfate, and the fractions were
dialyzed against buffer A. The dialysate was applied to a heparin
column, and the protein was eluted at 0.2-0.3 M NaCl. The
fractions were diluted with four volumes of buffer C and then applied
onto a HiTrap Q column. The RadA-c protein was eluted at 0.12-0.23
NaCl and was stored on ice. The concentrations of RadA-n and RadA-c
were determined by using molar extinction coefficients
( ATPase Activity--
The ATPase activities of RadA, RadA-n,
RadA-c, and the reconstituted mixture of RadA-n and RadA-c (the ratio
of 1:1, 2:1, or 5:1) were measured exactly as described in the
accompanying paper (30). The RadA, RadA-n, RadA-c, or mixture protein
(each at 2 µM), [ Gel Retardation Assay--
Various concentrations of RadA,
RadA-n, RadA-c, and the reconstituted mixture of RadA-n and RadA-c (the
ratio of 2:1) were used for the gel retardation assay using conditions
as described in the accompanying paper (30).
D-loop Formation Assay--
RadA, RadA-n, RadA-c, or the
reconstituted mixture of RadA-n and RadA-c were mixed with 1 µM (as nucleotide) of 32P-labeled 83-mer
oligonucleotide, W16(32), at the indicated concentration and incubated
in 19 µl of exchange buffer at 65 °C for 10 min. Then M13
double-stranded DNA (0.1 µg) was added to the mixtures, which were
further incubated for 2 min. The reaction using E. coli
RecA, prepared as described earlier (33), was performed under the same
conditions except at 37 °C. The reaction mixtures were manipulated
as described (30).
Strand Exchange Reactions--
RadA, RadA-n, RadA-c, or the
reconstituted mixture of RadA-n and RadA-c (the ratio of 1:1, 2:1, or
5:1) was incubated with single-stranded pUC118 (18 µM
nucleotide) in exchange buffer at 70 °C for 20 min. Then,
PstI-digested and 3'-32P-labeled double-stranded
pUC118 (14.5 µM nucleotide) was added to the mixtures,
which were further incubated for 1 h. The reaction mixtures were
manipulated as described (30).
Electron Microscopy--
RadA, RadA-n, or RadA-c protein (5.6 µM) was incubated with 21 µM (nucleotides)
single-stranded pUC118 in a buffer (20 mM Tris-HCl, pH 7.5, 15 mM MgCl2, and 2 mM
dithiothreitol) containing 1 mM ATP Gel Filtration Analysis--
RadA (120 µg), RadA-n (300 µg),
RadA-c (160 µg), or the reconstituted mixture of RadA-n and RadA-c
(100 and 110 µg, respectively; the molar ratio of 2:1) was analyzed
on a SMART system fitted with a Superdex 200 PC 3.2/30 column (Amersham
Pharmacia Biotech) equilibrated with buffer D (50 mM
Tris-HCl, pH 8.0, 0.1 mM EDTA, 0.5 mM
dithiothreitol, 10% glycerol, 0.3 M NaCl). The fractions were analyzed by 15% SDS-PAGE, and the bands were detected by Coomassie Blue staining. The native molecular mass of each protein was
determined by comparison with gel filtration standards (thyroglobulin, 670 kDa; IgG, 158 kDa; ovalbumin, 44 kDa; myoglobin, 17 kDa; vitamin B12, 1.35 kDa from Bio-Rad).
Phylogenetic Analysis--
A multiple sequence alignment was
constructed with the alignment software, CLUSTAL W 1.7 (34). The
obtained alignment was modified by visual inspection to adjust the gap
positions to exclude the gaps in the secondary structure elements as
much as possible. The tertiary structure of RecA (35) was referred to
for the modification. Because of the high sequence divergence, the
inclusion of Rad55 and Xrcc2 reduced the accuracy in the residue
correspondence of the alignment. Therefore, the two sequences were not
included in the alignment. For the molecular phylogenetic analysis, the sites including gaps were excluded from the multiple alignment. To
construct a phylogenetic tree, the genetic distance between every pair
of aligned sequences was calculated as a maximum likelihood estimate
(36) using the Jones, Taylor, Thornton model (37) for the
amino acid substitutions. Based on the distance, a tree was constructed
by the neighbor-joining method (38). The statistical significance of
the neighbor-joining tree topology was evaluated by a bootstrap
analysis (39) with one thousand iterative constructions of the
neighbor-joining tree. For the molecular phylogenetic analyses, two
software packages, PHYLIP 3.5c (44) and MOLPHY 2.3b3 (45) were used.
The trees thus obtained were drawn by TREEVIEW (40).
Structure Comparison of RadA and Other Rad51 Family
Proteins--
Amino acid sequence comparisons showed that RadA has
40% identity (54% similarity) to yeast Rad51. In contrast, it
exhibited only 29% similarity to E. coli RecA. Fig.
1 shows a diagram of the sequence
alignment using representative RecA/Rad51 family proteins. RadA has an
N-terminal domain (domain I) that shares a conserved sequence with the
N-terminal domains of the eukaryotic Rad51 proteins. The amino acid
sequence of RadA domain I is 25% (34%) and 28% (38%) identical
(similar) to yeast Rad51, and human Rad51, respectively. The N-terminal
domain is absent from E. coli RecA. On the other hand,
E. coli RecA has an additional C-terminal domain instead of
the N-terminal domain. RadB consists solely of the central core domain
(domain II) of this protein family. The amino acid sequence identity of
the domain II in RadA and RadB is about 28% (45% similarity).
Preparation of Two Truncated RadA Proteins--
Our biochemical
analysis showed that RadA, but not RadB, has a
DNA-dependent ATPase activity, D-loop formation activity
and the strand exchange activity (30). To understand the
structure-function relationship of the RecA family proteins, RadA was
separated into two parts, the N-terminal one-third (an additional
domain only in Rad51 proteins) and the C-terminal two-thirds (the
central core domain of the recA family proteins). From a sequence
alignment of the archaeal RadA and eukaryotic Rad51 proteins (Fig.
1B), a region from Ser36 to Arg107
at the N terminus of the P. furiosus RadA protein was found
to be strongly conserved. Therefore, we decided to cleave RadA between Arg107 and Ala108. The corresponding regions in
the radA gene for both parts of RadA were amplified by
polymerase chain reaction using the appropriate primers and were cloned
into the expression vector, pET21a, followed by confirmation of the
sequences. In the construct for the C-terminal region, a translational
initiation codon (ATG) was inserted in front of the codon for
Ala108. The two proteins, named RadA-n
(Met1-Arg107) and RadA-c (Met + Ala108-Asp349), were successfully produced in
E. coli and were purified to homogeneity after sequential
chromatographies, as described under "Experimental Procedures"
(Fig. 2). Neither RadA-n nor RadA-c precipitated with 0.5% (final concentration) polyethylenimine, in
contrast to RadA, indicating that the division of the RadA protein into
two parts causes the proteins to have decreased affinity to DNA. The
hydrophobic column chromatography was very effective for the separation
of the RadA protein from the DNA (30). The hydrophobic column was still
effective for RadA-c, but it could be omitted for the purification of
the RadA-n to obtain the pure proteins with an absorbance ratio
(A280/A260) higher than
2.0. From 1 liter of E. coli culture, about 5.5 mg of RadA-n
and 2.9 mg of RadA-c were purified.
ATPase Activity--
The RadA-n and
RadA-c proteins were assayed for ATPase activity. As shown in Fig.
3 and Table
I, RadA-c, but not RadA-n, had ATPase
activity, although it was 10-fold lower than that of the wild-type
RadA. The activity from RadA-c also showed some DNA dependence, and it
increased 2-fold in the presence of ssDNA or dsDNA as compared with the
absence of DNA. Interestingly, the ATPase activity of RadA-c increased
when RadA-n was added to the reaction, suggesting that RadA-n and
RadA-c reconstituted the active structure of RadA in the solution
during the incubation. To obtain the optimal molar ratio of RadA-n and
RadA-c to be mixed, the ATPase activities of the reconstituted samples
by different ratios were measured. When RadA-n was added to RadA-c with
2:1 molar ratio, the ATPase activity increased to 60% of the wild-type level. No more increase was observed even though RadA-n was added with
5:1 ratio. A typical result from experiments repeated several times
using the reconstituted sample by 2:1 ratio is presented in Fig. 3. The
calculated kcat values of each sample is shown in Table I.
DNA Pairing and Strand Exchange Activities--
The pairing and
strand transfer abilities of RadA-n and RadA-c were investigated. As
shown in Fig. 4A, neither
RadA-n nor RadA-c had D-loop formation activity under the conditions
for RadA activity. However, a very weak ability for the three-strand exchange was observed with RadA-c alone, and the joint molecules produced by RadA-c increased with increasing amounts of RadA-c used for
the reaction (Fig. 4B). Moreover, the joint molecule production increased when increasing amounts of RadA-n were added to
the reaction. The decreased efficiency of the joint molecule formation
by RadA-c was restored to 60% of the wild-type level when RadA-n was
added with 2:1 or 5:1 more ratio. The effect of RadA-n on RadA-c strand
exchange reaction is consistent with that on the ATPase activity.
Neither D-loop formation nor the strand exchange activity was observed
with RadA-n. These results indicate that the central core domain of
RadA is essential for the strand exchange activity and that the
N-terminal domain contributes to the enhancement of the reaction
efficiency.
DNA Binding Activity--
To determine whether the N-terminal
domain contributes to the self-assembly of RadA for cooperative DNA
binding, the affinities of the truncated RadA proteins to DNA were
compared by the gel mobility shift assays. RadA-c bound to both ssDNA
and dsDNA, but its affinity was severalfold lower than that of RadA
(Fig. 5). This result is consistent with
the weak stimulation of the RadA-c ATPase activity by DNAs. No DNA
binding was detected in the experiment using RadA-n under the same
conditions (data not shown), which suggests that the N-terminal domain
of RadA has little DNA binding activity by itself. In contrast to the
expectation from the results of the ATPase assay, no difference was
observed in the patterns of the shifted bands by RadA-c and the mixture
of RadA-n and RadA-c under our assay conditions (Fig. 5). The
DNA-protein complexes observed in the gel shift assay probably do not
directly reflect the active nucleoprotein filaments.
Oligomeric State of RadA Proteins--
RadA forms a nucleoprotein
filament with DNA in the presence of ATP We present here that RadA-c, with only the central core domain of
the RecA family proteins, has basic strand exchange activity in
vitro. The DNA binding ability of RadA-c was weaker than that of
RadA, and probably because of its lower affinity for DNA, the ATPase
activity of RadA-c was only slightly stimulated by DNA. From the gel
shift assays, RadA-n does not seem to be able to form stable complexes
with DNA by itself. However, the DNA-dependent ATPase
activity and the strand exchange activity of RadA-c were enhanced by
the addition of RadA-n into the reaction mixtures. The N-terminal
domain of RadA may contribute to change the conformation of RadA-c to a
more preferable form for making the nucleoprotein filament. A direct
contribution of the N-terminal region in human Rad51 to the DNA binding
has been proposed (46). In this case, however, the dissociation
constant (Kd) values to the 12-base pair
double-stranded DNA and the single-stranded DNA are 0.31 and 0.89 mM, respectively, which indicate a very weak binding affinity of the N-terminal fragment of human Rad51 to DNA. A homotypic interaction (self-association) of the eukaryotic Rad51 proteins has
been found (16, 29, 42, 43), and the N-terminal region mediates this
interaction (16). Our results for the archaeal RadA, from the EM
observation and the gel filtration, are consistent with the fact that
the N-terminal region is important for the self-association of Rad51.
For the self-association of the mouse Rad51 and Dmc1 proteins, the
N-terminal truncated proteins can interact with the intact Rad51 and
Dmc1 proteins, respectively (29). It is not known, in those cases, if
the truncated Rad51 or Dmc1 proteins can self-associate. Further
studies are required to understand the mechanism of the
self-association of the Rad51 family proteins and how the assembled
structures contribute to the strand exchange activity.
One interesting contrast is that RadB, with only the central core
domain and 28% sequence identity (45% similarity) to RadA-c, lacks
the DNA-dependent ATPase activity and the strand exchange activity. The oligopeptide with 20 amino acid residues, derived from
loop 1 in the RecA protein, has strand-pairing activity by itself (41).
A comparison of the sequences of this region in RadA and RadB revealed
that 11 and 4 of 20 residues are similar for RadA and RadB,
respectively, to the RecA sequence. The divergence of this region in
RadB may reflect the lack of strand exchange activity. For the purpose
of obtaining some insight into the origin of the RecA family proteins,
the amino acid sequences of the RecA/Rad51 family proteins were
compared in detail. Fig. 7 shows a
phylogenetic tree focused on the relationship of archaeal RadA and
RadB. Given the fact that genes encoding sequences homologous to RadA
and RadB have been found in the genomes of all the sequenced archaea to
date, RadB must have important roles, too. It is difficult to predict
the function of RadB from this phylogenetic relationship of the
RecA/Rad51 family proteins. However, one interesting finding from this
analysis is that RadB evolved two times faster than RadA (compare the
lengths of the branches in the RadA and RadB clusters in Fig. 7). To
confirm the difference in the evolution rate between RadA and RadB, the
nucleotide sequences of the radA and radB genes
from three Pyrococcal strains were compared. Base substitutions that
cause amino acid changes (nonsynonymous changes) were observed with
2-3 times higher frequency in radB than in radA,
although the same level of synonymous changes occurred between the two
genes (data not shown). For both genes, any number of nonsynonymous
changes per site was one order less than the corresponding number of
synonymous changes per site. This result suggests that RadB does not
have a specific pressure stimulating amino acid substitution but is
more accepting of sequence changes than RadA during evolution. If this
is true, then RadA may be involved in more essential processes than
RadB for the maintenance of the organism. RadB has much higher DNA
binding activity than RadA-c. When RadA-n was mixed with RadB with the
same condition as the reconstitution of RadA-n and RadA-c, neither DNA
binding nor ATPase activity was different from those by RadB alone
(data not shown). It would be interesting to compare in more
detail the structural and functional differences between RadA-c
and RadB.
The Rad51 protein is known to interact with other proteins in the RAD52
epistasis group, and it has been suggested that the N-terminal region
may be important for specific interactions with other proteins, because
it is conserved in Rad51 but not in RecA. The N-terminal region of RadA
may have roles in interactions with other proteins. RadA interacts with
RadB, as determined in our immunoprecipitation assay. In this case, the
interaction seems to be disrupted when RadA is separated into RadA-n
and RadA-c (30). To understand these specific protein-protein
interactions, more detailed structure-function studies will be
necessary. P. furiosus RadA is a very heat stable protein
and is easy to handle and to store. Structural analyses of this
archaeal RadA will contribute immensely to an understanding of the
precise molecular mechanisms of the DNA strand pairing and exchange reactions.
We thank Drs. J. DiRuggiero, S. Kowalczykowski,H. Iwasaki, K. Morikawa,and F. Robb for
discussions. We are grateful to Dr. Y. Shimura, the director of
Biomolecular Engineering Research Institute, for continuous encouragement.
*
The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
**
To whom correspondence should be addressed: Dept. of Molecular
Biology, Biomolecular Engineering Research Inst., 6-2-3 Furuedai, Suita, Osaka 565-0874, Japan. Tel.: 81-6-6872-8208; Fax:
81-6-6872-8219; E-mail: ishino@beri.co.jp.
Published, JBC Papers in Press, July 7, 2000, DOI 10.1074/jbc.M004556200
The abbreviations used are:
ssDNA, single-stranded DNA;
ATP
Domain Analysis of an Archaeal RadA Protein for the Strand
Exchange Activity*
,
, and**
Molecular Biology,
§ Structural Biology, and ¶ Bioinformatics,
Biomolecular Engineering Research Institute, Suita, Osaka 565-0874, Japan and the Department of Molecular Microbiology, Research
Institute for Microbial Diseases, Osaka University, Suita,
Osaka 565-0871, Japan
ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
M) of 2560 M
1·cm1 and 10810 M1·cm1, respectively, which
were obtained by the method of Gill and von Hippel (31). Nuclease
assays were done to check the contamination of any deoxyribonuclease in
the purified proteins using 32P-labeled DNA (both
single-stranded and double-stranded) as described (30). To reconstitute
RadA-n and RadA-c, both proteins were mixed with the various molar
ratio and were incubated at 60 °C for 3 min before use for various
assays described below.
-32P]ATP (0.1 µCi/µl), and 100 µM of ATP were incubated with or
without DNA (single-stranded or double-stranded M13 DNA, 0.2 µg) in
20 µl of ATPase buffer at 70 °C for the indicated times.
S at 90 °C for 15 min. The manipulation of the samples for the electron microscopic
observation was exactly as described in the accompanying paper
(30).
RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
View larger version (35K):
[in a new window]
Fig. 1.
Domain structure and sequence comparison of
RadA with RadB and eukaryotic Rad51s. A, the diagrams
show the domain arrangements of the Rad51 family proteins. The
red and green boxes indicate the Walker A and B
motifs, respectively. RadA and RadB are from P. furiosus.
SceRad51 and hRad51 are from S. cerevisiae and human,
respectively. B, comparison of the domain I sequence of
P. furiosus RadA with other archaeal RadA proteins, yeast,
and human Rad51 proteins. Identical and similar residues are indicated
by red and blue letters, respectively.
Pfu, P. furiosus; Afu,
Archaeoglobus fulgidus; Hvo, Haloferax
volcanii; Mth, Methanobacterium
thermoautotrophicum; Sso, Sulfolobus
solfataricus; Mja, Methanococcus
jannaschii.
View larger version (40K):
[in a new window]
Fig. 2.
Purification of RadA-n and RadA-c
proteins. RadA-n and RadB-c proteins were produced in E. coli cells and were purified by heat treatment, polymin
precipitation, and three or four column chromatographies.1 µg of
protein was analyzed by 15% SDS-PAGE followed by Coomassie Brilliant
Blue staining. The protein bands and sizes are follows: RadA, 38.4 kDa;
RadA-n, 11.7 kDa; RadA-c, 26.8 kDa. Lane M, molecular mass
markers; lane wt, wild type; lane c,
RadA-c; lane n, RadA-n.
View larger version (13K):
[in a new window]
Fig. 3.
ATPase activity of RadA and its mutant
proteins. The RadA or RadA-c protein (each at 2 µM), [ -32P]ATP (0.1 µCi/µl) and
100 µM of ATP were incubated with or without DNA at
70 °C for the indicated time, and an aliquot of the reaction was
analyzed by thin layer chromatography. Twice the amount of RadA-n
protein was used as that of intact RadA and RadA-c. 
, RadA; 
,
RadA-c; 
, RadA-n; 
, RadA-c plus RadA-n. The background
(radioactivities from the reaction without protein) was subtracted from
each time point.
ATPase activity of wild-type and mutant RadA proteins
View larger version (40K):
[in a new window]
Fig. 4.
D-loop formation and three-strand exchange
activities of truncated RadAs. A, RadA, RadA-c, or
RadA-n (each at indicated concentrations) was incubated with 1 µM of 32P-labeled 83-mer oligonucleotide,
W16( 
), at 65 °C for 10 min. Then M13 double-stranded DNA (0.1 µg) was added to the mixtures, which were further incubated for
either 2 min. The reaction mixtures were deproteinized and separated by
1% agarose gel electrophoresis. RadA, RadA-n, RadA-c, and RadA-n + RadA-c are indicated by wt, n, c, and
c+n, respectively. B, three-strand exchange
activity of RadA-c was examined at various concentrations (left
panel) or after reconstitution with RadA-n (right
panel). Lane 1, no protein; lane 2, 7.5 µM RadA; lane 3, 7.5 µM RadA-c;
lane 4, 15 µM RadA-c; lane 5, 22.5 µM RadA-c; lane 6, 7.5 µM RadA-c + 7.5 µM RadA-n; lane 7, 7.5 µM
RadA-c + 15 µM RadA-n; lane 8, 7.5 µM RadA-c + 37.5 µM RadA-n; lane
9, 37.5 µM RadA-n.
View larger version (34K):
[in a new window]
Fig. 5.
DNA binding activities of truncated
RadAs. A, the RadA-n protein was mixed with twice the
amount of RadA-c for efficient reconstitution (c+n) and was
compared with RadA (wt) and RadA-c (c) for DNA
binding abilities. Various concentrations of proteins were incubated
with a 32P-labeled single-stranded 83-mer, W16( ),
indicated by ss, or a double-stranded 83 mer,
W16()/W16(+), indicated by ds, at 60 °C for 10 min. The
reaction products were analyzed by 1% agarose gel electrophoresis, and
the bands were detected by autoradiography. B, the results
shown in A are graphically represented. , RadA + ssDNA;
, RadA +dsDNA; , RadA-c +ssDNA; , RadA-c + dsDNA; 
, RadA-c
and RadA-n + ssDNA; 
, RadA-c and RadA-n + dsDNA.
S. In the absence of DNA,
most of the electron microscopic images of RadA are ring-like
structures (30). Under the same conditions, neither the nucleoprotein
filament in the presence of DNA nor the ring-like structure in the
absence of DNA was observed when RadA was substituted by RadA-c or the
mixture of RadA-n and RadA-c (data not shown). Then purified RadA-n and
RadA-c, as well as wild-type RadA, were subjected to gel filtration
chromatography (Fig. 6). The peaks of the
eluted fractions of RadA-n and RadA-c corresponded to 25 and 22 kDa,
respectively. Some of RadA-c eluted close to the position corresponding
to 52 kDa. These results indicate that RadA-n and RadA-c mainly exist
as a dimer and a monomer, respectively, and some of the RadA-c form a
dimer. When the two proteins were mixed to 2:1 ratio, the main peak
appeared at around the size of 45 kDa, indicating that the two proteins
form a 1:1 complex. The band intensities of RadA-n and RadA-c on a
SDS-PAGE of the fractions supported the one-to-one complex formation of the two proteins. The small amount of proteins eluted at 100 kDa may be
the 2:2 complex. The excess RadA-n eluted at the same position as that
of RadA-n alone. On the other hand, the wild-type RadA eluted much
earlier, at the position corresponding to 520 kDa, indicating the
stable self-association of the RadA proteins.
View larger version (30K):
[in a new window]
Fig. 6.
Gel filtration analysis of RadA and its
truncated proteins. The gel filtration chromatography was
performed as described under "Experimental Procedures." Aliquots of
the gel filtration fractions were subjected to 15% SDS-PAGE analysis
followed by Coomassie Brilliant Blue staining. Numbers in
each lane indicate the fraction numbers. The peak positions of
Thyroglobulin (670 kDa), immunoglobulin G (158 kDa), ovalbumin (44 kDa), and myoglobin (17 kDa) eluted from the column are marked at the
top.
DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
View larger version (24K):
[in a new window]
Fig. 7.
Phylogenetic analysis of RecA/Rad51 family
proteins. All of the archaeal RadA and RadB sequences were
compared with those of the eukaryotic proteins in this family. The
bootstrap probabilities in percentages are shown only for nodes
occurring in more than 70%. The length of the bar indicates
10% estimated amino acid changes.
ACKNOWLEDGEMENTS
FOOTNOTES
ABBREVIATIONS
S, adenosine
5'-O-(thiotriphosphate);
PAGE, polyacrylamide gel
electrophoresis;
dsDNA, double-stranded DNA.
REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
1.
Kowalczykowski, S. C.,
Dixon, D. A.,
Eggleston, A. K.,
Lauder, S. D.,
and Rehrauer, W. M.
(1994)
Microbiol. Rev.
58,
401-465
2.
Shinohara, A.,
and Ogawa, T.
(1995)
Trends Biochem. Sci.
20,
387-391
3.
Roca, A. I.,
and Cox, M. M.
(1997)
Prog. Nucleic Acids Res. Mol. Biol.
56,
129-223
4.
Bianco, P. R.,
Tracy, R. B.,
and Kowalczykowski, S. C.
(1998)
Front. Biosci.
3,
570-603
5.
DiRuggiero, J.,
Santangelo, N.,
Nackerdien, Z.,
Ravel, J.,
and Robb, F. T.
(1997)
J. Bacteriol.
179,
4643-4645
6.
Uemori, T.,
Sato, Y.,
Kato, I.,
Doi, H.,
and Ishino, Y.
(1997)
Genes Cells
2,
499-512
7.
Sandler, S. J.,
Hugenholtz, P.,
Schleper, C.,
DeLong, E. F.,
Pace, N. R.,
and Clark, A. J.
(1999)
J. Bacteriol.
181,
907-915
8.
DiRuggiero, J. N.,
Brown, J. R.,
Bogert, A. P.,
and Robb, F. T.
(1999)
J. Mol. Evol.
49,
474-484
9.
Woods, W. G.,
and Dyall-Smith, M. L.
(1997)
Mol. Microbiol.
23,
791-797
10.
Seitz, E. M.,
Brockman, J. P.,
Sandler, S. J.,
Clark, A. J.,
and Kowalczykowski, S. C.
(1998)
Genes Dev.
12,
1248-1253
11.
Kil, Y. V.,
Baitin, D. M.,
Masui, R.,
Bonch-Osmolovskaya, E. A.,
Kuramitsu, S.,
and Lanzov, V. A.
(2000)
J. Bacteriol.
182,
130-134
12.
Spies, M., Kil, Y., Masui, R., Kato, R., Kujo, C., Ohshima, T.,
Kuramitsu, S., Lanzov, V. Eur. J. Biochem.
267, 1125-1137
13.
Kurumizaka, H.,
Aihara, H.,
Ikawa, S.,
Kashima, T.,
Bazemore, L. R.,
Kawasaki, K.,
Sarai, A.,
Radding, C. M.,
and Shibata, T.
(1996)
J. Biol. Chem.
271,
33515-33524
14.
Aihara, H.,
Ito, Y.,
Kurumizaka, H.,
Terada, T.,
Yokoyama, S.,
and Shibata, T.
(1997)
J. Mol. Biol.
290,
495-504
15.
Shinohara, A.,
Ogawa, H.,
and Ogawa, T.
(1992)
Cell
69,
457-470
16.
Donovan, J. W.,
Milne, G. T.,
and Weaver, D. T.
(1994)
Genes Dev.
8,
2552-2562
17.
Shen, Z.,
Cloud, K. G.,
Chen, D. J.,
and Park, M. S.
(1996)
J. Biol. Chem.
271,
148-152
18.
Clever, B.,
Interthal, H.,
Schmuckli-Maurer, J.,
King, J.,
Sigrist, M.,
and Heyer, W. D.
(1996)
EMBO J.
16,
2535-2544
19.
Petukhova, G.,
van Komen, S.,
Vergano, S.,
Klein, H.,
and Sung, P.
(1999)
J. Biol. Chem.
274,
29453-29462
20.
Johnson, R. D.,
and Symington, L. S.
(1995)
J. Bacteriol.
15,
4843-4850
21.
Buchhop, S.,
Gibson, M. K.,
Wang, X. W.,
Wagner, P.,
Sturzbecher, H. W.,
and Harris, C. C.
(1997)
Nucleic Acids Res.
25,
3868-3874
22.
Sturzbecher, H. W.,
Donzelmann, B.,
Henning, W.,
Knippschild, U.,
and Buchhop, S.
(1996)
EMBO J.
15,
1992-2002
23.
Scully, R.,
Chen, J.,
Plug, A.,
Xiao, Y.,
Weaver, D.,
Feunteun, J.,
Ashley, T.,
and Livingston, D. M.
(1997)
Cell
88,
265-275
24.
Chen, P. L.,
Chen, C. F.,
Chen, Y.,
Xiao, J.,
Sharp, Z. D.,
and Lee, W. H.
(1998)
Proc. Natl. Acad. Sci. U. S. A.
95,
5287-5292
25.
Katagiri, T.,
Saito, H.,
Shinohara, A.,
Ogawa, H.,
Kamada, N.,
Nakamura, Y.,
and Miki, Y.
(1998)
Genes Chromosomes Cancer
21,
217-222
26.
Mizuta, R.,
LaSalle, J. M.,
Cheng, H. L.,
Shinohara, A.,
Ogawa, H.,
Copeland, N.,
Jenkins, N. A.,
Lalande, M.,
and Alt, F. W.
(1997)
Proc. Natl. Acad. Sci. U. S. A.
94,
6927-6932
27.
Sharan, S. K.,
Morimatsu, M.,
Albrecht, U.,
Lim, D. S.,
Regel, E.,
Dinh, C.,
Sands, A.,
Eichele, G.,
Hasty, P.,
and Bradley, A.
(1997)
Nature
386,
804-810
28.
Wong, A. K. C.,
Pero, R.,
Ormonde, P. A.,
Tavtigian, S. V.,
and Bartel, P. L.
(1997)
J. Biol. Chem.
272,
31941-31944
29.
Tarsounas, M.,
Morita, T.,
Pearlman, R. E.,
and Moens, P. B.
(1999)
J. Cell Biol.
147,
207-219
30.
Komori, K.,
Miyata, T.,
DiRuggiero, J.,
Holley-Shanks, R.,
Hayashi, I.,
Cann, I. K. O.,
Mayanagi, K.,
Shinagawa, H.,
and Ishino, Y.
(2000)
J. Biol. Chem.
275,
33782-33790
31.
Gill, S. C.,
and von Hippel, P. H.
(1989)
Anal. Biochem.
182,
319-326
32.
Gupta, R. C.,
Bazemore, L. R.,
Golub, E. I.,
and Radding, C. M.
(1997)
Proc. Natl. Acad. Sci. U. S. A.
94,
463-468
33.
Morimatsu, K.,
Horii, T.,
and Takahashi, T.
(1995)
Eur. J. Biochem.
228,
779-785
34.
Thompson, J. D.,
Higgins, D. G.,
and Gibson, T. J.
(1994)
Nucleic Acids Res.
22,
4673-4680
35.
Story, R. M.,
Weber, I. T.,
and Steiz, T. A.
(1992)
Nature
355,
318-325
36.
Felsenstein, J.
(1996)
Methods Enzymol.
266,
418-427
37.
Jones, D. T.,
Taylor, W. R.,
and Thornton, J. M.
(1992)
Comput. Appl. Biosci.
8,
275-282
38.
Saitou, N.,
and Nei, M.
(1987)
Mol. Biol. Evol.
4,
406-425
39.
Felsenstein, J.
(1985)
Evolution
39,
783-791
40.
Page, R. D.
(1996)
Comp. Appl. Biosci.
12,
357-358
41.
Voloshin, O. N.,
Wang, L.,
and Camerini-Otero, R. D.
(1996)
Science
272,
868-871
42.
Kovalenko, O. V.,
Plug, A. W.,
Haaf, T.,
Gonda, D. K.,
Ashley, T.,
Ward, D. C.,
and Radding, C. M.
(1996)
Proc. Natl. Acad. Sci. U. S. A.
93,
2958-2963
43.
Kovalenko, O. V.,
Golub, E. I.,
Bray-Ward, P.,
Ward, D. C.,
and Radding, C. M.
(1997)
Nucleic Acids Res.
25,
4946-4925
44.
Felsenstein, J.
(1993)
PHYLIP, version 3.5c
, Department of Genetics, University of Washington, Seattle, WA
45.
Adachi, J.,
and Hasegawa, M.
(1996)
MOLPHY, version 2.3b3
, Institute of Statistical Mathematics, Tokyo
46.
Aihara, H.,
Ito, Y.,
Kurumizaka, H.,
Yokoyama, S.,
and Shibata, T.
(1999)
J. Mol. Biol.
290,
495-504
Copyright © 2000 by The American Society for Biochemistry and Molecular Biology, Inc.
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati What's this?
This article has been cited by other articles:
|
|
 |
|
  R. Fujikane, H. Shinagawa, and Y. Ishino The archaeal Hjm helicase has recQ-like functions, and may be involved in repair of stalled replication fork Genes Cells, February 1, 2006; 11(2): 99 - 110. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Akiba, N. Ishii, N. Rashid, M. Morikawa, T. Imanaka, and K. Harata Structure of RadB recombinase from a hyperthermophilic archaeon, Thermococcus kodakaraensis KOD1: an implication for the formation of a near-7-fold helical assembly Nucleic Acids Res., June 13, 2005; 33(10): 3412 - 3423. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. V. Kil, E. A. Glazunov, and V. A. Lanzov Characteristic Thermodependence of the RadA Recombinase from the Hyperthermophilic Archaeon Desulfurococcus amylolyticus J. Bacteriol., April 1, 2005; 187(7): 2555 - 2557. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. Fujikane, K. Komori, H. Shinagawa, and Y. Ishino Identification of a Novel Helicase Activity Unwinding Branched DNAs from the Hyperthermophilic Archaeon, Pyrococcus furiosus J. Biol. Chem., April 1, 2005; 280(13): 12351 - 12358. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Ariza, D. J. Richard, M. F. White, and C. S. Bond Conformational flexibility revealed by the crystal structure of a crenarchaeal RadA Nucleic Acids Res., March 8, 2005; 33(5): 1465 - 1473. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Komori, M. Hidaka, T. Horiuchi, R. Fujikane, H. Shinagawa, and Y. Ishino Cooperation of the N-terminal Helicase and C-terminal Endonuclease Activities of Archaeal Hef Protein in Processing Stalled Replication Forks J. Biol. Chem., December 17, 2004; 279(51): 53175 - 53185. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| All ASBMB Journals | Molecular and Cellular Proteomics |
| Journal of Lipid Research | ASBMB Today |
