Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Originally published In Press as doi:10.1074/jbc.M004556200 on July 7, 2000

J. Biol. Chem., Vol. 275, Issue 43, 33791-33797, October 27, 2000
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
275/43/33791    most recent
M004556200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Komori, K.
Right arrow Articles by Ishino, a. Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Komori, K.
Right arrow Articles by Ishino, a. Y.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Domain Analysis of an Archaeal RadA Protein for the Strand Exchange Activity*

Kayoko KomoriDagger , Tomoko Miyata§, Hiromi Daiyasu, Hiroyuki Toh, Hideo Shinagawa||, and and, Yoshizumi IshinoDagger **

From the Departments of Dagger  Molecular Biology, § Structural Biology, and  Bioinformatics, Biomolecular Engineering Research Institute, Suita, Osaka 565-0874, Japan and the || Department of Molecular Microbiology, Research Institute for Microbial Diseases, Osaka University, Suita, Osaka 565-0871, Japan

Received for publication, May 26, 2000, and in revised form, June 30, 2000

    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Archaeal RadA, like eukaryotic Rad51 and bacterial RecA, promotes strand exchange between DNA strands with homologous sequences in vitro and is believed to participate in the homologous recombination in cells. The amino acid sequences of the archaeal RadA proteins are more similar to the eukaryotic Rad51s rather than the bacterial RecAs, and the N-terminal region containing domain I is conserved among the RadA and Rad51 proteins but is absent from RecA. To understand the structure-function relationship of RadA, we divided the RadA protein from Pyrococcus furiosus into two parts, the N-terminal one-third (RadA-n) and the residual C-terminal two-thirds (RadA-c), the latter of which contains the central core domain (domain II) of the RecA/Rad51 family proteins. RadA-c had the DNA-dependent ATPase activity and the strand exchange activity by itself, although much weaker (10%) than that of the intact RadA. These activities of RadA-c were restored to 60% of those of RadA by addition of RadA-n, indicating that the proper active structure of RadA was reconstituted in vitro. These results suggest that the basic activities of the RecA/Rad51 family proteins for homologous recombination are derived from domain II, and the N-terminal region may help to enhance the catalytic efficiencies.

    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Genetic recombination is important in generating genetic diversity and in repairing DNA damage. The RecA protein of eubacteria and the Rad51 protein of eukaryotes play a central role in homologous DNA recombination by searching for sequence homology and exchanging the DNA strands (reviewed in Refs. 1-4). Two genes, radA and radB, both of which encode RecA/Rad51 family proteins, have been found in the genomes of archaeal organisms (5, 6). All of the euryarchaeotic total genome sequences that have been determined to date contain both RadA and RadB (7, 8). Biochemical analyses have shown that the archaeal RadA proteins have functionally similar properties to the RecA family proteins from other domains of life, and they probably play a critical role in recombination and repair (9-12).

The N-terminal regions of eukaryotic Rad51-like proteins are highly conserved, but the corresponding region is absent in bacterial RecA proteins. Instead, RecA has an extra C-terminal region. The C-terminal region of RecA possibly works by catching the double-stranded DNA with the sequence homologous to the ssDNA,1 which is complexed with RecA protein (13, 14). Eukaryotic Rad51 is known to interact with other proteins, including Rad52 (15-17), Rad54 (18, 19), Rad55/57 (20), p53 (21, 22), Brca1 (23), and Brca2 (24-28). The eukaryotic Rad51 has a unique N-terminal region, which is therefore thought to have important roles for the interactions with these proteins. On the other hand, a recent mutational analysis indicated that the N-terminal domain of the human Rad51 protein constitutes a DNA binding domain (14). From this result, it has been proposed that the N-terminal domain of Rad51 could have the same function as the C-terminal domain of RecA, although they have no structural homology to each other (14).

We cloned the two genes, radA and radB from the hyperthermophilic archaeon, Pyrococcus furiosus, expressed them in Escherichia coli, and characterized the gene products, RadA and RadB (30). The amino acid sequences of RadA and RadB are very similar to that of eukaryotic Rad51 (54 and 29% similarity, respectively, to S. cerevisiae Rad51). RadA has a DNA-dependent ATPase activity, D-loop formation activity, and strand exchange activity, which are similar to the abilities of the other RecA family proteins. On the other hand, RadB has a very weak ATPase activity that is not stimulated by DNA. Little RadB strand exchange activity could be detected with either a plasmid substrate or an oligonucleotide substrate, even though the protein had very strong DNA binding ability. An immunological analysis showed that the amount of RadB protein in the P. furiosus cell was 200 times less than that of RadA. RadA contains an N-terminal region like that of the eukaryotic Rad51. On the other hand, RadB has only the central core region of the RecA family proteins and has neither the N-terminal nor C-terminal extra domain.

To explore the structure-function relationship for the DNA pairing and strand exchange activities of the RecA/Rad51 family proteins, we made deletion mutant proteins, RadA-n and RadA-c, which contain only the N-terminal and C-terminal (central core) regions of RadA, respectively. The RadA-c had the strand exchange activity by itself, although it was much weaker than that of intact RadA. The decreased activity of RadA-c was restored by the addition of RadA-n, indicating that the appropriate conformation of RadA was reconstituted.

    EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Preparation of RadA, RadA-n, and RadA-c Proteins-- The construction of the expression plasmid of the radA gene in E. coli and the purification procedure of the RadA protein are described in the accompanying paper (30). The N-terminal- and C-terminal truncated RadAs (RadA-n, Met1-Arg107; RadA-c, Ala108-Asp349) were prepared by expression of each truncated gene in E. coli. The genes, radA-n and radA-c were amplified by polymerase chain reaction using two sets of primers (RADAF, ACATATGGCTGGTGAGGAAGTTAAGGAGAT, and RADANR, CACGAGCTCGAGTTATTATCTCTTCTTGAGATATTC, or RADACF, CACGAGCATATGGCTACAATAGGGAGAATTTC, and RADAR, TCTCGAGTCTAATCCTCTATCCCTTTTTCA) and were inserted into the NdeI-XhoI sites of the pET21a expression plasmid. The resultant plasmids were designated pPFRADAN and pPFRADAC, respectively. E. coli JM109 (DE3) carrying pPFRADAN or pPFRADAC was cultivated, and the expression of the radA-n or radA-c gene was induced under the same conditions as for pPFRADA/JM109 (DE3). The heat-resistant fractions were prepared from cells carrying either pFURADAC or pFURADAN, in sonication buffer with or without 0.4 M NaCl by sonication and heat treatment. After treatment with 0.5% polyethylenimine, the supernatant from each cell was precipitated with ammonium sulfate (80% saturation). The RadA-n precipitate was resuspended in and dialyzed against buffer A and was applied to a HiTrap Q column. The fractions eluted at 0.12-0.36 M NaCl were mixed with four volumes of buffer A and were applied to a heparin column. The protein fraction (0.12-0.35 M NaCl) was combined with four volumes of buffer C (buffer A, except at pH 8.8) and was applied to a Mono S HR 5/5 column. The pass fraction was applied to a HiTrap Q column, and the RadA-n was eluted at 0.24-0.36 NaCl. The RadA-c precipitate was resuspended in buffer A containing M ammonium sulfate and was applied to a phenyl-Sepharose column. The RadA-c protein was eluted at 0.7-0.3 M ammonium sulfate, and the fractions were dialyzed against buffer A. The dialysate was applied to a heparin column, and the protein was eluted at 0.2-0.3 M NaCl. The fractions were diluted with four volumes of buffer C and then applied onto a HiTrap Q column. The RadA-c protein was eluted at 0.12-0.23 NaCl and was stored on ice. The concentrations of RadA-n and RadA-c were determined by using molar extinction coefficients (epsilon M) of 2560 M-1·cm-1 and 10810 M-1·cm-1, respectively, which were obtained by the method of Gill and von Hippel (31). Nuclease assays were done to check the contamination of any deoxyribonuclease in the purified proteins using 32P-labeled DNA (both single-stranded and double-stranded) as described (30). To reconstitute RadA-n and RadA-c, both proteins were mixed with the various molar ratio and were incubated at 60 °C for 3 min before use for various assays described below.

ATPase Activity-- The ATPase activities of RadA, RadA-n, RadA-c, and the reconstituted mixture of RadA-n and RadA-c (the ratio of 1:1, 2:1, or 5:1) were measured exactly as described in the accompanying paper (30). The RadA, RadA-n, RadA-c, or mixture protein (each at 2 µM), [gamma -32P]ATP (0.1 µCi/µl), and 100 µM of ATP were incubated with or without DNA (single-stranded or double-stranded M13 DNA, 0.2 µg) in 20 µl of ATPase buffer at 70 °C for the indicated times.

Gel Retardation Assay-- Various concentrations of RadA, RadA-n, RadA-c, and the reconstituted mixture of RadA-n and RadA-c (the ratio of 2:1) were used for the gel retardation assay using conditions as described in the accompanying paper (30).

D-loop Formation Assay-- RadA, RadA-n, RadA-c, or the reconstituted mixture of RadA-n and RadA-c were mixed with 1 µM (as nucleotide) of 32P-labeled 83-mer oligonucleotide, W16(32), at the indicated concentration and incubated in 19 µl of exchange buffer at 65 °C for 10 min. Then M13 double-stranded DNA (0.1 µg) was added to the mixtures, which were further incubated for 2 min. The reaction using E. coli RecA, prepared as described earlier (33), was performed under the same conditions except at 37 °C. The reaction mixtures were manipulated as described (30).

Strand Exchange Reactions-- RadA, RadA-n, RadA-c, or the reconstituted mixture of RadA-n and RadA-c (the ratio of 1:1, 2:1, or 5:1) was incubated with single-stranded pUC118 (18 µM nucleotide) in exchange buffer at 70 °C for 20 min. Then, PstI-digested and 3'-32P-labeled double-stranded pUC118 (14.5 µM nucleotide) was added to the mixtures, which were further incubated for 1 h. The reaction mixtures were manipulated as described (30).

Electron Microscopy-- RadA, RadA-n, or RadA-c protein (5.6 µM) was incubated with 21 µM (nucleotides) single-stranded pUC118 in a buffer (20 mM Tris-HCl, pH 7.5, 15 mM MgCl2, and 2 mM dithiothreitol) containing 1 mM ATPgamma S at 90 °C for 15 min. The manipulation of the samples for the electron microscopic observation was exactly as described in the accompanying paper (30).

Gel Filtration Analysis-- RadA (120 µg), RadA-n (300 µg), RadA-c (160 µg), or the reconstituted mixture of RadA-n and RadA-c (100 and 110 µg, respectively; the molar ratio of 2:1) was analyzed on a SMART system fitted with a Superdex 200 PC 3.2/30 column (Amersham Pharmacia Biotech) equilibrated with buffer D (50 mM Tris-HCl, pH 8.0, 0.1 mM EDTA, 0.5 mM dithiothreitol, 10% glycerol, 0.3 M NaCl). The fractions were analyzed by 15% SDS-PAGE, and the bands were detected by Coomassie Blue staining. The native molecular mass of each protein was determined by comparison with gel filtration standards (thyroglobulin, 670 kDa; IgG, 158 kDa; ovalbumin, 44 kDa; myoglobin, 17 kDa; vitamin B12, 1.35 kDa from Bio-Rad).

Phylogenetic Analysis-- A multiple sequence alignment was constructed with the alignment software, CLUSTAL W 1.7 (34). The obtained alignment was modified by visual inspection to adjust the gap positions to exclude the gaps in the secondary structure elements as much as possible. The tertiary structure of RecA (35) was referred to for the modification. Because of the high sequence divergence, the inclusion of Rad55 and Xrcc2 reduced the accuracy in the residue correspondence of the alignment. Therefore, the two sequences were not included in the alignment. For the molecular phylogenetic analysis, the sites including gaps were excluded from the multiple alignment. To construct a phylogenetic tree, the genetic distance between every pair of aligned sequences was calculated as a maximum likelihood estimate (36) using the Jones, Taylor, Thornton model (37) for the amino acid substitutions. Based on the distance, a tree was constructed by the neighbor-joining method (38). The statistical significance of the neighbor-joining tree topology was evaluated by a bootstrap analysis (39) with one thousand iterative constructions of the neighbor-joining tree. For the molecular phylogenetic analyses, two software packages, PHYLIP 3.5c (44) and MOLPHY 2.3b3 (45) were used. The trees thus obtained were drawn by TREEVIEW (40).

    RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Structure Comparison of RadA and Other Rad51 Family Proteins-- Amino acid sequence comparisons showed that RadA has 40% identity (54% similarity) to yeast Rad51. In contrast, it exhibited only 29% similarity to E. coli RecA. Fig. 1 shows a diagram of the sequence alignment using representative RecA/Rad51 family proteins. RadA has an N-terminal domain (domain I) that shares a conserved sequence with the N-terminal domains of the eukaryotic Rad51 proteins. The amino acid sequence of RadA domain I is 25% (34%) and 28% (38%) identical (similar) to yeast Rad51, and human Rad51, respectively. The N-terminal domain is absent from E. coli RecA. On the other hand, E. coli RecA has an additional C-terminal domain instead of the N-terminal domain. RadB consists solely of the central core domain (domain II) of this protein family. The amino acid sequence identity of the domain II in RadA and RadB is about 28% (45% similarity).


View larger version (35K):
[in this window]
[in a new window]
 
Fig. 1.   Domain structure and sequence comparison of RadA with RadB and eukaryotic Rad51s. A, the diagrams show the domain arrangements of the Rad51 family proteins. The red and green boxes indicate the Walker A and B motifs, respectively. RadA and RadB are from P. furiosus. SceRad51 and hRad51 are from S. cerevisiae and human, respectively. B, comparison of the domain I sequence of P. furiosus RadA with other archaeal RadA proteins, yeast, and human Rad51 proteins. Identical and similar residues are indicated by red and blue letters, respectively. Pfu, P. furiosus; Afu, Archaeoglobus fulgidus; Hvo, Haloferax volcanii; Mth, Methanobacterium thermoautotrophicum; Sso, Sulfolobus solfataricus; Mja, Methanococcus jannaschii.

Preparation of Two Truncated RadA Proteins-- Our biochemical analysis showed that RadA, but not RadB, has a DNA-dependent ATPase activity, D-loop formation activity and the strand exchange activity (30). To understand the structure-function relationship of the RecA family proteins, RadA was separated into two parts, the N-terminal one-third (an additional domain only in Rad51 proteins) and the C-terminal two-thirds (the central core domain of the recA family proteins). From a sequence alignment of the archaeal RadA and eukaryotic Rad51 proteins (Fig. 1B), a region from Ser36 to Arg107 at the N terminus of the P. furiosus RadA protein was found to be strongly conserved. Therefore, we decided to cleave RadA between Arg107 and Ala108. The corresponding regions in the radA gene for both parts of RadA were amplified by polymerase chain reaction using the appropriate primers and were cloned into the expression vector, pET21a, followed by confirmation of the sequences. In the construct for the C-terminal region, a translational initiation codon (ATG) was inserted in front of the codon for Ala108. The two proteins, named RadA-n (Met1-Arg107) and RadA-c (Met + Ala108-Asp349), were successfully produced in E. coli and were purified to homogeneity after sequential chromatographies, as described under "Experimental Procedures" (Fig. 2). Neither RadA-n nor RadA-c precipitated with 0.5% (final concentration) polyethylenimine, in contrast to RadA, indicating that the division of the RadA protein into two parts causes the proteins to have decreased affinity to DNA. The hydrophobic column chromatography was very effective for the separation of the RadA protein from the DNA (30). The hydrophobic column was still effective for RadA-c, but it could be omitted for the purification of the RadA-n to obtain the pure proteins with an absorbance ratio (A280/A260) higher than 2.0. From 1 liter of E. coli culture, about 5.5 mg of RadA-n and 2.9 mg of RadA-c were purified.


View larger version (40K):
[in this window]
[in a new window]
 
Fig. 2.   Purification of RadA-n and RadA-c proteins. RadA-n and RadB-c proteins were produced in E. coli cells and were purified by heat treatment, polymin precipitation, and three or four column chromatographies.1 µg of protein was analyzed by 15% SDS-PAGE followed by Coomassie Brilliant Blue staining. The protein bands and sizes are follows: RadA, 38.4 kDa; RadA-n, 11.7 kDa; RadA-c, 26.8 kDa. Lane M, molecular mass markers; lane wt, wild type; lane c, RadA-c; lane n, RadA-n.

ATPase Activity-- The RadA-n and RadA-c proteins were assayed for ATPase activity. As shown in Fig. 3 and Table I, RadA-c, but not RadA-n, had ATPase activity, although it was 10-fold lower than that of the wild-type RadA. The activity from RadA-c also showed some DNA dependence, and it increased 2-fold in the presence of ssDNA or dsDNA as compared with the absence of DNA. Interestingly, the ATPase activity of RadA-c increased when RadA-n was added to the reaction, suggesting that RadA-n and RadA-c reconstituted the active structure of RadA in the solution during the incubation. To obtain the optimal molar ratio of RadA-n and RadA-c to be mixed, the ATPase activities of the reconstituted samples by different ratios were measured. When RadA-n was added to RadA-c with 2:1 molar ratio, the ATPase activity increased to 60% of the wild-type level. No more increase was observed even though RadA-n was added with 5:1 ratio. A typical result from experiments repeated several times using the reconstituted sample by 2:1 ratio is presented in Fig. 3. The calculated kcat values of each sample is shown in Table I.


View larger version (13K):
[in this window]
[in a new window]
 
Fig. 3.   ATPase activity of RadA and its mutant proteins. The RadA or RadA-c protein (each at 2 µM), [gamma -32P]ATP (0.1 µCi/µl) and 100 µM of ATP were incubated with or without DNA at 70 °C for the indicated time, and an aliquot of the reaction was analyzed by thin layer chromatography. Twice the amount of RadA-n protein was used as that of intact RadA and RadA-c. , RadA; black-square, RadA-c; open circle , RadA-n; , RadA-c plus RadA-n. The background (radioactivities from the reaction without protein) was subtracted from each time point.

                              
View this table:
[in this window]
[in a new window]
 
Table I
ATPase activity of wild-type and mutant RadA proteins

DNA Pairing and Strand Exchange Activities-- The pairing and strand transfer abilities of RadA-n and RadA-c were investigated. As shown in Fig. 4A, neither RadA-n nor RadA-c had D-loop formation activity under the conditions for RadA activity. However, a very weak ability for the three-strand exchange was observed with RadA-c alone, and the joint molecules produced by RadA-c increased with increasing amounts of RadA-c used for the reaction (Fig. 4B). Moreover, the joint molecule production increased when increasing amounts of RadA-n were added to the reaction. The decreased efficiency of the joint molecule formation by RadA-c was restored to 60% of the wild-type level when RadA-n was added with 2:1 or 5:1 more ratio. The effect of RadA-n on RadA-c strand exchange reaction is consistent with that on the ATPase activity. Neither D-loop formation nor the strand exchange activity was observed with RadA-n. These results indicate that the central core domain of RadA is essential for the strand exchange activity and that the N-terminal domain contributes to the enhancement of the reaction efficiency.


View larger version (40K):
[in this window]
[in a new window]
 
Fig. 4.   D-loop formation and three-strand exchange activities of truncated RadAs. A, RadA, RadA-c, or RadA-n (each at indicated concentrations) was incubated with 1 µM of 32P-labeled 83-mer oligonucleotide, W16(-), at 65 °C for 10 min. Then M13 double-stranded DNA (0.1 µg) was added to the mixtures, which were further incubated for either 2 min. The reaction mixtures were deproteinized and separated by 1% agarose gel electrophoresis. RadA, RadA-n, RadA-c, and RadA-n + RadA-c are indicated by wt, n, c, and c+n, respectively. B, three-strand exchange activity of RadA-c was examined at various concentrations (left panel) or after reconstitution with RadA-n (right panel). Lane 1, no protein; lane 2, 7.5 µM RadA; lane 3, 7.5 µM RadA-c; lane 4, 15 µM RadA-c; lane 5, 22.5 µM RadA-c; lane 6, 7.5 µM RadA-c + 7.5 µM RadA-n; lane 7, 7.5 µM RadA-c + 15 µM RadA-n; lane 8, 7.5 µM RadA-c + 37.5 µM RadA-n; lane 9, 37.5 µM RadA-n.

DNA Binding Activity-- To determine whether the N-terminal domain contributes to the self-assembly of RadA for cooperative DNA binding, the affinities of the truncated RadA proteins to DNA were compared by the gel mobility shift assays. RadA-c bound to both ssDNA and dsDNA, but its affinity was severalfold lower than that of RadA (Fig. 5). This result is consistent with the weak stimulation of the RadA-c ATPase activity by DNAs. No DNA binding was detected in the experiment using RadA-n under the same conditions (data not shown), which suggests that the N-terminal domain of RadA has little DNA binding activity by itself. In contrast to the expectation from the results of the ATPase assay, no difference was observed in the patterns of the shifted bands by RadA-c and the mixture of RadA-n and RadA-c under our assay conditions (Fig. 5). The DNA-protein complexes observed in the gel shift assay probably do not directly reflect the active nucleoprotein filaments.


View larger version (34K):
[in this window]
[in a new window]
 
Fig. 5.   DNA binding activities of truncated RadAs. A, the RadA-n protein was mixed with twice the amount of RadA-c for efficient reconstitution (c+n) and was compared with RadA (wt) and RadA-c (c) for DNA binding abilities. Various concentrations of proteins were incubated with a 32P-labeled single-stranded 83-mer, W16(-), indicated by ss, or a double-stranded 83 mer, W16(-)/W16(+), indicated by ds, at 60 °C for 10 min. The reaction products were analyzed by 1% agarose gel electrophoresis, and the bands were detected by autoradiography. B, the results shown in A are graphically represented. , RadA + ssDNA; black-square, RadA +dsDNA; open circle , RadA-c +ssDNA; , RadA-c + dsDNA; triangle , RadA-c and RadA-n + ssDNA; black-triangle, RadA-c and RadA-n + dsDNA.

Oligomeric State of RadA Proteins-- RadA forms a nucleoprotein filament with DNA in the presence of ATPgamma S. In the absence of DNA, most of the electron microscopic images of RadA are ring-like structures (30). Under the same conditions, neither the nucleoprotein filament in the presence of DNA nor the ring-like structure in the absence of DNA was observed when RadA was substituted by RadA-c or the mixture of RadA-n and RadA-c (data not shown). Then purified RadA-n and RadA-c, as well as wild-type RadA, were subjected to gel filtration chromatography (Fig. 6). The peaks of the eluted fractions of RadA-n and RadA-c corresponded to 25 and 22 kDa, respectively. Some of RadA-c eluted close to the position corresponding to 52 kDa. These results indicate that RadA-n and RadA-c mainly exist as a dimer and a monomer, respectively, and some of the RadA-c form a dimer. When the two proteins were mixed to 2:1 ratio, the main peak appeared at around the size of 45 kDa, indicating that the two proteins form a 1:1 complex. The band intensities of RadA-n and RadA-c on a SDS-PAGE of the fractions supported the one-to-one complex formation of the two proteins. The small amount of proteins eluted at 100 kDa may be the 2:2 complex. The excess RadA-n eluted at the same position as that of RadA-n alone. On the other hand, the wild-type RadA eluted much earlier, at the position corresponding to 520 kDa, indicating the stable self-association of the RadA proteins.


View larger version (30K):
[in this window]
[in a new window]
 
Fig. 6.   Gel filtration analysis of RadA and its truncated proteins. The gel filtration chromatography was performed as described under "Experimental Procedures." Aliquots of the gel filtration fractions were subjected to 15% SDS-PAGE analysis followed by Coomassie Brilliant Blue staining. Numbers in each lane indicate the fraction numbers. The peak positions of Thyroglobulin (670 kDa), immunoglobulin G (158 kDa), ovalbumin (44 kDa), and myoglobin (17 kDa) eluted from the column are marked at the top.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

We present here that RadA-c, with only the central core domain of the RecA family proteins, has basic strand exchange activity in vitro. The DNA binding ability of RadA-c was weaker than that of RadA, and probably because of its lower affinity for DNA, the ATPase activity of RadA-c was only slightly stimulated by DNA. From the gel shift assays, RadA-n does not seem to be able to form stable complexes with DNA by itself. However, the DNA-dependent ATPase activity and the strand exchange activity of RadA-c were enhanced by the addition of RadA-n into the reaction mixtures. The N-terminal domain of RadA may contribute to change the conformation of RadA-c to a more preferable form for making the nucleoprotein filament. A direct contribution of the N-terminal region in human Rad51 to the DNA binding has been proposed (46). In this case, however, the dissociation constant (Kd) values to the 12-base pair double-stranded DNA and the single-stranded DNA are 0.31 and 0.89 mM, respectively, which indicate a very weak binding affinity of the N-terminal fragment of human Rad51 to DNA. A homotypic interaction (self-association) of the eukaryotic Rad51 proteins has been found (16, 29, 42, 43), and the N-terminal region mediates this interaction (16). Our results for the archaeal RadA, from the EM observation and the gel filtration, are consistent with the fact that the N-terminal region is important for the self-association of Rad51. For the self-association of the mouse Rad51 and Dmc1 proteins, the N-terminal truncated proteins can interact with the intact Rad51 and Dmc1 proteins, respectively (29). It is not known, in those cases, if the truncated Rad51 or Dmc1 proteins can self-associate. Further studies are required to understand the mechanism of the self-association of the Rad51 family proteins and how the assembled structures contribute to the strand exchange activity.

One interesting contrast is that RadB, with only the central core domain and 28% sequence identity (45% similarity) to RadA-c, lacks the DNA-dependent ATPase activity and the strand exchange activity. The oligopeptide with 20 amino acid residues, derived from loop 1 in the RecA protein, has strand-pairing activity by itself (41). A comparison of the sequences of this region in RadA and RadB revealed that 11 and 4 of 20 residues are similar for RadA and RadB, respectively, to the RecA sequence. The divergence of this region in RadB may reflect the lack of strand exchange activity. For the purpose of obtaining some insight into the origin of the RecA family proteins, the amino acid sequences of the RecA/Rad51 family proteins were compared in detail. Fig. 7 shows a phylogenetic tree focused on the relationship of archaeal RadA and RadB. Given the fact that genes encoding sequences homologous to RadA and RadB have been found in the genomes of all the sequenced archaea to date, RadB must have important roles, too. It is difficult to predict the function of RadB from this phylogenetic relationship of the RecA/Rad51 family proteins. However, one interesting finding from this analysis is that RadB evolved two times faster than RadA (compare the lengths of the branches in the RadA and RadB clusters in Fig. 7). To confirm the difference in the evolution rate between RadA and RadB, the nucleotide sequences of the radA and radB genes from three Pyrococcal strains were compared. Base substitutions that cause amino acid changes (nonsynonymous changes) were observed with 2-3 times higher frequency in radB than in radA, although the same level of synonymous changes occurred between the two genes (data not shown). For both genes, any number of nonsynonymous changes per site was one order less than the corresponding number of synonymous changes per site. This result suggests that RadB does not have a specific pressure stimulating amino acid substitution but is more accepting of sequence changes than RadA during evolution. If this is true, then RadA may be involved in more essential processes than RadB for the maintenance of the organism. RadB has much higher DNA binding activity than RadA-c. When RadA-n was mixed with RadB with the same condition as the reconstitution of RadA-n and RadA-c, neither DNA binding nor ATPase activity was different from those by RadB alone (data not shown). It would be interesting to compare in more detail the structural and functional differences between RadA-c and RadB.


View larger version (24K):
[in this window]
[in a new window]
 
Fig. 7.   Phylogenetic analysis of RecA/Rad51 family proteins. All of the archaeal RadA and RadB sequences were compared with those of the eukaryotic proteins in this family. The bootstrap probabilities in percentages are shown only for nodes occurring in more than 70%. The length of the bar indicates 10% estimated amino acid changes.

The Rad51 protein is known to interact with other proteins in the RAD52 epistasis group, and it has been suggested that the N-terminal region may be important for specific interactions with other proteins, because it is conserved in Rad51 but not in RecA. The N-terminal region of RadA may have roles in interactions with other proteins. RadA interacts with RadB, as determined in our immunoprecipitation assay. In this case, the interaction seems to be disrupted when RadA is separated into RadA-n and RadA-c (30). To understand these specific protein-protein interactions, more detailed structure-function studies will be necessary. P. furiosus RadA is a very heat stable protein and is easy to handle and to store. Structural analyses of this archaeal RadA will contribute immensely to an understanding of the precise molecular mechanisms of the DNA strand pairing and exchange reactions.

    ACKNOWLEDGEMENTS

We thank Drs. J. DiRuggiero, S. Kowalczykowski,H. Iwasaki, K. Morikawa,and F. Robb for discussions. We are grateful to Dr. Y. Shimura, the director of Biomolecular Engineering Research Institute, for continuous encouragement.

    FOOTNOTES

* The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

** To whom correspondence should be addressed: Dept. of Molecular Biology, Biomolecular Engineering Research Inst., 6-2-3 Furuedai, Suita, Osaka 565-0874, Japan. Tel.: 81-6-6872-8208; Fax: 81-6-6872-8219; E-mail: ishino@beri.co.jp.

Published, JBC Papers in Press, July 7, 2000, DOI 10.1074/jbc.M004556200

    ABBREVIATIONS

The abbreviations used are: ssDNA, single-stranded DNA; ATPgamma S, adenosine 5'-O-(thiotriphosphate); PAGE, polyacrylamide gel electrophoresis; dsDNA, double-stranded DNA.

    REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

1. Kowalczykowski, S. C., Dixon, D. A., Eggleston, A. K., Lauder, S. D., and Rehrauer, W. M. (1994) Microbiol. Rev. 58, 401-465
2. Shinohara, A., and Ogawa, T. (1995) Trends Biochem. Sci. 20, 387-391
3. Roca, A. I., and Cox, M. M. (1997) Prog. Nucleic Acids Res. Mol. Biol. 56, 129-223
4. Bianco, P. R., Tracy, R. B., and Kowalczykowski, S. C. (1998) Front. Biosci. 3, 570-603
5. DiRuggiero, J., Santangelo, N., Nackerdien, Z., Ravel, J., and Robb, F. T. (1997) J. Bacteriol. 179, 4643-4645
6. Uemori, T., Sato, Y., Kato, I., Doi, H., and Ishino, Y. (1997) Genes Cells 2, 499-512
7. Sandler, S. J., Hugenholtz, P., Schleper, C., DeLong, E. F., Pace, N. R., and Clark, A. J. (1999) J. Bacteriol. 181, 907-915
8. DiRuggiero, J. N., Brown, J. R., Bogert, A. P., and Robb, F. T. (1999) J. Mol. Evol. 49, 474-484
9. Woods, W. G., and Dyall-Smith, M. L. (1997) Mol. Microbiol. 23, 791-797
10. Seitz, E. M., Brockman, J. P., Sandler, S. J., Clark, A. J., and Kowalczykowski, S. C. (1998) Genes Dev. 12, 1248-1253
11. Kil, Y. V., Baitin, D. M., Masui, R., Bonch-Osmolovskaya, E. A., Kuramitsu, S., and Lanzov, V. A. (2000) J. Bacteriol. 182, 130-134
12. Spies, M., Kil, Y., Masui, R., Kato, R., Kujo, C., Ohshima, T., Kuramitsu, S., Lanzov, V. Eur. J. Biochem. 267, 1125-1137
13. Kurumizaka, H., Aihara, H., Ikawa, S., Kashima, T., Bazemore, L. R., Kawasaki, K., Sarai, A., Radding, C. M., and Shibata, T. (1996) J. Biol. Chem. 271, 33515-33524
14. Aihara, H., Ito, Y., Kurumizaka, H., Terada, T., Yokoyama, S., and Shibata, T. (1997) J. Mol. Biol. 290, 495-504
15. Shinohara, A., Ogawa, H., and Ogawa, T. (1992) Cell 69, 457-470
16. Donovan, J. W., Milne, G. T., and Weaver, D. T. (1994) Genes Dev. 8, 2552-2562
17. Shen, Z., Cloud, K. G., Chen, D. J., and Park, M. S. (1996) J. Biol. Chem. 271, 148-152
18. Clever, B., Interthal, H., Schmuckli-Maurer, J., King, J., Sigrist, M., and Heyer, W. D. (1996) EMBO J. 16, 2535-2544
19. Petukhova, G., van Komen, S., Vergano, S., Klein, H., and Sung, P. (1999) J. Biol. Chem. 274, 29453-29462
20. Johnson, R. D., and Symington, L. S. (1995) J. Bacteriol. 15, 4843-4850
21. Buchhop, S., Gibson, M. K., Wang, X. W., Wagner, P., Sturzbecher, H. W., and Harris, C. C. (1997) Nucleic Acids Res. 25, 3868-3874
22. Sturzbecher, H. W., Donzelmann, B., Henning, W., Knippschild, U., and Buchhop, S. (1996) EMBO J. 15, 1992-2002
23. Scully, R., Chen, J., Plug, A., Xiao, Y., Weaver, D., Feunteun, J., Ashley, T., and Livingston, D. M. (1997) Cell 88, 265-275
24. Chen, P. L., Chen, C. F., Chen, Y., Xiao, J., Sharp, Z. D., and Lee, W. H. (1998) Proc. Natl. Acad. Sci. U. S. A. 95, 5287-5292
25. Katagiri, T., Saito, H., Shinohara, A., Ogawa, H., Kamada, N., Nakamura, Y., and Miki, Y. (1998) Genes Chromosomes Cancer 21, 217-222
26. Mizuta, R., LaSalle, J. M., Cheng, H. L., Shinohara, A., Ogawa, H., Copeland, N., Jenkins, N. A., Lalande, M., and Alt, F. W. (1997) Proc. Natl. Acad. Sci. U. S. A. 94, 6927-6932
27. Sharan, S. K., Morimatsu, M., Albrecht, U., Lim, D. S., Regel, E., Dinh, C., Sands, A., Eichele, G., Hasty, P., and Bradley, A. (1997) Nature 386, 804-810
28. Wong, A. K. C., Pero, R., Ormonde, P. A., Tavtigian, S. V., and Bartel, P. L. (1997) J. Biol. Chem. 272, 31941-31944
29. Tarsounas, M., Morita, T., Pearlman, R. E., and Moens, P. B. (1999) J. Cell Biol. 147, 207-219
30. Komori, K., Miyata, T., DiRuggiero, J., Holley-Shanks, R., Hayashi, I., Cann, I. K. O., Mayanagi, K., Shinagawa, H., and Ishino, Y. (2000) J. Biol. Chem. 275, 33782-33790
31. Gill, S. C., and von Hippel, P. H. (1989) Anal. Biochem. 182, 319-326
32. Gupta, R. C., Bazemore, L. R., Golub, E. I., and Radding, C. M. (1997) Proc. Natl. Acad. Sci. U. S. A. 94, 463-468
33. Morimatsu, K., Horii, T., and Takahashi, T. (1995) Eur. J. Biochem. 228, 779-785
34. Thompson, J. D., Higgins, D. G., and Gibson, T. J. (1994) Nucleic Acids Res. 22, 4673-4680
35. Story, R. M., Weber, I. T., and Steiz, T. A. (1992) Nature 355, 318-325
36. Felsenstein, J. (1996) Methods Enzymol. 266, 418-427
37. Jones, D. T., Taylor, W. R., and Thornton, J. M. (1992) Comput. Appl. Biosci. 8, 275-282
38. Saitou, N., and Nei, M. (1987) Mol. Biol. Evol. 4, 406-425
39. Felsenstein, J. (1985) Evolution 39, 783-791
40. Page, R. D. (1996) Comp. Appl. Biosci. 12, 357-358
41. Voloshin, O. N., Wang, L., and Camerini-Otero, R. D. (1996) Science 272, 868-871
42. Kovalenko, O. V., Plug, A. W., Haaf, T., Gonda, D. K., Ashley, T., Ward, D. C., and Radding, C. M. (1996) Proc. Natl. Acad. Sci. U. S. A. 93, 2958-2963
43. Kovalenko, O. V., Golub, E. I., Bray-Ward, P., Ward, D. C., and Radding, C. M. (1997) Nucleic Acids Res. 25, 4946-4925
44. Felsenstein, J. (1993) PHYLIP, version 3.5c , Department of Genetics, University of Washington, Seattle, WA
45. Adachi, J., and Hasegawa, M. (1996) MOLPHY, version 2.3b3 , Institute of Statistical Mathematics, Tokyo
46. Aihara, H., Ito, Y., Kurumizaka, H., Yokoyama, S., and Shibata, T. (1999) J. Mol. Biol. 290, 495-504


Copyright © 2000 by The American Society for Biochemistry and Molecular Biology, Inc.
Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
GENES CELLSHome page
R. Fujikane, H. Shinagawa, and Y. Ishino
The archaeal Hjm helicase has recQ-like functions, and may be involved in repair of stalled replication fork
Genes Cells, February 1, 2006; 11(2): 99 - 110.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
T. Akiba, N. Ishii, N. Rashid, M. Morikawa, T. Imanaka, and K. Harata
Structure of RadB recombinase from a hyperthermophilic archaeon, Thermococcus kodakaraensis KOD1: an implication for the formation of a near-7-fold helical assembly
Nucleic Acids Res., June 13, 2005; 33(10): 3412 - 3423.
[Abstract] [Full Text] [PDF]


Home page
J. Bacteriol.Home page
Y. V. Kil, E. A. Glazunov, and V. A. Lanzov
Characteristic Thermodependence of the RadA Recombinase from the Hyperthermophilic Archaeon Desulfurococcus amylolyticus
J. Bacteriol., April 1, 2005; 187(7): 2555 - 2557.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
R. Fujikane, K. Komori, H. Shinagawa, and Y. Ishino
Identification of a Novel Helicase Activity Unwinding Branched DNAs from the Hyperthermophilic Archaeon, Pyrococcus furiosus
J. Biol. Chem., April 1, 2005; 280(13): 12351 - 12358.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
A. Ariza, D. J. Richard, M. F. White, and C. S. Bond
Conformational flexibility revealed by the crystal structure of a crenarchaeal RadA
Nucleic Acids Res., March 8, 2005; 33(5): 1465 - 1473.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
K. Komori, M. Hidaka, T. Horiuchi, R. Fujikane, H. Shinagawa, and Y. Ishino
Cooperation of the N-terminal Helicase and C-terminal Endonuclease Activities of Archaeal Hef Protein in Processing Stalled Replication Forks
J. Biol. Chem., December 17, 2004; 279(51): 53175 - 53185.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
275/43/33791    most recent
M004556200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Komori, K.
Right arrow Articles by Ishino, a. Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Komori, K.
Right arrow Articles by Ishino, a. Y.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2000 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement