Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Originally published In Press as doi:10.1074/jbc.M005040200 on August 18, 2000

J. Biol. Chem., Vol. 275, Issue 43, 33998-34008, October 27, 2000
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
275/43/33998    most recent
M005040200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lee, W. Y.
Right arrow Articles by Lever, J. E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lee, W. Y.
Right arrow Articles by Lever, J. E.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Cyclic Nucleotide Regulation of Na+/Glucose Cotransporter (SGLT1) mRNA Stability

INTERACTION OF A NUCLEOCYTOPLASMIC PROTEIN WITH A REGULATORY DOMAIN IN THE 3'-UNTRANSLATED REGION CRITICAL FOR STABILIZATION*

Wha Young Lee, Paul Loflin, Constance J. Clancey, Hua Peng, and Julia E. LeverDagger

From the Department of Biochemistry and Molecular Biology, University of Texas-Houston Medical School, Houston, Texas 77225

Received for publication, June 12, 2000, and in revised form, August 14, 2000

    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Expression of the Na+-coupled glucose cotransporter SGLT1 is regulated post-transcriptionally at the level of mRNA stability. We have previously demonstrated that cAMP-dependent stabilization of the SGLT1 message was correlated with the protein phosphorylation-dependent binding of cytoplasmic proteins to a uridine-rich sequence (URE) in the 3'-untranslated region (UTR). In the present study, the regulatory role of the URE was demonstrated by inserting it into the 3'-UTR of a beta -globin reporter minigene under the control of the tetracycline-regulated promoter. The resultant chimeric globin/SGLT1 mRNA expressed after transfection into LLC-PK1 cells exhibited a decreased half-life compared with the beta -globin control, indicating that the URE serves a destabilizing function. Activation of protein kinase A stabilized the chimeric message but not the beta -globin control, indicating the presence of a regulatory stabilizing sequence within the URE. A 38-kDa nucleocytoplasmic protein was identified that recognized a 12-nucleotide binding site within the URE. A mutation in this binding site that prevented protein binding assayed in vitro by UV cross-linking also prevented protein kinase A-dependent stabilization of the chimeric message assayed in vivo. These findings identify the interaction between a 38-kDa nucleocytoplasmic protein and a regulatory uridine-rich sequence in the 3'-UTR as critical for cAMP-mediated SGLT1 message stabilization.

    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Glucose is the major carbon and energy source for eukaryotic cells. Transport of glucose into mammalian cells is the rate-limiting step for its utilization and accordingly is a highly regulated process. Maintenance of a constant blood glucose level is essential for cellular homeostasis. In kidney, glucose is reabsorbed from the urinary filtrate by the action of several types of glucose transporters arranged in series along the proximal tubule. These function together in polarized epithelial cells to mediate transepithelial transport of glucose. SGLT1 (Na+/glucose) cotransporters in the apical membrane catalyze active glucose transport into the cell driven by the Na+ gradient (1). Glucose diffuses passively out of the cell into the circulation via basolateral GLUT facilitative transporters (2). High affinity glucose transporters SGLT1 and GLUT1 located in late proximal tubule scavenge the remainder of filtered glucose not reabsorbed in early proximal tubule (3). SGLT1 is also expressed in small intestine where it mediates absorption of dietary glucose and galactose (3, 4).

Most of our current information concerning the regulation of SGLT1 expression has been obtained from studies using the polarized epithelial cell line LLC-PK1, derived from porcine kidney (5). SGLT1 is expressed in this cell line as shown by cDNA cloning and Northern blot analysis (6) and is highly regulated by the cell growth and differentiation state (5, 7, 8). Protein kinase A (PKA) and protein kinase C (PKC) exert opposing effects on SGLT1 mRNA stability and steady-state levels in confluent cultures. Activation of PKA results in SGLT1 message stabilization (9), whereas PKC activation by phorbol esters such as phorbol 12-O-tetradecanoate 13-acetate (TPA) results in rapid degradation of the SGLT1 message (8). PKA-stimulated message stabilization was associated with a protein phosphorylation-dependent binding of cytoplasmic protein(s) to a uridine-rich sequence (URE) in the 3'-UTR (10). Changes in SGLT1 mRNA half-life elicited by PKA activation correlate well with changes in steady-state levels of the transporter (9), indicating that message stability is a major determinant of expression level.

In the present study, we identify a cis-regulatory domain within the URE of the SGLT1 mRNA 3'-UTR that binds a 38-kDa nucleocytoplasmic protein and is required for PKA-mediated stabilization of this message. Our approach was to map the minimal protein-binding site using an in vitro assay of PKA-stimulated RNA-protein complex formation. This in vitro assay was also used to characterize key RNA sequence specificity determinants and identify a mutation that prevents protein binding. The in vivo effects of this mutation, placed in the context of the URE, on cAMP-mediated message stabilization were then tested by inserting it into a beta -globin reporter minigene construct and transfecting it into LLC-PK1 cells. Results from this analysis, in combination with deletion studies, demonstrate that the SGLT1 URE contains distinct sequence domains that convey instability to the stable beta -globin message as well as a regulatory domain that acts to stabilize the message in response to PKA activation.

    EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Materials-- [alpha -32P]Uridine triphosphate (3000 Ci/mmol) was obtained from ICN (Costa Mesa, CA). Nucleotide triphosphates were from Roche Molecular Biochemicals. RNA polymerases T3 and T7 were purchased from Promega (Madison, WI). RNase T1 (aspergillus oryzae) was from Calbiochem (La Jolla, CA). 3-Isobutyl-1-methylxanthine (IBMX) and phosphatase (potato acid, type III) were obtained from Sigma. Plasmids pTet-tTAk, pUHC13-3, and pT3/T7alpha 18 were purchased from Life Technologies, Inc., and pSVneo was from CLONTECH (Palo Alto, CA).

Cell Culture-- The porcine renal cell line LLC-PK1 clone G8 was cultured in a 1:1 mixture of Dulbecco's modified Eagle's medium and Ham's F-12 medium supplemented with 10% fetal bovine serum (HyClone, Logan, UT), 2 mM glutamine, 0.37% sodium bicarbonate, and 24 mM HEPES, pH 7.0, as described previously (11). For experiments, cells were seeded at a density of 104 cells/cm2 and grown for 4 days (postconfluent state) in this medium supplemented with 1% penicillin-streptomycin (50 units/ml), and then IBMX (final concentration, 1 mM) was added to the indicated samples with medium change. Unless otherwise stated, cells were harvested at 96 h after addition of IBMX with one medium change at 72 h after treatment.

Preparation of Cytoplasmic and Nuclear Cell Extracts-- Monolayers of cells were washed three times with ice-cold phosphate-buffered saline and lysed on ice with buffer A containing 10 mM HEPES, pH 7.9, 0.1 mM EDTA, 0.1 mM EGTA, 10 mM KCl, 1 mM dithiothreitol (DTT), 0.4% Nonidet P-40, 1 mM sodium pyrophosphate, 1 mM NaF, 0.5 mM sodium orthovanadate, and 0.5 mM phenylmethysulfonyl fluoride as modified from Schreiber et al. (12). The lysates were incubated on ice for 5 min and then centrifuged at 12,000 × g for 1 min at 4 °C. The cytosolic supernatants were removed and recentrifuged at 12,000 × g for 15 min to remove any paticulate material. The pellets were washed once with 1 ml of ice-cold buffer A and then were extracted for 30 min at 4 °C in buffer B containing 20 mM HEPES, pH 7.9, 0.42 M NaCl, 1 mM EDTA, 1 mM EGTA, 1 mM DTT, 1 mM phenylmethylsulfonyl fluoride, 1 mM sodium pyrophosphate, 1 mM NaF, and 0.5 mM sodium orthovanadate. The nuclear extracts were centrifuged at 12,000 × g for 20 min at 4 °C and stored in aliquots at -85 °C. The protein concentration of cytosolic and nuclear extracts was determined by the Micro BCA protein assay (Pierce) as described by Atkins and Tuen (13).

Synthesis of Sense RNA Fragments for Binding Studies-- Plasmid DNAs were linearized with appropriate restriction enzymes and transcribed in the presence of [alpha -32P]uridine triphosphate (3000 Ci/mmol). The renal SGLT1 cDNA plasmid pPSGT-B1 (6) was kindly provided by Dr. David Rhoads (Massachusetts General Hospital, Boston, MA). All nucleotide numbers refer to the pig SGLT1 sequence (GenBankTM accession number M34044) reported by Ohta et al. (6). Plasmid 3UTR2 is a 1317-bp EcoRV/HindIII fragment of pPSGT-B1 subcloned into the pBluescript II SK(-) vector. Plasmid p3UTR2Delta 7 was generated from 3UTR2 by deleting a 443-bp BamHI/AvaII fragment.

A sense 3UTR2 RNA transcript was synthesized from StuI-linearized 3UTR2 using T3 RNA polymerase and contained 435 nucleotides (nt) of the pig SGLT1 3'-UTR (nucleotides 2263-2697) and 69 nt of pBluescript SK(-). Plasmid 3UTR2Delta 7 was linearized with StuI and transcribed with T3 RNA polymerase to yield a transcript of 178 nt containing 122 nt of the pig SGLT1 3'-UTR (nucleotides 2576-2697) and 56 nt of pBluescript. Plasmids 122-nt Bam and 122-nt m2/Bam (see below) were linearized with BbsI and transcribed with T3 polymerase to yield wild-type and mutant 120-nt transcripts, respectively, that lack pBluescript sequence in the riboprobe.

Shorter probes containing sequences within this 122-nt SGLT1 3'-UTR region (2576-2697) and the homologous human probe HSGLT were synthesized from synthetic double-stranded DNA oligonucleotide templates that contained a minimal T7 RNA polymerase promoter sequence CGTAATACGACTCACTATAGGG at their 5' end. Single-stranded oligonucleotides (2 µg/µl) were dissolved in TE buffer, pH 7.6, and then NaCl was added to a final concentration of 100 mM. Equal volumes of sense and antisense oligonucleotides were mixed and heated in a boiling water bath for 10 min and then incubated at 60 °C for 1 h. After cooling to room temperature, the NaCl concentration was adjusted to 300 mM, and double-stranded DNA was precipitated in ethanol at -70 °C overnight. Pellets were washed with 80% ethanol, dissolved in TE buffer, pH 7.6, at 1 µg/µl, and stored at -20 °C. Sense strand RNA transcripts were synthesized from synthetic double-stranded DNA templates using T7 RNA polymerase, 5 µM alpha -[32P]uridine triphosphate, 3000 Ci/mmol, and 0.5 mM each of ATP, GTP, and CTP. The sequences of the RNA probes used in the present study are summarized in Fig. 1.

After transcription, RNase-free DNase (RQ1 DNase, Promega) was added, and mixtures were incubated for an additional 30 min at 37 °C to remove template DNA. Then 20 µg of yeast tRNA was added as carrier, followed by dilution with diethylpropylcarbonate-treated water to a final volume of 100 µl. Labeled transcripts were extracted with phenol/chloroform and precipitated twice with 2 M ammonium acetate in 2.5 volumes of ice-cold ethanol at -80 °C for at least 1 h. The final pellet was washed with 80% ice-cold ethanol, air-dried, dissolved in diethylpropylcarbonate-treated water, stored at -20 °C, and used as soon as possible. The integrity of the transcripts was verified by electrophoresis on 6% acrylamide urea gels.

To synthesize unlabeled transcripts in quantity for competition experiments, transcription reactions were performed by the same procedure described above except [32P]UTP was replaced by 1 mM UTP, and the total volume of each reaction mixture was increased to 100 µl. Also, the RNA transcripts were precipitated without addition of carrier yeast tRNA, and the concentration was determined by UV absorption at 260 nm.

UV Cross-linking Assay of RNA-Protein Interaction-- Radiolabeled RNA probe binding to protein was determined by the UV cross-linking assay described previously (14) with minor modifications. Briefly, either cytosolic or nuclear cell extracts (40 or 20 µg, respectively) were incubated with 0.2 ng of 32P-labeled RNA probe (105 cpm) at room temperature for 15 min in 10 mM HEPES, pH 7.6, 3 mM MgCl2, 40 mM KCl, 4 mM DTT, 10% glycerol, 0.5% Nonidet P-40, 10 mg/ml heparin, and 200 µg/ml yeast tRNA. The reaction mixtures were then digested with RNase T1 (20 units/ng RNA) for 30 min at room temperature. The RNA-protein complexes were cross-linked by exposing reaction mixtures on ice to 120,000 µJ short-wave radiation (254 nm) in a UV cross-linker 1800 (Stratagene) for 7 min. Samples were boiled for 3 min in SDS sample buffer containing 50 mM Tris-HCl, pH 6.8, 100 mM DTT, 2% sodium dodecyl sulfate, 10% glycerol, 0.1% bromphenol blue, and 0.5% beta -mercaptoethanol and then resolved on 12% SDS-polyacrylamide gels. The gels were dried and exposed to x-ray film at -80 °C using an intensifying screen.

Northwestern Blot Analysis-- Cytoplasmic proteins, 40-60 µg, were resolved by SDS-PAGE and transferred to a nitrocellulose membrane (Schleicher & Schuell) using an ABN model SD 1000 electrotransfer unit. The membrane was washed twice for 20 min in phosphate-buffered saline, pH 7.4, and then protein renaturation was carried out by incubating the filter with a solution containing 12 mM HEPES, pH 7.6, 50 mM NaCl, 5% glycerol, and 1 mM EDTA at 4 °C for 3-16 h. The filter was then incubated with a blocking solution containing 12 mM HEPES, pH 7.6, 50 mM NaCl, 1× Denhardt's solution, and 100 µg/ml yeast tRNA for 2-3 h at room temperature. The indicated sense 32P-labeled RNA probe was added to 2-5 ml of blocking solution to a final concentration of 0.5-1 × 106 cpm/ml and incubated with the filter on a rocker at room temperature for 60 min. The blot was gently washed three times for 5 min each with a solution containing 50 mM NaCl and 12 mM HEPES, pH 7.6. The blot was then air-dried and exposed to x-ray film at -80 °C with an intensifying screen.

Chromatographic Fractionation of Binding Activity-- Nuclear extracts (105.6 mg of protein) were prepared from five roller bottles of IBMX-treated confluent cells and then fractionated by ammonium sulfate precipitation. Proteins precipitated between 30 and 60% ammonium sulfate were collected by centrifugation at 12,000 × g for 15 min, dialyzed overnight against 0.4 M Tris-HCl, pH 8.0, 1 mM DTT, 1 mM phenylmethylsulfonyl fluoride, 1 mM sodium pyrophosphate, 1 mM NaF, and 0.5 mM sodium orthovanadate with one buffer change, and then applied to a 123-ml diethylaminoethyl cellulose (DE52) column equilibrated with 0.4 M Tris-HCl, pH 8.0. The column was eluted in a gradient of 0.2-0.6 M KCl at a flow rate of 0.48 ml/min. Fractions (1 ml each) were collected beginning after 20 ml of elution, and 10 µl of each fraction was assayed for RNA binding using the UV cross-linking assay.

Affinity Purification Using a Biotinylated Specific RNA Probe-- Streptavidin-conjugated magnetic beads were washed three times with binding buffer TEN500 (10 mM Tris-HCl, pH 7.5, 1 mM EDTA, and 500 mM NaCl). Biotinylated RNA probes were prepared by in vitro transcription with T7 polymerase as described above except transcription mixtures contained 5 mM each of ATP, GTP, and UTP, 2.5 mM CTP, and 2.5 mM biotin-14 CTP. The indicated biotinylated RNA probe (200 pmol) was then complexed with 1 mg of beads in two volumes of TEN500 buffer by incubating for 30 min at 4 °C on a rocker. Then the RNA-streptavidin complexed beads were washed three times with wash buffer TEN1000 (10 mM Tris-HCl, pH 7.5, 1 mM EDTA, and 1 M NaCl).

Confluent LLC-PK1 cells on two 15-cm dishes were treated with 1 mM IBMX for 72 h and then switched to Dulbecco's modified Eagle's medium deficient in methionine, cysteine, and cystine supplemented with 10% dialyzed fetal bovine serum, 2 mM glutamine, and 1 mM IBMX. After 1 h culture in 35S-deficient medium, 35S-labeled methionine/cysteine was added at a final concentration of 100 µCi/ml, and incubation was continued for an additional 5 h before preparation of a nuclear extract. The extract was first precleared of nonspecific binding proteins by incubation with streptavidin-conjugated beads equilibrated in nuclear extraction buffer B for 1 h at 4 °C on a rocker. The precleared supernatant was then incubated with the specific RNA-streptavidin-complexed beads 1 h at 4 °C on a rocker. The supernatant was removed, and beads were washed three times with nuclear extraction buffer B. Then the protein-RNA-streptavidin-coupled beads were boiled in SDS sample buffer for 5 min to release bound proteins and analyzed by SDS-PAGE together with prestained molecular weight markers. Gels were soaked in Autofluor (National Diagnostics, Somerville, NJ). Dried gels were exposed to Kodak MR film at -80 °C for 2-3 days.

Reporter Plasmid Construction-- The beta -globin reporter plasmid pTet-BBB (15), which expresses beta -globin under the control of a tetracycline-regulated promoter, was obtained from Dr. Ann-Bin Shyu (University of Texas-Houston Medical School, Houston, TX). To test the influence of the 435-nt U-rich sequence element (3UTR2; Fig. 1) on the stability of the beta -globin message, 3UTR2 was inserted into a unique BglII site of pTet-BBB located in the 3'-UTR of beta -globin. Plasmid p3UTR2/Bam was prepared from p3UTR2 (10) by digestion with StuI and religation in the presence of excess BamHI linker, d(CGGGATCCCG), from New England Biolabs (Beverly, MA). Similarly, plasmid 122-nt Bam was prepared from p3UTR2Delta 7 using the above strategy. 3UTR2/Bam was digested with BamHI, and a 450-bp fragment was recovered and inserted into the unique BglII site in pTet-BBB to create pTet-BBB + 3UTR2.

Plasmids p3UTR2/Bam and p122nt/Bam were used as templates for site-directed mutagenesis to construct p3UTR2 m2/Bam and p122nt m2/Bam which contained a TT right-arrow GG substitution at nucleotides 2622-2623. Polyacrylamide gel-purified 50 bp complimentary oligonucleotide primers 5'-GTT TGC TTT ATG GTT GGT TAA CTT TTT CTT ATG GCT GCA CAA GTA CAA CC-3' and 5'-GGT TGT ACT TGT GCA GCC ATA AGA AAA AGT TAA CCA ACC ATA AAG CAA AC-3' from Integrated DNA Technologies (Coralville, IA) were used for site-directed mutagenesis. These were designed to achieve the required melting temperature in the presence of the AT-rich template and 2 mismatched nucleotides. The reaction was performed using the QuikChange Site-Directed Mutagenesis Kit (Stratagene) according to manufacturer's instructions. After 16 cycles of denaturation, annealing and extension, products were digested with DpnI to remove the original template strands, then cooled to 4 °C prior to transformation of super competent XL-1 Blue cells. p3UTR2 m2/Bam was cut with BamHI to release a 450 bp fragment which was inserted into the BglII site in pTet-BBB to create pTet-BBB + 3UTR2 m2.

pTet-BBB + 47 nt was constructed by annealing sense and antisense oligonucleotides of the sequence 5'-CGG GAT CCT TTT GTT TTA TAA TGT TTG CTT TAT TTT TGG TTA ACT TTT TCT TAT GGA TCC G-3', which contains the 47-nt sequence of pig SGLT1 3'-UTR (residues 2597-2643) flanked by BamHI linkers on both ends. After digestion with BamHI, this fragment was ligated into the unique BglII site of pTet-BBB. Automated sequencing was used to confirm the sequence and correct orientation of all constructs.

Selection of Stable pTet-tTA LLC-PK1 Transfectant Cell Lines-- LLC-PK1 cells stably expressing the tetracycline-regulated transactivator (pTet-tTA) were obtained by calcium phosphate-mediated transfection as follows. The transfection mixture (final volume, 1.2 ml) contained 20 µg of DNA in 558 µl of H2O (2 µg of pTet-tTA, 0.4 µg of pSV2neo as selectable marker, and 17.6 µg of pT7/T3alpha -18 as carrier DNA), 558 µl of 2× HBS (0.274 M NaCl, 10 mM KCl, 1.4 mM Na2HPO4, 15 mM glucose, 42 mM HEPES, pH 7.02) and 84 µl of M CaCl2. After 20-30 min of precipitation, the mixture was added to a 10-cm dish of cells at 80% cell confluence. After exposure to the DNA precipitate for 16-20 h, cells were then washed and fed with fresh medium. Two days later, cells were split 1:5 into fresh medium containing 500 ng/ml tetracycline and 0.5 mg/ml G418. Cells were maintained in the selection medium for 3-4 weeks with medium change every 3-4 days. Individual G418-resistant clones were isolated by trypsinization within a glass cylinder and expanded by growth in the selective medium.

Transactivator activity of each stably transfected clone was screened by transient transfection with pUHC13-3 (Life Technologies, Inc.), a luciferase reporter plasmid responsive to the tetracycline-regulated transcriptional activator (pTA), into duplicate dishes of each isolated clone, using calcium-phosphate precipitation as described above. All dishes received 1.2-ml aliquots of the precipitation mixture containing 2 µg of pUHC13-3 and 18 µg of pT3/T7alpha -18 carrier DNA. After 16-20 h, DNA was removed, and fresh medium containing 0.5 mg/ml G418 was added to each dish. Tetracycline was then added to one dish of each duplicate to a final concentration of 500 ng/ml. Titration studies using concentrations of tetracycline between 0 and 125 ng/ml tetracycline indicated that 30 ng/ml tetracycline was sufficient to prevent detectable luciferase expression from pUHC13-3 (data not shown). Two days after transfection, cells were washed twice with phosphate-buffered saline, and monolayers were assayed for tetracycline-regulated luciferase activity using the Luciferase Assay System (E1500; Promega, Madison, WI) according to the manufacturer's directions. Stable transfectant clonal cell line LLC-TAK-B7 exhibited a 50-fold increase in luciferase activity at 48 h after removal of tetracycline and was chosen as the host cell line for tetracycline-regulated ectopic gene expression. The kinetics of reappearance of luciferase activity following the removal of tetracycline were also analyzed. After a 3-h lag, luciferase activity increased linearly for 16 h, reaching 50-60% of maximum at 15 h after the removal of tetracycline (data not shown).

Transient Transfection of LLC-TAK-B7 with beta -Globin Reporter Plasmids-- The calcium phosphate transfection method described above was modified as follows to introduce beta -globin reporter plasmid plasmids pTetBBB and its derivatives into LLC-TAK-B7 with increased efficiency. LLC-TAK-B7 cells were plated at a density of 105 cells/cm2 on 10-cm dishes and grown overnight in medium containing 500 ng/ml tetracycline and 500 µg/ml G418. After 15-18 h, the medium was removed and replaced with 2 ml of fresh medium containing tetracycline and G418. After 1 h, 0.24 ml of a calcium phosphate transfection mixture containing 2 µg of beta -globin reporter plasmid, 18 µg of carrier DNA, and 80 µg of CalPhos Maximizer (CLONTECH) was added for 4 h. Transient transfection experiments using the luciferase reporter plasmid pUHC13-3 indicated that addition of CalPhos Maximizer produced an 18-fold increase in luciferase activity per dish with greatly improved cell viability and required only 4 h of exposure of cells to the DNA precipitate compared with the 24 h of DNA exposure required in the absence of this component. Cells were washed twice and then given fresh medium containing 30 ng/ml tetracycline and 500 µg/ml G418 with or without 1 mM IBMX. After 24 h, the medium was removed, cells were washed twice then given fresh medium without tetracycline but the addition of 1 mM IBMX where indicated. As a control, 500 ng/ml tetracycline was added to one dish to suppress transcription from the plasmid. After a 15-h pulse of expression from the plasmid, transcription was terminated by addition of 500 ng/ml tetracycline. At the indicated times, monolayers were washed twice with ice-cold phosphate-buffered saline, and cytoplasmic RNA was extracted (16) to determine the kinetics of mRNA decay.

Antisense RNA Probes for Northern Blots-- Plasmid pGAPDH was a gift from Dr. Dennis L. Foss, University of Minnesota, and consists of 865 bp of porcine GAPDH coding sequence (GenBankTM accession number U48832) in vector pGEM-T. The plasmid was linearized with HindIII and antisense RNA transcribed using T7 RNA polymerase and [alpha -32P]UTP. Plasmid pBSSK(-) beta -globin was created by subcloning rabbit beta -globin cDNA (GenBankTM accession number V00879) into the EcoRV site of pBluescript SK(-). The resulting plasmid was linearized with HindIII and 32P-labeled antisense RNA transcribed using T3 RNA polymerase.

Northern Blot Analysis of Transfectants-- Cytoplasmic RNA (10 µg) was denatured and fractionated on a 1% agarose gel containing formaldehyde (17). Samples of 0.5 µg of 123-bp DNA ladder were also included as molecular weight markers. A poly(A)- sample was prepared from the zero time sample by hybridization with oligo(dT) and digestion of the double-stranded region with ribonuclease H. Samples were transferred by pressure to a Bright Star nylon membrane (Ambion, Austin, TX) using a PosiBlot apparatus (Stratagene) and cross-linked using a StratalinkerTM 1800 (Stratagene). Membranes were prehybridized 3 h at 55 °C as described previously (7) and then hybridized with antisense RNA probes for beta -globin and GAPDH, 3 × 106 dpm/ml each, at 55 °C overnight. Membranes were washed twice for 15 min at room temperature and then for 1 h at 55 °C and 30 min at 65 °C. All wash solutions contained 0.1× SSC and 0.1% SDS. If necessary, background was reduced by a second 65 °C wash or by a brief 68 °C wash. Quantitation of radioactivity was performed using an Instant ImagerTM (Packard Instrument Co., Meriden, CT). Filters were also exposed to X-Ray film at -85 °C using an intensifying screen. Following analysis with RNA probes, molecular weight markers were detected by hybridization with 123-bp DNA ladders labeled with alpha [32P]CTP by the random prime method.

    RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Nucleocytoplasmic Distribution of RNA Binding Activities-- A 122-nt uridine-rich region (nucleotides 2576-2697) in the 3'-UTR of porcine SGLT1 mRNA (Fig. 1) has been implicated in the stabilization of this message after PKA activation (10). For this analysis, 32P-labeled sense RNA transcripts within a uridine-rich region of the SGLT1 3'-UTR were utilized. After binding, digestion of unprotected RNA with ribonuclease T1, and covalent cross-linking of the RNA-protein complex catalyzed by UV irradiation, labeled RNA-protein complexes were visualized after resolution by SDS-PAGE. The 122-nt RNA fragment recognized a cytoplasmic RNA binding activity that was stimulated after treatment of cells with cAMP elevating agents such as forskolin or IBMX (10). Stimulation was blocked by the PKA inhibitor H89 and was dependent on protein phosphorylation.


View larger version (30K):
[in this window]
[in a new window]
 
Fig. 1.   Summary of the sense RNA probes used in RNA-protein binding studies. 3'-UTR represents the entire 1.83-kb 3'-UTR of SGLT1 mRNA and indicates restriction enzyme sites that divide SGLT1 3'-UTR cDNA into four regions (3UTR1-4) to produce corresponding sense RNA probes by in vitro transcription. Nucleotide numbers refer to the porcine SGLT1 sequence reported by Ohta et al. (6). The 47-nt URE is shown by the thick line, and pentameric uridine motifs are shown as U. The sense RNA sequence for the 122-nt probe is shown. The sequence for the minimal 12-nt binding site is shown in bold type. HSGLT is a 32-nt probe based on human SGLT1 exon 15 (nucleotides 1098-1129).

We investigated the possibility that nuclear RNA-binding proteins may also bind the SGLT1 URE sequence. A 47-nt RNA probe (nucleotides 2597-2643), consisting of a uridine-rich domain within the 122-nt region, formed a single 50-kDa complex using either nuclear or cytoplasmic extracts (Fig. 2A). Direct comparison of nuclear and cytoplasmic binding to the 47-nt probe assessed by band intensity under identical conditions indicated that the specific activity of SG-URBP was much greater in the nucleus than in the cytoplasm and was stimulated after treatment of cells with the cAMP phosphodiesterase inhibitor IBMX (Fig. 2A). Probe 3UTR2, a 435-nt fragment (nucleotides 2263-2697) overlapping the 122-nt region, gave a similar pattern of multiple IBMX-stimulated bands to that observed using the 122-nt probe in both cytoplasmic (Fig. 2B) and nuclear (not shown) extracts. No complex formation was observed in either nuclear or cytoplasmic extracts if the 122-nt region was deleted from probe 3UTR2 (not shown). Therefore, the regions immediately flanking the 122-nt site did not contribute to protein binding.


View larger version (43K):
[in this window]
[in a new window]
 
Fig. 2.   Identification of minimal RNA recognition sequences involved in IBMX-stimulated RNA-protein complex formation in nuclear and cytoplasmic extracts. A, the relative abundance of the 50-kDa complex was directly compared in cytoplasmic (40 µg of protein) and nuclear extracts (13.5 µg of protein) under identical conditions using [alpha -32P]UTP-labeled 47-nt RNA probe. The minimal RNA sequence necessary for complex formation was assayed in both cytoplasmic (B) and nuclear (C) extracts using a series of radiolabeled sense RNA probes described in Fig. 1. Extracts from cells treated for 96 h with 1 mM IBMX (I) or control (C) cells are compared.

Mapping the Minimal Cognate Sequence-- To further localize the binding site within the 47-nt RNA sequence, we generated a series of sense RNA fragments from corresponding synthetic double-stranded oligonucleotides containing a T7 promoter (Fig. 1). Fragments labeled with alpha -32P-labeled UTP by in vitro transcription with T7 polymerase were incubated with nuclear and cytoplasmic extracts from control and IBMX-treated cells and analyzed by the UV cross-linking assay (Fig. 2). As we have reported previously (10), complex formation with either the 3UTR2 transcript or the 122-nt transcript (previously named 3UTR2Delta 7) was greatly increased in cytoplasmic extracts from IBMX-treated cells compared with controls (Fig. 2B). The U-rich region represented by the 47-nt transcript contains two pentameric uridine motifs separated by 7 nucleotides (Fig. 1). Deletion of residues from the 5' end of the 47-nt transcript to form a 28-nt transcript, which contains both uridine pentamers, retained 50-kDa complex formation in both cytoplasmic and nuclear extracts (Fig. 2, B and C). Further deletion from the 5' end with removal of both pentameric uridine motifs to form a 23-nt transcript abolished complex formation in both nuclear and cytoplasmic extracts. A homologous 32-nt transcript (HSGLT; Fig. 1) consisting of nucleotides 1098-1129 from exon 15 of the human genomic SGLT1 sequence (GenBankTM accession number L29339) also exhibited IBMX-stimulated formation of the 50-kDa complex both in nuclear and cytoplasmic extracts from LLC-PK1 cells (Fig. 2, B and C). HSGLT contained both pentameric uridine motifs present in the wild-type porcine sequence but differed in flanking residues.

Additional deletions within the URE region established that of the two pentameric uridine motifs shown in the diagram in Fig. 1, only the 5' proximal one was necessary for 50-kDa complex formation. The 12-nt transcript (nucleotides 2620-2631), in which the 3' proximal pentameric uridine motif was deleted but the 5' proximal uridine pentamer was retained, represented the minimal sequence sufficient for IBMX-stimulated 50-kDa complex formation. The 41-, 38-, and 29-kDa transcripts, which lacked the 5' proximal uridine pentamer but contained the 3' proximal one, were not able to form the 50-kDa complex in either nuclear extracts (Fig. 2C) or cytoplasmic extracts (not shown). The 122-, 47-, 28-, and 19-nt transcripts, which contained both uridine pentamers, exhibited 50-kDa complex formation (Fig. 2). The 23- and 24-nt transcripts, which lacked both uridine pentamers, were ineffective in complex formation.

Protein binding required single-stranded sense RNA. The 50-kDa complex formation was observed using a sense 12-nt transcript (Fig. 2C) but not with the antisense 12-nt transcript or with double-stranded RNA annealed from sense and antisense 12-nt transcripts (not shown).

Specificity of RNA-Protein Complex Formation-- We had previously shown that binding of cytoplasmic proteins to the 435-nt 3UTR2 probe was reduced by addition of an excess of unlabeled specific competitor RNAs but not by nonspecific RNAs (10). Furthermore, binding to 3UTR2 was competed by poly(U) RNA but not by other ribohomopolymers (10). Fig. 3 demonstrates that binding of nuclear proteins to either the human HSGLT or porcine 47-, 28-, or 12-nt 32P-labeled probes is competitively inhibited by a 250-fold molar excess of unlabeled 47-, 28-, 19-, and 12-nt RNA transcripts, all of which contain sequence elements sufficient for 50-kDa RNA-protein complex formation. By contrast, a 250-fold molar excess of either of the unlabeled 41-, 23-, and 29-nt transcripts, which lack these recognition elements, did not compete for binding to these probes. Similar results were obtained using cytoplasmic extracts (not shown). These competitive interactions among RNA probes that contain the 5' uridine pentamer indicate that these probes recognize the same cellular factor. The inability of RNA probes lacking this uridine pentamer to competitively inhibit binding confirms the requirement for this motif in specific complex formation.


View larger version (44K):
[in this window]
[in a new window]
 
Fig. 3.   Competition analysis of 3'-UTR fragments. Unlabeled sense RNA competitors at 250-fold molar excess were preincubated for 15 min with a nuclear extract from IBMX-treated culture before addition of the indicated [alpha -32P]UTP-labeled RNA probe. Identical results were observed using a cytoplasmic extract (data not shown). -, no unlabeled RNA added.

A 250-fold molar excess of poly(U) RNA competitively inhibited 50-kDa complex formation with the 122-nt transcript in both nuclear and cytoplasmic extracts as well as binding of nuclear proteins to the 47- and 28-nt transcripts (Fig. 4). Poly(A), poly(C), and poly(G) were ineffective as competitors. These results indicate that uridine residues play an important role in complex formation in both the nucleus and cytoplasm.


View larger version (38K):
[in this window]
[in a new window]
 
Fig. 4.   Competition analysis of unlabeled ribohomopolymers with labeled 3'-UTR RNA fragments. Either cytoplasmic (A) or nuclear (B) extracts from cells treated with 1 mM IBMX for 96 h were preincubated 15 min with a 250-fold molar excess of the indicated unlabeled nucleotide ribohomopolymer. A, poly(A); U, poly(U); G, poly(G); C, poly(C). Then complex formation with the indicated [alpha -32P]UTP-labeled sense probes was tested using the UV cross-linking assay. -, no unlabeled RNA added.

Stimulation of Nuclear and Cytoplasmic Binding Activities-- We investigated the kinetics of activation of the URE binding activity in both nucleus and cytoplasm after treatment of confluent monolayers with IBMX for comparison with untreated control monolayers. Using either the 47-nt probe (Fig. 5A) or the 12-nt probe (Fig. 5B), 50-kDa complex formation in nuclear extracts was stimulated by IBMX within 1 h of addition and stimulation was maintained for 96 h. Similar results were obtained using nuclear extracts from forskolin-treated cells (Fig. 5C). In cytosolic extracts from control, untreated cells, a transient stimulation of complex formation was observed at time points up to 24 h after medium change, but complex formation was greatly diminished at later time points up to 96 h (Fig. 5, A and B). By contrast, in cytosolic extracts from IBMX-treated cells, complex formation, assayed with either the 47-nt (Fig. 5A) or the 12-nt (Fig. 5B) probes, was reproducibly maximal at 96 h relative to controls. Similar findings were obtained using the 122-nt probe (not shown). These findings indicate that PKA activation resulted in a rapid (<1 h) activation of binding activity in both the nucleus and cytoplasm, which is maintained up to 96 h.


View larger version (59K):
[in this window]
[in a new window]
 
Fig. 5.   Time course of 50-kDa complex formation in cytosolic and nuclear fractions after treatment with protein kinase activators. A and B, cytoplasmic and nuclear extracts from confluent cultures treated with 1 mM IBMX for the indicated times and untreated controls were assayed by UV-cross-linking with an [alpha -32P]UTP-labeled sense 47-nt probe (A) or 12-nt probe (B). C, confluent cultures were treated with 100 µM forskolin for the indicated times for comparison with untreated controls and cultures treated with 1 mM IBMX (I), before isolation of nuclear extracts and assay by UV cross-linking using the 47-nt probe. D, nuclear extracts from cultures treated with 0.1 µM TPA for the indicated times and untreated controls were assayed by UV cross-linking using the 47-nt probe.

Treatment of LLC-PK1 cells with 0.1 µM TPA results in rapid degradation of the SGLT1 message as a result of PKC activation (8). To investigate the possible role of the URE region in the SGLT1 3'-UTR in mediating PKC-stimulated SGLT1 message decay, we assayed RNA-protein complex formation in extracts from control and 0.1 µM TPA-treated cells using the 47-nt probe. At several exposure times, no significant difference in 50-kDa band intensity was observed between control and TPA-treated cells using nuclear extracts (Fig. 5D) or cytoplasmic extracts (not shown), nor were additional complexes detected. These observations indicate that TPA-mediated message destabilization is not associated with changes in protein binding to the URE.

Northwestern Blot Analysis-- In the above studies, protein binding was detected as a covalent complex with its cognate mRNA transcript. To directly identify cytoplasmic proteins that may have affinity for the SGLT1 URE, we carried out Northwestern blotting of proteins from control and IBMX-treated cells (Fig. 6). Proteins were resolved by SDS-polyacrylamide gel electrophoresis, transferred to nitrocellulose membranes, allowed to renature, and then incubated with 32P-labeled sense RNA probes. This method did not require ribonuclease digestion or UV cross-linking. Probe 3UTR2 and the 122-nt probe each recognized a 38-kDa protein and a 70-kDa protein that exhibited increased binding activity in IBMX-treated cell extracts (Fig. 6A). Another major band at 29 kDa was also observed. Probes of 47 nt and smaller were ineffective using this protocol because of technical difficulties in retaining label on the blot after washing. The 38- and 70-kDa bands detected in IBMX-treated cells were greatly reduced if cell extracts were treated with potato acid phosphatase before electrophoresis (Fig. 6B). Addition of the phosphatase inhibitor microcystin LR protected against these effects of phosphatase treatment (Fig. 6B).


View larger version (90K):
[in this window]
[in a new window]
 
Fig. 6.   Northwestern blot analysis of RNA-binding proteins. A, cytosolic extracts (60 µg) from control (C) or IBMX-treated (I) cells were resolved by SDS-PAGE using 12% acrylamide. Proteins were transferred to a nitrocellulose membrane and renatured overnight, as described under "Experimental Procedures." The membrane was hybridized with [alpha -32P]UTP-labeled sense 3UTR2 or 122-nt RNA probes as indicated and visualized by autoradiography. B, a cytosolic extract from IBMX-treated cells (I) was treated with 1 µg of potato acid phosphatase (PAP) in either the presence or absence of 10 nM phosphatase inhibitor microcystin LR (MICC-LR) prior to SDS-PAGE and Northwestern blot analysis using the 122-nt 32P-labeled RNA probe for detection. Results obtained using untreated cell extracts from cells grown in the absence of IBMX (C) are shown for comparison.

These observations identify a major cytoplasmic 38-kDa URE-binding protein that exhibits increased binding activity in IBMX-treated cells as well as a requirement for protein phosphorylation. A 50-kDa RNA-protein complex is detected by these probes in cytoplasmic extracts after UV cross-linking; the increased size represents the contribution of cross-linked RNA. A 50-kDa cross-linked complex is observed with probes ranging in size from 435 to 12 nt, suggesting that the same minimal protected size of bound RNA remains after T1 ribonuclease digestion.

Mutational Analysis of the Binding Site within the URE-- The importance of uridine residues and the 5' proximal uridine pentamer in RNA-protein binding suggested by competition and deletion analysis was further explored using mutational analysis. We tested whether one or both uridine pentamers is required for binding and whether the flanking nucleotide residues also play a role in binding specificity. Introduction of two U right-arrow G substitutions in the 5' proximal uridine pentamer corresponding to positions 2622-2623 in the SGLT1 sequence (mutant 28-nt m2) substantially reduced the amount of 50-kDa complex formed with either cytoplasmic (Fig. 7A) or nuclear (Fig. 7B) extracts, whereas the same substitution in the 3' proximal uridine pentamer (mutant 28-nt m5) had no discernable effect. A transcript containing these U right-arrow G substitutions in both pentamers (mutant 28-nt m3) also exhibited greatly reduced 50-kDa complex formation. Two U right-arrow G substitutions within the three uridine residues at the 5' end of the 28-nt probe (28 nt m1) had only minimal effect on complex formation (Fig. 7A). C right-arrow A substitution of one or both of the residues flanking the 3' proximal uridine pentamer (mutants 28-nt m4 and 28-nt m7) did not affect complex formation. Substitution of both flanking residues of the 3' proximal uridine pentamer from CUUUUUC right-arrow AUUUUUG, the same residues flanking the 5' proximal uridine pentamer, also did not affect complex formation (28-nt m6). Substitution of G and C residues flanking both uridine pentamers to A to create two AUUUUUA motifs (mutant 28-nt m7) similarly had no effect on complex formation. Substitution to C of both residues flanking the 5' proximal uridine pentamer (mutant 19-nt m3) had no appreciable effect (see Fig. 10B, bottom panel). Deletion of one uridine residue from the 5' proximal pentamer caused reduced complex formation (not shown).


View larger version (38K):
[in this window]
[in a new window]
 
Fig. 7.   Effect of mutations on RNA-protein complex formation. Either cytoplasmic (A) or nuclear (B) extracts from IBMX-treated cultures were analyzed by the UV cross-linking assay using the indicated [alpha -32P]UTP-labeled sense RNA mutant and wild-type 28-nt RNA transcripts. C, DEAE-cellulose column fractions 15 and 63 and the total nuclear extract (T) were assayed for RNA binding activity using the indicated wild-type and mutant [alpha -32P]UTP-labeled 28-nt RNA probes. D, wild-type and mutant 28-nt RNA sequences. Mutated bases are shown in bold type.

Nuclear extracts from IBMX-treated cells were fractionated by ammonium sulfate precipitation followed by DEAE-cellulose chromatography (Fig. 7C). Fractions were assayed using the UV cross-linking assay. Binding activity for the wild-type 28 nt probe (Fig. 7C) as well as the 47-, 19-, and 12-nt RNA probes (not shown) exhibited the same elution profile with peak activity in fraction 63. These results reinforced conclusions from competition studies that these probes recognized the same RNA-binding protein. Probe 28-nt m7, which contained two AUUUUUA motifs, also exhibited peak binding in fraction 63 (Fig. 7C). Probe 28-nt m2 did not show binding activity in any fraction (not shown), consistent with its inability to bind proteins in the total cell extract.

Taken together, our results indicate that the 5' proximal uridine pentamer is critical for protein recognition but that the nucleotides immediately flanking it do not appear to contribute to binding specificity. Furthermore, these mutation data reinforce conclusions from deletion analysis in Fig. 2 that the 3' proximal uridine pentamer is not essential for 50-kDa complex formation with either cytoplasmic or nuclear extracts.

Using increased electrophoretic resolution and a 120-nt RNA transcript encompassing nucleotides 2576-2695, 50- and 57-kDa cross-linked complexes were observed in both nuclear and cytoplasmic extracts, and two additional major complexes of 68 and 120 kDa were observed using nuclear extracts (Fig. 8). Because the 120-nt transcript recognized multiple nuclear proteins, we introduced the same UU right-arrow GG substitution present in 28-nt m2 to create mutant transcript 120-nt m2. Both cytoplasmic and nuclear 50-kDa complex formation were abolished in 120-nt m2. This mutation did not affect the formation of the nuclear 57-kDa complex but did reduce formation of the larger nuclear complexes.


View larger version (52K):
[in this window]
[in a new window]
 
Fig. 8.   Effect of mutation and secondary structure on protein binding to the URE. A, cytosolic (µg) and nuclear (µg) extracts from either control (C) or IBMX-treated (I) cultures were assayed using the UV cross-linking assay and wild-type and mutant 120-nt probes. Probe 120-nt m2 contained a UU right-arrow GG substitution corresponding to nucleotides 2622-2623 in the porcine SGLT1 sequence. B, the 120-nt probe was boiled for 10 min and then either cooled on ice (QC) or allowed to renature for 30 min at room temperature (SC) before assay of binding activity at 16 °C. using the UV cross-linking assay. RT, probe was not boiled but incubated for 30 min at room temperature before assay.

Binding activity of the wild-type and mutant 120-nt transcripts was also compared in the absence of cross-linking using electrophoretic mobility shift assay in nondenaturing gels (Fig. 9). This analysis permits the detection of multi-protein complexes and avoids possible artifacts because of sequence requirements for UV-catalyzed cross-linking. At least five major complexes were observed in nuclear extracts from IBMX-treated cells using the wild-type 120-nt probe but only one major complex using the 120-nt m2 probe.


View larger version (95K):
[in this window]
[in a new window]
 
Fig. 9.   Analysis of RNA-protein complexes formed with wild-type and mutant probes assayed by electrophoretic band shift in nondenaturing gels. Cytosolic (25 µg) and nuclear (15 µg) extracts from either control (C) or IBMX-treated (I) cultures were incubated with the indicated 32P-labeled RNA probes, unprotected RNA was digested with ribonuclease T1, and then labeled complexes were analyzed without UV cross-linking on nondenaturing 6% polyacrylamide gels as described previously (35). Probe, no extract added.

Effect of Secondary Structure-- The possible role of secondary structure of the 120-nt RNA transcript in protein binding activity was tested by boiling the probe for 10 min and then either quickly cooling it on ice or slowly cooling it for 30 min at room temperature before assay of binding activity using nuclear extracts (Fig. 8B). Because it was necessary to assay binding activity at 16 °C instead of room temperature to prevent renaturation during assay, an alteration in the relative band intensities is observed in the control sample at the lower assay temperature. These results indicate that when renaturation of the RNA transcript was slowed by quick cooling, binding activity was greatly reduced, indicating a requirement for RNA secondary structure in protein recognition.

Isolation of RNA-binding Proteins Using a Specific Biotinylated RNA-- The 19-nt probe was double-labeled with 32P and biotin by in vitro transcription in the presence of both [alpha -32P]UTP and biotin-14 CTP and tested using the UV cross-linking assay (Fig. 10C). Biotinylation did not affect the ability of this probe to form the 50-kDa complex. However, attempts to use the wild-type 19-nt probe for affinity purification on streptavidin-conjugated beads were hindered by degradation of the probe in the presence of nuclear extracts. However, probe 19-nt m3, which contains two C substitutions flanking the uridine pentamer, also exhibits 50-kDa complex formation unaffected by biotinylation (Fig. 10, B and C) but is much more resistant to degradation. Unlabeled biotinylated 19-nt m3 probe was able to competitively inhibit binding of 32P-labeled unbiotinylated and biotinylated wild-type 19-nt and 19-nt m3 probes (Fig. 10C), indicating that the same protein was recognized.


View larger version (32K):
[in this window]
[in a new window]
 
Fig. 10.   Isolation of a 38-kDa protein using a specific biotinylated RNA probe and streptavidin-coated magnetic particles. A, precleared nuclear extracts from LLC-PK1 cells treated with IBMX for 72 h and biosynthetically labeled with 35S were incubated with the indicated biotin-14-CTP-labeled RNA probes bound to streptavidin-conjugated magnetic particles as described under "Experimental Procedures." Proteins eluted from the RNA-bead complex by boiling 5 min in SDS sample buffer were resolved by 12% SDS-PAGE. T, total nuclear extract; P, precleared nuclear extract; N, nonspecific binding of protein to streptavidin magnetic beads in the absence of RNA; S, supernatant after specific probe binding; B-28 m2, proteins bound to biotin-14-CTP-labeled 28-nt m2 RNA probe complexed with streptavidin particles; B-19 m3, proteins bound to biotin-14-CTP-labeled 19-nt m3 RNA probe complexed with streptavidin particles. B, UV cross-linking assay of nuclear extracts from either control (C) or IBMX-treated (I) cells using 32P-labeled 19-nt or 19-nt m3 RNA probes. C, 35S-labeled nuclear extracts were preincubated 15 min with or without addition of a 250-fold molar excess of unlabeled biotin-14-CTP-labeled 19-nt m3 RNA probe before UV-cross-linking analysis using either [alpha -32P]UTP-labeled (32P) or biotin-CTP/[alpha -32P]UTP double-labeled (32P/biotin) 19-nt wild-type or 19-nt m3 RNA probe.

Nuclear extracts were prepared from IBMX-treated cells biosynthetically labeled with [35S]methionine. Fig. 10A demonstrates that an 35S-labeled band (indicated by arrow) with an apparent molecular mass of 38 kDa was bound to biotinylated probe 19-nt m3. The estimated 38-kDa size of this band agrees with that obtained by Northwestern blot analysis of cytoplasmic extracts. A 27-kDa band was also eluted. A 27-kDa band was also noted by Northwestern blot (Fig. 6) and appears to represent the protein component of a 28-kDa RNA-protein complex formed in extracts from control cultures not treated with IBMX (10). The 28-kDa complex is down-regulated after IBMX treatment and recognizes the same 12-nt minimal RNA-binding site shown in Fig. 1 as shown by deletion analysis. These bands were not observed in the absence of RNA or using a biotinylated probe 28-nt m2, which, as shown in Fig. 7, does not bind the 38-kDa protein. A number of higher molecular mass bands were eluted that represent nonspecific binding to the bead because they are observed in the absence of added RNA (lane N).

The 3UTR2 Sequence (Bases 2263-2697) Contains Both Destabilizing Elements and PKA-dependent Stabilizing Elements-- To demonstrate the obligatory role of the URE region of the SGLT1 3'-UTR in regulating message stability in response to PKA activation, we utilized tetracycline-regulated expression of beta -globin mRNA as a reporter message (Fig. 11). The stable beta -globin message has been extensively used to analyze regulation of mRNA turnover by AU-rich sequence elements in various proto-oncogenes, lymphokines and cytokine 3'-UTRs (18). Test sequences are inserted into the unique BglII site located at the junction of the beta -globin translated and 3'-untranslated regions in plasmid pTet-BBB (15). pTet-BBB encodes a beta -globin minigene containing two introns and three exons. Transcription from this vector under the control of the tetracycline-regulated promoter (tet-OFF) in the presence of a tetracycline-regulated transcriptional activator is switched on in the absence of tetracycline, yielding a chimeric beta -globin mRNA. Transcription is rapidly switched off after the addition of tetracycline, permitting the analysis of RNA decay properties and half-life. This system offers important advantages over the use of actinomycin D to block transcription because tetracycline does not affect cell physiology or influence transcription of endogenous cellular mRNAs. Actinomycin D has been reported to influence mRNA decay rates (19) and the nucleocytoplasmic distribution of RNA-binding proteins such as HuR (20). Furthermore other inducible promoter systems such as c-fos require serum induction conditions that may influence the evaluation of cell signaling effects on message decay.


View larger version (48K):
[in this window]
[in a new window]
 
Fig. 11.   A mutation that prevents protein binding also prevents IBMX-stimulated stabilization of chimeric URE-globin mRNAs assayed in vivo. LLC-TAK-B7 cells, a clonal line of LLC-PK1 cells stably transfected with the tetracycline-regulated transactivator pTA, were transiently transfected with the indicated pTet-BBB construct as described under "Experimental Procedures." Washed monolayers were switched to medium containing 30 ng/ml tetracycline and 500 µg/ml G418 with (I) or without (C) 1 mM IBMX for 24 h. A pulse of beta -globin mRNA synthesis was then initiated by removal of tetracycline for 15 h in the presence and absence of 1 mM IBMX. Then transcription was terminated by addition of 500 ng/ml tetracycline, and cells were harvested at the indicated times for isolation of cytoplasmic RNA. Samples were analyzed by Northern blot with quantitation by a PhosphorImager. Blots were sequentially hybridized with riboprobes for beta -globin and GAPDH mRNA. For half-life determinations, beta -globin mRNA values were normalized to GAPDH. Open circles, IBMX-treated; filled circles, control; uninduced, cells were maintained in the presence of tetracycline to prevent expression. Poly(A)- RNA was prepared by treating an aliquot of the zero time RNA sample with oligo(dT) and ribonuclease H to remove the poly(A) tail. Estimated molecular mass values of the transcripts at zero time were: pTet-BBB, 1 kb; pTet-BBB + UTR2, 1.45 kb. Values for the poly(A)- samples were: pTet-BBB, 0.75 kb; pTet-BBB + UTR2, 1.2 kb.

To optimize and standardize tetracycline regulation of transcription, the tetracycline-regulated transactivator plasmid pTet-pTA was stably transfected into LLC-PK1 clone G8 cells by co-transfection with a plasmid encoding a neomycin resistance gene. Stable transfectants were selected using G418 and cloned by single-cell plating. Clonal lines were screened for tetracycline-regulated expression of a transiently transfected plasmid pUHC13-3 in which luciferase transcription is under the regulation of the tetracycline-regulated promoter. A cell line LLC-TAK-B7 was chosen as host cell line for these studies based on its 50-fold increase in luciferase expression after removal of tetracycline.

The 3UTR2 region of the SGLT1 3'-UTR was inserted into the BglII site of pTet-BBB to construct pTet-BBB + 3UTR2. Plasmids were transiently transfected into LLC-TAK-B7 cells. After 24 h, beta -globin expression was induced by removal of tetracycline. After 15 h of expression in the presence and absence of 1 mM IBMX as indicated, transcription was terminated by addition of tetracycline, and the kinetics of mRNA decay were determined by Northern blot analysis of total cytoplasmic RNA using hybridization with a beta -globin riboprobe. Data were normalized to levels of GAPDH mRNA. Results shown in Fig. 11 indicate that beta -globin mRNA transcribed from pTet-BBB decayed with a half-life of 7.2 h in the absence of IBMX and 7.6 h in the presence of IBMX. Although known to be cell line-dependent, these values compare favorably with the value of 8 h reported for beta -globin mRNA half-life in 3T3 cells (18) and indicate that IBMX treatment does not significantly influence beta -globin mRNA decay. Introduction of the 3UTR2 sequence into beta -globin mRNA (pTet-BBB + 3UTR2) and transfection into control cells not treated with IBMX resulted in destabilization of the chimeric reporter message, which decayed with a half-life of 3.7 h (Fig. 11). The destabilizing effect of the 3UTR2 sequence was prevented in IBMX-treated cultures, which exhibited a half-life for decay of the beta -globin/3UTR2 chimeric message of 7.1 h (Fig. 11). These results indicate that the 435-nt 3UTR2 region contains both destabilizing sequences and sequences that convey PKA-mediated stability in the presence of these destabilizing sequences.

The 47-nt region (bases 2597-2643) was similarly inserted into the BglII site of pTet-BBB to form pTet-BBB + 47 nt. This construct was transfected into LLC-TAK-B7 cells, and the decay rates of the resulting chimeric message were determined. Results shown in Fig. 12 indicate that in control cells in the absence of IBMX treatment, these sequences did not appreciably destabilize beta -globin mRNA (t1/2 = 15.3 h) compared with the pTet-BBB control (t1/2 = 7.2 h). In fact, the 47-nt sequence exerted a measurable stabilization effect. Therefore, the destabilizing effect associated with the 435-nt 3UTR2 sequence in control cells presumably is localized outside the 47-nt URE region. However, the possibility exists that secondary structure requirements for destabilization are not present in the 47-nt sequence.


View larger version (29K):
[in this window]
[in a new window]
 
Fig. 12.   Decay of chimeric beta -globin/URE mRNA in untreated cells. Cells were transiently transfected with either pTet-BBB or pTet-BBB + 47-nt and RNA decay rates measured as described in the legend to Fig. 11 except no IBMX treatment was carried out. Filled circles, pTet-BBB; filled triangles, pTet-BBB + 47-nt. U, cells were maintained in the presence of tetracycline to prevent expression.

Bases 2622-2623 Are Critical for IBMX-stimulated Message Stabilization-- To directly demonstrate the involvement of the 38-kDa RNA-binding protein in IBMX-stimulated message stabilization, a UU right-arrow GG substitution at bases 2622-2623 was introduced into the 3UTR2 sequence and then inserted into pTet-BBB to generate pTet-BBB + 3UTR2 m2. This same mutation in 28-nt m2 and 122-nt m2 probes was shown to prevent binding of the 38-kDa protein assayed either by UV cross-linking or band shift in nondenaturing gels (Figs. 7-9). Analysis of decay kinetics after transient transfection of these constructs demonstrated that the chimeric beta -globin/3UTR2 m2 mRNA decayed with a similar half-life in control (t1/2 = 5.3 h) and IBMX-treated (t1/2 = 5.5 h) cells (Fig. 11). These results provide evidence that a mutation that prevents binding of the 38-kDa protein to its cognate site also blocks PKA-mediated message stabilization. Taken together, these findings indicate that binding of this protein is necessary although possibly not sufficient for PKA-mediated message stabilization.

    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

The targeted decay or stabilization of specific mRNAs in response to cell signaling pathways, in combination with transcriptional control, is a powerful means to rapidly and selectively modulate steady-state mRNA levels in adaptation to changes in the cell growth state or environment. Native SGLT1 mRNA transcripts containing a 1.7-kb 3'-UTR are 8-fold less stable compared with transcripts lacking the 3'-UTR, indicating the presence of destabilizing sequences within the 3'-UTR region (9). The SGLT1 3'-UTR also contains a cAMP-dependent regulatory sequence because elevation of cAMP levels led to an 8-fold increase in the half-life of transcripts containing the 3'-UTR, a value that correlated quantitatively with a similar increase in steady-state levels of both the transporter protein subunit and the message (9). Message stabilization correlated with increased protein binding to a URE in the 3'-UTR (10). The studies presented here provide further insight into this mechanism. Mutational analysis of the minimal binding site within the URE identified a uridine pentamer essential both for cyclic nucleotide-dependent protein binding assayed in vitro and for cyclic nucleotide-dependent stabilization of a reporter message assayed in vivo. A 38-kDa nucleocytoplasmic protein that specifically binds this site in a PKA-stimulated, protein phosphorylation-dependent manner was identified by Northwestern blot analysis as well as by affinity purification using a specific biotinylated RNA. These studies provide direct evidence that binding of this protein to its site in the URE is necessary for cyclic nucleotide-dependent message stabilization. Furthermore, our results suggest that the cAMP regulatory element within the 3'-UTR recognized by this protein is distinct from sequences that promote destabilization. Binding activity was predominantly found in the nucleus although also present in the cytoplasm, suggesting a role in both cellular compartments.

A complex interaction between cis-acting sequences within the message coding or noncoding regions and trans-acting protein factors in the nucleus and cytoplasm has been implicated in regulating the decay of a number of different mRNAs (21). However, there is currently no information on how this interaction influences mRNA degradation or how the process is regulated. Evidence that ongoing translation is required for destabilization has been reported in certain cases (22, 23). Poly(A) shortening initiates mRNA degradation (21), and deadenylation is subject to regulation by cis-acting sequences in the 3'-UTR (24).

Although much attention has focused on the role of AU-rich RNA destabilizing elements that are present in the 3'-UTRs of many labile transiently expressed RNAs such as those encoding proto-oncogenes, lymphokines, and cytokines (18), a much wider diversity of mRNAs is subject to post-transcriptional regulation. Examples of stabilization or destabilization of specific mRNAs by PKA (25-27) or PKC activation (8, 28, 29) have been described, but the sequences and trans-acting factors that mediate stability regulation have been identified in only a few cases. The involvement of specific RNA-binding proteins in regulated mRNA turnover has been inferred from indirect correlative evidence. The proteins were shown, using RNA gel mobility shift or UV catalyzed RNA-protein cross-linking, to bind in vitro to mRNA sequences that conferred altered stability in vivo when inserted into reporter genes and transfected into cells. Several proteins meeting these criteria have been purified, and their cDNAs have been cloned (30-32). In the case of HuR (33, 34) and HnRNP D (35), ectopic overexpression of their cDNAs was shown to alter decay of a reporter globin message containing their cognate binding site. However, interpretation of these studies is not unequivocal because protein overexpression could alter decay by nonphysiological means, e.g. by saturating the decay machinery, activating low affinity or nonspecific pathways, or altering the normal nucleocytoplasmic distribution. Interestingly, in vivo UV cross-linking failed to detect binding of hnRNP D to poly(A)+ RNA, although HuR binding was detected (36). Agonist destabilization of hamster beta -adrenergic receptor mRNA was disrupted by point mutations that prevented protein binding to an AU-rich region in its 3'-UTR (37); these proteins were subsequently identified as hnRNP A1 and HuR (38). However, hnRNP A1 has been shown to bind an unusually diverse array of RNA sequences (39), whereas HuR has typically been implicated in message stabilization rather than destabilization (33).

Sequence analysis of the 3'-UTRs of a wide variety of orthologous genes revealed stretches of 100 nucleotides or more that were highly conserved for over 300 million years of evolution, suggesting an essential function (40, 41). Porcine and human SGLT1 3'-UTRs exhibit 75% nucleotide sequence identity, a value comparable with that of their coding regions. An RNA transcript based on the homologus region in the human SGLT1 gene also recognized the same binding activity in LLC-PK1 cell extracts and contained the pentameric uridine motif, indicating that human SGLT1 may be regulated by a similar mechanism.

In addition to a demonstrated role in regulating mRNA stability, the 3'-UTR has been implicated in regulating mRNA translation efficiency (42). This may be mediated by interaction of the poly(A) tail and its poly(A)-binding protein with the initiation factor eIF4G in the cap-binding protein complex via a loop structure (43), as demonstrated by studies in yeast (44) and mammalian cells (45). The poly(A)-binding protein shuttles between the nucleus and cytoplasm and may play a role in transport of mRNP particles to the cytoplasm (46).

The identity of the 38-kDa RNA-binding protein described here is unknown. We have detected nuclear and cytoplasmic proteins that form a 50-kDa complex with our 47-nt probe in a wide variety of cell lines that do not express SGLT1 including COS cells, MDCK cells and 3T3 cells, suggesting a wider role. The cis-acting sequences described in this report differ from those described in the 3'-UTR of other messages whose stability is regulated by cAMP. Agonist destabilization of the beta -adrenergic receptor mRNA was associated in hamster with protein binding to a 20-nt AU-rich sequence containing an AUUUUA motif flanked by U-rich regions (37) and in human with binding to an AU-rich nonamer UAAUAUAUU (47). Cyclic nucleotide destabilization of type-1 plasminogen activator-inhibitor mRNA was associated with a predominantly A-rich sequence (26), whereas a C-rich sequence was implicated in leutinizing hormone/human chorionic gonadotropin receptor mRNA regulation (48). The cAMP-regulated stabilizing region in the lactate dehydrogenase-A 3'-UTR was identified as AUAUUUUCUGUAUUAUAUGUGU (49). A search of sequence data bases for sequences matching the consensus 12-nt minimal cis-acting sequence identified in our study revealed that it occurs rarely, nor was it found in other cAMP-regulated messages. Our observation that protein binding to the 120-nt fragment is secondary structure-dependent suggests that a search for potential binding sites in other messages involves more than the simple presence of short primary sequence motifs. A requirement for specific hairpin loop structures for RNA-protein binding has been noted for many mRNAs, notably the iron-responsive elements (50), where a combinatorial approach has been used to select stem-loop structures with high affinity for iron regulatory factor. A combinatorial approach has also been used to select AU-rich element consensus sequences (51).

Both nuclear and cytoplasmic binding activities were rapidly activated within 1 h of addition of IBMX or forskolin and were abolished by phosphatase treatment. These observations suggest that binding of the 38-kDa protein to the URE is dependent on nuclear and cytoplasmic protein phosphorylation events triggered by PKA. Addition of the purified PKA catalytic subunit to unstimulated cell extracts in the presence of substrates did not activate 50-kDa complex formation, suggesting that the 38-kDa protein is not phosphorylated directly by PKA but rather is activated by a protein kinase cascade triggered by PKA. It is possible that binding of the 38-kDa protein to the SGLT1 URE is initiated in the nucleus and accompanies the message to the cytoplasm, providing continuous protection from the cellular decay machinery. Efforts are currently underway to determine the identity of the 38-kDa protein and other components of the multiprotein complex and to elucidate their individual role in nuclear and cytoplasmic events that regulate the stability and translatability of the SGLT1 message.

    ACKNOWLEDGEMENT

We thank Dr. Ann-Bin Shyu for the tet-BBB plasmid and helpful advice.

    FOOTNOTES

* This work was supported by Grant DK27400 from the National Institutes of Health.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Dagger To whom correspondence should be addressed: Dept. of Biochemistry and Molecular Biology, University of Texas-Houston Medical School, P.O. Box 20708, Houston, TX 77225. Tel.: 713-500-6055; Fax: 713-500-0652; E-mail: Julia.E.Lever@uth.tmc.edu.

Published, JBC Papers in Press, August 18, 2000, DOI 10.1074/jbc.M005040200

    ABBREVIATIONS

The abbreviations used are: SGLT, Na+-coupled glucose transporter; PKA, protein kinase A; PKC, protein kinase C; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; IBMX, 3-isobutyl-1-methylxanthine; TPA, phorbol 12-O-tetradecanoate 13-acetate; UTR, untranslated region; URE, U-rich element; nt, nucleotide(s); DTT, dithiothreitol; bp, base pair(s); PAGE, polyacrylamide gel electrophoresis; kb, kilobase(s).

    REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

1. Wright, E. M., Hager, K. M., and Turk, E. (1992) Curr. Opin. Cell Biol. 4, 696-702
2. Silverman, M. (1991) Annu. Rev. Biochem. 60, 757-794
3. Lee, W. S., Kanai, Y., Wells, R. G., and Hediger, M. A. (1994) J. Biol. Chem. 269, 12032-12039
4. Dominguez, J. H., Song, B., Maianu, L., Garvery, W. T., and Qulali, M. (1994) J. Am. Soc. Nephrol. 5, S29-S36
5. Amsler, K., and Cook, J. S. (1982) Am. J. Physiol. 242, C94-C101
6. Ohta, T., Isselbacher, K. J., and Rhoads, D. B. (1990) Mol. Cell. Biol. 10, 6491-6499
7. Yet, S. F., Kong, C. T., Peng, H., and Lever, J. E. (1994) J. Cell. PhysioL. 158, 506-512
8. Shioda, T., Ohta, T., Isselbacher, K. J., and Rhoads, D. B. (1994) Proc. Natl. Acad. Sci. U. S. A. 91, 11919-11923
9. Peng, H., and Lever, J. E. (1995) J. Biol. Chem. 270, 20536-20542
10. Peng, H., and Lever, J. E. (1995) J. Biol. Chem. 270, 23996-24003
11. Peng, H., and Lever, J. E. (1993) J. Cell. Physiol. 154, 238-247
12. Schreiber, E., Matthias, P., Muller, M. M., and Schaffner, W. (1989) Nucleic Acids Res. 17, 6419
13. Atkins, R. E., and Tuen, R. S. (1992) BioTechniques 12, 496-499
14. You, Y., Chen, C. Y., and Shyu, A. B. (1992) Mol. Cell. Biol. 12, 2931-2940
15. Xu, N., Loflin, P., Chen, C. Y., and Shyu, A. B. (1998) Nucleic Acids Res. 26, 558-565
16. Shyu, A. B., Belasco, J. G., and Greenberg, M. E. (1991) Genes Dev. 5, 221-231
17. Maniatis, T., Fritsch, E. F., and Sambrook, J. (1989) Molecular Cloning: A Laboratory Manual , 2nd Ed. , Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
18. Chen, C. Y., and Shyu, A. B. (1995) Trends Biochem. Sci. 20, 465-470
19. Greenberg, M. E., Hermanowski, A. L., and Ziff, E. B. (1986) Mol. Cell. Biol. 6, 1050-1057
20. Fan, X. C., and Steitz, J. A. (1999) Proc. Natl. Acad. Sci. U. S. A. 96, 5-7
21. Jacobson, A., and Peltz, S. W. (1996) Annu. Rev. Biochem. 65, 693-739
22. Aharon, T., and Schneider, R. J. (1993) Mol. Cell. Biol. 13, 1971-1980
23. Savant-Bhonsale, S., and Cleveland, D. W. (1992) Genes Dev. 6, 1927-1939
24. Wickens, M., Anderson, P., and Jackson, R. J. (1997) Curr. Opin. Genet. Dev. 7, 220-232
25. Chen, M., Schnermann, J., Smart, A. M., Brosius, F. C., Killen, P. D., and Briggs, J. P. (1993) J. Biol. Chem. 268, 24138-24144
26. Tillmann-Bogush, M., Heaton, J. H., and Gelehrter, T. D. (1999) J. Biol. Chem. 274, 1172-1179
27. Kaestner, K. H., Flores-Riveros, J. R., McLenithan, J. C., Janicot, M., and Lane, M. D. (1991) Proc. Nat. Acad. Sci. U. S. A. 88, 1933-1937
28. Short, S., Tian, D., Short, M. L., and Jungmann, R. A. (2000) J. Biol. Chem. 275, 12963-12969
29. Huang, D., Hubbard, C. J., and Jungmann, R. A. (1995) Mol. Endocrinol. 9, 994-1004
30. Ma, W. J., Cheng, S., Campbell, C., Wright, A., and Furneaux, H. (1996) J. Biol. Chem. 271, 8144-8151
31. Myer, V. E., Fan, X. C., and Steitz, J. A. (1997) EMBO J. 16, 2130-2139
32. Zhang, W., Wagner, B. J., Ehrenman, K., Schaefer, A. W., DeMaria, C. T., Crater, D., DeHaven, K., Long, L., and Brewer, G. (1993) Mol. Cell. Biol. 13, 7652-7665
33. Fan, X. C., and Steitz, J. A. (1998) EMBO J. 17, 3448-3460
34. Peng, S. S., Chen, C. Y., Xu, N., and Shyu, A. B. (1998) EMBO J. 17, 3461-3470
35. Loflin, P., Chen, C.-Y., and Shyu, A. B. (1999) Genes Dev. 13, 1884-1897
36. Gallouzi, I. E., Brennan, C. M., Stenberg, M. G., Swanson, M. S., Eversole, A., Maizels, N., and Steitz, J. A. (2000) Proc. Natl. Acad. Sci. U. S. A. 97, 3073-3078
37. Tholanikunnel, B. G., and Malbon, C. C. (1997) J. Biol. Chem. 272, 11471-11478
38. Blaxall, B. C., Pellett, A. C., Wu, S. C., Pende, A., and Port, J. D. (2000) J. Biol. Chem. 275, 4290-4297
39. Abdul-Manan, N., and Williams, K. R. (1996) Nucleic Acids Res. 24, 4063-4070
40. Spicher, A., Guicherit, O. M., Duret, L., Aslanian, A., Sanjines, E. M., Denko, N. C., Giaccia, A. J., and Blau, H. M. (1998) Mol. Cell. Biol. 18, 7371-7382
41. Duret, L., and Bucher, P. (1997) Curr. Opin. Struct. Biol. 7, 399-406
42. Yang, Q., McDermott, P. J., Duzic, E., Pleij, C. W., Sherlock, J. D., and Lanier, S. M. (1997) J. Biol. Chem. 272, 15466-15473
43. Tarun, S. Z., Jr., Wells, S. E., Deardorff, J. A., and Sachs, A. B. (1997) Proc. Natl. Acad. Sci. U. S. A. 94, 9046-9051
44. Tarun, S. Z., Jr., and Sachs, A. B. (1996) EMBO J. 15, 7168-7177
45. Le, H., Tanguay, R. L., Balasta, M. L., Wei, C. C., Browning, K. S., Metz, A. M., Goss, D. J., and Gallie, D. R. (1997) J. Biol. Chem. 272, 16247-16255
46. Afonina, E., Stauber, R., and Pavlakis, G. N. (1998) J. Biol. Chem. 273, 13015-13021
47. Danner, S., Frank, M., and Lohse, M. J. (1998) J. Biol. Chem. 273, 3223-3229
48. Kash, J. C., and Menon, K. M. J. (1998) J. Biol. Chem. 273, 10658-10664
49. Tian, D., Huang, D., Short, S., Short, M. L., and Jungmann, R. A. (1998) J. Biol. Chem. 273, 24861-24866
50. Henderson, B., Menotti, E., Bonnard, C., and Kuhn, L. (1994) J. Biol. Chem. 269, 17481-17489
51. Gao, F. B., Carson, C. C., Levine, T., and Keene, J. D. (1994) Proc. Natl. Acad. Sci. U. S. A. 91, 11207-11211


Copyright © 2000 by The American Society for Biochemistry and Molecular Biology, Inc.
Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
J. P. Katz, N. Perreault, B. G. Goldstein, H.-H. Chao, R. P. Ferraris, and K. H. Kaestner
Foxl1 null mice have abnormal intestinal epithelia, postnatal growth retardation, and defective intestinal glucose uptake
Am J Physiol Gastrointest Liver Physiol, October 1, 2004; 287(4): G856 - G864.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. R. McMullen, E. Cocuzzi, M. Hatzoglou, and L. E. Nagy
Chronic Ethanol Exposure Increases the Binding of HuR to the TNF{alpha} 3'-Untranslated Region in Macrophages
J. Biol. Chem., October 3, 2003; 278(40): 38333 - 38341.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
D. C. Mitchell and N. H. Ing
Estradiol Stabilizes Estrogen Receptor Messenger Ribonucleic Acid in Sheep Endometrium via Discrete Sequence Elements in Its 3'-Untranslated Region
Mol. Endocrinol., April 1, 2003; 17(4): 562 - 574.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
I. Yaman, J. Fernandez, B. Sarkar, R. J. Schneider, M. D. Snider, L. E. Nagy, and M. Hatzoglou
Nutritional Control of mRNA Stability Is Mediated by a Conserved AU-rich Element That Binds the Cytoplasmic Shuttling Protein HuR
J. Biol. Chem., October 25, 2002; 277(44): 41539 - 41546.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
T. Korn, T. Kuhlkamp, C. Track, I. Schatz, K. Baumgarten, V. Gorboulev, and H. Koepsell
The Plasma Membrane-associated Protein RS1 Decreases Transcription of the Transporter SGLT1 in Confluent LLC-PK1 Cells
J. Biol. Chem., November 21, 2001; 276(48): 45330 - 45340.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
275/43/33998    most recent
M005040200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lee, W. Y.
Right arrow Articles by Lever, J. E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lee, W. Y.
Right arrow Articles by Lever, J. E.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2000 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement