|
Originally published In Press as doi:10.1074/jbc.M005040200 on August 18, 2000
J. Biol. Chem., Vol. 275, Issue 43, 33998-34008, October 27, 2000
Cyclic Nucleotide Regulation of Na+/Glucose
Cotransporter (SGLT1) mRNA Stability
INTERACTION OF A NUCLEOCYTOPLASMIC PROTEIN WITH A REGULATORY
DOMAIN IN THE 3'-UNTRANSLATED REGION CRITICAL FOR
STABILIZATION*
Wha Young
Lee,
Paul
Loflin,
Constance J.
Clancey,
Hua
Peng, and
Julia E.
Lever
From the Department of Biochemistry and Molecular Biology,
University of Texas-Houston Medical School, Houston, Texas 77225
Received for publication, June 12, 2000, and in revised form, August 14, 2000
 |
ABSTRACT |
Expression of the Na+-coupled
glucose cotransporter SGLT1 is regulated post-transcriptionally at the
level of mRNA stability. We have previously demonstrated that
cAMP-dependent stabilization of the SGLT1 message was
correlated with the protein phosphorylation-dependent binding of cytoplasmic proteins to a uridine-rich sequence (URE) in the
3'-untranslated region (UTR). In the present study, the regulatory role
of the URE was demonstrated by inserting it into the 3'-UTR of a
-globin reporter minigene under the control of the
tetracycline-regulated promoter. The resultant chimeric globin/SGLT1 mRNA expressed after transfection into LLC-PK1 cells exhibited a
decreased half-life compared with the -globin control, indicating that the URE serves a destabilizing function. Activation of protein kinase A stabilized the chimeric message but not the -globin control, indicating the presence of a regulatory stabilizing sequence within the URE. A 38-kDa nucleocytoplasmic protein was identified that
recognized a 12-nucleotide binding site within the URE. A mutation in this binding site that prevented protein binding assayed in vitro by UV cross-linking also prevented protein kinase
A-dependent stabilization of the chimeric message assayed
in vivo. These findings identify the interaction between a
38-kDa nucleocytoplasmic protein and a regulatory uridine-rich sequence
in the 3'-UTR as critical for cAMP-mediated SGLT1 message stabilization.
 |
INTRODUCTION |
Glucose is the major carbon and energy source for eukaryotic
cells. Transport of glucose into mammalian cells is the rate-limiting step for its utilization and accordingly is a highly regulated process.
Maintenance of a constant blood glucose level is essential for cellular
homeostasis. In kidney, glucose is reabsorbed from the urinary filtrate
by the action of several types of glucose transporters arranged in
series along the proximal tubule. These function together in polarized
epithelial cells to mediate transepithelial transport of glucose.
SGLT1
(Na+/glucose) cotransporters in the apical membrane
catalyze active glucose transport into the cell driven by the
Na+ gradient (1). Glucose diffuses passively out of the
cell into the circulation via basolateral GLUT facilitative
transporters (2). High affinity glucose transporters SGLT1 and GLUT1
located in late proximal tubule scavenge the remainder of filtered
glucose not reabsorbed in early proximal tubule (3). SGLT1 is also expressed in small intestine where it mediates absorption of dietary glucose and galactose (3, 4).
Most of our current information concerning the regulation of SGLT1
expression has been obtained from studies using the polarized epithelial cell line LLC-PK1, derived from porcine kidney
(5). SGLT1 is expressed in this cell line as shown by cDNA cloning and Northern blot analysis (6) and is highly regulated by the cell
growth and differentiation state (5, 7, 8). Protein kinase A (PKA) and
protein kinase C (PKC) exert opposing effects on SGLT1 mRNA
stability and steady-state levels in confluent cultures. Activation of
PKA results in SGLT1 message stabilization (9), whereas PKC activation
by phorbol esters such as phorbol 12-O-tetradecanoate 13-acetate (TPA) results in rapid degradation of the SGLT1 message (8).
PKA-stimulated message stabilization was associated with a protein
phosphorylation-dependent binding of cytoplasmic protein(s) to a uridine-rich sequence (URE) in the 3'-UTR (10). Changes in SGLT1
mRNA half-life elicited by PKA activation correlate well with
changes in steady-state levels of the transporter (9), indicating that
message stability is a major determinant of expression level.
In the present study, we identify a cis-regulatory domain
within the URE of the SGLT1 mRNA 3'-UTR that binds a 38-kDa
nucleocytoplasmic protein and is required for PKA-mediated
stabilization of this message. Our approach was to map the minimal
protein-binding site using an in vitro assay of
PKA-stimulated RNA-protein complex formation. This in vitro
assay was also used to characterize key RNA sequence specificity
determinants and identify a mutation that prevents protein binding. The
in vivo effects of this mutation, placed in the context of
the URE, on cAMP-mediated message stabilization were then tested by
inserting it into a -globin reporter minigene construct and
transfecting it into LLC-PK1 cells. Results from this
analysis, in combination with deletion studies, demonstrate that the
SGLT1 URE contains distinct sequence domains that convey instability to
the stable -globin message as well as a regulatory domain that acts
to stabilize the message in response to PKA activation.
 |
EXPERIMENTAL PROCEDURES |
Materials--
[ -32P]Uridine triphosphate (3000 Ci/mmol) was obtained from ICN (Costa Mesa, CA). Nucleotide
triphosphates were from Roche Molecular Biochemicals. RNA polymerases
T3 and T7 were purchased from Promega (Madison, WI). RNase T1
(aspergillus oryzae) was from Calbiochem (La Jolla, CA).
3-Isobutyl-1-methylxanthine (IBMX) and phosphatase (potato acid, type
III) were obtained from Sigma. Plasmids pTet-tTAk, pUHC13-3, and
pT3/T7 18 were purchased from Life Technologies, Inc., and pSVneo was
from CLONTECH (Palo Alto, CA).
Cell Culture--
The porcine renal cell line
LLC-PK1 clone G8 was cultured in a 1:1 mixture of
Dulbecco's modified Eagle's medium and Ham's F-12 medium
supplemented with 10% fetal bovine serum (HyClone, Logan, UT), 2 mM glutamine, 0.37% sodium bicarbonate, and 24 mM HEPES, pH 7.0, as described previously (11). For
experiments, cells were seeded at a density of 104
cells/cm2 and grown for 4 days (postconfluent state) in
this medium supplemented with 1% penicillin-streptomycin (50 units/ml), and then IBMX (final concentration, 1 mM) was
added to the indicated samples with medium change. Unless otherwise
stated, cells were harvested at 96 h after addition of IBMX with
one medium change at 72 h after treatment.
Preparation of Cytoplasmic and Nuclear Cell
Extracts--
Monolayers of cells were washed three times with
ice-cold phosphate-buffered saline and lysed on ice with buffer A
containing 10 mM HEPES, pH 7.9, 0.1 mM EDTA,
0.1 mM EGTA, 10 mM KCl, 1 mM dithiothreitol (DTT), 0.4% Nonidet P-40, 1 mM sodium
pyrophosphate, 1 mM NaF, 0.5 mM sodium
orthovanadate, and 0.5 mM phenylmethysulfonyl fluoride as
modified from Schreiber et al. (12). The lysates were
incubated on ice for 5 min and then centrifuged at 12,000 × g for 1 min at 4 °C. The cytosolic supernatants were
removed and recentrifuged at 12,000 × g for 15 min to
remove any paticulate material. The pellets were washed once with 1 ml
of ice-cold buffer A and then were extracted for 30 min at 4 °C in
buffer B containing 20 mM HEPES, pH 7.9, 0.42 M
NaCl, 1 mM EDTA, 1 mM EGTA, 1 mM
DTT, 1 mM phenylmethylsulfonyl fluoride, 1 mM
sodium pyrophosphate, 1 mM NaF, and 0.5 mM
sodium orthovanadate. The nuclear extracts were centrifuged at
12,000 × g for 20 min at 4 °C and stored in aliquots at 85 °C. The protein concentration of cytosolic and nuclear extracts was determined by the Micro BCA protein assay (Pierce)
as described by Atkins and Tuen (13).
Synthesis of Sense RNA Fragments for Binding
Studies--
Plasmid DNAs were linearized with appropriate restriction
enzymes and transcribed in the presence of
[ -32P]uridine triphosphate (3000 Ci/mmol). The renal
SGLT1 cDNA plasmid pPSGT-B1 (6) was kindly provided by Dr. David
Rhoads (Massachusetts General Hospital, Boston, MA). All nucleotide
numbers refer to the pig SGLT1 sequence (GenBankTM
accession number M34044) reported by Ohta et al. (6).
Plasmid 3UTR2 is a 1317-bp EcoRV/HindIII fragment
of pPSGT-B1 subcloned into the pBluescript II SK( ) vector. Plasmid
p3UTR2 7 was generated from 3UTR2 by deleting a 443-bp
BamHI/AvaII fragment.
A sense 3UTR2 RNA transcript was synthesized from
StuI-linearized 3UTR2 using T3 RNA polymerase and contained
435 nucleotides (nt) of the pig SGLT1 3'-UTR (nucleotides 2263-2697)
and 69 nt of pBluescript SK( ). Plasmid 3UTR2 7 was linearized with
StuI and transcribed with T3 RNA polymerase to yield a
transcript of 178 nt containing 122 nt of the pig SGLT1 3'-UTR
(nucleotides 2576-2697) and 56 nt of pBluescript. Plasmids 122-nt
Bam and 122-nt m2/Bam (see below) were linearized
with BbsI and transcribed with T3 polymerase to yield
wild-type and mutant 120-nt transcripts, respectively, that lack
pBluescript sequence in the riboprobe.
Shorter probes containing sequences within this 122-nt SGLT1 3'-UTR
region (2576-2697) and the homologous human probe HSGLT were
synthesized from synthetic double-stranded DNA oligonucleotide templates that contained a minimal T7 RNA polymerase promoter sequence
CGTAATACGACTCACTATAGGG at their 5' end. Single-stranded oligonucleotides (2 µg/µl) were dissolved in TE buffer, pH 7.6, and
then NaCl was added to a final concentration of 100 mM.
Equal volumes of sense and antisense oligonucleotides were mixed and heated in a boiling water bath for 10 min and then incubated at 60 °C for 1 h. After cooling to room temperature, the NaCl
concentration was adjusted to 300 mM, and double-stranded
DNA was precipitated in ethanol at 70 °C overnight. Pellets were
washed with 80% ethanol, dissolved in TE buffer, pH 7.6, at 1 µg/µl, and stored at 20 °C. Sense strand RNA transcripts were
synthesized from synthetic double-stranded DNA templates using T7 RNA
polymerase, 5 µM -[32P]uridine
triphosphate, 3000 Ci/mmol, and 0.5 mM each of ATP, GTP,
and CTP. The sequences of the RNA probes used in the present study are
summarized in Fig. 1.
After transcription, RNase-free DNase (RQ1 DNase, Promega) was added,
and mixtures were incubated for an additional 30 min at 37 °C to
remove template DNA. Then 20 µg of yeast tRNA was added as carrier,
followed by dilution with diethylpropylcarbonate-treated water to a
final volume of 100 µl. Labeled transcripts were extracted with
phenol/chloroform and precipitated twice with 2 M ammonium acetate in 2.5 volumes of ice-cold ethanol at 80 °C for at least 1 h. The final pellet was washed with 80% ice-cold ethanol,
air-dried, dissolved in diethylpropylcarbonate-treated water, stored at
20 °C, and used as soon as possible. The integrity of the
transcripts was verified by electrophoresis on 6% acrylamide urea gels.
To synthesize unlabeled transcripts in quantity for competition
experiments, transcription reactions were performed by the same
procedure described above except [32P]UTP was replaced by
1 mM UTP, and the total volume of each reaction mixture was
increased to 100 µl. Also, the RNA transcripts were precipitated
without addition of carrier yeast tRNA, and the concentration was
determined by UV absorption at 260 nm.
UV Cross-linking Assay of RNA-Protein
Interaction--
Radiolabeled RNA probe binding to protein was
determined by the UV cross-linking assay described previously (14) with
minor modifications. Briefly, either cytosolic or nuclear cell extracts (40 or 20 µg, respectively) were incubated with 0.2 ng of
32P-labeled RNA probe (105 cpm) at room
temperature for 15 min in 10 mM HEPES, pH 7.6, 3 mM MgCl2, 40 mM KCl, 4 mM DTT, 10% glycerol, 0.5% Nonidet P-40, 10 mg/ml
heparin, and 200 µg/ml yeast tRNA. The reaction mixtures were then
digested with RNase T1 (20 units/ng RNA) for 30 min at room
temperature. The RNA-protein complexes were cross-linked by exposing
reaction mixtures on ice to 120,000 µJ short-wave radiation (254 nm)
in a UV cross-linker 1800 (Stratagene) for 7 min. Samples were boiled
for 3 min in SDS sample buffer containing 50 mM Tris-HCl,
pH 6.8, 100 mM DTT, 2% sodium dodecyl sulfate, 10%
glycerol, 0.1% bromphenol blue, and 0.5% -mercaptoethanol and then
resolved on 12% SDS-polyacrylamide gels. The gels were dried and
exposed to x-ray film at 80 °C using an intensifying screen.
Northwestern Blot Analysis--
Cytoplasmic proteins, 40-60
µg, were resolved by SDS-PAGE and transferred to a nitrocellulose
membrane (Schleicher & Schuell) using an ABN model SD 1000 electrotransfer unit. The membrane was washed twice for 20 min in
phosphate-buffered saline, pH 7.4, and then protein renaturation was
carried out by incubating the filter with a solution containing 12 mM HEPES, pH 7.6, 50 mM NaCl, 5% glycerol, and
1 mM EDTA at 4 °C for 3-16 h. The filter was then
incubated with a blocking solution containing 12 mM HEPES, pH 7.6, 50 mM NaCl, 1× Denhardt's solution, and 100 µg/ml yeast tRNA for 2-3 h at room temperature. The indicated sense
32P-labeled RNA probe was added to 2-5 ml of blocking
solution to a final concentration of 0.5-1 × 106
cpm/ml and incubated with the filter on a rocker at room temperature for 60 min. The blot was gently washed three times for 5 min each with
a solution containing 50 mM NaCl and 12 mM
HEPES, pH 7.6. The blot was then air-dried and exposed to x-ray film at
80 °C with an intensifying screen.
Chromatographic Fractionation of Binding Activity--
Nuclear
extracts (105.6 mg of protein) were prepared from five roller bottles
of IBMX-treated confluent cells and then fractionated by ammonium
sulfate precipitation. Proteins precipitated between 30 and 60%
ammonium sulfate were collected by centrifugation at 12,000 × g for 15 min, dialyzed overnight against 0.4 M
Tris-HCl, pH 8.0, 1 mM DTT, 1 mM
phenylmethylsulfonyl fluoride, 1 mM sodium pyrophosphate, 1 mM NaF, and 0.5 mM sodium orthovanadate with one buffer change, and then applied to a 123-ml diethylaminoethyl cellulose (DE52) column equilibrated with 0.4 M Tris-HCl,
pH 8.0. The column was eluted in a gradient of 0.2-0.6 M
KCl at a flow rate of 0.48 ml/min. Fractions (1 ml each) were collected
beginning after 20 ml of elution, and 10 µl of each fraction was
assayed for RNA binding using the UV cross-linking assay.
Affinity Purification Using a Biotinylated Specific RNA
Probe--
Streptavidin-conjugated magnetic beads were washed three
times with binding buffer TEN500 (10 mM Tris-HCl, pH 7.5, 1 mM EDTA, and 500 mM NaCl). Biotinylated RNA
probes were prepared by in vitro transcription with T7
polymerase as described above except transcription mixtures contained 5 mM each of ATP, GTP, and UTP, 2.5 mM CTP, and
2.5 mM biotin-14 CTP. The indicated biotinylated RNA probe
(200 pmol) was then complexed with 1 mg of beads in two volumes of
TEN500 buffer by incubating for 30 min at 4 °C on a rocker. Then the
RNA-streptavidin complexed beads were washed three times with wash
buffer TEN1000 (10 mM Tris-HCl, pH 7.5, 1 mM
EDTA, and 1 M NaCl).
Confluent LLC-PK1 cells on two 15-cm dishes were treated
with 1 mM IBMX for 72 h and then switched to
Dulbecco's modified Eagle's medium deficient in methionine, cysteine,
and cystine supplemented with 10% dialyzed fetal bovine serum,
2 mM glutamine, and 1 mM IBMX. After 1 h
culture in 35S-deficient medium, 35S-labeled
methionine/cysteine was added at a final concentration of 100 µCi/ml,
and incubation was continued for an additional 5 h before
preparation of a nuclear extract. The extract was first precleared of
nonspecific binding proteins by incubation with streptavidin-conjugated
beads equilibrated in nuclear extraction buffer B for 1 h at
4 °C on a rocker. The precleared supernatant was then incubated with
the specific RNA-streptavidin-complexed beads 1 h at 4 °C on a
rocker. The supernatant was removed, and beads were washed three times
with nuclear extraction buffer B. Then the
protein-RNA-streptavidin-coupled beads were boiled in SDS sample buffer
for 5 min to release bound proteins and analyzed by SDS-PAGE together
with prestained molecular weight markers. Gels were soaked in Autofluor
(National Diagnostics, Somerville, NJ). Dried gels were exposed to
Kodak MR film at 80 °C for 2-3 days.
Reporter Plasmid Construction--
The -globin reporter
plasmid pTet-BBB (15), which expresses -globin under the control of
a tetracycline-regulated promoter, was obtained from Dr. Ann-Bin Shyu
(University of Texas-Houston Medical School, Houston, TX). To test the
influence of the 435-nt U-rich sequence element (3UTR2; Fig. 1) on the
stability of the -globin message, 3UTR2 was inserted into a unique
BglII site of pTet-BBB located in the 3'-UTR of -globin.
Plasmid p3UTR2/Bam was prepared from p3UTR2 (10) by
digestion with StuI and religation in the presence of excess
BamHI linker, d(CGGGATCCCG), from New England Biolabs
(Beverly, MA). Similarly, plasmid 122-nt Bam was prepared
from p3UTR2 7 using the above strategy. 3UTR2/Bam was digested with BamHI, and a 450-bp fragment was recovered and
inserted into the unique BglII site in pTet-BBB to create
pTet-BBB + 3UTR2.
Plasmids p3UTR2/Bam and p122nt/Bam were used as
templates for site-directed mutagenesis to construct p3UTR2
m2/Bam and p122nt m2/Bam which contained a TT GG substitution at nucleotides 2622-2623. Polyacrylamide gel-purified
50 bp complimentary oligonucleotide primers 5'-GTT TGC TTT ATG GTT GGT
TAA CTT TTT CTT ATG GCT GCA CAA GTA CAA CC-3' and 5'-GGT TGT ACT TGT
GCA GCC ATA AGA AAA AGT TAA CCA ACC ATA AAG CAA AC-3' from Integrated
DNA Technologies (Coralville, IA) were used for site-directed
mutagenesis. These were designed to achieve the required melting
temperature in the presence of the AT-rich template and 2 mismatched
nucleotides. The reaction was performed using the QuikChange
Site-Directed Mutagenesis Kit (Stratagene) according to manufacturer's
instructions. After 16 cycles of denaturation, annealing and extension,
products were digested with DpnI to remove the original
template strands, then cooled to 4 °C prior to transformation of
super competent XL-1 Blue cells. p3UTR2 m2/Bam was cut with
BamHI to release a 450 bp fragment which was inserted into
the BglII site in pTet-BBB to create pTet-BBB + 3UTR2 m2.
pTet-BBB + 47 nt was constructed by annealing sense and antisense
oligonucleotides of the sequence 5'-CGG GAT CCT TTT GTT TTA TAA TGT TTG
CTT TAT TTT TGG TTA ACT TTT TCT TAT GGA TCC G-3', which contains the
47-nt sequence of pig SGLT1 3'-UTR (residues 2597-2643) flanked by
BamHI linkers on both ends. After digestion with
BamHI, this fragment was ligated into the unique
BglII site of pTet-BBB. Automated sequencing was used to
confirm the sequence and correct orientation of all constructs.
Selection of Stable pTet-tTA LLC-PK1 Transfectant
Cell Lines--
LLC-PK1 cells stably expressing the
tetracycline-regulated transactivator (pTet-tTA) were obtained by
calcium phosphate-mediated transfection as follows. The transfection
mixture (final volume, 1.2 ml) contained 20 µg of DNA in 558 µl of
H2O (2 µg of pTet-tTA, 0.4 µg of pSV2neo as selectable
marker, and 17.6 µg of pT7/T3 -18 as carrier DNA), 558 µl of 2×
HBS (0.274 M NaCl, 10 mM KCl, 1.4 mM Na2HPO4, 15 mM
glucose, 42 mM HEPES, pH 7.02) and 84 µl of 2 M CaCl2. After 20-30 min of precipitation, the
mixture was added to a 10-cm dish of cells at 80% cell confluence.
After exposure to the DNA precipitate for 16-20 h, cells were then
washed and fed with fresh medium. Two days later, cells were split 1:5
into fresh medium containing 500 ng/ml tetracycline and 0.5 mg/ml G418. Cells were maintained in the selection medium for 3-4 weeks with medium change every 3-4 days. Individual G418-resistant clones were
isolated by trypsinization within a glass cylinder and expanded by
growth in the selective medium.
Transactivator activity of each stably transfected clone was screened
by transient transfection with pUHC13-3 (Life Technologies, Inc.), a
luciferase reporter plasmid responsive to the tetracycline-regulated transcriptional activator (pTA), into duplicate dishes of each isolated
clone, using calcium-phosphate precipitation as described above. All
dishes received 1.2-ml aliquots of the precipitation mixture containing
2 µg of pUHC13-3 and 18 µg of pT3/T7 -18 carrier DNA. After
16-20 h, DNA was removed, and fresh medium containing 0.5 mg/ml G418
was added to each dish. Tetracycline was then added to one dish of each
duplicate to a final concentration of 500 ng/ml. Titration studies
using concentrations of tetracycline between 0 and 125 ng/ml
tetracycline indicated that 30 ng/ml tetracycline was sufficient to
prevent detectable luciferase expression from pUHC13-3 (data not
shown). Two days after transfection, cells were washed twice with
phosphate-buffered saline, and monolayers were assayed for
tetracycline-regulated luciferase activity using the Luciferase Assay
System (E1500; Promega, Madison, WI) according to the manufacturer's
directions. Stable transfectant clonal cell line LLC-TAK-B7 exhibited a
50-fold increase in luciferase activity at 48 h after removal of
tetracycline and was chosen as the host cell line for
tetracycline-regulated ectopic gene expression. The kinetics of
reappearance of luciferase activity following the removal of
tetracycline were also analyzed. After a 3-h lag, luciferase activity
increased linearly for 16 h, reaching 50-60% of maximum at
15 h after the removal of tetracycline (data not shown).
Transient Transfection of LLC-TAK-B7 with -Globin Reporter
Plasmids--
The calcium phosphate transfection method described
above was modified as follows to introduce -globin reporter plasmid
plasmids pTetBBB and its derivatives into LLC-TAK-B7 with increased
efficiency. LLC-TAK-B7 cells were plated at a density of
105 cells/cm2 on 10-cm dishes and grown
overnight in medium containing 500 ng/ml tetracycline and 500 µg/ml
G418. After 15-18 h, the medium was removed and replaced with 2 ml of
fresh medium containing tetracycline and G418. After 1 h, 0.24 ml
of a calcium phosphate transfection mixture containing 2 µg of
-globin reporter plasmid, 18 µg of carrier DNA, and 80 µg of
CalPhos Maximizer (CLONTECH) was added for 4 h. Transient transfection experiments using the luciferase reporter
plasmid pUHC13-3 indicated that addition of CalPhos Maximizer produced
an 18-fold increase in luciferase activity per dish with greatly
improved cell viability and required only 4 h of exposure of cells
to the DNA precipitate compared with the 24 h of DNA exposure
required in the absence of this component. Cells were washed twice and
then given fresh medium containing 30 ng/ml tetracycline and 500 µg/ml G418 with or without 1 mM IBMX. After 24 h,
the medium was removed, cells were washed twice then given fresh medium
without tetracycline but the addition of 1 mM IBMX where
indicated. As a control, 500 ng/ml tetracycline was added to one dish
to suppress transcription from the plasmid. After a 15-h pulse of
expression from the plasmid, transcription was terminated by addition
of 500 ng/ml tetracycline. At the indicated times, monolayers were
washed twice with ice-cold phosphate-buffered saline, and cytoplasmic
RNA was extracted (16) to determine the kinetics of mRNA decay.
Antisense RNA Probes for Northern Blots--
Plasmid pGAPDH was
a gift from Dr. Dennis L. Foss, University of Minnesota, and consists
of 865 bp of porcine GAPDH coding sequence (GenBankTM
accession number U48832) in vector pGEM-T. The plasmid was linearized
with HindIII and antisense RNA transcribed using T7 RNA
polymerase and [ -32P]UTP. Plasmid pBSSK( ) -globin
was created by subcloning rabbit -globin cDNA
(GenBankTM accession number V00879) into the
EcoRV site of pBluescript SK( ). The resulting plasmid was
linearized with HindIII and 32P-labeled
antisense RNA transcribed using T3 RNA polymerase.
Northern Blot Analysis of Transfectants--
Cytoplasmic RNA (10 µg) was denatured and fractionated on a 1% agarose gel containing
formaldehyde (17). Samples of 0.5 µg of 123-bp DNA ladder were also
included as molecular weight markers. A poly(A) sample
was prepared from the zero time sample by hybridization with oligo(dT)
and digestion of the double-stranded region with ribonuclease H. Samples were transferred by pressure to a Bright Star nylon membrane
(Ambion, Austin, TX) using a PosiBlot apparatus (Stratagene) and
cross-linked using a StratalinkerTM 1800 (Stratagene).
Membranes were prehybridized 3 h at 55 °C as described
previously (7) and then hybridized with antisense RNA probes for
-globin and GAPDH, 3 × 106 dpm/ml each, at
55 °C overnight. Membranes were washed twice for 15 min at room
temperature and then for 1 h at 55 °C and 30 min at 65 °C.
All wash solutions contained 0.1× SSC and 0.1% SDS. If necessary,
background was reduced by a second 65 °C wash or by a brief 68 °C
wash. Quantitation of radioactivity was performed using an Instant
ImagerTM (Packard Instrument Co., Meriden, CT). Filters
were also exposed to X-Ray film at 85 °C using an intensifying
screen. Following analysis with RNA probes, molecular weight markers
were detected by hybridization with 123-bp DNA ladders labeled with
[32P]CTP by the random prime method.
 |
RESULTS |
Nucleocytoplasmic Distribution of RNA Binding Activities--
A
122-nt uridine-rich region (nucleotides 2576-2697) in the 3'-UTR of
porcine SGLT1 mRNA (Fig. 1) has been
implicated in the stabilization of this message after PKA activation
(10). For this analysis, 32P-labeled sense RNA transcripts
within a uridine-rich region of the SGLT1 3'-UTR were utilized. After
binding, digestion of unprotected RNA with ribonuclease T1, and
covalent cross-linking of the RNA-protein complex catalyzed by UV
irradiation, labeled RNA-protein complexes were visualized after
resolution by SDS-PAGE. The 122-nt RNA fragment recognized a
cytoplasmic RNA binding activity that was stimulated after treatment of
cells with cAMP elevating agents such as forskolin or IBMX (10).
Stimulation was blocked by the PKA inhibitor H89 and was dependent on
protein phosphorylation.

View larger version (30K):
[in this window]
[in a new window]
|
Fig. 1.
Summary of the sense RNA probes used in
RNA-protein binding studies. 3'-UTR represents the entire 1.83-kb
3'-UTR of SGLT1 mRNA and indicates restriction enzyme sites that
divide SGLT1 3'-UTR cDNA into four regions (3UTR1-4) to produce
corresponding sense RNA probes by in vitro transcription.
Nucleotide numbers refer to the porcine SGLT1 sequence reported by
Ohta et al. (6). The 47-nt URE is shown by the thick
line, and pentameric uridine motifs are shown as U. The
sense RNA sequence for the 122-nt probe is shown. The sequence for the
minimal 12-nt binding site is shown in bold type. HSGLT is a
32-nt probe based on human SGLT1 exon 15 (nucleotides
1098-1129).
|
|
We investigated the possibility that nuclear RNA-binding proteins may
also bind the SGLT1 URE sequence. A 47-nt RNA probe (nucleotides
2597-2643), consisting of a uridine-rich domain within the 122-nt
region, formed a single 50-kDa complex using either nuclear or
cytoplasmic extracts (Fig.
2A). Direct comparison of nuclear and cytoplasmic binding to the 47-nt probe assessed by band
intensity under identical conditions indicated that the specific activity of SG-URBP was much greater in the nucleus than in the cytoplasm and was stimulated after treatment of cells with the cAMP
phosphodiesterase inhibitor IBMX (Fig. 2A). Probe 3UTR2, a
435-nt fragment (nucleotides 2263-2697) overlapping the 122-nt region,
gave a similar pattern of multiple IBMX-stimulated bands to that
observed using the 122-nt probe in both cytoplasmic (Fig. 2B) and nuclear (not shown) extracts. No complex formation
was observed in either nuclear or cytoplasmic extracts if the 122-nt region was deleted from probe 3UTR2 (not shown). Therefore, the regions
immediately flanking the 122-nt site did not contribute to protein
binding.

View larger version (43K):
[in this window]
[in a new window]
|
Fig. 2.
Identification of minimal RNA recognition
sequences involved in IBMX-stimulated RNA-protein complex formation in
nuclear and cytoplasmic extracts. A, the relative
abundance of the 50-kDa complex was directly compared in cytoplasmic
(40 µg of protein) and nuclear extracts (13.5 µg of protein) under
identical conditions using [ -32P]UTP-labeled 47-nt RNA
probe. The minimal RNA sequence necessary for complex formation was
assayed in both cytoplasmic (B) and nuclear (C)
extracts using a series of radiolabeled sense RNA probes described in
Fig. 1. Extracts from cells treated for 96 h with 1 mM
IBMX (I) or control (C) cells are compared.
|
|
Mapping the Minimal Cognate Sequence--
To further localize the
binding site within the 47-nt RNA sequence, we generated a series of
sense RNA fragments from corresponding synthetic double-stranded
oligonucleotides containing a T7 promoter (Fig. 1). Fragments labeled
with -32P-labeled UTP by in vitro
transcription with T7 polymerase were incubated with nuclear and
cytoplasmic extracts from control and IBMX-treated cells and analyzed
by the UV cross-linking assay (Fig. 2). As we have reported previously
(10), complex formation with either the 3UTR2 transcript or the 122-nt
transcript (previously named 3UTR2 7) was greatly increased in
cytoplasmic extracts from IBMX-treated cells compared with controls
(Fig. 2B). The U-rich region represented by the 47-nt
transcript contains two pentameric uridine motifs separated by 7 nucleotides (Fig. 1). Deletion of residues from the 5' end of the 47-nt
transcript to form a 28-nt transcript, which contains both uridine
pentamers, retained 50-kDa complex formation in both cytoplasmic and
nuclear extracts (Fig. 2, B and C). Further
deletion from the 5' end with removal of both pentameric uridine motifs
to form a 23-nt transcript abolished complex formation in both nuclear
and cytoplasmic extracts. A homologous 32-nt transcript (HSGLT; Fig. 1)
consisting of nucleotides 1098-1129 from exon 15 of the human genomic
SGLT1 sequence (GenBankTM accession number L29339) also
exhibited IBMX-stimulated formation of the 50-kDa complex both in
nuclear and cytoplasmic extracts from LLC-PK1 cells (Fig.
2, B and C). HSGLT contained both pentameric uridine motifs present in the wild-type porcine sequence but differed in flanking residues.
Additional deletions within the URE region established that of the two
pentameric uridine motifs shown in the diagram in Fig. 1, only the 5'
proximal one was necessary for 50-kDa complex formation. The 12-nt
transcript (nucleotides 2620-2631), in which the 3' proximal
pentameric uridine motif was deleted but the 5' proximal uridine
pentamer was retained, represented the minimal sequence sufficient for
IBMX-stimulated 50-kDa complex formation. The 41-, 38-, and 29-kDa
transcripts, which lacked the 5' proximal uridine pentamer but
contained the 3' proximal one, were not able to form the 50-kDa complex
in either nuclear extracts (Fig. 2C) or cytoplasmic extracts
(not shown). The 122-, 47-, 28-, and 19-nt transcripts, which contained
both uridine pentamers, exhibited 50-kDa complex formation (Fig. 2).
The 23- and 24-nt transcripts, which lacked both uridine pentamers,
were ineffective in complex formation.
Protein binding required single-stranded sense RNA. The 50-kDa complex
formation was observed using a sense 12-nt transcript (Fig.
2C) but not with the antisense 12-nt transcript or with double-stranded RNA annealed from sense and antisense 12-nt transcripts (not shown).
Specificity of RNA-Protein Complex Formation--
We had
previously shown that binding of cytoplasmic proteins to the 435-nt
3UTR2 probe was reduced by addition of an excess of unlabeled specific
competitor RNAs but not by nonspecific RNAs (10). Furthermore, binding
to 3UTR2 was competed by poly(U) RNA but not by other ribohomopolymers
(10). Fig. 3 demonstrates that binding of
nuclear proteins to either the human HSGLT or porcine 47-, 28-, or
12-nt 32P-labeled probes is competitively inhibited by a
250-fold molar excess of unlabeled 47-, 28-, 19-, and 12-nt RNA
transcripts, all of which contain sequence elements sufficient for
50-kDa RNA-protein complex formation. By contrast, a 250-fold molar
excess of either of the unlabeled 41-, 23-, and 29-nt transcripts,
which lack these recognition elements, did not compete for binding to
these probes. Similar results were obtained using cytoplasmic extracts
(not shown). These competitive interactions among RNA probes that
contain the 5' uridine pentamer indicate that these probes recognize
the same cellular factor. The inability of RNA probes lacking this uridine pentamer to competitively inhibit binding confirms the requirement for this motif in specific complex formation.

View larger version (44K):
[in this window]
[in a new window]
|
Fig. 3.
Competition analysis of 3'-UTR
fragments. Unlabeled sense RNA competitors at 250-fold molar
excess were preincubated for 15 min with a nuclear extract from
IBMX-treated culture before addition of the indicated
[ -32P]UTP-labeled RNA probe. Identical results were
observed using a cytoplasmic extract (data not shown). , no unlabeled
RNA added.
|
|
A 250-fold molar excess of poly(U) RNA competitively inhibited 50-kDa
complex formation with the 122-nt transcript in both nuclear and
cytoplasmic extracts as well as binding of nuclear proteins to the 47- and 28-nt transcripts (Fig. 4). Poly(A),
poly(C), and poly(G) were ineffective as competitors. These results
indicate that uridine residues play an important role in complex
formation in both the nucleus and cytoplasm.

View larger version (38K):
[in this window]
[in a new window]
|
Fig. 4.
Competition analysis of unlabeled
ribohomopolymers with labeled 3'-UTR RNA fragments. Either
cytoplasmic (A) or nuclear (B) extracts from
cells treated with 1 mM IBMX for 96 h were
preincubated 15 min with a 250-fold molar excess of the indicated
unlabeled nucleotide ribohomopolymer. A, poly(A);
U, poly(U); G, poly(G); C, poly(C).
Then complex formation with the indicated
[ -32P]UTP-labeled sense probes was tested using the UV
cross-linking assay. , no unlabeled RNA added.
|
|
Stimulation of Nuclear and Cytoplasmic Binding Activities--
We
investigated the kinetics of activation of the URE binding activity in
both nucleus and cytoplasm after treatment of confluent monolayers with
IBMX for comparison with untreated control monolayers. Using either the
47-nt probe (Fig. 5A) or the
12-nt probe (Fig. 5B), 50-kDa complex formation in nuclear
extracts was stimulated by IBMX within 1 h of addition and
stimulation was maintained for 96 h. Similar results were obtained
using nuclear extracts from forskolin-treated cells (Fig.
5C). In cytosolic extracts from control, untreated cells, a
transient stimulation of complex formation was observed at time points
up to 24 h after medium change, but complex formation was greatly
diminished at later time points up to 96 h (Fig. 5, A
and B). By contrast, in cytosolic extracts from IBMX-treated
cells, complex formation, assayed with either the 47-nt (Fig.
5A) or the 12-nt (Fig. 5B) probes, was reproducibly maximal at 96 h relative to controls. Similar
findings were obtained using the 122-nt probe (not shown). These
findings indicate that PKA activation resulted in a rapid (<1 h)
activation of binding activity in both the nucleus and cytoplasm, which
is maintained up to 96 h.

View larger version (59K):
[in this window]
[in a new window]
|
Fig. 5.
Time course of 50-kDa complex formation in
cytosolic and nuclear fractions after treatment with protein kinase
activators. A and B, cytoplasmic and nuclear
extracts from confluent cultures treated with 1 mM IBMX for
the indicated times and untreated controls were assayed by
UV-cross-linking with an [ -32P]UTP-labeled sense 47-nt
probe (A) or 12-nt probe (B). C,
confluent cultures were treated with 100 µM forskolin for
the indicated times for comparison with untreated controls and cultures
treated with 1 mM IBMX (I), before isolation of
nuclear extracts and assay by UV cross-linking using the 47-nt probe.
D, nuclear extracts from cultures treated with 0.1 µM TPA for the indicated times and untreated controls
were assayed by UV cross-linking using the 47-nt probe.
|
|
Treatment of LLC-PK1 cells with 0.1 µM TPA
results in rapid degradation of the SGLT1 message as a result of PKC
activation (8). To investigate the possible role of the URE region in the SGLT1 3'-UTR in mediating PKC-stimulated SGLT1 message decay, we
assayed RNA-protein complex formation in extracts from control and 0.1 µM TPA-treated cells using the 47-nt probe. At several exposure times, no significant difference in 50-kDa band intensity was
observed between control and TPA-treated cells using nuclear extracts
(Fig. 5D) or cytoplasmic extracts (not shown), nor were additional complexes detected. These observations indicate that TPA-mediated message destabilization is not associated with changes in
protein binding to the URE.
Northwestern Blot Analysis--
In the above studies, protein
binding was detected as a covalent complex with its cognate mRNA
transcript. To directly identify cytoplasmic proteins that may have
affinity for the SGLT1 URE, we carried out Northwestern blotting of
proteins from control and IBMX-treated cells (Fig.
6). Proteins were resolved by
SDS-polyacrylamide gel electrophoresis, transferred to nitrocellulose
membranes, allowed to renature, and then incubated with
32P-labeled sense RNA probes. This method did not require
ribonuclease digestion or UV cross-linking. Probe 3UTR2 and the 122-nt
probe each recognized a 38-kDa protein and a 70-kDa protein that
exhibited increased binding activity in IBMX-treated cell extracts
(Fig. 6A). Another major band at 29 kDa was also observed.
Probes of 47 nt and smaller were ineffective using this protocol
because of technical difficulties in retaining label on the blot after washing. The 38- and 70-kDa bands detected in IBMX-treated cells were
greatly reduced if cell extracts were treated with potato acid
phosphatase before electrophoresis (Fig. 6B). Addition of the phosphatase inhibitor microcystin LR protected against these effects of phosphatase treatment (Fig. 6B).

View larger version (90K):
[in this window]
[in a new window]
|
Fig. 6.
Northwestern blot analysis of RNA-binding
proteins. A, cytosolic extracts (60 µg) from control
(C) or IBMX-treated (I) cells were resolved by
SDS-PAGE using 12% acrylamide. Proteins were transferred to a
nitrocellulose membrane and renatured overnight, as described under
"Experimental Procedures." The membrane was hybridized with
[ -32P]UTP-labeled sense 3UTR2 or 122-nt RNA probes as
indicated and visualized by autoradiography. B, a cytosolic
extract from IBMX-treated cells (I) was treated with 1 µg
of potato acid phosphatase (PAP) in either the presence or
absence of 10 nM phosphatase inhibitor microcystin LR
(MICC-LR) prior to SDS-PAGE and Northwestern blot analysis
using the 122-nt 32P-labeled RNA probe for detection.
Results obtained using untreated cell extracts from cells grown in the
absence of IBMX (C) are shown for comparison.
|
|
These observations identify a major cytoplasmic 38-kDa URE-binding
protein that exhibits increased binding activity in IBMX-treated cells
as well as a requirement for protein phosphorylation. A 50-kDa
RNA-protein complex is detected by these probes in cytoplasmic extracts
after UV cross-linking; the increased size represents the contribution
of cross-linked RNA. A 50-kDa cross-linked complex is observed with
probes ranging in size from 435 to 12 nt, suggesting that the same
minimal protected size of bound RNA remains after T1 ribonuclease digestion.
Mutational Analysis of the Binding Site within the URE--
The
importance of uridine residues and the 5' proximal uridine pentamer in
RNA-protein binding suggested by competition and deletion analysis was
further explored using mutational analysis. We tested whether one or
both uridine pentamers is required for binding and whether the flanking
nucleotide residues also play a role in binding specificity.
Introduction of two U G substitutions in the 5' proximal uridine
pentamer corresponding to positions 2622-2623 in the SGLT1 sequence
(mutant 28-nt m2) substantially reduced the amount of 50-kDa complex
formed with either cytoplasmic (Fig.
7A) or nuclear (Fig.
7B) extracts, whereas the same substitution in the 3'
proximal uridine pentamer (mutant 28-nt m5) had no discernable effect.
A transcript containing these U G substitutions in both pentamers
(mutant 28-nt m3) also exhibited greatly reduced 50-kDa complex
formation. Two U G substitutions within the three uridine residues
at the 5' end of the 28-nt probe (28 nt m1) had only minimal effect on
complex formation (Fig. 7A). C A substitution of one or
both of the residues flanking the 3' proximal uridine pentamer (mutants
28-nt m4 and 28-nt m7) did not affect complex formation. Substitution
of both flanking residues of the 3' proximal uridine pentamer from
CUUUUUC AUUUUUG, the same residues flanking the 5' proximal uridine
pentamer, also did not affect complex formation (28-nt m6).
Substitution of G and C residues flanking both uridine pentamers to A
to create two AUUUUUA motifs (mutant 28-nt m7) similarly had no effect
on complex formation. Substitution to C of both residues flanking the
5' proximal uridine pentamer (mutant 19-nt m3) had no appreciable
effect (see Fig. 10B, bottom panel). Deletion of
one uridine residue from the 5' proximal pentamer caused reduced
complex formation (not shown).

View larger version (38K):
[in this window]
[in a new window]
|
Fig. 7.
Effect of mutations on RNA-protein complex
formation. Either cytoplasmic (A) or nuclear
(B) extracts from IBMX-treated cultures were analyzed by the
UV cross-linking assay using the indicated
[ -32P]UTP-labeled sense RNA mutant and wild-type 28-nt
RNA transcripts. C, DEAE-cellulose column fractions 15 and
63 and the total nuclear extract (T) were assayed for RNA binding
activity using the indicated wild-type and mutant
[ -32P]UTP-labeled 28-nt RNA probes. D,
wild-type and mutant 28-nt RNA sequences. Mutated bases are shown in
bold type.
|
|
Nuclear extracts from IBMX-treated cells were fractionated by ammonium
sulfate precipitation followed by DEAE-cellulose chromatography (Fig.
7C). Fractions were assayed using the UV cross-linking
assay. Binding activity for the wild-type 28 nt probe (Fig.
7C) as well as the 47-, 19-, and 12-nt RNA probes (not
shown) exhibited the same elution profile with peak activity in
fraction 63. These results reinforced conclusions from competition
studies that these probes recognized the same RNA-binding protein.
Probe 28-nt m7, which contained two AUUUUUA motifs, also exhibited peak
binding in fraction 63 (Fig. 7C). Probe 28-nt m2 did not
show binding activity in any fraction (not shown), consistent with its
inability to bind proteins in the total cell extract.
Taken together, our results indicate that the 5' proximal uridine
pentamer is critical for protein recognition but that the nucleotides
immediately flanking it do not appear to contribute to binding
specificity. Furthermore, these mutation data reinforce conclusions
from deletion analysis in Fig. 2 that the 3' proximal uridine pentamer
is not essential for 50-kDa complex formation with either cytoplasmic
or nuclear extracts.
Using increased electrophoretic resolution and a 120-nt RNA transcript
encompassing nucleotides 2576-2695, 50- and 57-kDa cross-linked
complexes were observed in both nuclear and cytoplasmic extracts, and
two additional major complexes of 68 and 120 kDa were observed using
nuclear extracts (Fig. 8). Because the
120-nt transcript recognized multiple nuclear proteins, we introduced the same UU GG substitution present in 28-nt m2 to create mutant transcript 120-nt m2. Both cytoplasmic and nuclear 50-kDa complex formation were abolished in 120-nt m2. This mutation did not affect the
formation of the nuclear 57-kDa complex but did reduce formation of the
larger nuclear complexes.

View larger version (52K):
[in this window]
[in a new window]
|
Fig. 8.
Effect of mutation and secondary structure on
protein binding to the URE. A, cytosolic (µg) and
nuclear (µg) extracts from either control (C) or
IBMX-treated (I) cultures were assayed using the UV
cross-linking assay and wild-type and mutant 120-nt probes. Probe
120-nt m2 contained a UU GG substitution corresponding to
nucleotides 2622-2623 in the porcine SGLT1 sequence. B, the
120-nt probe was boiled for 10 min and then either cooled on ice
(QC) or allowed to renature for 30 min at room temperature
(SC) before assay of binding activity at 16 °C. using the
UV cross-linking assay. RT, probe was not boiled but
incubated for 30 min at room temperature before assay.
|
|
Binding activity of the wild-type and mutant 120-nt transcripts was
also compared in the absence of cross-linking using electrophoretic mobility shift assay in nondenaturing gels (Fig.
9). This analysis permits the detection
of multi-protein complexes and avoids possible artifacts because of
sequence requirements for UV-catalyzed cross-linking. At least five
major complexes were observed in nuclear extracts from IBMX-treated
cells using the wild-type 120-nt probe but only one major complex using
the 120-nt m2 probe.

View larger version (95K):
[in this window]
[in a new window]
|
Fig. 9.
Analysis of RNA-protein complexes formed with
wild-type and mutant probes assayed by electrophoretic band shift in
nondenaturing gels. Cytosolic (25 µg) and nuclear (15 µg)
extracts from either control (C) or IBMX-treated
(I) cultures were incubated with the indicated
32P-labeled RNA probes, unprotected RNA was digested with
ribonuclease T1, and then labeled complexes were analyzed without UV
cross-linking on nondenaturing 6% polyacrylamide gels as described
previously (35). Probe, no extract added.
|
|
Effect of Secondary Structure--
The possible role of secondary
structure of the 120-nt RNA transcript in protein binding activity was
tested by boiling the probe for 10 min and then either quickly cooling
it on ice or slowly cooling it for 30 min at room temperature before
assay of binding activity using nuclear extracts (Fig. 8B).
Because it was necessary to assay binding activity at 16 °C instead
of room temperature to prevent renaturation during assay, an alteration in the relative band intensities is observed in the control sample at
the lower assay temperature. These results indicate that when renaturation of the RNA transcript was slowed by quick cooling, binding
activity was greatly reduced, indicating a requirement for RNA
secondary structure in protein recognition.
Isolation of RNA-binding Proteins Using a Specific Biotinylated
RNA--
The 19-nt probe was double-labeled with 32P and
biotin by in vitro transcription in the presence of both
[ -32P]UTP and biotin-14 CTP and tested using the UV
cross-linking assay (Fig.
10C). Biotinylation did not
affect the ability of this probe to form the 50-kDa complex. However,
attempts to use the wild-type 19-nt probe for affinity purification on
streptavidin-conjugated beads were hindered by degradation of the probe
in the presence of nuclear extracts. However, probe 19-nt m3, which
contains two C substitutions flanking the uridine pentamer, also
exhibits 50-kDa complex formation unaffected by biotinylation (Fig. 10,
B and C) but is much more resistant to
degradation. Unlabeled biotinylated 19-nt m3 probe was able to
competitively inhibit binding of 32P-labeled unbiotinylated
and biotinylated wild-type 19-nt and 19-nt m3 probes (Fig.
10C), indicating that the same protein was recognized.

View larger version (32K):
[in this window]
[in a new window]
|
Fig. 10.
Isolation of a 38-kDa protein using a
specific biotinylated RNA probe and streptavidin-coated magnetic
particles. A, precleared nuclear extracts from
LLC-PK1 cells treated with IBMX for 72 h and
biosynthetically labeled with 35S were incubated with the
indicated biotin-14-CTP-labeled RNA probes bound to
streptavidin-conjugated magnetic particles as described under
"Experimental Procedures." Proteins eluted from the RNA-bead
complex by boiling 5 min in SDS sample buffer were resolved by 12%
SDS-PAGE. T, total nuclear extract; P, precleared
nuclear extract; N, nonspecific binding of protein to
streptavidin magnetic beads in the absence of RNA; S,
supernatant after specific probe binding; B-28 m2, proteins
bound to biotin-14-CTP-labeled 28-nt m2 RNA probe complexed with
streptavidin particles; B-19 m3, proteins bound to
biotin-14-CTP-labeled 19-nt m3 RNA probe complexed with streptavidin
particles. B, UV cross-linking assay of nuclear extracts
from either control (C) or IBMX-treated (I) cells
using 32P-labeled 19-nt or 19-nt m3 RNA probes.
C, 35S-labeled nuclear extracts were
preincubated 15 min with or without addition of a 250-fold molar excess
of unlabeled biotin-14-CTP-labeled 19-nt m3 RNA probe before
UV-cross-linking analysis using either
[ -32P]UTP-labeled (32P) or
biotin-CTP/[ -32P]UTP double-labeled
(32P/biotin) 19-nt wild-type or 19-nt m3 RNA
probe.
|
|
Nuclear extracts were prepared from IBMX-treated cells biosynthetically
labeled with [35S]methionine. Fig. 10A
demonstrates that an 35S-labeled band (indicated by
arrow) with an apparent molecular mass of 38 kDa was
bound to biotinylated probe 19-nt m3. The estimated 38-kDa size of this
band agrees with that obtained by Northwestern blot analysis of
cytoplasmic extracts. A 27-kDa band was also eluted. A 27-kDa band was
also noted by Northwestern blot (Fig. 6) and appears to represent the
protein component of a 28-kDa RNA-protein complex formed in extracts
from control cultures not treated with IBMX (10). The 28-kDa complex is
down-regulated after IBMX treatment and recognizes the same 12-nt
minimal RNA-binding site shown in Fig. 1 as shown by deletion analysis.
These bands were not observed in the absence of RNA or using a
biotinylated probe 28-nt m2, which, as shown in Fig. 7, does not bind
the 38-kDa protein. A number of higher molecular mass bands were eluted
that represent nonspecific binding to the bead because they are
observed in the absence of added RNA (lane
N).
The 3UTR2 Sequence (Bases 2263-2697) Contains Both Destabilizing
Elements and PKA-dependent Stabilizing Elements--
To
demonstrate the obligatory role of the URE region of the SGLT1 3'-UTR
in regulating message stability in response to PKA activation, we
utilized tetracycline-regulated expression of -globin mRNA as a
reporter message (Fig. 11). The stable
-globin message has been extensively used to analyze regulation of
mRNA turnover by AU-rich sequence elements in various
proto-oncogenes, lymphokines and cytokine 3'-UTRs (18). Test sequences
are inserted into the unique BglII site located at the
junction of the -globin translated and 3'-untranslated regions in
plasmid pTet-BBB (15). pTet-BBB encodes a -globin minigene
containing two introns and three exons. Transcription from this vector
under the control of the tetracycline-regulated promoter (tet-OFF) in
the presence of a tetracycline-regulated transcriptional activator is
switched on in the absence of tetracycline, yielding a chimeric
-globin mRNA. Transcription is rapidly switched off after the
addition of tetracycline, permitting the analysis of RNA decay
properties and half-life. This system offers important
advantages over the use of actinomycin D to block transcription because
tetracycline does not affect cell physiology or influence transcription
of endogenous cellular mRNAs. Actinomycin D has been reported to influence mRNA decay rates (19) and the nucleocytoplasmic
distribution of RNA-binding proteins such as HuR (20). Furthermore
other inducible promoter systems such as c-fos require serum
induction conditions that may influence the evaluation of cell
signaling effects on message decay.

View larger version (48K):
[in this window]
[in a new window]
|
Fig. 11.
A mutation that prevents protein binding
also prevents IBMX-stimulated stabilization of chimeric URE-globin
mRNAs assayed in vivo. LLC-TAK-B7 cells, a
clonal line of LLC-PK1 cells stably transfected with the
tetracycline-regulated transactivator pTA, were transiently transfected
with the indicated pTet-BBB construct as described under
"Experimental Procedures." Washed monolayers were switched to
medium containing 30 ng/ml tetracycline and 500 µg/ml G418 with
(I) or without (C) 1 mM IBMX for
24 h. A pulse of -globin mRNA synthesis was then initiated
by removal of tetracycline for 15 h in the presence and absence of
1 mM IBMX. Then transcription was terminated by addition of
500 ng/ml tetracycline, and cells were harvested at the indicated times
for isolation of cytoplasmic RNA. Samples were analyzed by Northern
blot with quantitation by a PhosphorImager. Blots were sequentially
hybridized with riboprobes for -globin and GAPDH mRNA. For
half-life determinations, -globin mRNA values were normalized to
GAPDH. Open circles, IBMX-treated; filled
circles, control; uninduced, cells were
maintained in the presence of tetracycline to prevent expression.
Poly(A) RNA was prepared by treating an aliquot of the
zero time RNA sample with oligo(dT) and ribonuclease H to remove the
poly(A) tail. Estimated molecular mass values of the transcripts at
zero time were: pTet-BBB, 1 kb; pTet-BBB + UTR2, 1.45 kb. Values for
the poly(A) samples were: pTet-BBB, 0.75 kb; pTet-BBB + UTR2, 1.2 kb.
|
|
To optimize and standardize tetracycline regulation of transcription,
the tetracycline-regulated transactivator plasmid pTet-pTA was stably
transfected into LLC-PK1 clone G8 cells by co-transfection with a plasmid encoding a neomycin resistance gene. Stable
transfectants were selected using G418 and cloned by single-cell
plating. Clonal lines were screened for tetracycline-regulated
expression of a transiently transfected plasmid pUHC13-3 in which
luciferase transcription is under the regulation of the
tetracycline-regulated promoter. A cell line LLC-TAK-B7 was chosen as
host cell line for these studies based on its 50-fold increase in
luciferase expression after removal of tetracycline.
The 3UTR2 region of the SGLT1 3'-UTR was inserted into the
BglII site of pTet-BBB to construct pTet-BBB + 3UTR2.
Plasmids were transiently transfected into LLC-TAK-B7 cells. After
24 h, -globin expression was induced by removal of
tetracycline. After 15 h of expression in the presence and absence
of 1 mM IBMX as indicated, transcription was terminated by
addition of tetracycline, and the kinetics of mRNA decay were
determined by Northern blot analysis of total cytoplasmic RNA using
hybridization with a -globin riboprobe. Data were normalized to
levels of GAPDH mRNA. Results shown in Fig. 11 indicate that
-globin mRNA transcribed from pTet-BBB decayed with a half-life
of 7.2 h in the absence of IBMX and 7.6 h in the presence of
IBMX. Although known to be cell line-dependent, these
values compare favorably with the value of 8 h reported for
-globin mRNA half-life in 3T3 cells (18) and indicate that IBMX
treatment does not significantly influence -globin mRNA decay.
Introduction of the 3UTR2 sequence into -globin mRNA (pTet-BBB + 3UTR2) and transfection into control cells not treated with IBMX
resulted in destabilization of the chimeric reporter message, which
decayed with a half-life of 3.7 h (Fig. 11). The destabilizing effect of the 3UTR2 sequence was prevented in IBMX-treated cultures, which exhibited a half-life for decay of the -globin/3UTR2 chimeric message of 7.1 h (Fig. 11). These results indicate that the 435-nt 3UTR2 region contains both destabilizing sequences and sequences that
convey PKA-mediated stability in the presence of these destabilizing sequences.
The 47-nt region (bases 2597-2643) was similarly inserted into the
BglII site of pTet-BBB to form pTet-BBB + 47 nt. This
construct was transfected into LLC-TAK-B7 cells, and the decay rates of the resulting chimeric message were determined. Results shown in Fig.
12 indicate that in control cells in
the absence of IBMX treatment, these sequences did not appreciably
destabilize -globin mRNA (t1/2 = 15.3 h)
compared with the pTet-BBB control (t1/2 = 7.2 h). In fact, the 47-nt sequence exerted a measurable stabilization effect. Therefore, the destabilizing effect associated with the 435-nt
3UTR2 sequence in control cells presumably is localized outside the
47-nt URE region. However, the possibility exists that secondary
structure requirements for destabilization are not present in the 47-nt
sequence.

View larger version (29K):
[in this window]
[in a new window]
|
Fig. 12.
Decay of chimeric
-globin/URE mRNA in untreated cells. Cells
were transiently transfected with either pTet-BBB or pTet-BBB + 47-nt
and RNA decay rates measured as described in the legend to Fig. 11
except no IBMX treatment was carried out. Filled circles,
pTet-BBB; filled triangles, pTet-BBB + 47-nt. U,
cells were maintained in the presence of tetracycline to prevent
expression.
|
|
Bases 2622-2623 Are Critical for IBMX-stimulated Message
Stabilization--
To directly demonstrate the involvement of the
38-kDa RNA-binding protein in IBMX-stimulated message stabilization, a
UU GG substitution at bases 2622-2623 was introduced into the
3UTR2 sequence and then inserted into pTet-BBB to generate pTet-BBB + 3UTR2 m2. This same mutation in 28-nt m2 and 122-nt m2 probes was shown
to prevent binding of the 38-kDa protein assayed either by UV
cross-linking or band shift in nondenaturing gels (Figs. 7-9).
Analysis of decay kinetics after transient transfection of these
constructs demonstrated that the chimeric -globin/3UTR2 m2 mRNA
decayed with a similar half-life in control (t1/2 = 5.3 h) and IBMX-treated (t1/2 = 5.5 h)
cells (Fig. 11). These results provide evidence that a mutation that
prevents binding of the 38-kDa protein to its cognate site also blocks
PKA-mediated message stabilization. Taken together, these findings
indicate that binding of this protein is necessary although possibly
not sufficient for PKA-mediated message stabilization.
 |
DISCUSSION |
The targeted decay or stabilization of specific mRNAs in
response to cell signaling pathways, in combination with
transcriptional control, is a powerful means to rapidly and selectively
modulate steady-state mRNA levels in adaptation to changes in the
cell growth state or environment. Native SGLT1 mRNA transcripts
containing a 1.7-kb 3'-UTR are 8-fold less stable compared with
transcripts lacking the 3'-UTR, indicating the presence of
destabilizing sequences within the 3'-UTR region (9). The SGLT1 3'-UTR
also contains a cAMP-dependent regulatory sequence because
elevation of cAMP levels led to an 8-fold increase in the half-life of
transcripts containing the 3'-UTR, a value that correlated
quantitatively with a similar increase in steady-state levels of both
the transporter protein subunit and the message (9). Message
stabilization correlated with increased protein binding to a URE in the
3'-UTR (10). The studies presented here provide further insight into this mechanism. Mutational analysis of the minimal binding site within
the URE identified a uridine pentamer essential both for cyclic
nucleotide-dependent protein binding assayed in
vitro and for cyclic nucleotide-dependent
stabilization of a reporter message assayed in vivo. A
38-kDa nucleocytoplasmic protein that specifically binds this site in a
PKA-stimulated, protein phosphorylation-dependent manner
was identified by Northwestern blot analysis as well as by affinity
purification using a specific biotinylated RNA. These studies provide
direct evidence that binding of this protein to its site in the URE is
necessary for cyclic nucleotide-dependent message
stabilization. Furthermore, our results suggest that the cAMP
regulatory element within the 3'-UTR recognized by this protein is
distinct from sequences that promote destabilization. Binding activity
was predominantly found in the nucleus although also present in the
cytoplasm, suggesting a role in both cellular compartments.
A complex interaction between cis-acting sequences within
the message coding or noncoding regions and trans-acting
protein factors in the nucleus and cytoplasm has been implicated in
regulating the decay of a number of different mRNAs (21). However,
there is currently no information on how this interaction influences mRNA degradation or how the process is regulated. Evidence that ongoing translation is required for destabilization has been reported in certain cases (22, 23). Poly(A) shortening initiates mRNA degradation (21), and deadenylation is subject to regulation by
cis-acting sequences in the 3'-UTR (24).
Although much attention has focused on the role of AU-rich RNA
destabilizing elements that are present in the 3'-UTRs of many labile
transiently expressed RNAs such as those encoding proto-oncogenes, lymphokines, and cytokines (18), a much wider diversity of mRNAs is
subject to post-transcriptional regulation. Examples of stabilization or destabilization of specific mRNAs by PKA (25-27) or PKC
activation (8, 28, 29) have been described, but the sequences and trans-acting factors that mediate stability regulation have
been identified in only a few cases. The involvement of specific
RNA-binding proteins in regulated mRNA turnover has been inferred
from indirect correlative evidence. The proteins were shown, using RNA
gel mobility shift or UV catalyzed RNA-protein cross-linking, to bind
in vitro to mRNA sequences that conferred altered
stability in vivo when inserted into reporter genes and
transfected into cells. Several proteins meeting these criteria have
been purified, and their cDNAs have been cloned (30-32). In the
case of HuR (33, 34) and HnRNP D (35), ectopic overexpression of their
cDNAs was shown to alter decay of a reporter globin message
containing their cognate binding site. However, interpretation of these
studies is not unequivocal because protein overexpression could alter decay by nonphysiological means, e.g. by saturating the
decay machinery, activating low affinity or nonspecific pathways, or altering the normal nucleocytoplasmic distribution. Interestingly, in vivo UV cross-linking failed to detect binding of hnRNP D
to poly(A)+ RNA, although HuR binding was detected (36). Agonist destabilization of hamster -adrenergic receptor mRNA was
disrupted by point mutations that prevented protein binding to an
AU-rich region in its 3'-UTR (37); these proteins were subsequently identified as hnRNP A1 and HuR (38). However, hnRNP A1 has been shown
to bind an unusually diverse array of RNA sequences (39), whereas HuR
has typically been implicated in message stabilization rather than
destabilization (33).
Sequence analysis of the 3'-UTRs of a wide variety of orthologous genes
revealed stretches of 100 nucleotides or more that were highly
conserved for over 300 million years of evolution, suggesting an
essential function (40, 41). Porcine and human SGLT1 3'-UTRs exhibit
75% nucleotide sequence identity, a value comparable with that of
their coding regions. An RNA transcript based on the homologus region
in the human SGLT1 gene also recognized the same binding activity in
LLC-PK1 cell extracts and contained the pentameric uridine
motif, indicating that human SGLT1 may be regulated by a similar mechanism.
In addition to a demonstrated role in regulating mRNA stability,
the 3'-UTR has been implicated in regulating mRNA translation efficiency (42). This may be mediated by interaction of the poly(A)
tail and its poly(A)-binding protein with the initiation factor eIF4G
in the cap-binding protein complex via a loop structure (43), as
demonstrated by studies in yeast (44) and mammalian cells (45). The
poly(A)-binding protein shuttles between the nucleus and cytoplasm and
may play a role in transport of mRNP particles to the cytoplasm
(46).
The identity of the 38-kDa RNA-binding protein described here is
unknown. We have detected nuclear and cytoplasmic proteins that form a
50-kDa complex with our 47-nt probe in a wide variety of cell lines
that do not express SGLT1 including COS cells, MDCK cells and 3T3
cells, suggesting a wider role. The cis-acting sequences described in this report differ from those described in the 3'-UTR of
other messages whose stability is regulated by cAMP. Agonist destabilization of the -adrenergic receptor mRNA was associated in hamster with protein binding to a 20-nt AU-rich sequence containing an AUUUUA motif flanked by U-rich regions (37) and in human with
binding to an AU-rich nonamer UAAUAUAUU (47). Cyclic nucleotide destabilization of type-1 plasminogen activator-inhibitor mRNA was
associated with a predominantly A-rich sequence (26), whereas a C-rich
sequence was implicated in leutinizing hormone/human chorionic
gonadotropin receptor mRNA regulation (48). The cAMP-regulated stabilizing region in the lactate dehydrogenase-A 3'-UTR was identified as AUAUUUUCUGUAUUAUAUGUGU (49). A search of sequence data bases for
sequences matching the consensus 12-nt minimal cis-acting sequence identified in our study revealed that it occurs rarely, nor
was it found in other cAMP-regulated messages. Our observation that
protein binding to the 120-nt fragment is secondary
structure-dependent suggests that a search for potential
binding sites in other messages involves more than the simple presence
of short primary sequence motifs. A requirement for specific hairpin
loop structures for RNA-protein binding has been noted for many
mRNAs, notably the iron-responsive elements (50), where a
combinatorial approach has been used to select stem-loop structures
with high affinity for iron regulatory factor. A combinatorial approach
has also been used to select AU-rich element consensus sequences (51).
Both nuclear and cytoplasmic binding activities were rapidly activated
within 1 h of addition of IBMX or forskolin and were abolished by
phosphatase treatment. These observations suggest that binding of the
38-kDa protein to the URE is dependent on nuclear and cytoplasmic
protein phosphorylation events triggered by PKA. Addition of the
purified PKA catalytic subunit to unstimulated cell extracts in the
presence of substrates did not activate 50-kDa complex formation,
suggesting that the 38-kDa protein is not phosphorylated directly by
PKA but rather is activated by a protein kinase cascade triggered by
PKA. It is possible that binding of the 38-kDa protein to the SGLT1 URE
is initiated in the nucleus and accompanies the message to the
cytoplasm, providing continuous protection from the cellular decay
machinery. Efforts are currently underway to determine the identity of
the 38-kDa protein and other components of the multiprotein complex and
to elucidate their individual role in nuclear and cytoplasmic events
that regulate the stability and translatability of the SGLT1 message.
 |
ACKNOWLEDGEMENT |
We thank Dr. Ann-Bin Shyu for the tet-BBB
plasmid and helpful advice.
 |
FOOTNOTES |
*
This work was supported by Grant DK27400 from the National
Institutes of Health.The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
To whom correspondence should be addressed: Dept. of Biochemistry
and Molecular Biology, University of Texas-Houston Medical School, P.O.
Box 20708, Houston, TX 77225. Tel.: 713-500-6055; Fax: 713-500-0652;
E-mail: Julia.E.Lever@uth.tmc.edu.
Published, JBC Papers in Press, August 18, 2000, DOI 10.1074/jbc.M005040200
 |
ABBREVIATIONS |
The abbreviations used are:
SGLT, Na+-coupled glucose transporter;
PKA, protein kinase A;
PKC, protein kinase C;
GAPDH, glyceraldehyde-3-phosphate dehydrogenase;
IBMX, 3-isobutyl-1-methylxanthine;
TPA, phorbol
12-O-tetradecanoate 13-acetate;
UTR, untranslated region;
URE, U-rich element;
nt, nucleotide(s);
DTT, dithiothreitol;
bp, base pair(s);
PAGE, polyacrylamide gel electrophoresis;
kb, kilobase(s).
 |
REFERENCES |
| 1.
|
Wright, E. M.,
Hager, K. M.,
and Turk, E.
(1992)
Curr. Opin. Cell Biol.
4,
696-702
|
| 2.
|
Silverman, M.
(1991)
Annu. Rev. Biochem.
60,
757-794
|
| 3.
|
Lee, W. S.,
Kanai, Y.,
Wells, R. G.,
and Hediger, M. A.
(1994)
J. Biol. Chem.
269,
12032-12039
|
| 4.
|
Dominguez, J. H.,
Song, B.,
Maianu, L.,
Garvery, W. T.,
and Qulali, M.
(1994)
J. Am. Soc. Nephrol.
5,
S29-S36
|
| 5.
|
Amsler, K.,
and Cook, J. S.
(1982)
Am. J. Physiol.
242,
C94-C101
|
| 6.
|
Ohta, T.,
Isselbacher, K. J.,
and Rhoads, D. B.
(1990)
Mol. Cell. Biol.
10,
6491-6499
|
| 7.
|
Yet, S. F.,
Kong, C. T.,
Peng, H.,
and Lever, J. E.
(1994)
J. Cell. PhysioL.
158,
506-512
|
| 8.
|
Shioda, T.,
Ohta, T.,
Isselbacher, K. J.,
and Rhoads, D. B.
(1994)
Proc. Natl. Acad. Sci. U. S. A.
91,
11919-11923
|
| 9.
|
Peng, H.,
and Lever, J. E.
(1995)
J. Biol. Chem.
270,
20536-20542
|
| 10.
|
Peng, H.,
and Lever, J. E.
(1995)
J. Biol. Chem.
270,
23996-24003
|
| 11.
|
Peng, H.,
and Lever, J. E.
(1993)
J. Cell. Physiol.
154,
238-247
|
| 12.
|
Schreiber, E.,
Matthias, P.,
Muller, M. M.,
and Schaffner, W.
(1989)
Nucleic Acids Res.
17,
6419
|
| 13.
|
Atkins, R. E.,
and Tuen, R. S.
(1992)
BioTechniques
12,
496-499
|
| 14.
|
You, Y.,
Chen, C. Y.,
and Shyu, A. B.
(1992)
Mol. Cell. Biol.
12,
2931-2940
|
| 15.
|
Xu, N.,
Loflin, P.,
Chen, C. Y.,
and Shyu, A. B.
(1998)
Nucleic Acids Res.
26,
558-565
|
| 16.
|
Shyu, A. B.,
Belasco, J. G.,
and Greenberg, M. E.
(1991)
Genes Dev.
5,
221-231
|
| 17.
|
Maniatis, T.,
Fritsch, E. F.,
and Sambrook, J.
(1989)
Molecular Cloning: A Laboratory Manual
, 2nd Ed.
, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
|
| 18.
|
Chen, C. Y.,
and Shyu, A. B.
(1995)
Trends Biochem. Sci.
20,
465-470
|
| 19.
|
Greenberg, M. E.,
Hermanowski, A. L.,
and Ziff, E. B.
(1986)
Mol. Cell. Biol.
6,
1050-1057
|
| 20.
|
Fan, X. C.,
and Steitz, J. A.
(1999)
Proc. Natl. Acad. Sci. U. S. A.
96,
5-7
|
| 21.
|
Jacobson, A.,
and Peltz, S. W.
(1996)
Annu. Rev. Biochem.
65,
693-739
|
| 22.
|
Aharon, T.,
and Schneider, R. J.
(1993)
Mol. Cell. Biol.
13,
1971-1980
|
| 23.
|
Savant-Bhonsale, S.,
and Cleveland, D. W.
(1992)
Genes Dev.
6,
1927-1939
|
| 24.
|
Wickens, M.,
Anderson, P.,
and Jackson, R. J.
(1997)
Curr. Opin. Genet. Dev.
7,
220-232
|
| 25.
|
Chen, M.,
Schnermann, J.,
Smart, A. M.,
Brosius, F. C.,
Killen, P. D.,
and Briggs, J. P.
(1993)
J. Biol. Chem.
268,
24138-24144
|
| 26.
|
Tillmann-Bogush, M.,
Heaton, J. H.,
and Gelehrter, T. D.
(1999)
J. Biol. Chem.
274,
1172-1179
|
| 27.
|
Kaestner, K. H.,
Flores-Riveros, J. R.,
McLenithan, J. C.,
Janicot, M.,
and Lane, M. D.
(1991)
Proc. Nat. Acad. Sci. U. S. A.
88,
1933-1937
|
| 28.
|
Short, S.,
Tian, D.,
Short, M. L.,
and Jungmann, R. A.
(2000)
J. Biol. Chem.
275,
12963-12969
|
| 29.
|
Huang, D.,
Hubbard, C. J.,
and Jungmann, R. A.
(1995)
Mol. Endocrinol.
9,
994-1004
|
| 30.
|
Ma, W. J.,
Cheng, S.,
Campbell, C.,
Wright, A.,
and Furneaux, H.
(1996)
J. Biol. Chem.
271,
8144-8151
|
| 31.
|
Myer, V. E.,
Fan, X. C.,
and Steitz, J. A.
(1997)
EMBO J.
16,
2130-2139
|
| 32.
|
Zhang, W.,
Wagner, B. J.,
Ehrenman, K.,
Schaefer, A. W.,
DeMaria, C. T.,
Crater, D.,
DeHaven, K.,
Long, L.,
and Brewer, G.
(1993)
Mol. Cell. Biol.
13,
7652-7665
|
| 33.
|
Fan, X. C.,
and Steitz, J. A.
(1998)
EMBO J.
17,
3448-3460
|
| 34.
|
Peng, S. S.,
Chen, C. Y.,
Xu, N.,
and Shyu, A. B.
(1998)
EMBO J.
17,
3461-3470
|
| 35.
|
Loflin, P.,
Chen, C.-Y.,
and Shyu, A. B.
(1999)
Genes Dev.
13,
1884-1897
|
| 36.
|
Gallouzi, I. E.,
Brennan, C. M.,
Stenberg, M. G.,
Swanson, M. S.,
Eversole, A.,
Maizels, N.,
and Steitz, J. A.
(2000)
Proc. Natl. Acad. Sci. U. S. A.
97,
3073-3078
|
| 37.
|
Tholanikunnel, B. G.,
and Malbon, C. C.
(1997)
J. Biol. Chem.
272,
11471-11478
|
| 38.
|
Blaxall, B. C.,
Pellett, A. C.,
Wu, S. C.,
Pende, A.,
and Port, J. D.
(2000)
J. Biol. Chem.
275,
4290-4297
|
| 39.
|
Abdul-Manan, N.,
and Williams, K. R.
(1996)
Nucleic Acids Res.
24,
4063-4070
|
| 40.
|
Spicher, A.,
Guicherit, O. M.,
Duret, L.,
Aslanian, A.,
Sanjines, E. M.,
Denko, N. C.,
Giaccia, A. J.,
and Blau, H. M.
(1998)
Mol. Cell. Biol.
18,
7371-7382
|
| 41.
|
Duret, L.,
and Bucher, P.
(1997)
Curr. Opin. Struct. Biol.
7,
399-406
|
| 42.
|
Yang, Q.,
McDermott, P. J.,
Duzic, E.,
Pleij, C. W.,
Sherlock, J. D.,
and Lanier, S. M.
(1997)
J. Biol. Chem.
272,
15466-15473
|
| 43.
|
Tarun, S. Z., Jr.,
Wells, S. E.,
Deardorff, J. A.,
and Sachs, A. B.
(1997)
Proc. Natl. Acad. Sci. U. S. A.
94,
9046-9051
|
| 44.
|
Tarun, S. Z., Jr.,
and Sachs, A. B.
(1996)
EMBO J.
15,
7168-7177
|
| 45.
|
Le, H.,
Tanguay, R. L.,
Balasta, M. L.,
Wei, C. C.,
Browning, K. S.,
Metz, A. M.,
Goss, D. J.,
and Gallie, D. R.
(1997)
J. Biol. Chem.
272,
16247-16255
|
| 46.
|
Afonina, E.,
Stauber, R.,
and Pavlakis, G. N.
(1998)
J. Biol. Chem.
273,
13015-13021
|
| 47.
|
Danner, S.,
Frank, M.,
and Lohse, M. J.
(1998)
J. Biol. Chem.
273,
3223-3229
|
| 48.
|
Kash, J. C.,
and Menon, K. M. J.
(1998)
J. Biol. Chem.
273,
10658-10664
|
| 49.
|
Tian, D.,
Huang, D.,
Short, S.,
Short, M. L.,
and Jungmann, R. A.
(1998)
J. Biol. Chem.
273,
24861-24866
|
| 50.
|
Henderson, B.,
Menotti, E.,
Bonnard, C.,
and Kuhn, L.
(1994)
J. Biol. Chem.
269,
17481-17489
|
| 51.
|
Gao, F. B.,
Carson, C. C.,
Levine, T.,
and Keene, J. D.
(1994)
Proc. Natl. Acad. Sci. U. S. A.
91,
11207-11211
|
Copyright © 2000 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
J. P. Katz, N. Perreault, B. G. Goldstein, H.-H. Chao, R. P. Ferraris, and K. H. Kaestner
Foxl1 null mice have abnormal intestinal epithelia, postnatal growth retardation, and defective intestinal glucose uptake
Am J Physiol Gastrointest Liver Physiol,
October 1, 2004;
287(4):
G856 - G864.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. R. McMullen, E. Cocuzzi, M. Hatzoglou, and L. E. Nagy
Chronic Ethanol Exposure Increases the Binding of HuR to the TNF{alpha} 3'-Untranslated Region in Macrophages
J. Biol. Chem.,
October 3, 2003;
278(40):
38333 - 38341.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. C. Mitchell and N. H. Ing
Estradiol Stabilizes Estrogen Receptor Messenger Ribonucleic Acid in Sheep Endometrium via Discrete Sequence Elements in Its 3'-Untranslated Region
Mol. Endocrinol.,
April 1, 2003;
17(4):
562 - 574.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
I. Yaman, J. Fernandez, B. Sarkar, R. J. Schneider, M. D. Snider, L. E. Nagy, and M. Hatzoglou
Nutritional Control of mRNA Stability Is Mediated by a Conserved AU-rich Element That Binds the Cytoplasmic Shuttling Protein HuR
J. Biol. Chem.,
October 25, 2002;
277(44):
41539 - 41546.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Korn, T. Kuhlkamp, C. Track, I. Schatz, K. Baumgarten, V. Gorboulev, and H. Koepsell
The Plasma Membrane-associated Protein RS1 Decreases Transcription of the Transporter SGLT1 in Confluent LLC-PK1 Cells
J. Biol. Chem.,
November 21, 2001;
276(48):
45330 - 45340.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 2000 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|