HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

J. Biol. Chem., Vol. 275, Issue 44, 34306-34313, November 3, 2000

This Article Abstract Full Text (PDF) All Versions of this Article: 275/44/34306    most recent M003880200v1 Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Montano, M. M. Articles by Bianco, N. R. Search for Related Content PubMed PubMed Citation Articles by Montano, M. M. Articles by Bianco, N. R. Social Bookmarking                      What's this?

Identification and Characterization of a Novel Factor That Regulates Quinone Reductase Gene Transcriptional Activity^*

Monica M. Montano, Bryan M. Wittmann, and Nicole R. Bianco

From the Department of Pharmacology, Case Western Reserve University, Cleveland, Ohio 44122

Received for publication, May 8, 2000, and in revised form, July 18, 2000

	ABSTRACT

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

The regulation of the quinone reductase (QR) gene as well as other genes involved in detoxification is known to be mediated by an electrophile/antioxidant response element (EpRE/ARE). We have previously observed that QR is up-regulated by the antiestrogen trans-hydroxytamoxifen in breast cancer cells. QR gene regulation by the antiestrogen-occupied estrogen receptor (ER) is mediated by the EpRE-containing region of the human QR gene, and the ER is one of the complex of proteins that binds to the EpRE. In an effort to further understand the mechanism for ER regulation of QR gene we identified other protein factors that regulate QR gene transcriptional activity in breast cancer cells. One of these protein factors, hPMC2 (human homolog of Xenopus gene which prevents mitotic catastrophe), directly binds to the EpRE and interacts with the ER in yeast genetic screening and in vitro assays. Interestingly hPMC2 interacts more strongly to ER when compared with ER. In transient transfection assays using reporter constructs containing the EpRE, hPMC2 alone can slightly activate reporter in ER-negative MDA-MB-231 breast cancer cells. The activation of QR gene activity by hPMC2 is enhanced in the presence of ER.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Phase 2 detoxification enzymes such as NAD(P)H:(quinone-acceptor) oxidoreductase (quinone reductase (QR)),¹ glutathione S-transferases (GSTs), epoxide hydrolase, and UDP-glucuronosyltransferases are induced in cells by electrophilic compounds and phenolic antioxidants (reviewed in Refs. 1 and 2). These widely distributed enzymes detoxify electrophiles, thereby protecting cells against the toxic and neoplastic effects of carcinogens. We have previously shown that increases in QR enzyme activity can be induced by low concentrations of antiestrogens in breast cancer cells (3). Induction of QR enzymatic activity showed unusual reversed pharmacology, being markedly up-regulated by antiestrogen and suppressed by estrogen in breast cancer cells. The antiestrogen regulation of quinone reductase enzymatic activity represents a potentially important pharmacological mechanism for this group of anticancer drugs that had not been previously recognized.

The electrophile response element (EpRE) motif has been identified in the regulatory region of the genes encoding QR and the GST-Ya subunit (4, 5). This element has been shown to mediate basal expression and its activation by phenolic antioxidants (6-10), and it appears to be essential for antiestrogen stimulation (3). QR expression is up-regulated at the transcriptional level through the EpRE by antiestrogen-liganded estrogen receptor (ER). Interestingly ER is a more potent activator of QR gene transcriptional activity than ER. Gel shift assays suggest that antiestrogen-mediated induction of QR gene transcriptional activity in MCF7 cells involves a direct transcriptional effect where ER or ER are components of the protein complex that binds the EpRE. However several aspects of antiestrogen regulation of QR transcriptional activity cannot be attributed solely to ER binding to the EpRE and remain to be investigated. This is especially true in light of our previous observations that 1) the time course of induction of QR enzyme activity is relatively slow (with increases in QR mRNA first detectable at 12-16 h after antiestrogen treatment of MCF7 cells (3)), 2) antiestrogen activation of GST Ya gene transcriptional activity is mediated through an EpRE that is not homologous to the ERE (3), and 3) the interaction of the ER with the EpRE is weak, and the EpRE interacts with additional proteins (12). Clearly the regulation by antiestrogen-liganded ER may be also attributable to changes in the levels and/or the activity of other factors. Thus studies, now reported here, were conducted to further dissect the molecular mechanism(s) involved in antiestrogen induction of QR activity and identify other transcriptional factors involved in this regulation.

We used yeast genetic screenings to identify protein factors that fulfill two criteria, the ability to bind to the EpRE and interact with the ER. We report the identification and characterization of hPMC2 as a factor that fulfills these two criteria in yeast genetic screenings as well as in vitro assays. Although only a slight up-regulation of QR gene transcriptional activity was observed with hPMC2, antiestrogen-liganded ER enhanced hPMC2-mediated activation of QR transcriptional activity.

	EXPERIMENTAL PROCEDURES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Chemicals and Materials-- Cell culture media were purchased from Life Technologies, Inc. Calf serum was from Hyclone Laboratories (Logan, UT), and fetal calf serum was from Sigma. The antiestrogen trans-hydroxytamoxifen (TOT) was obtained from Sigma. tert-Butylhydroquinone was obtained from Aldrich. Custom oligonucleotides were purchased from Genosys (Grand Island, NY).

Plasmids-- The reporter constructs for one-hybrid screenings were constructed by cloning one copy of the EpRE into the pHISi-1 and pLacZi vector (CLONTECH, Palo Alto, CA) to make EpRE-pHISi-1 and EpRE-pLacZi. The following oligonucleotides, which contain the 476 to 437 region of the human QR gene, were used: EpRE-1, 5'-AATTAAATCGCAGTCACAGTGACTCAGCAGAATCTGAGCCTAGG -3'; EpRE-2, 5'-TCGACCTAGGCTCAGATTCTGCTGAGTCACTGTGACTGCGATTT-3'; EpRE-3, 5'-CGCGCCTAGGCTCAGATTCTGGTGAGTCACTGTGACTGCGATTT-3'. EpRE 1 and 2 were annealed, gel-purified, and cloned into EcoRI/SalI-digested pLacZi vector. EpRE 1 and 3 were annealed, gel-purified, and cloned into EcoRI/MluI-digested pHISi-1. The oligonucleotides containing mutated EpRE, 5'-AATTAAATCGCAGTCACAGGTCAGACGCAGAATCTGAGCCTAGG-3' and 5'-TCGACCTAGGCTCAGATTCTGCGTCTGACCTGTGACTGCGATTT-3', were annealed, gel-purified, and cloned into EcoRI/SalI-digested pLacZi vector to make EpRE_mut-pLacZi.

pNQO1CAT 0.863 (containing 863 base pairs of the QR gene promoter, which contains one copy of the EpRE between 476 and 437), pNQO1 CAT 0.365 (containing 365 base pairs of the QR gene promoter and missing the EpRE), pNQO1hARE-tk-CAT (containing the region between 476 and 446 of the QR gene promoter introduced upstream of the thymidine kinase gene promoter in the pBLCAT2 vector), pNQO1hARE_(mut)-tk-CAT (containing a mutated TRE element), and pNQO1hARE_(mut2)-tk-CAT (containing a mutated TRE-like element) have been described previously (9, 10, 12).

The partial hPMC2 clone, pAD-GAL4-2.1-hPMC2(139-422), obtained from yeast two-hybrid screening contains amino acids 139-422 of human homolog of XPMC2 cloned in-frame with the activation domain of GAL4 in the pAD-GAL4-2.1 phagemid vector (Stratagene, La Jolla, CA). The partial cDNA clone was released by BamHI/SalI digestion and inserted in-frame with the FLAG epitope into BamHI/SalI-digested pCMV-Tag2B vector (Stratagene) to make pCMV-Tag2B-hPMC2(139-422). cDNA encoding amino acids 1-204 was obtained using Access reverse transcriptase-PCR kit from Promega (Madison, WI). Briefly, DNA-free RNA was obtained by treatment of total RNA with DNaseI in the presence of placental RNase inhibitor for 30 min at 37 °C. After phenol/chloroform extraction and ethanol precipitation, reverse transcriptase-PCR reactions were performed for each RNA sample using 0.25 µg of DNA-free total RNA in 1× reaction buffer, 0.2 mM each of dATP, dCTP, dGTP, and dTTP, 1 mM MgSO₄, 5 units of avian myeloblastosis virus reverse transcriptase, 5 units of Tfl DNA polymerase, and 1 µM each of upstream primer (CGGCCCAGGCGCTGGACGGCAG) and downstream primer (CTATGGCAGCTTCGATATCCGGTG). The first strand cDNA synthesis reactions were performed at 48 C for 45 min, 94 C for 2 min. The second strand cDNA synthesis and PCR amplification reactions were performed at 40 cycles of 94 °C for 30 s, 60 °C for 1 min, 68 °C for 2 min, followed by a final extension step at 68 °C for 7 min. Amplified cDNA was run on a 1.2% agarose gel and purified using the QIAEX kit from Qiagen (Chatsworth, CA). The cDNA was then cloned into the pCR-Blunt II-TOPO vector to make pCRII-TOPO-hPMC2(1-204) using the Zero Blunt TOPO PCR cloning kit from Invitrogen (Carlsbad, CA) and sequenced using the Sequenase Kit (U. S. Biochemical Corp.).

To construct a mammalian expression vector for full-length hPMC2 cDNA, pCRII-TOPO-hPMC2(1-204) was digested with BamHI and EcoRV to release the fragment encoding amino acids 1-204. The fragment was then inserted in-frame with the FLAG epitope at the 5' end and in-frame with amino acids 205-422 at the 3' end into BamHI/EcoRV-digested pCMV-Tag2B-hPMC2(139-422) to make pCMV-Tag2B-hPMC2. pGEX2T-hPMC2, which encodes full-length and FLAG-epitope tagged hPMC2 in-frame with GST was constructed by NotI/XhoI digestion of pCMV-Tag2B-hPMC2. The insert, which contains cDNA encoding full-length FLAG-hPMC2, was blunted with Klenow and inserted into BamHI-digested and -blunted pGEX2T (Amersham Pharmacia Biotech). pEGFP-hPMC2, which encodes full-length hPMC2 in-frame with the coding sequence for green fluorescent protein (GFP), was constructed by BamHI/XhoI digestion of pCMV-Tag2B-hPMC2. The insert was blunted and cloned into BglII-digested and -blunted pEGFP-C3 vector (CLONTECH).

The expression vectors for the wild type human estrogen receptor  and  have been described previously (12, 13). To construct pBD-GAL4-ER(EF), which encodes the EF domain of ER cloned in-frame with the DNA binding domain of GAL4, CMV-ER was digested with KpnI/SmaI, blunted, and inserted into SalI-digested, blunted pBD-GAL4-Cam (Stratagene). To construct pGEX2T-ER, which encodes full-length and FLAG epitope-tagged ER in-frame with GST, FLAG-ER-BSII-SK+ was digested with XbaI/HindIII. The insert was blunted and cloned into BamHI-digested and -blunted pGEX2T. The plasmid pCMV (CLONTECH), which encodes the -galactosidase gene, was used as an internal control for transfection efficiency in all experiments.

Yeast Genetic Screenings-- To identify putative EpRE-interacting proteins, the EpRE-containing reporter vectors, EpRE-pHISi-1 and EpRE-pLacZi (CLONTECH), were integrated into the yeast strain YM4271 genome sequentially. As a negative control the mutated EpRE-containing reporter vector, EpRE_mut-pLacZi, was introduced separately into the YM4271 yeast strain. Yeast cells containing the EpRE-pHISi-1 and EpRE-pLacZi reporter vectors were cotransformed with a human MCF7 (a breast cancer epithelial cell line) cDNA library in pAD-GAL4 (14) and plated on media lacking histidine and supplemented with 50 mM 3-aminotriazole. 3-Aminotriazole is a competitive inhibitor of the yeast HIS3 protein, which suppresses the basal level of expression of HIS3. -Galactosidase activities were determined from HIS3⁺ colonies using both filter lift or liquid assays (14).

HIS3⁺ colonies exhibiting high -galactosidase activity (LacZ⁺ colonies) were further tested for interaction with the estrogen receptor. The yeast two hybrid screenings used to test interactions of putative EpRE-interacting clones with the estrogen receptor were described previously (14). To establish interaction of promising clones with ER, a standard two-hybrid strategy was used wherein library plasmids encoding putative EpRE-interacting clones were also transformed into YRG2 yeast strain containing pBD-GAL-ER(EF) and plated into media lacking histidine. -Galactosidase activities were determined from HIS3⁺ colonies.

To recover library plasmids, total DNA from HIS3⁺, LacZ⁺ colonies was isolated and used to transform Escherichia coli (XLI-Blu MRF' strain from Stratagene). To ensure that the correct cDNAs were isolated, library plasmids were transformed back into the YM4271 yeast strain containing EpRE-pHISi-1 and EpRE-pLacZi, or EpRE_mut-pLacZi reporter vectors, plated onto media lacking histidine, and tested for -galactosidase activity. The cDNAs were also transformed back into the YRG2 yeast strain containing pBD-GAL-ER(EF).

Purification of hPMC2 Protein-- Crude extracts were obtained from E. coli transformed with pGEX2T-hPMC2 or pGEX2T-ER and induced with isopropyl--D-thiogalactopyranoside (Promega). Five hundred micrograms of crude extract containing GST fusion proteins were incubated overnight at 4 °C with 50 µl of glutathione-Sepharose beads (50% slurry; Amersham Pharmacia Biotech). After three washes with 1 ml of NET (150 mM NaCl, 5 mM EDTA, 50 mM Tris, pH 7.4), the beads were incubated overnight at 4 °C with 25 µl (or 1.25 units) of thrombin protease in 1× PBS. After protease treatment, the beads were spun down, and the supernatants, which contain purified hPMC2 or ER, were collected. Aliquots of the protein samples were analyzed by SDS-polyacrylamide gel electrophoresis protein assay kit (Pierce) before being utilized in gel shift assays to check protein quality and relative purity and total protein concentration in extracts, respectively. As a negative control, crude extracts from E. coli transformed with pGEX2T (i.e. lacking hPMC2 or ER coding sequence) were subjected to the same purification and protease treatment procedure.

Gel Shift Assays-- The single-stranded oligomers, either 5'-AAT TAA ATC GCA GTC ACA GTG ACT CAG CAG AAT CTG AGC CTA GG -3', which contains the 476 to 437 region of the human QR gene or 5'-AGC TAG TCA GGT CAC AGT GAC CTG ATC-3', which contains the consensus ERE, were annealed to their complement. The resultant double-stranded oligomer was gel-purified on a nondenaturing 4.5% polyacrylamide gel run in 0.5× Tris-buffered EDTA. The ability of purified protein(s) to bind to the EpRE was analyzed using gel mobility shift assays as described previously (12). Briefly, 4 µl (10-100 ng) of purified proteins were mixed with 1 ng of end-labeled EpRE oligomer in the presence of 0.4 µg/µl dI-dC, 20 mM HEPES, 200 mM KCl, 10 mM MgCl₂, 2 mM dithiothreitol, 2 mM EDTA, 20% glycerol, 1 µg/µl bovine serum albumin and incubated at room temperature for 20 min. The specificity of binding was assessed by competition with excess unlabeled double-stranded EpRE, mutated EpRE, or ERE. The non-denaturing gels used to analyze the protein-DNA complexes were run as described previously (15). The FLAG antibody M2 was obtained from Sigma. The ER polyclonal antibody was obtained from the laboratory of Benita S. Katzenellenbogen (University of Illinois, Champaign-Urbana, IL).

In Vitro Transcription and Translation-- In vitro transcription and translation of ER and ER were performed using the Promega TNT kit. Briefly, 1 µg of ER-BSII-SK+ or ER-BSII-SK+ (12) were mixed with 25 µl of TNT rabbit reticulocyte lysate, 2 µl of TNT buffer, 1 µl of amino acid mixture, 1 µl of T3 RNA polymerase (20 U/µl), and 4 µl of [³⁵S]methionine (15 µCi/µl; ICN, Costa Mesa, CA). The final reaction of 50 µl was incubated for 90 min at 30 °C.

GST Pull-down Assays-- For the in vitro interaction assays, 500 µg of E. coli bacteria crude extracts containing GST-hPMC2 fusion protein were incubated at 4 °C with 50 µl of glutathione-Sepharose beads (50% slurry; Amersham Pharmacia Biotech) for 2.5 h. After two washes with 1 ml of NENT (100 mM NaCl, 1 mM EDTA, 0.5% Nonidet P-40, 20 mM Tris, pH 7.9, 0.5% milk) and two washes with 1 ml of binding buffer (20 mM HEPES, pH 7.9, 10% v/v glycerol, 60 mM NaCl, 1 mM dithiothreitol, 6 mM MgCl₂, 1 mM EDTA), the beads were incubated with 5 µl of in vitro translated ER or ER overnight at 4 °C. The beads were then washed 3 times with 1 ml of NET and 2 times with 1 ml of binding buffer. After washing, bound protein was eluted with 10 mM reduced glutathione in 50 mM Tris-HCl, pH 8.0, and boiled in SDS sample buffer. The protein samples were then analyzed by SDS-polyacrylamide gel electrophoresis. The gel was dried, and radiolabeled protein was detected by autoradiography.

Cell Culture and Transfections-- MDA-MB-231 and HepG2 cells were maintained and transfected as described previously (3, 16). Cells were seeded for transfection in a 100-mm dish in improved minimum essential media minus phenol red containing 5% charcoal dextran treated calf serum. Cells at 30-50% confluence were transfected by the CaPO₄ coprecipitation method 48 h later with 2 µg of EpRE (wild type or mutant)-containing reporter constructs, ER expression vector, hPMC2 expression vector, and 1.5 µg of pCMV -galactosidase internal control plasmid. Carrier DNA pTZ19R was added to adjust the total DNA to 15 µg. Cells remained in contact with the precipitate for 5 h and were then subjected to a 2.5-min glycerol shock (20% glycerol in improved minimum essential media minus phenol red plus 5% charcoal dextran treated calf serum). Cells were rinsed with Hepes-buffered saline solution and given fresh media with or without hormones. All cells were harvested 24 h after hormone treatment. Extracts were prepared in 200 µl of 250 mM Tris HCl, pH 7.5, using three freeze-thaw cycles. -Galactosidase activity, which was measured to normalize for transfection efficiency, and CAT activity were assayed as described previously (17).

Intracellular Localization of hPMC2-- The pEGFP-hPMC2 vector was transfected into MDA-MB-231 cells as described above. As a control, separate plates of cells were transfected with pEGFP-C3 vector alone. Twenty-four hours after glycerol shock, the cells were observed by both phase contrast and fluorescence microscopy.

Statistical Analysis-- Data were evaluated by analysis of variance and tested for statistical significance using Student's t test.

	RESULTS

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Identification of EpRE Binding and ER-interacting Factors Using the Yeast One/Two-hybrid Screening-- Yeast genetic screenings were used to identify protein factors expressed in breast cancer cells that bind to the EpRE as well as interact with the ER. One copy of EpRE (representing the 476 and 446 region of the QR gene) was cloned upstream of the LacZ and HIS3 reporter gene promoter followed by genomic integration of reporter constructs into yeast cells. cDNA libraries from MCF7 breast cancer cells were screened for expression of putative EpRE-interacting clones by their ability to activate LacZ and HIS3 reporter gene constructs. To verify the interaction of these clones with the EpRE we mutated the 5-base pair core sequence that is well conserved among the EpREs identified from different genes. Because protein factors that modulate the transcriptional activation of the QR gene by antiestrogens most likely interact with the ER, putative EpRE-interacting clones were also screened for their ability to interact with the ER. Clones were introduced into yeast cells expressing the EF domain of human ER fused to the GAL4 DNA binding domain, and their interaction was measured by the ability of the clones to activate a reporter construct containing the GAL4 upstream activating sequence. Of eight putative EpRE interacting clones identified, one clone was selected for further analyses because of strong binding to the EpRE and interaction with ER in two separate yeast screenings (Fig. 1).

View larger version (39K): [in this window] [in a new window]   Fig. 1.   Yeast genetic screenings. UAS, upstream-activating sequence.

The sequence of the putative EpRE- and ER-interacting clone was determined, and GenBank^TM and literature searches indicated that the clone was the human homologue of the Xenopus laevis gene, which prevents mitotic catastrophe, XPMC2 (18). The partial hPMC2 clone obtained from yeast two hybrid screening contains amino acids 139-422 of human PMC2. cDNA encoding amino acids 1-138 was obtained using reverse transcriptase-PCR and fused with the rest of the coding region. The full-length hPMC2 gene encodes a 47-kDa protein that prevents premature entry into mitosis (termed mitotic catastrophe) in fission yeast (19). hPMC2 has 422 amino acids and is basic with many lysine residues. An exonuclease domain has been identified at the carboxyl-terminal region (amino acids 233-406 (20)). hPMC2 also has a P-loop motif (Gly-X-Gly-X-X-Gly) with a well conserved lysine at amino acid residues 252-257, indicative of an ATP binding domain (21). Several potential phosphorylation sites for protein kinase C are localized from amino acids 9 to 98, as well as a tyrosine phosphorylation site at amino acids 342-350. The carboxyl-terminal region of hPMC2 also shows homology to two other known proteins: HEM45, an estrogen regulated transcript in human tumor lines and rat uterus (22), and ISG20, an interferon-induced promyelocytic leukemia protein nuclear body-associated protein (23).

hPMC2 Interacts with the ER and Binds to the EpRE in in Vitro Assays-- The interaction of hPMC2 with the ER and ER was examined in vitro in GST pull-down assays. In vitro translated and radiolabeled ER was retained in a column wherein hPMC2 was expressed as a fusion protein with GST bound to a glutathione-Sepharose, indicating a direct interaction between hPMC2 and ER (Fig. 2). The interaction of hPMC2 with ER appears to be stronger when compared with its interaction to ER. With regard to the effects of ligand on the interaction of ER with hPMC2, the strength of interaction of hPMC2 with ER can be described as follows: tamoxifen-liganded ER = unliganded ER > estrogen-liganded ER.

View larger version (39K): [in this window] [in a new window]   Fig. 2.   hPMC2 interacts with ER. In vitro-translated [35S]methionine-labeled ER (lanes 2-4) and ER (lanes 6-8) were incubated with GST-hPMC2 bound to Sepharose beads in the presence of control vehicle (), estradiol (E, 106 M), or trans-hydroxytamoxifen (T, 106 M). Bound protein was eluted and analyzed by 12.5% SDS-polyacrylamide gel electrophoresis. Lanes 1 and 5 are the input lanes and represent 10% of total in vitro translated products added in samples 2-4 and 6-8. The numbers at the left indicate molecular size markers in kilodaltons. The autoradiograph is representative of three separate experiments.

To verify binding of hPMC2 to the EpRE, the interaction of purified FLAG-hPMC2 protein (Fig. 3A) with radiolabeled EpRE was examined in gel shift assays. A shifted DNA-protein complex is evident in samples containing purified hPMC2 but not with control extracts (Fig. 3B). Binding of hPMC2 to the EpRE occurred in a dose-dependent manner. The DNA-protein complex was competed by excess amounts of unlabeled EpRE but not mutated EpRE or wild type ERE (Fig. 3C). A supershifted complex was observed in the presence of FLAG antibody. These studies indicate that hPMC2 interacted with the EpRE in a specific manner. Because our GST pull-down assays indicate the hPMC2 interacts with ER and more strongly so than with ER, we examined the effect of purified ER (Fig. 3A) on the ability of hPMC2 to bind to the EpRE. When purified hPMC2 was coincubated with purified ER, we observed a more intense DNA-protein complex band as well as supershifted bands when compared with hPMC2 alone (Fig. 3D). Increased binding was observed in the absence of ligand and in the presence of the antiestrogen TOT. These results suggest an enhancement of the ability of hPMC2 to bind to the EpRE in the presence of ER. The DNA-protein complex observed in the presence of hPMC2 and ER was slightly supershifted and immunodepleted in the presence of ER antibody (Fig. 3D), suggesting that an interaction between ER and hPMC2 is involved in the enhancement of hPMC2 binding to the EpRE.

View larger version (39K): [in this window] [in a new window]   Fig. 3.   hPMC2 binds directly to the EpRE. A, Coomassie-stained gel showing 100 ng each of purified ER and hPMC2. B, gel mobility shift assays were performed using radiolabeled EpRE representing the 476 to 437 region of the human QR gene with control extract (thrombin protease-digested GST lacking hPMC2 or ER (lane 1)) or increasing concentrations (12.5, 25, 50, 100 ng) of purified hPMC2 protein (lanes 2-5). C, radiolabeled EpRE was incubated with 100 ng of purified hPMC2 protein (lanes 2-6). Competitor unlabeled EpRE (100-fold excess (lane 3)), mutated EpRE (200-fold excess (lane 4)), unlabeled ERE (200-fold excess (lane 5)), or FLAG antibody (Aby) M2 (lane 6) were included in the reaction as indicated above each lane. The position of the major shifted complex (SB) and the supershifted complex (SSB) are indicated. D, radiolabeled EpRE was incubated with purified hPMC2 and/or ER and treated with vehicle (), estradiol (E, 106 M), or TOT (T, 106 M) or ER polyclonal antibody as indicated above each lane. The position of the major shifted complex (SB) and the supershifted complex (SSB) are indicated. The autoradiographs are representative of three separate experiments.

The ability of hPMC2 to bind to the EpRE as well as interact with the ER is supported by experiments examining intracellular localization of hPMC2. Using fluorescence microscopy, we observed that transiently transfected GFP-tagged hPMC2 can be localized primarily in the nucleus (Fig. 4). GFP vector alone showed cytoplasmic and nuclear localization, and GFP-tagged prenylcysteine carboxyl methyltransferase that has been reported to exhibit primarily non-nuclear localization (24) did so under our experimental conditions.

View larger version (16K): [in this window] [in a new window]   Fig. 4.   hPMC2 is localized in the nucleus. The pEGFP-hPMC2 vector (A) or pEGFP-C3 vector alone or pEGFP-PCMT (B) were transfected into MDA-MB-231 cells as described under "Experimental Procedures." Twenty-four hours after glycerol shock, the cells were observed by fluorescence microscopy.

hPMC2 Up-regulates QR Gene Transcriptional Activity, and ER Enhances hPMC2 Activation of QR Gene Transcriptional Activity-- To determine if binding of hPMC2 to the EpRE results in the regulation of QR gene transcriptional activity in mammalian cells, hPMC2 cDNA was cloned into the pCMV-Tag2B mammalian expression vector and cotransfected with a CAT reporter construct containing the EpRE (wild type or mutated) cloned upstream of the heterologous TK promoter. These experiments were performed in ER-negative MDA-MB-231 breast cancer cells and HepG2 liver carcinoma because of the low basal or non-induced levels of QR in these cells. Increasing amounts of hPMC2 expression vector induced a slight, albeit statistically significant increase (1.7 ± 0.2, p < 0.01) in EpRE-TK-CAT activity in MDA-MB-231 cells (Fig. 5A). This represents maximal activation because further increases in the amount of hPMC2 expression vector did not increase reporter activity. Because increased hPMC2 binding to the EpRE was observed in the presence of ER, we determined if ER could enhance the activation of QR transcriptional activity by hPMC2. For these experiments we transfected levels of expression vector for ER that did not induce activation of EpRE-tk-CAT activity. Under these conditions we observe a more significant activation (3.2 ± 0.3) of EpRE enhancer activity. This level of induction is comparable with that observed with tert-butylhydroquinone, a well known chemical inducer of QR transcriptional activity, as well as that previously reported for NRF1, another activator of QR transcriptional activity (25). The level of induction is also comparable with the level of increase (2-4-fold) in QR mRNA induced by antiestrogen in breast cancer cells (12). Estradiol, which induced relatively weak binding of ER to hPMC2, did not enhance the induction of reporter activity. When cotransfected, hPMC2 and ER did not induce an increase in the activity of the CAT reporter containing mutated EpREs (Fig. 5B). Under similar transfection conditions wherein suboptimal concentrations of ER was cotransfected, hPMC2 was also able to activate EpRE activity in another cell line, HepG2 (Fig. 6A).

View larger version (28K): [in this window] [in a new window]   Fig. 5.   Enhancement of EpRE enhancer activity by hPMC2 and modulation by ER. MDA-MB-231 cells were transfected with expression vectors for hPMC2 or ER using the indicated nanogram amounts along with pNQO1hARE-tk-CAT (containing the region between 476 and 446 of the QR gene promoter introduced upstream of the thymidine kinase promoter in the pBLCAT2 vector, upper panel), pNQO1hARE(mut)-tk-CAT (containing a mutated TRE element, B), or pNQO1hARE(mut2)-tk-CAT (containing a mutated TRE-like element, B). In A, cells were treated with tert-butylhydroquinone (TBHQ) (105 M), TOT (107 M), or estradiol (108 M) for 24 h as indicated. In B, cells from the same experiments as in A were transfected with 100 ng of hPMC2 expression vector and 25 ng of ER expression vector. Cells transfected with ER expression vector were also treated with TOT (107 M) for 24 h. The cells were also transfected with the -galactosidase internal reporter to correct for transfection efficiency. Cell extracts were prepared and analyzed for CAT activity and -galactosidase activity as described under "Experimental Procedures." Values are the means +S.E. from three separate experiments.

View larger version (28K): [in this window] [in a new window]   Fig. 6.   A, hPMC2 induction of EpRE enhancer activity in HepG2 liver carcinoma cells. HepG2 cells were transfected with expression vectors for hPMC2 (200 ng) and/or ER (50 ng). The amount of expression vectors used represents the optimal concentration of hPMC2 and the suboptimal concentration of ER required for EpRE reporter activation in HepG2 cells, as determined in preliminary transfection experiments. Cells transfected with ER expression vector were also treated with TOT (107 M) for 24 h. B, hPMC2 and ER enhance QR gene transcriptional activity. MDA-MB-231 cells were transfected with the pNQO1CAT 0.863 or pNQO1CAT 0.365 reporter gene construct along with expression vectors for hPMC2 (100 ng) and/or ER (25 ng). The amount of expression vectors used represents the optimal concentration of hPMC2 and the suboptimal concentration of ER required for QR promoter reporter activation, as determined in preliminary transfection experiments. Cells transfected with ER expression vector were also treated with TOT (107 M) for 24 h. The cells were also transfected with the -galactosidase internal reporter to correct for transfection efficiency. Cell extracts were prepared and analyzed for CAT activity and -galactosidase activity as described under "Experimental Procedures." Values are the means ±S.E. from three separate experiments.

hPMC2 was then tested for its ability to regulate the activity of reporter construct containing QR gene 5' regulatory region and promoter region. No activation of this promoter was evident with hPMC2 alone, but when hPMC2 was cotransfected with suboptimal concentrations of ER, a more significant activation of the wild type EpRE-containing CAT reporter was observed (Fig. 6B). No activation by hPMC2 was observed with the reporter construct wherein the EpRE-containing region was deleted (NQO1 0.365 CAT). Thus, hPMC2 was able to activate QR gene transcriptional activity in the presence of ER, and this activation was mediated through the EpRE.

	DISCUSSION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

We report the identification of a novel EpRE binding factor using yeast genetic screenings. Binding of hPMC2 to the EpRE was verified using in vitro gel shift assays. The binding of hPMC2 to the EpRE induced an increase in EpRE enhancer activity. ER interacts with hPMC2 and enhanced hPMC2 induction of EpRE enhancer activity. Nuclear localization of hPMC2 supports the interaction of this protein with the ER as well as the ability to regulate transcription. We propose that the interaction of ER with factors that bind to the EpRE such as hPMC2 is involved in antiestrogen-liganded ER-mediated induction of QR transcriptional activity.

XPMC2 was originally cloned as a gene involved in cell cycle regulation (19). Convergence of signaling pathways involved in the control of the response to oxidative stress and mitogenic signaling pathways is supported by previous reports on the ARE-dependent induction of phase II-detoxifying enzymes by mitogen-activated protein kinase and extracellular-regulated kinase 2 kinase (26). XPMC2 prevents mitotic catastrophe in yeast resulting from disruption of Cdc2 kinase regulation of Wee1 and Mik1 kinase activities (19). Control of Cdc2 kinase is a key step in controlling cell cycle transition from G₁ to S phase and G₂ to M (27). Wee1 and Mik1 kinase negatively regulate Cdc2 kinases by phosphorylating a conserved tyrosine residue (28). XPMC2 was found to be a substrate for Cdc2 kinase, and XPMC2 acts as a negative cell cycle regulator by competing with mitotic substrates for phosphorylation by Cdc2 kinase (19). The target of XPMC2 action is unknown. hPMC2 may act as a negative cell cycle regulator by its regulation of QR transcriptional activity. The activation of anticancer quinones by QR results in enhanced cellular levels of reactive oxygen species (29). Increased levels of reactive oxygen species affects the efferent pathways involved in cell cycle control, leading to p21 induction (29). p21 induction has been correlated with a suppression of the activity of Cdc2 and other cyclin-dependent kinases associated with cyclin A.

Sequence analyses of hPMC2 indicate several functionally relevant domains that may provide clues regarding the cellular function of hPMC2. For example there is a putative exonuclease domain at amino acids 233-406. Proteins that possess exonuclease domains are involved in wide variety of cellular function in addition to transcription such as DNA replication, cell cycle progression, DNA repair and recombination, and RNA processing (20). However, disruption of the exonuclease domain by removal of amino acids 322-422 did not affect the ability of hPMC2 to bind to DNA or activate EpRE enhancer activity (data not shown). It is possible that the putative exonuclease activity is separate from the ability of hPMC2 to regulate transcription. This appears to be the case for the DNA repair enzyme HAP1/Ref1 (30). HAP1 protein, the human homologue of E. coli exonuclease III protein, not only possesses DNA repair activity but also plays a role in transcription by redox regulation of Jun DNA binding activity. It will be of interest if hPMC2 is also a bifunctional protein.

hPMC2 has a P-loop that may be involved in nucleotide binding and has been identified in other DNA-binding proteins such as core binding factors (CBFs, a family of heterodimeric transcription factors that have important roles in developmental pathways and human disease (31)) and PCRH-REB-1 (which binds to the corticotropin-releasing hormone-responsive element in the rat proopiomelanocortin gene promoter POMC corticotropin-releasing hormone-responsive element (32)). In certain cases such as the Runt domain of core binding factors, stabilization of DNA binding was observed in the presence of ATP (31). Alternatively, the nucleotide binding fold could be part of the recognition motif for DNA. Our experiments however indicate a decrease in hPMC2 binding to the EpRE upon the addition of ATP (data not shown). Verification of true inhibition of hPMC2 DNA binding awaits studies identifying the functional domains of hPMC2 that are involved in the binding to the EpRE, activation of EpRE enhancer activity, and ways in which ER modulates hPCM2 function. hPMC2 does not have the LXXLL motif that has been shown to be important for the interaction of liganded-ER with other protein factors (33). However, it has been shown that peptides without the LXXLL motif interact with tamoxifen bound-ER (34).

Our findings support a model for ER-mediated regulation of QR transcriptional activity that involves the interaction of the ER with activators of EpRE activity. Our previous findings indicate that ER is a stronger activator of QR transcriptional activity than ER (12). In the present studies we observed that hPMC2 interacts more strongly with ER when compared with ER. Thus, there is a good concordance between the ER isoform that interacts with hPMC2 and the ER isoform that induced QR transcriptional activity. However, our present studies also indicate that the interaction of hPMC2 with ER and enhancement of hPMC2 binding to the EpRE may not be the only prerequisite for activation. Although antiestrogen-liganded ER interacted strongly with hPMC2 and enhanced hPMC2 binding to EpRE, so did unliganded ER. We have previously reported that antiestrogen-liganded ER and not unliganded ER or ER bound to estrogens activates QR gene transcriptional activity (3, 12). Moreover, in the present studies unliganded ER did not enhance hPMC2 induction of QR transcriptional activity. Similarly DNA binding by the ER alone is not sufficient for full transcriptional activation and requires interaction with other coregulator factors (11). It is possible that enhancement of hPMC2 activity by ER involves other factors in addition to the ER and hPMC2. The observations that estrogen-liganded ER only exhibits weak interaction with hPMC2 and did not enhance hPMC2-mediated induction of EpRE enhancer activity suggest another intriguing possibility. It is possible that the increase in QR transcriptional activity may not only result from transcriptional activation by antiestrogen-liganded ER but the release from repressive effects of estrogen-liganded ER. Increased QR transcriptional activity in the presence of antiestrogens relative to control (untreated) levels may be partly due to the inhibition of activity of residual estrogens in the media. Studies are under way to further define the mechanism(s) involved in the activation of EpRE activity by hPMC2 and ER. We will also determine if hPMC2 can activate the transcriptional activity of other genes containing EpREs in their regulatory regions. Finally the functional implications of ER- and hPMC2-mediated regulation of QR transcriptional activity on the growth regulatory pathways in breast cancer cells are being examined.

	ACKNOWLEDGEMENTS

We thank Dr. Benita Katzenellenbogen for the ER and ER expression vectors, Dr. Inho Choi in Dr. Katzenellenbogen's laboratory for the ER polyclonal antibody, and Dr. Mark Philips for the GFP-PCMT expression vector. We are also grateful to Dr. Paul MacDonald for very helpful advice during the preparation of this manuscript.

	FOOTNOTES

^* This work was supported by National Institutes of Health Grant CA80959 (to M. M. M.).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

To whom correspondence should be addressed: Case Western Reserve University School of Medicine, Dept. of Pharmacology, H. G. Wood Bldg. W307, 2109 Adelbert Rd., Cleveland, OH 44122. Tel.: 216-368-3378; Fax: 216-368-3395; E-mail: mxm126@po.cwru.edu.

Published, JBC Papers in Press, July 24, 2000, DOI 10.1074/jbc.M003880200

	ABBREVIATIONS

The abbreviations used are: QR, quinone reductase; ER, estrogen receptor; EpRE, electrophile response element; TOT, trans-hydroxytamoxifen; ARE, antioxidant response element; ER, estrogen receptor; GST, glutathione S-transferases; PCR, polymerase chain reaction; GFP, green fluorescent protein; ERE, estrogen receptor response element; TRE, 12-O-tetradecanoylphorbol-13-acetate response element.

	REFERENCES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

CiteULike

Complore

Connotea

Del.icio.us

Digg

Reddit

Technorati

This article has been cited by other articles:

				Y. Coute, K. Kindbeiter, S. Belin, R. Dieckmann, L. Duret, L. Bezin, J.-C. Sanchez, and J.-J. Diaz ISG20L2, a Novel Vertebrate Nucleolar Exoribonuclease Involved in Ribosome Biogenesis Mol. Cell. Proteomics, March 1, 2008; 7(3): 546 - 559. [Abstract] [Full Text] [PDF]

				A. J. Krieg, E. M. Hammond, and A. J. Giaccia Functional Analysis of p53 Binding under Differential Stresses. Mol. Cell. Biol., October 1, 2006; 26(19): 7030 - 7045. [Abstract] [Full Text] [PDF]

				P. J. Ansell, C. Espinosa-Nicholas, E. M. Curran, B. M. Judy, B. J. Philips, M. Hannink, and D. B. Lubahn In Vitro and in Vivo Regulation of Antioxidant Response Element-Dependent Gene Expression by Estrogens Endocrinology, January 1, 2004; 145(1): 311 - 317. [Abstract] [Full Text] [PDF]

				L. C. Hodges, J. D. Cook, E. K. Lobenhofer, L. Li, L. Bennett, P. R. Bushel, C. M. Aldaz, C. A. Afshari, and C. L. Walker Tamoxifen Functions As a Molecular Agonist Inducing Cell Cycle-Associated Genes in Breast Cancer Cells Mol. Cancer Res., February 1, 2003; 1(4): 300 - 311. [Abstract] [Full Text] [PDF]

				H.-C. Huang, T. Nguyen, and C. B. Pickett Phosphorylation of Nrf2 at Ser-40 by Protein Kinase C Regulates Antioxidant Response Element-mediated Transcription J. Biol. Chem., November 1, 2002; 277(45): 42769 - 42774. [Abstract] [Full Text] [PDF]