 |
INTRODUCTION |
DNA double-strand breaks
(DSBs)1 are produced when
ionizing radiation creates closely spaced single-strand breaks on
opposite strands of a duplex DNA. DSBs can also be produced by the
action of radiomimetic drugs and by certain recombination
endonucleases. DSBs are among the most lethal forms of DNA damage.
Unrepaired DSBs create acentric chromosomal fragments that are lost in
subsequent cell divisions, leading to aneuploidy or cell death. All
eukaryotic cells have efficient mechanisms for DSB repair. This repair
can proceed by a recombination mechanism, mediated by the Rad51 protein and other gene products, or it can proceed via a nonhomologous end-joining pathway (1-5).
In human cells, NHEJ involves the concerted action of several proteins.
The heterodimeric Ku protein carries out the initial recognition of
broken DNA ends, forming a platform for the recruitment of other repair
proteins (6-12). The DNA-dependent protein kinase catalytic subunit binds to the initial Ku-DNA complex, inducing an
inward translocation of Ku, and leaving DNA-PKcs in direct contact with
the DNA termini (8, 13). The next steps in the repair pathway are not
as well understood. A complex of three proteins, MRE11, RAD50, and
NBS1, may be involved in resection of the ends to remove damaged
nucleotides and to expose regions of microhomology on opposite sides of
the DNA break (14-18). A complex of DNA ligase IV and the accessory
protein, XRCC4, carries out the actual ligation (19-22). There may
also be involvement of other, as yet unidentified, proteins that are
required for assembly of the repair complex, anchoring of the free DNA
ends, or coupling of repair to cellular signaling pathways. The
biochemistry of the NHEJ reaction remains incompletely understood.
Several systems have been described that permit re-creation of the
reaction in cell free extracts from somatic cells or Xenopus
eggs (23-27). However, crude systems have a limited potential for
mechanistic studies, and it is therefore an important goal to obtain
all of the components of the NHEJ system in pure and active form.
The current study focuses on the DNA ligase component. DNL IV is one of
three isoforms of nuclear DNA ligase found in human cells (28-30). DNA
ligase I is a replicative ligase required for the joining of
lagging-strand DNA fragments, and DNA ligase III is required for
nucleotide excision repair (31-34). The only known function of DNL IV
is in NHEJ (20, 35, 36). Although all three ligases are
ATP-dependent and share a conserved catalytic core, DNL IV
has several unique features (30, 34, 37, 38). Most significantly, DNL
IV has an obligate partner protein, XRCC4, is required for biological
function (39-41). Cells lacking either DNL IV or XRCC4 are
radiation-sensitive and are unable to complete V(D)J recombination,
which involves a DSB intermediate and is required for the development
of the adaptive immune system (20, 22, 42); these phenotypes are
similar to those arising from mutations in other genes in the NHEJ
pathway (43-47). Mice lacking DNL IV or XRCC4 display an additional
phenotype of a high level of apoptosis in the developing nervous system
(22, 42). The reason for this phenotype is unclear, but it could be due
to high sensitivity to unrepaired DSBs in developing neurons.
The native molecular weight of the DNL IV·XRCC4 complex is uncertain
and has been the subject of conflicting estimates (29, 39). Moreover,
although XRCC4 stabilizes DNL IV and enhances its enzymatic activity,
it is not clear if it plays a fundamental role in the reaction
mechanism, and if so, why DNL IV requires this cofactor and other
ligases do not. In the present study, we use multiple, independent
approaches to demonstrate that the active form of the DNL IV·XRCC4
complex is a heterotetramer. Cross-linking suggests that an XRCC4 dimer
forms the structural core of the complex and is therefore responsible
for maintaining the tetrameric state. We suggest that the presence of
two ligase active sites within the complex is an adaptation that
permits the two strands of DNA to be ligated in a coordinated manner.
| |
EXPERIMENTAL PROCEDURES |
Cloning of DNL IV and XRCC4 cDNAs and Creation of Recombinant
Baculoviruses--
DNL IV (accession no. AA081632) and XRCC4
(accession no. R14027) cDNA clones were obtained from the Image
Consortium (clone ID IMAGE 547947 (5') and IMAGE 26811 (5'),
respectively). The DNL IV clone contained the complete coding sequence,
which was amplified by PCR using Pfu DNA polymerase
(Stratagene, La Jolla, CA), primer 1, d(GATCGTCGACACCATGGCTGCCTCACAAACT), and primer 2, d(AATTGTCGACTTAATGATGATGATGATGATGAATCAAATACTGGTTTTC). The
primers introduced a 6-histidine tag at the 3' end of the open reading
frame and SalI sites at both ends of the amplified fragment.
This fragment was digested with SalI and inserted into the
SalI site of pCITE-4a(+) (Invitrogen, Carlsbad, CA). The
resulting plasmid was digested with BamHI and
NotI, and the DNL IV-encoding fragment was inserted at the
corresponding sites of the pVL1392 baculovirus transfer vector
(PharMingen, San Diego, CA). The DNL IV(His)6 polypeptide
has a predicted molecular mass of 104,747 Da.
In some experiments, where noted, FLAG and Myc epitope-tagged variants
of DNL IV were used. To construct these, a PCR reaction was performed
using the DNL IV-His6 clone in the pCITE-4a(+) vector as
template, primer 1, and primer 3, d(CGGACGCGTGAATCAAATACTGGTT). These
amplify the DNL IV coding sequence with deletion of the His6 tag and the addition of an MluI site at the
3' end. To construct the FLAG-tagged variant, the PCR product was
inserted into pCR-Blunt II-TOPO (Invitrogen, Carlsbad, CA), and the
resulting clone was digested with EcoRI and subcloned into
pCITE-4a(+) to provide flanking restriction sites. A short DNA fragment
downstream of the 3' end of the DNL IV gene was excised by digestion
with MluI and NotI, and a double-stranded
oligonucleotide consisting of d(CGCGTCCGACTACAAGGACGACGATGACAAGTAAGC)
and d(GGCCGCTTACTTGTCATCGTCGTCCTTGTAGTCGGA) was inserted. This results
in the addition of a FLAG epitope (DYKDDDDK) at the C terminus of DNL
IV. The resulting plasmid was digested with BamHI and
NotI, and the DNL IV-FLAG encoding fragment was inserted
into the corresponding sites of the pVL1393 baculovirus transfer vector
(PharMingen). To construct the Myc-tagged variant, PCR was performed
using DNL IV-(His)6 in pCITE-4a(+), primer 1, and primer 3. The amplified fragment was digested with SalI and MluI and was inserted into the corresponding sites of the
pMS211 vector (48). This results in the addition of three tandem Myc epitope sequences (EQKLISEEDL) at the C terminus of the protein. The
resulting plasmid was digested with SalI and NotI
to release the DNL IV-Myc coding fragment, which was inserted into the
corresponding sites of the pCITE-4a(+) vector. A
BamHI-NotI fragment was subcloned into pVL1393 as
described above.
The XRCC4 clone obtained from the Image Consortium was sequenced, and
it was determined that this clone contained only the 3' region of the
gene. In an attempt to obtain the entire gene, total HeLa cell RNA was
prepared using TRIzol (Life Technologies, Inc.) and reverse
transcription-PCR was performed using SuperScript II Reverse
Transcriptase and Taq polymerase (Life Technologies, Inc.).
The primers used for this experiment,
d(GATCGGATCCACCATGGGCTACCCATACGATGTTCCAGATTACGCTCATATGGAGAGAAAAATAAGC) and d(AGTGGGATCCTTAAATCTCATCAAAGAG), amplify the entire XRCC4 open
reading frame and introduce a hemagglutinin epitope tag at the 5' end
(YPYDVPDYA). The amplified fragment was inserted into the pCR2.1 vector
(Invitrogen, Carlsbad, CA). DNA sequencing showed that several base
changes had been introduced into the 3' region of the XRCC4 gene. To
correct these, the plasmid containing the amplified XRCC4 gene was
digested with EcoRI, and the resulting fragment was
subcloned into pCITE-4a(+). A PstI-NotI fragment encompassing the 3' region of XRCC4 was excised and replaced with a
corresponding fragment from the Image Consortium XRCC4 clone. The
resulting plasmid was digested with BamHI and
NotI, and the XRCC4-encoding fragment was subcloned into the
corresponding sites of the pVL1393 baculovirus transfer vector
(PharMingen). The HA-XRCC4 polypeptide has a predicted molecular mass
of 39,389 Da.
In some experiments, where noted, a FLAG-tagged variant of XRCC4 was
used. The plasmid containing the complete HA-XRCC4 gene in pCITE-4a(+)
was digested with NdeI and NotI to excise the
XRCC4 coding sequence (removing the HA tag), and the resulting fragment was subcloned into the corresponding sites of the pSK277 baculovirus transfer vector (49), resulting in the addition of a FLAG tag at the N terminus.
To generate viral stocks, transfer vectors encoding DNL IV and XRCC4
were transfected, together with linearized AcNPV baculovirus DNA
(PharMingen), into Sf9 insect cells using a
liposome-mediated method (Cellfectin, Life Technologies, Inc.).
Recombinant baculovirus stocks were amplified separately to a titer of
at least 5 × 107 plaque-forming units/ml. Protein
expression was confirmed by immunoblotting using anti-histidine
antibody (mAb Tetra-His; Qiagen, Valencia, CA) and anti-HA antibody
(mAb 12CA5; Roche Molecular Biochemicals).
Purification of the DNL IV·XRCC4 Complex--
Recombinant DNL
IV and XRCC4-expressing baculoviruses were used to co-infect 3 L of
Sf9 cells at a multiplicity of infection of 5. After
60 h, Sf9 cells were collected by centrifugation
and suspended in 90 ml of lysis buffer (50 mM
NaH2PO4, pH 8.0, 500 mM NaCl, 5 mM 
-mercaptoethanol, 10% glycerol). The suspension was
sonicated and then centrifuged for 1 h at 150,000 × g. The supernatant was mixed with 10 ml (packed volume) of
Ni+-NTA-agarose (Qiagen, Valencia, CA) and incubated for
4 h at 4 °C with rotation. The Ni+-NTA-agarose was
packed into a column, washed with lysis buffer, and eluted with a
linear gradient of imidazole (0-500 mM) in lysis buffer.
Fractions were analyzed by SDS-PAGE, and the presence of DNL IV and
XRCC4 was determined by immunoblotting. Fractions containing these
proteins (which eluted at approximately 0.12 M imidazole)
were pooled and dialyzed against CB buffer (50 mM Tris-HCl,
pH 7.9, 1 mM EDTA, 1 mM dithiothreitol, 0.02%
Tween 20, 5% glycerol) containing 0.35 M KCl. The dialyzed
protein (14 ml) was loaded onto a Superdex 200 (26/60) column (Amersham
Pharmacia Biotech) that had been pre-equilibrated with CB buffer
containing 0.35 M KCl. Fractions containing DNL IV and
XRCC4 were pooled and dialyzed against TM buffer (50 mM
Tris-HCl, pH 7.5, 12.5 mM MgCl2, 1 mM EDTA, 1 mM dithiothreitol, 10% glycerol)
containing 0.1 M KCl. The material from the Superdex 200 column was divided in half, and each half was loaded onto a Mono Q (HR
5/5) column pre-equilibrated with TM buffer containing 0.1 M KCl. The column was washed and eluted with a linear
gradient of KCl (0.1-0.6 M) in TM buffer. Fractions
containing DNL IV and XRCC4 (which eluted together at about 0.275 M KCl) were adjusted to 15% glycerol, aliquoted, and
stored at 
70 °C.
To purify FLAG-tagged DNL IV·XRCC4, which was used in one experiment
where noted, recombinant DNL IV-FLAG and FLAG-XRCC4-expressing baculoviruses were used to co-infect Sf9 cells. The
pellet from 0.5 liter of culture was suspended in 30 ml of lysis buffer
(as described in the preceding paragraph except with 0.1 M
NaCl), sonicated, and centrifuged. The supernatant was loaded onto a 5-ml Q-Sepharose FF column (Amersham Pharmacia Biotech), equilibrated with lysis buffer containing 0.1 M KCl. The column was
washed and eluted with lysis buffer containing 0.5 M NaCl.
Pooled DNL IV-XRCC4-containing fractions were loaded onto a Superdex
200 (16/60) column (Amersham Pharmacia Biotech) that had been
pre-equilibrated with lysis buffer containing 0.35 M NaCl.
Fractions were pooled that contained the DNL IV·XRCC4 complex
(excluding fractions containing free XRCC4), and these were subjected
to Mono Q chromatography.
Determination of Native Molecular Weight--
Gel filtration
chromatography was performed using a Superdex 200 (26/60) column
(Amersham Pharmacia Biotech) using TM buffer containing 0.275 M KCl. To construct a calibration curve, a set of standard
proteins was analyzed (high and low molecular weight gel filtration
calibration kit, Amersham Pharmacia Biotech). The Kav parameter was determined
(Kav = (Ve Vo)/(Vt Vo), where Ve represents
elution volume, Vo represents void volume, and
Vt represents total bed volume). The
Kav values for standard proteins were plotted as
a function of the logarithm of molecular weight, and the resulting
calibration curve was used to derive a molecular weight for the DNL
IV·XRCC4 complex.
Native molecular weight was also determined by the method of Ferguson
(50). Native gel electrophoresis was performed in a buffer containing
50 mM Tris base, 40 mM boric acid, and 10 mM EDTA. Standard and unknown proteins were analyzed on a
series of gels containing different concentrations of polyacrylamide (4%, 5%, 5.5%, 6%, 8%, and 10%). Relative mobility
(Rf) was calculated as the ratio of mobility of
a given protein to the mobility of bromphenol blue dye. For each
protein, a derived value, 100[log (Rf × 100)], was plotted as a function of acrylamide concentration (51, 52).
The slopes of the lines generated for each standard protein were
determined by linear regression analysis and were plotted as a function
of the logarithm molecular weight. This calibration curve (a
"Ferguson plot") was applied to determine the native molecular
weight of the DNL IV·XRCC4 complex.
Immunoprecipitation of Myc-tagged DNL
IV--
Antibody-conjugated Sepharose was prepared by incubation of
purified mAb 9E10 (gift of M. Sadofsky, Medical College of Georgia) with CNBr activated Sepharose 6MB (Amersham Pharmacia Biotech). Coupling was performed overnight at 4 °C in a buffer containing 0.1 M NaHCO3, pH 8.3, and 0.5 M NaCl.
The reaction was stopped by washing with the same buffer lacking
antibody. The beads were blocked by incubating with 1.2 M
ethanolamine for 2 h at room temperature. The beads were washed in
0.1 M NaOAc, pH 4.0, containing 0.5 M NaCl,
then with 0.1 M Tris-HCl, pH 8.0, containing 0.5 M NaCl. This cycle of washing was repeated twice more.
A triple coinfection was performed using 1 liter of Sf9 cells
and baculoviruses encoding the DNL IV-His6, DNL IV-Myc, and HA-XRCC4 polypeptides. Each virus was used at a multiplicity of infection of about 5. An extract was prepared and subjected to Ni+-NTA-agarose chromatography as described above. Protein
from a peak fraction was incubated with mAb 9E10 anti-Myc Sepharose
overnight at 4 °C in a buffer containing 0.5 M NaCl, 50 mM Tris-HCl, pH 7.4, and 0.3% Nonidet P-40. The beads were
washed three times with the same buffer, and bound proteins were
analyzed by SDS-PAGE.
Adenylation and Nick-ligation Assays--
Adenylation reactions
were performed in a final volume of 10 µl. Reactions contained 2 µl
of a ligase-containing protein fraction, and in addition contained 60 mM Tris-HCl, pH 8.0, 10 mM MgCl2, 5 mM dithiothreitol, 50 µg/ml bovine serum albumin, and 1 µCi of [
-32P]ATP (6000 Ci/mmol, PerkinElmer Life
Sciences). Reactions were incubated for 10 min at room
temperature and terminated by addition of SDS-PAGE sample buffer.
Adenylated proteins were resolved by SDS-PAGE and visualized by
PhosphorImager analysis.
Nick-ligation reactions were performed using a (dT)16
substrate, which was 5' end-labeled using T4 polynucleotide kinase and [
-32P]ATP (6000 Ci/mmol). The radiolabeled
(dT)16 was hybridized with a stoichiometric amount of
poly(dA) (200-nt average length, Amersham Pharmacia Biotech). Ligation
reactions were performed in a volume of 5 µl, and contained 1 ng of
DNA substrate, 60 mM Tris-HCl, pH 8.0, 10 mM
MgCl2, 5 mM dithiothreitol, 50 µg/ml BSA, and
1 mM ATP. In addition, reactions contained 1 µl of
ligase-containing fraction, which was diluted with TM buffer containing
0.275 M KCl to give the amount of protein indicated in the
legend to Fig. 6. Reactions were incubated at 37 °C for 10 min and stopped by addition of 95% formamide loading dye. Products
were analyzed by 20% urea-PAGE. The gel was fixed with 10% methanol,
10% acetic acid, and the products were visualized by PhosphorImager analysis.
Chemical Cross-linking and Detection of Cross-linked Complexes by
Immunoblotting--
Chemical cross-linking reactions were performed
using a homobifunctional N-hydroxysuccinimide ester
cross-linker that had an 11.4-Å arm length (BS3, Pierce).
Reactions were assembled by mixing 10 µl of protein-containing fractions, 10 µl of phosphate-buffered saline (27 mM KCl,
1 mM KH2PO4, 137 mM
NaCl, 43 mM Na2HPO4), and 2 µl of
aqueous BS3 solution. Final BS3 concentrations
were as indicated in the relevant figure. Reactions were incubated for
1 h at room temperature and terminated by adjusting to 200 mM Tris-HCl, pH 8.0. Cross-linked products were resolved by
5% and 7% SDS-PAGE and analyzed by immunoblotting, using
anti-histidine tag (mAb Tetra-His; Qiagen) and anti-HA (mAb 12CA5;
Roche Molecular Biochemicals) primary antibodies. Immunoblots were
incubated with the appropriately conjugated anti-mouse secondary
antibodies and were developed as indicated in the legend to Fig
5.
Cell-free Nonhomologous End-joining Assay--
Extracts were
prepared and assayed essentially as described (25). Whole cell extracts
were prepared from 4 × 109 human lymphoblasts
(GM00558 cell line; Coriell Cell Repositories, Camden, NJ). Cells were
harvested by centrifugation, resuspended, and lysed by homogenization
in 10 ml of hypotonic lysis buffer (10 mM Tris-HCl, pH 8.0, 0.1 mM EDTA, 5 mM dithiothreitol) using 20 strokes of an A pestle. Proteinase inhibitors (0.17 mg/ml
phenylmethylsulfonyl fluoride, 1 µg/ml pepstatin A, 1 µg/ml
leupeptin, 1 µg/ml soybean trypsin inhibitor) were added. After 20 min incubation on ice, 3.33 ml of high salt buffer (50 mM
Tris-HCl, pH 7.5, 1 M KCl, 2 mM EDTA, 2 mM dithiothreitol) was added. Cell lysate was centrifuged for 3 h at 200,000 × g. The supernatant was
dialyzed against 20 mM Tris-HCl, pH 8.0, 0.1 M
KOAc, 20% glycerol, 0.5 mM EDTA, and 1 mM
dithiothreitol. Aliquots were prepared and stored at 70 °C.
DNA substrate for the NHEJ assay was prepared by digestion of
pBluescript II KS(+) vector (Stratagene) with BamHI. The DNA substrate was labeled with T4 polynucleotide kinase and
[-32P]ATP (6000 Ci/mmol). NHEJ reaction mixtures
contained 10 mM Tris-HCl, pH 7.9, 65 mM KOAc,
0.25 mM EDTA, 0.5 mM dithiothreitol, 10%
glycerol, 50 mM triethanolamine, pH 7.5, 0.7 mM
MgOAc, 100 µg/ml BSA, 2 mM ATP, and approximately 10 µg
of cell extract protein. The reaction mixture was incubated for 10 min
at 37 °C. DNA (10 ng) was added, bringing the final volume to 10 µl. Incubation was continued for 1 h at 37 °C. The reaction
was stopped by adding 150 µl of a solution containing 0.2 M NaCl, 0.02 M EDTA, 1% SDS, 4 µg/ml tRNA,
and 100 µl of a solution containing 10 mM Tris-HCl, pH
7.9, 1 mM EDTA, and 0.1 M NaCl. Reactions were
extracted with 300 µl of phenol:chloroform:isoamyl alcohol (50:49:1,
v:v). A solution of 0.5 M NH4OAc in ethanol was
added (500 µl), the nucleic acid precipitate was collected by
centrifugation, and reaction products were analyzed by 0.6% agarose
gel electrophoresis. Ligated products were detected by PhosphorImager analysis.
| |
RESULTS |
Purification of a DNL IV·XRCC4 Complex--
The overall cloning
scheme for human DNL IV and XRCC4 is described under "Experimental
Procedures." The human DNL IV cDNA was obtained by PCR
amplification of a single IMAGE consortium clone containing the
full-length gene sequence. Two different AUG codons have been proposed
as sites of initiation of translation for DNL IV, making this an enzyme
of either 844 or 911 residues (28, 39, 53). We generated constructs
expressing both forms, each with a hexahistidine tag introduced at the
C terminus (see "Experimental Procedures"). Preliminary
characterization revealed that only the 911-residue form was active in
an AMP-adenylation assay (data not shown), in agreement with a previous
report (53). Based on the difficulty encountered in our attempts to
purify the shorter form, we speculate that the N-terminal region
contributes to overall folding of the protein. All subsequent
experiments were performed with the longer, 911-residue form.
The human XRCC4 cDNA clone was assembled from two sources. The 5'
portion of the gene was obtained by reverse transcriptase-PCR using
HeLa cell RNA, and the 3' portion was obtained from an IMAGE consortium
clone, as described under "Experimental Procedures." Both the DNL
IV and the XRCC4 clones were transferred into baculovirus vectors,
which were then amplified to create recombinant viral stocks.
Baculoviruses containing the DNL IV and XRCC4 cDNAs were used to
co-infect Sf9 cells, and protein purification was
carried out according to the scheme shown in Fig.
1A. After lysis, the infected
cell extract was subjected to immobilized metal ion chromatography using Ni+-NTA-agarose. The histidine-tagged DNL IV binds
directly to this resin, and the XRCC4 binds indirectly because of its
interaction with DNL IV. The Ni+-NTA-agarose column was
eluted with a gradient of imidazole, and the DNL IV·XRCC4-containing
fractions were pooled and applied to a Superdex-200 gel filtration
column. DNL IV and XRCC4 eluted together from this column in a single
well resolved peak, indicating the presence of a homogeneous, stable
complex (Fig. 1B). These fractions were pooled and applied
to a Mono Q anion exchange column, from which DNL IV and XRCC4 again
eluted together in a single sharp peak (Fig. 1C).
View larger version (57K):
[in this window]
[in a new window]
|
Fig. 1.
Purification of DNL IV·XRCC4
complex. A, diagram shows purification procedure.
Baculovirus-infected cell extracts were prepared as described under
"Experimental Procedures." Extracts were subjected to sequential
chromatography on Ni+-NTA-agarose, Superdex-200, and Mono Q
as described under "Experimental Procedures." B,
analysis of Superdex-200 fractions by 7% SDS-PAGE with Coomassie Blue
staining. Arrows at right denote positions of DNL
IV and XRCC4. Identity of these polypeptides was confirmed by
immunoblotting (data not shown). Positions of molecular size markers
are indicated at left (kDa). C, analysis of Mono
Q fractions by 7% SDS-PAGE with Coomassie Blue staining.
|
|
Determination of Native Molecular Weight and Stoichiometry of DNL
IV·XRCC4 Complex--
It was of interest to determine the number of
copies of each polypeptide that were present within the DNL IV·XRCC4
complex. By definition, DSB repair requires a mechanism for coordinated ligation of the two DNA strands, and one straightforward way to achieve
this would be if two copies of the DNL IV polypeptide were present in
the complex.
We used two complementary approaches to determine the native molecular
weight of the DNL IV·XRCC4 complex. In the first of these, we
calibrated the Superdex 200 gel filtration column used in the DNL
IV·XRCC4 purification by determining the Kav
values for a set of standard proteins of known molecular weight. A
calibration curve based on these Kav values is
shown in Fig. 2A. Comparison of the Kav for DNL IV·XRCC4 versus
the standards suggests a native molecular mass for the complex of
approximately 310,000 Da.
View larger version (18K):
[in this window]
[in a new window]
|
Fig. 2.
Determination of native molecular weight of
DNL IV·XRCC4 complex. A, gel filtration analysis of
DNL IV·XRCC4 complex. Superdex 200 gel filtration chromatography was
performed as described under "Experimental Procedures." Molecular
size standards include chymotrypsinogen A (25,000 Da), ovalbumin
(43,000 Da), BSA (67,000 Da), aldolase (158,000 Da), catalase (232,000 Da), ferritin (440,000 Da), and thyroglobulin (669,000 Da). For each
protein, a Kav parameter was derived as
described under "Experimental Procedures." The
Kav for the DNL IV·XRCC4 complex is indicated
by the arrow. B, native gel electrophoresis
(Ferguson plot) analysis. Electrophoresis was performed as described
under "Experimental Procedures." Proteins used as molecular size
standards were -lactalbumin (14,200 Da), carbonic anhydrase (29,000 Da), ovalbumin (45,000 Da), BSA monomer (66,000 Da), BSA dimer (132,000 Da), urease trimer (272,000 Da), and urease hexamer (544,000 Da). Each
standard and unknown protein was run on a series of gels with different
polyacrylamide concentrations ranging from 4% to 10%. Relative
mobility (Rf) was calculated as the ratio of
mobility of a given protein to the mobility of bromphenol blue dye. For
each protein, a derived value, 100[log(Rf × 100)], was plotted as a function of acrylamide concentration (data not
shown). The slopes of the lines generated for each standard protein
were determined by linear regression analysis, and the resulting
numerical values were plotted as a function of molecular weight to
generate the calibration curve (Ferguson plot) shown in
panel B. The position of the DNL IV·XRCC4
complex on this curve is indicated by the arrow.
|
|
As an independent method of determining native molecular weight, we
used native gel electrophoresis. The mobility of a given protein on a
native gel is a function of both size and charge, making it impossible
to determine molecular weight from a single measurement. However, the
mobility of the same protein on gels of different porosities varies in
a systematic way, which can be related to molecular weight. We measured
relative mobility of the DNL IV·XRCC4 complex and a group of standard
proteins using a set of native gels containing from 4% to 10%
polyacrylamide. Data were analyzed as described under "Experimental
Procedures." The log-linear relationship between mobility and
polyacrylamide concentration was determined for each standard and
unknown protein, and the slopes of the best-fit lines were plotted as a
function of the logarithm of molecular weight to obtain the calibration curve shown in Fig. 2B. The native molecular mass of the DNL
IV·XRCC4 complex determined by this method is 290,000 Da, in good
agreement with the results of gel filtration. Together, the gel
filtration and native gel electrophoresis data are consistent with the
existence of a tetrameric complex, (DNL
IV)2(XRCC4)2, which has a predicted molecular
mass of 288,272 Da, although the precision of the experiments is such
that we cannot rule out other alternatives, such as
(DNLIV)2(XRCC4)3.
As another measure of the stoichiometry of DNL IV and XRCC4, we
quantitated the relative amount of each polypeptides using two
independent methods. In the first, purified DNL IV·XRCC4 was analyzed
by SDS-PAGE, stained with Coomassie Blue, and the amount of each
stained band was quantitated by densitometry. The results suggested a
molar ratio of XRCC4 to DNL IV of 1.03-1.19, as measured in two
independent experiments (Table I). Within
the likely experimental error, this is most consistent with a
composition of (DNL IV)2(XRCC4)2.
View this table:
[in this window]
[in a new window]
|
Table I
Quantitation of the density of the stained bands of DNL IV · XRCC4 complex
Approximately 2.5 mg of DNL IV · XRCC4 complex was analyzed by
7% SDS-PAGE. Gels were stained with Coomassie Blue and destained to
equilibrium with 10% acetic acid, 10% methanol. Gels were dried on a
clear cellulose membrane and analyzed by densitometer (Imaging
Densitometer model GS-700, Bio-Rad). Molar ratio was calculated by
normalizing density according to polypeptide molecular weight.
|
|
Although Coomassie Blue staining is a widely accepted method, it is
known that certain polypeptides may be relatively overstained or
understained. Therefore, we also used an alternative method of
detection, which involved re-cloning DNL IV and XRCC4, each with an
identical FLAG epitope tag. The two polypeptides were co-expressed in
baculovirus-infected Sf9 cells, and the complex was
purified by sequential chromatography on Q-Sepharose, Superdex 200, and
Mono Q columns as described under "Experimental Procedures." The
last two of these columns effectively resolve the DNL IV·XRCC4 complex from free XRCC4, which was also present in the co-infected Sf9 cells. Fractions corresponding to the complex
were pooled and analyzed by immunoblotting with anti-FLAG primary
antibody and alkaline phosphatase-conjugated secondary antibody. The
immunoblot was developed with a fluorescent substrate and visualized
using a Storm imaging system (Fig.
3A). Because both polypeptides
carry the same epitope, the fluorescence signal is proportional to
relative molar amounts of each. Quantitation of this signal revealed
that the stoichiometry of DNL IV and XRCC4 is 1:1, within an error of
about 10% (Fig. 3B).
View larger version (23K):
[in this window]
[in a new window]
|
Fig. 3.
Immunoblotting of DNL IV·XRCC4 complex with
anti-FLAG antibodies. Flag-tagged variants of the DNL IV and XRCC4
polypeptides were co-expressed in Sf9 cells and the DNL
IV·XRCC4 complex was purified as described under "Experimental
Procedures." A, immunoblotting of purified DNL IV·XRCC4
complex with anti-FLAG antibody (Sigma-Aldrich). Increasing amounts of
DNL IV·XRCC4 were loaded in each lane, as indicated in nanograms.
Immunoblotting was performed using polyvinylidene difluoride membrane
with detection by enzyme-catalyzed fluorescence substrate (Vistra ECF
substrate, Amersham Pharmacia Biotech). The immunoblot was imaged using
a Storm system (Molecular Dynamics). DNL IV and XRCC4 bands were
identified by migration relative to prestained molecular size markers
(data not shown) and are denoted by arrows. B,
fluorescence of each band was quantitated using the Storm system.
|
|
Co-immunoprecipitation of His6- and Myc Epitope-tagged
DNL IV Polypeptides--
Because of the uncertainty inherent in the
measurement of native molecular weight, it was desirable to confirm the
proposed heterotetrameric structure by independent means. To verify
that at least two copies of the DNL IV polypeptide were present in each
complex, we performed a triple mixed infection of Sf9
cells with baculoviruses expressing the previously described DNL
IV-His6 and HA-XRCC4 proteins, together with another
baculovirus expressing a DNL IV-Myc epitope protein. Cell lysates were
prepared and subjected to Ni+-NTA-agarose chromatography,
and protein from a peak fraction was immunoprecipitated using anti-Myc
antibody-conjugated Sepharose beads as described under "Experimental Procedures."
The immunoprecipitate was analyzed by SDS-PAGE with Coomassie Blue
staining, which revealed a prominent doublet at the approximate position expected for the DNL IV polypeptide (Fig.
4A, lane
3). The lower band of the doublet (labeled his)
comigrated with a DNL IV-His6 marker (lane
1), whereas the upper band (labeled myc) migrated
at a slightly larger position because of the presence of the three
tandemly repeated Myc epitope sequences. Immunoblotting with anti-His
tag and anti-Myc antibodies confirmed the identity of tag present in
each polypeptide (panels B and C).
MBP-RAG1 and MBP-RAG2 proteins, which bear both His and Myc tags, were included as markers in each panel (lane 2) in
order to allow precise mobility comparisons.
View larger version (24K):
[in this window]
[in a new window]
|
Fig. 4.
Immunoprecipitation of DNL IV·XRCC4 complex
containing both His6 and Myc epitope-tagged DNL IV
polypeptides. A triple mixed infection was performed using
baculovirus expressing DNL IV-His6, DNL IV-Myc, and
HA-XRCC4 polypeptides, and cell lysates were subjected to sequential
Ni+-NTA-agarose chromatography and immunoprecipitation
using mAb 9E10-conjugated Sepharose. The following samples were
analyzed in each panel: lane M (panel
A only), prestained molecular size markers (Bio-Rad);
lane 1, marker consisting of purified DNL
IV-His6·HA-XRCC4 complex; lane 2,
marker consisting of recombinant Myc/His6-tagged MBP-RAG1
protein (120 kDa) and Myc/His6-tagged MBP-RAG2 protein (90 kDa) (65); lane 3, immunoprecipitate from triple
mixed infection. A, 7% SDS-PAGE gel stained with Coomassie
Brilliant Blue. B, immunoblot of 7% SDS-PAGE gel, probed
with anti-histidine tag primary antibody and alkaline
phosphatase-conjugated rabbit anti-mouse IgG secondary antibody and
developed with bromochloroindolyl phosphate/nitro blue tetrazolium
stain. C, same immunoblot as in panel
B, subjected to additional incubation with mAb 9E10 anti-Myc
primary antibody and horseradish peroxidase-conjugated rabbit
anti-mouse IgG secondary antibody and developed using Luminol-based ECL
Western blotting System (Amersham Pharmacia Biotech). Each panel is a
composite of lanes from the same gel.
|
|
Each of the DNL IV polypeptides in this experiment bears only one type
of epitope tag (i.e. His6 or Myc, but not both).
Because DNL IV·XRCC4 complex was subjected to sequential affinity
purification, the recovery of protein at the end of the experiment is
possible only if a polypeptide bearing each tag are present in the same physical complex. The results (Fig. 4A, lane
3) provide strong evidence supporting the presence of at
least two DNL IV polypeptides within the proposed heterotetrameric structure.
Chemical Cross-linking of DNLIV·XRCC4 Complex--
The preceding
experiment suggests that there are at least two DNL IV polypeptides in
the complex, but does not address the number of XRCC4 polypeptides. To
more precisely determine the number of XRCC4 polypeptides, as well as
to determine which polypeptides are in direct contact with one another,
we performed chemical cross-linking on the DNL IV·XRCC4 complex,
using BS3, a water-soluble homobifunctional
N-hydroxysuccinimide compound that reacts with primary
amines. BS3 is expected to react with the N terminus and
with lysine residues. Cross-linked products were analyzed by both 5%
and 7% SDS-PAGE, in order to obtain maximum resolution over a wide
size range. Immunoblotting was performed to determine which
polypeptides were present in each cross-linked complex.
Immunoblotting with the anti-HA antibody showed that XRCC4 was present
in two cross-linked complexes, designated X and Y (Fig. 5, A and B).
Complex X migrates at a position corresponding to about 150,000 Da,
relative to the marker proteins, and contains only XRCC4, with no
detectable DNL IV (compare panel A with
C and panel B with D).
Because there was no evidence for intermediates running between the
XRCC4 monomer and complex X at the lowest cross-linker concentration
(0.4 µM), we suggest that complex X must correspond to a
cross-linked XRCC4 dimer. This species migrates significantly more
slowly than predicted from its molecular mass of 79,000 Da, probably
because of the branched geometry of the cross-linked structure. A
slightly more rapidly migrating form of complex X appears at higher
BS3 concentrations and might correspond to a more compact,
multiply cross-linked form (Fig. 5A).
View larger version (61K):
[in this window]
[in a new window]
|
Fig. 5.
Chemical cross-linking of DNL IV·XRCC4
complex. A-D, analysis of cross-linked products by
SDS-PAGE and immunoblotting. Purified DNL complex (1.2 µg) was used
in cross-linking reactions with the homobifunctional
N-hydroxysuccinimide cross-linker BS3, as
described under "Experimental Procedures." The final concentration
of BS3 ranged from 0 to 382 µM as indicated.
Cross-linked proteins were resolved by SDS-PAGE using two different
concentrations of polyacrylamide in order to provide optimum resolution
for complexes of different size (panels A and
C, 7% SDS-PAGE; panels B and
D, 5% SDS-PAGE). Individual gels were immunoblotted with
anti-HA antibody to detect HA-XRCC4 (panels A and
B) or with anti-His tag antibody to detect DNL
IV-His6. Anti-HA antibody was visualized using horseradish
peroxidase-conjugated rabbit anti-mouse IgG secondary antibody and a
Luminol-based detection system as described in the legend to Fig. 4.
Anti-His tag antibody was visualized alkaline phosphatase-conjugated
rabbit anti-mouse IgG secondary antibody and bromochloroindolyl
phosphate/nitro blue tetrazolium stain. For each of the panels, the
positions of molecular size markers are indicated at the
left. Arrowheads at the right mark the
positions of non-cross-linked DNL IV and XRCC4, as well as cross-linked
complexes denoted as X and Y. In some lanes, complex X was resolved as
a doublet, which may reflect cross-linking at multiple sites.
E, schematic diagram showing interpretation of cross-linking
analysis. Complex X apparently corresponds to a (HA-XRCC4)2
homodimer. Complex Y apparently corresponds to a (DNL IV)(XRCC4)
heterodimer, although the presence of higher order species cannot be
ruled out.
|
|
Complex Y has an apparent molecular mass of greater than 200,000 Da and
contains both XRCC4 and DNL IV. We suggest that complex Y corresponds
principally to a cross-linked XRCC4·DNL IV dimer. Complex Y forms
quite a broad band in the 5% SDS-PAGE analysis, and could also include
a cross-linked (DNL IV)(XRCC4)2 trimer. We did not detect
species migrating significantly more slowly than complex Y, suggesting
that cross-linked DNL IV dimer is probably not present.
In addition to the BS3 cross-linking, we also performed
similar experiments using N-hydroxysulfosuccinimidyl
4-azidobenzoate, a heterobifunctional photo-activated
cross-linker that reacts with primary amines at one end of the molecule
and reacts nonspecifically with various amino acid side chain groups at
the other end. Results were substantially the same as with
BS3 (data not shown).
In the course of these experiments, we observed that the XRCC4 in the
purified complex, although not the DNL IV, had a marked tendency to
undergo spontaneous oxidation. This was manifested as an appearance of
variable amounts of a cross-linked XRCC4 dimer in the absence of added
chemical cross-linker, and could be avoided by inclusion of 35 mM dithiothreitol in the SDS-PAGE sample buffer. We note
that dithiothreitol had no effect on mobility of the DNL IV·XRCC4
complex in native gels, indicating that disulfide bonds are not
required for maintenance of the tetrameric structure.
Fig. 5E summarizes and provides an interpretation of the
cross-linking experiments. We suggest that an XRCC4 dimer forms the core of the complex and can be readily cross-linked to give the complex
X observed in our gels. Each XRCC4 polypeptide is in contact with one
DNL IV polypeptide, and these can be cross-linked to give complex Y. The two DNL IV polypeptides do not appear to be in contact with each
other, as there is no evidence for the formation of a cross-linked DNL
IV dimer.
Activity of Purified DNLIV·XRCC4 Complex in Nick-ligation and
NHEJ Assays--
Although the biological function of DNL IV is to join
DNA double-strand breaks, previous reports indicate that the purified enzyme has only a minimal ability to carry out this reaction in vitro, presumably because of a requirement for additional
cofactors (25).
Because of the anticipated lack of direct double-strand break joining
activity, preliminary characterization of the purified recombinant DNL
IV·XRCC4 complex was performed using a nick-ligation assay (54).
Results are shown in Fig. 6. There was a
progressive increase in the formation of ligated products as increasing
amounts of DNL IV·XRCC4 were added to the reaction (Fig.
6A). Interestingly, under the conditions used, the number of
ligation events was approximately equal to the amount of DNL IV·XRCC4
tetramer added to the reaction (Fig. 6B), suggesting that
the enzyme might be limited to a single turnover under these
conditions. Further kinetic studies will be needed to understand the
mechanism of interaction with this substrate in more detail.
View larger version (35K):
[in this window]
[in a new window]
|
Fig. 6.
Nick-ligation assay using purified DNL
IV·XRCC4 complex. Nick-ligation reactions were performed as
described under "Experimental Procedures." The amount of DNL
IV·XRCC4 complex in each reaction is indicated. Reaction in
left lane contained 400 units of T4 DNA ligase
(New England Biolabs). A, reaction products were analyzed by
20% urea-PAGE. Positions of monomer (dT)16 substrate and
of the dimer and multimer ligation products are indicated at
right. Schematic diagram at bottom shows
(dT)16:poly(dA) substrate. Vertical
arrows indicate potential nick-ligation sites. B,
quantitation of data in panel A.
|
|
We next investigated the activity of DNL IV·XRCC4 in the presence of
other repair factors. An NHEJ assay system has recently been described
that measures plasmid end-joining in the presence of a whole cell
extract from human lymphoblasts (25). The system is faithful, in that
the reaction is dependent on endogenous Ku, DNA-PK, and DNL IV, but
end-joining efficiency is low, typically less than 5%, and in our
experience is somewhat variable. We carried out NHEJ assays essentially
as described (25) using a BamHI-digested plasmid substrate
and adding purified DNL IV·XRCC4 complex. Results are shown in Fig.
7. As expected, the purified DNL
IV·XRCC4 complex alone had little activity. Similarly, the
lymphoblast cell extract alone had little activity under these
conditions. However, the combination of the DNL IV·XRCC4 complex and
cell extract showed a high level of activity, with as much as 70% of
the monomer substrate being converted to various ligated forms. This
result indicates that DNL IV·XRCC4 is a limiting component in cell
extracts, and that there is strong synergy between exogenous,
recombinant enzyme and cellular factors.
View larger version (34K):
[in this window]
[in a new window]
|
Fig. 7.
NHEJ assay. End-joining assays were
performed as described under "Experimental Procedures" using
BamHI-digested plasmid substrate and the indicated amount of
purified DNL IV·XRCC4 complex and lymphoblast cell extract protein.
A, products analyzed by 0.6% agarose gel electrophoresis
and detected by PhosphorImager analysis. Arrows at
right indicate monomer substrate and various reaction
products. Identity of reaction products has been assigned tentatively,
based on electrophoretic mobility. Arrows indicate linear
dimers (dimer), open circles (OC), and closed
circles (CC). Bracket indicates other multimers.
B, quantitation of results in panel A
(lanes 2-6) by PhosphorImager analysis.
|
|
We note that DNL IV·XRCC4 catalyzes many fewer ligation events, per
mole of complex, in the end-joining assay than in the nick-ligation
assay (compare Figs. 7 and 6). This presumably reflect the complexity
of the interactions in reactions containing crude extract. For example,
the DNL IV·XRCC4 may participate in nonproductive complexes with
endogenous repair proteins or it may interact with specific negative
regulatory proteins. Further purification and characterization of the
components in the extract will be required to address this issue.
In order to determine whether the DNL IV·XRCC4 complex was
stimulating the specific, Ku-dependent pathway of
end-joining, we tested the effect of several human autoimmune sera on
the reaction (Fig. 8). The reaction was
strongly inhibited by four different sera (lanes
4-6 and 8). Two of these contained anti-Ku
antibodies (HT and OY), one contained
anti-DNA-PKcs antibodies (FT), and one contained a mixture
of both types of antibodies (TT). By contrast, there was no
inhibition in the absence of serum (lane 9) or in the presence of control sera (lanes 3 and
7). One of the control sera was from a normal individual
(NS), and the other was an autoimmune serum (TA)
that contained antibodies against another nuclear autoantigen, RNA
helicase A (55). In addition to the autoimmune sera, we tested an
anti-DNA-PKcs monoclonal antibody (mAb 18-2), which also strongly
inhibited the reaction (data not shown).
View larger version (29K):
[in this window]
[in a new window]
|
Fig. 8.
Inhibition of NHEJ by anti-Ku and
anti-DNA-PKcs sera. End-joining assays were performed as in Fig.
6, using 0 or 10 µg of cell extract protein as indicated
(CE) and 0 or 80 ng of DNL IV·XRCC4. Reactions contained 1 µl of the following human sera, as indicated: NS, normal
serum; HT, anti-Ku; OY, anti-Ku; TT,
anti-Ku and anti-DNA-PKcs; TA, anti-RNA helicase A;
TF, anti-DNA-PKcs. Reactions in lanes
9 and 10 contained 1 µl of phosphate-buffered
saline in place of serum. In lane 10, products
were digested with BamHI subsequent to ligation.
A, products analyzed by 0.6% agarose gel electrophoresis
and detected by PhosphorImager analysis. Arrows at
right indicate monomer substrate and various reaction
products, as in Fig. 7. B, quantitation of results in
panel A.
|
|
To determine whether the end-joining occurred perfectly, without
insertion and deletion of nucleotides, we digested the products of a
control reaction with BamHI, which cleaved substantially all
of the ligated DNA (Fig. 8, lane 10). Together,
these results indicate that the reaction is faithful and remains
dependent on physiologically essential repair proteins even when large
amounts of DNL IV complex are present to drive the reaction. We have so far been unable to reconstitute the reaction with a mixture of purified
DNL IV·XRCC4, Ku, and DNA-PKcs, indicating that at least one other
repair factor is likely to be required, in agreement with a previous
study (25).
| |
DISCUSSION |
We have expressed and purified an active, recombinant DNL
IV·XRCC4 complex. Physical characterization of the complex by gel filtration, native gel electrophoresis, quantitative analysis of
Coomassie Blue binding, quantitative immunoblotting, and chemical cross-linking strongly suggests that is a mixed tetramer containing two
copies of DNL IV and two copies of XRCC4. We were also able to isolate
mixed multimers containing DNL IV polypeptides with two different
epitope tags, which provides additional confirming evidence that more
than one copy of DNL IV is present. Although each experimental approach
is subject to specific limitations, together they provide strong
evidence in favor of the tetramer model. To our knowledge, DNL IV is
the first example of a mammalian DNA ligase that contains two active
sites within the active enzyme complex. We suggest that this is a
specialized adaptation to the function of DNL IV in double-strand break repair.
Chemical cross-linking experiments suggest that a XRCC4·XRCC4
interface forms the core of the DNL IV·XRCC4 tetramer. Consistent with this model, previous studies have shown that XRCC4 self-aggregates when expressed in the absence of DNL IV (56-58). As has been reported by others, XRCC4 has a propensity for formation of disulfide linked dimers (56). Because the interior of the cell is a reducing environment, it is unlikely that such disulfide linkages exist in
vivo, and we suggest that they may form during storage or handling of the purified protein. The propensity for oxidation probably reflects
chance juxtaposition of cysteine residues at the XRCC4·XRCC4 interface. Two-hybrid studies suggest that this interface involves amino acids 115-204. Three cysteine residues are present within this
region (58).
The DNL IV·XRCC4 complex has been subjected to gel filtration
analysis in several previous studies, with conflicting results. In one
case, the DNL IV·XRCC4 complex was shown to coelute with a DNL
III·XRCC1 complex, in another, it was estimated to have a molecular
weight of about 200,000, and in a third report, the molecular weight
was estimated to be 400,000 (29, 39, 59). Various authors have
suggested the existence of a DNL IV-XRCC4 dimer, a (DNL
IV)(XRCC4)2 trimer and, in a very recent study, a (DNL
IV)2(XRCC4)2 tetramer (3, 29, 39, 53, 59). One explanation for the discrepancy in the results is that, in the earlier
studies, the gel filtration columns may not have been sufficiently well
calibrated in the high molecular range to distinguish between different
higher order oligomeric forms. In any case, the variability underscores
the need for multiple approaches in order to accurately determine
oligomeric structure.
Although the isolated DNL IV·XRCC4 complex had virtually no ability
to join double-stranded DNA fragments in an end-joining assay, there
was strong synergy between the isolated enzyme and other repair factors
present in cell extracts. This provides strong evidence that the
tetrameric DNL IV·XRCC4 complex is the active form of the enzyme. Our
results also demonstrate that the DNL IV·XRCC4 complex is the
limiting component when the nonhomologous end-joining reaction is
reconstituted with a mammalian cell extract prepared under the
conditions described (25).
One of the challenges inherent in the reconstitution of complex
biological reactions is that multiple, competing reaction pathways may
operate simultaneously. In the case of NHEJ, previous workers have
observed the operation of both Ku-dependent and
Ku-independent pathways in cell-free systems (25, 26, 60). The
Ku-dependent pathway is believed to reflect the major
physiological pathway of mammalian NHEJ, as identified by genetic
analysis, whereas the Ku-independent pathways are not well
characterized and could reflect nonspecific activity of other DNA
ligases in the extract. Because the DNL IV·XRCC4 complex is highly
dependent on Ku and other repair proteins for its activity, the
addition of the purified complex to a cell-free NHEJ system provides
the ability to increase the flux through the Ku-dependent
pathway without increasing background attributable to nonspecific
end-joining. This ability will facilitate future mechanistic studies of
NHEJ using the in vitro system.
The DNL IV·XRCC4 tetramer presumably has a dyad symmetry, which
implies that it may play a role in bridging the two DNA ends in NHEJ.
There have already been several suggestions that other repair proteins
may work to facilitate the synapsis of DNA ends. Ku itself has some
capacity to bridge DNA ends, as evidenced by the facilitated kinetics
of transfer of Ku protein between DNA fragments with cohesive ends (61)
and by direct observations using atomic force microscopy (8, 10).
DNA-PKcs may also be involved in synapsis, as evidenced by atomic force
microscopy and by enzymatic studies showing the superactivation of
DNA-bound kinase by single-stranded DNA presented in trans (8, 9, 62,
63). One way to reconcile these various observations is to postulate
that occupancy of the DNA termini by Ku, DNA-PKcs, and DNL IV·XRCC4
occurs sequentially, rather than simultaneously.
We have recently reported results of a series of binding and
photocross-linking studies using oligonucleotides designed to trap
repair complexes in defined positions and orientations. On the basis of
these and other studies, we suggest that NHEJ involves sequential
occupancy of the ends by three different complexes, as shown in Fig.
9.
View larger version (26K):
[in this window]
[in a new window]
|
Fig. 9.
Model for NHEJ showing sequential assembly of
protein-DNA complexes at the site of a DSB. A, initial
complex, showing oriented Ku heterodimer in contact with 14-nt site.
B, DNA-PK complex, showing inward translocation of Ku and
enzymatically active DNA-PKcs in contact with termini. Site size is 28 nt. C, ligation complex, showing dyad-symmetric DNL
IV·XRCC4 complex bridging DNA ends, with one DNL IV active site in
contact with each of the two termini. Site size is unknown.
Dashed ellipse represents additional, unknown
repair factors required to stabilize the ligation complex.
|
|
§,
TOP
ABSTRACT
INTRODUCTION
