HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

J. Biol. Chem., Vol. 275, Issue 45, 35176-35184, November 10, 2000

This Article Abstract Full Text (PDF) All Versions of this Article: 275/45/35176    most recent M005557200v1 Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Feinberg, H. Articles by Weis, W. I. Search for Related Content PubMed PubMed Citation Articles by Feinberg, H. Articles by Weis, W. I. Social Bookmarking                      What's this?

Mechanism of pH-dependent N-Acetylgalactosamine Binding by a Functional Mimic of the Hepatocyte Asialoglycoprotein Receptor^*

Hadar Feinberg, Dawn Torgersen^§, Kurt Drickamer^§, and William I. Weis^¶

From the  Department of Structural Biology, Stanford University School of Medicine, Stanford, California 94305 and the ^§ Glycobiology Institute, Department of Biochemistry, University of Oxford, Oxford OX1 3QU, United Kingdom

Received for publication, June 25, 2000, and in revised form, August 4, 2000

	ABSTRACT

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Efficient release of ligands from the Ca²⁺-dependent carbohydrate-recognition domain (CRD) of the hepatic asialoglycoprotein receptor at endosomal pH requires a small set of conserved amino acids that includes a critical histidine residue. When these residues are incorporated at corresponding positions in an homologous galactose-binding derivative of serum mannose-binding protein, the pH dependence of ligand binding becomes more like that of the receptor. The modified CRD displays 40-fold preferential binding to N-acetylgalactosamine compared with galactose, making it a good functional mimic of the asialoglycoprotein receptor. In the crystal structure of the modified CRD bound to N-acetylgalactosamine, the histidine (His²⁰²) contacts the 2-acetamido methyl group and also participates in a network of interactions involving Asp²¹², Arg²¹⁶, and Tyr²¹⁸ that positions a water molecule in a hydrogen bond with the sugar amide group. These interactions appear to produce the preference for N-acetylgalactosamine over galactose and are also likely to influence the pK_a of His²⁰². Protonation of His²⁰² would disrupt its interaction with an asparagine that serves as a ligand for Ca²⁺ and sugar. The structure of the modified CRD without sugar displays several different conformations that may represent structures of intermediates in the release of Ca²⁺ and sugar ligands caused by protonation of His²⁰².

	INTRODUCTION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

The hepatocyte asialoglycoprotein receptor mediates uptake of glycoproteins bearing oligosaccharides terminating in galactose or N-acetylgalactosamine (GalNAc)¹ residues (1). The receptor contains two homologous polypeptide chains: the major form is designated rat hepatic lectin 1 (RHL-1), and the minor form is designated RHL-2/3 (2). Each of these component polypeptides consists of a short N-terminal cytoplasmic domain, a single transmembrane -helix, an -helical stalk, and a C-terminal carbohydrate-recognition domain (CRD). The stalk mediates trimerization of the receptor, probably by formation of a parallel coiled-coil of -helices (3).² The CRD is a member of the C-type (Ca²⁺-dependent) lectin superfamily (4). Structural analysis of the homologous C-type CRDs of rat mannose-binding proteins (MBP-A and MBP-C) (5-7) has shown that two Ca²⁺ stabilize an extensive series of loops at one end of the domain. Sugar ligands interact directly with Ca²⁺ at site 2, which is designated the principal Ca²⁺ site. Vicinal hydroxyl groups on the pyranose ring of the sugar form both direct coordination bonds with this Ca²⁺ and hydrogen bonds with amino acid side chains that also serve as Ca²⁺ coordination ligands.

Structure-based sequence alignments between RHL-1 and MBP-A and site-directed mutagenesis have led to the identification of several residues that provide selective affinity for galactose in C-type lectins (8, 9). Substitution of Glu and Asn with Gln and Asp at positions 185 and 187 of MBP-A and also the presence of a tryptophan residue at position 189 confer upon MBP-A galactose affinity that is comparable with that of RHL-1 (9). Discrimination against mannose is provided by a glycine-rich sequence immediately following Trp¹⁸⁹, which forms a compact, well ordered loop that holds Trp¹⁸⁹ in position for interaction with the B face of galactose while sterically excluding mannose (10). This galactose-binding mutant of MBP-A is designated QPDWG. RHL-1 displays a 60-fold preference for GalNAc over Gal, whereas QPDWG does not discriminate between these two sugars. Introduction of a histidine residue found in RHL-1 into the equivalent position, 202, of QPDWG confers approximately 9-fold selectivity for GalNAc over Gal, thereby providing a partial mimic of RHL-1. The crystal structure of this mutant complexed with GalNAc (11) revealed that the distal edge of the His²⁰² imidazole ring directly contacts the methyl group of the acetamido moiety.

RHL-1 and many other C-type lectins exploit the Ca²⁺ dependence of sugar binding to release their endocytosed ligands in endosomes. Acidification of endosomes reduces the affinity for Ca²⁺ and hence sugar. The ligand and receptor are sorted from one another, with the receptor returning to the cell surface for another round of ligand binding, whereas the ligand is usually delivered to lysosomes for degradation. For different C-type lectins, the pH at which Ca²⁺ affinity is sufficiently weakened to result in loss of sugar ligands is tuned so that separation of ligand and receptor occurs in an appropriate endosome. For RHL-1 in isolation, the pH at which half-maximal sugar binding occurs (pH_B) at 1 mM Ca²⁺ is 7.1 (at 5 mM Ca²⁺ pH_B is 6.3) (12), which corresponds to the separation of this receptor from its sugar ligands in mildly acidic early endosomes. In contrast, MBP-A, which is not an endocytic receptor, shifts to a state with weaker Ca²⁺ affinity only when the pH is reduced to below 5.0. These results indicate that different pH sensitivity for Ca²⁺ binding can be encoded in the common C-type CRD structural framework.

Mutagenesis of the RHL-1 CRD has led to the identification of several residues that are necessary for release of ligands at endosomal pH. Key residues include His²⁵⁶, Asp²⁶⁶, and Arg²⁷⁰. Introduction of these RHL-1 residues at corresponding positions in MBP-A results in shifts in the pH dependence of ligand binding. Introduction of His²⁰² to generate the GalNAc-selective mutant of QPDWG, QPDWG-H, changes pH_B from 5.0 to 5.7 at 1 mM Ca²⁺ and from 3.5 to 5.3 at 4 mM Ca²⁺ (12). Inspection of the structure of QPDWG-H (11) reveals that His²⁰² acts as a hydrogen bond acceptor from the amide group of Asn²¹⁰, which is a Ca²⁺ and sugar ligand (see Fig. 1a). Introduction of aspartic acid at position 212 of QPDWG-H to generate the mutant QPDWG-HD, results in an 8-fold reduction in the effective Ca²⁺ affinity and an increase in pH_B (6.1 at 1 mM Ca²⁺, and 5.7 at 4 mM Ca²⁺), although in the absence of His²⁰² this substitution has no effect (12). These results suggest that Asp²¹² alters the pK_a of His²⁰². Replacement of a loop at positions 216-218 in QPDWG-HD with the corresponding RHL-1 sequence Arg-Pro-Tyr produces the mutant QPDWG-HDRPY, which shows a further 5-fold reduction Ca²⁺ affinity and a raised pH_B (6.4 at 4 mM Ca²⁺) (12). Although this mutant binds Ca²⁺ approximately 15 times more weakly than RHL-1 at pH 7.8, its properties make it the best available mimic of RHL-1.

Biochemical and structural data on QPDWG-HDRPY presented here provide a structural basis for the strong GalNAc selectivity of RHL-1. A high resolution crystal structure of native QPDWG-HDRPY reveals conformational differences that likely represent intermediates leading to the loss of Ca²⁺ at endosomal pH. An intricate network of interactions appears to be responsible for adjusting the pH at which Ca²⁺ is released from the structure.

	EXPERIMENTAL PROCEDURES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Protein Expression and Purification-- Following expression in the previously described bacterial system (12), the arginine residue that was introduced into QPDWG-HDRPY proved to be accessible to clostripain digestion. Thus, it was not possible to use clostripain to remove the N-terminal extension sequence following the approach used in previous crystallization studies (13). To obviate this problem, the expression vector was modified by replacing appropriate restriction fragments with synthetic oligonucleotides to encode a cleavage site for factor Xa. In the final vector, the sequence encoding the bacterial ompA signal sequence (14) is followed by the sequence GCTGAATTAATTCCAAGCTTGGATAAAATCGAGGGTAGA, which is fused to codon 73 of the MBP-A cDNA (15). The N-terminal sequence of the secreted protein, which was confirmed by automated Edman degradation, is Ala-Glu-Leu-Ile-Pro-Ser-Leu-Asp-Lys-Ile-Glu-Gly-Arg-Ala-Ile-Glu-Val-Lys-Leu-Ala. Following cleavage with Factor Xa (New England Biolabs), the new N-terminal sequence Ala-Ile-Glu-Val-Lys-Leu-Ala was again confirmed by Edman degradation. The resulting protein thus has exactly the same N terminus as the trimeric fragments of wild type MBP-A and other mutants previously studied by crystallography (10, 11, 13, 16).

Cultures (6 l) of Escherichia coli strain JA221 containing the expression plasmid were grown in Luria-Bertani broth containing 50 µg/ml ampicillin at 25 °C to an A₅₅₀ of 0.8. Following induction with 40 µM isopropyl--D-thiogalactoside and addition of CaCl₂ to a final concentration of 100 mM, incubation was continued for a further 18 h at 25 °C. Cells were harvested by centrifugation for 15 min at 4000 × g, suspended in 500 ml of loading buffer (1.25 M NaCl, 25 mM Tris-HCl, pH 7.8, and 25 mM CaCl₂) and sonicated with the 4-mm probe of a Branson model 250 sonifier for a total of 10 min in 2-min bursts interspersed with cooling on ice. Debris was removed by centrifugation for 15 min at 27,000 × g and by further centrifugation for 60 min at 100,000 × g. The supernatant was applied to a column (5 ml) of galactose-Sepharose, which was washed, eluted, and analyzed as described previously (17). Eluted protein (approximately 25 mg in 40 ml) was adjusted to 25 mM CaCl₂, and preparative digestion was performed with 200 µg of factor Xa for 16 h at 37 °C. Digested protein was isolated on galactose-Sepharose and repurified by reverse phase chromatography as described previously (13, 17).

Binding Assays-- Solid phase binding competition assays were performed using ¹²⁵I-Gal₃₄-serum albumin as reporter ligand (9). The results reported are the ratios of concentrations required for half-maximal competition of binding (K_I values) for Gal and GalNAc, determined using a nonlinear least-squares fitting program (SigmaPlot, SPSS, Inc.).

Crystallization and Structure Determination-- Lyophilized protein was dissolved in 10 mM NaCl, 10 mM CaCl₂ and neutralized with 50 mM NaOH to give a final pH of ~7.5. The protein was diluted to a final concentration of 15-22.5 mg/ml with 10 mM NaCl, 10 mM CaCl₂. Crystals of QPDWG-HDRPY were grown at 20 °C by hanging drop vapor diffusion, by mixing 1-2 µl of protein solution with 1-2 µl of reservoir solution containing 13.5% polyethylene glycol 8,000, 100 mM Tris-HCl pH 8.0, 10 mM NaCl, and 20 mM CaCl₂ (solution A). Crystals appeared within 3-4 days and grew to full size in 7-14 days. Prior to data collection, the crystals were adapted in a stepwise fashion to solution A plus 0, 5, 7.5, 10, 15, and 20% 2-methyl-2,4-pentanediol and flash cooled by plunging into liquid nitrogen. The complex with GalNAc was prepared by including 200 mM GalNAc (Sigma) in the soaking solutions.

Diffraction data from native and GalNAc-soaked crystals were measured to maximum Bragg spacings of 1.9 Å on a MAR345 Image plate detector at the Stanford Synchrotron Radiation Laboratory beam line 9-1. A total of 166 images were measured from a single native crystal (size 200 × 50 × 50 µm³), with oscillation ranges of 1.2, 1.0, or 0.6° depending on the portion of reciprocal space being measured. Exposure times were 10 s for the 1.2 and 1.0° sweeps and 5 s for the 0.6° sweep. For the GalNAc-soaked crystal (size 250 × 250 × 60 µm³), 96 1.2° oscillation sweeps were measured at 60 s/image. The same images were then remeasured with a 10 s/image exposure time to measure reflections that were saturated in the high dose pass. Intensities were integrated, scaled and merged with DENZO and SCALEPACK (18) (Table I).

Crystals of QPDWG-HDRPY are nearly isomorphous with those of the QPDWG-H mutant and permitted structure solution by rigid body refinement of the QPDWG-H model (11) against the QPDWG-HDRPY data set. The temperature factors from the QPDWG-H model were retained, and all water molecules were omitted from the model. All refinement procedures employed the maximum likelihood amplitude target in CNS (19). An overall anisotropic temperature factor and a bulk solvent correction were applied throughout. The trimer was refined as a single rigid body against data from 30-2.5 Å (R = 0.398, R_free = 0.408), and then the protomers were refined as individual rigid bodies extending the resolution range to 30-2.2 Å (R = 0.363, R_free = 0.366). After several rounds of positional and isotropic temperature factor refinement, the side chains of the mutated residues at positions 212 and 216-218 could be seen clearly in the maps and were added to the model using the program O (20). The electron density maps clearly indicated that the glycine-rich loop comprising residues 188-197 in protomer B has a different conformation from that of the search model. These residues were removed from the model, and after several rounds of positional and isotropic temperature factor refinement alternating with manual model adjustment (initially using data from 30-2.2 Å and then extending the range to 30-1.95 Å), this loop region could be built unambiguously. Water molecules were assigned to peaks in F_o  F_c electron density maps at a contour greater than 3.5  that were within hydrogen bonding distance from a potential partner. The sugar complex was refined by similar strategy, starting from the refined model for the QPDWG-HDRPY data set. As found in other studies of this crystal form (10, 11), the positioning of GalNAc was unambiguous for protomer A and C and less well defined for protomer B. Only the  anomer of GalNAc was modeled. In addition to the three GalNAc residues found in the principal Ca²⁺ binding site (one for each protomer), another GalNAc molecule was found between two protomers, near the end of the neck and the first -strand (residues 100-107) of protomer C and the first -helix of protomer A. This binding site probably has no biological relevance and is observed because of the high concentrations of sugar used in the soaking experiment. The final native model contains residues 73-226 of each protomer, 412 water molecules, 9 Ca²⁺, and 2 Cl. The GalNAc complex consists of residues 73-226 of each protomer, 171 water molecules, 9 Ca²⁺, 3 Cl, and 4 molecules of GalNAc.

	RESULTS

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

GalNAc Selectivity of MBP-A/RHL-1 Chimeras-- Previous studies have revealed that the imidazole ring of His²⁰² plays a critical role in preferential binding of GalNAc compared with Gal, as well as serving as part of the pH-sensing mechanism in the asialoglycoprotein receptor (11, 12). For this reason, it was of interest to examine the sugar binding properties of other asialoglycoprotein receptor mimics created in the context of the CRD from MBP to assess the possible influence of other residues in this region (Table II). Addition of Asp²¹² (QPDWG-HD) increases selectivity for GalNAc over Gal from 9- to 14-fold. Remarkably, addition of the Arg-Pro-Tyr (RPY) sequence to QPDWG-HD generates further selectivity for GalNAc, with the resulting QPDWG-HDRPY mutant showing a 40-fold preference for GalNAc over Gal. Therefore, introduction of just four residues beyond the QPDWG-H mutant generates a chimeric protein that displays nearly the full GalNAc selectivity of RHL-1, as well as having a pH dependence of sugar binding close to that of the hepatic asialoglycoprotein receptor (12).

Structural Correlates of GalNAc Selectivity-- To examine the structural basis for preferential binding of GalNAc, the structure of QPDWG-HDRPY complexed with GalNAc was determined at 1.95 Å resolution (Tables I and III). The crystal form used in these studies contains a trimer in the asymmetric unit, providing three independent views of the molecule for each structure. As found in other studies of this crystal form (10, 11), differences in overall temperature factors lead to copy A of the trimer being best defined, copy C being slightly less well ordered, and copy B being the least well defined. Nonetheless, in all three copies the mode of binding appears to be identical.

The complex with GalNAc can be best understood with reference to the structures of the QPDWG-H mutant studied previously. The principal Ca²⁺ and sugar binding site is identical to that observed in QPDWG-H, and GalNAc is bound in this site as before (Figs. 1, a and b, and 2a). The network of Ca²⁺ coordination and hydrogen bonds that forms the ternary protein/Ca²⁺/sugar complex is retained. Trp¹⁸⁹ and the glycine-rich loop adopt identical positions in the complex as those in QPDWG-H, with the 5 and 6 positions of GalNAc stacking over the Trp ring. Thus, the interactions that have previously been observed to define galactose binding in C-type lectins (10, 11) are observed in this complex.

View larger version (23K): [in this window] [in a new window]   Fig. 1.   GalNAc binding to QPDWG-HDRPY. a, stereo diagram of the complex. The upper portion of the CRD backbone is shown in a blue ribbon representation, except that the glycine-rich loop is shown in red. The principal Ca2+ is shown as a green sphere. Selected side chains are shown in ball-and-stick representation. GalNAc is shown with yellow bonds. Hydrogen bonds are shown as dashed lines. b, schematic diagram of the interactions in the GalNAc binding site. Ca2+ coordination bonds are shown as thin black lines, hydrogen bonds are red lines, van der Waals' contacts with the methyl group of GalNAc are blue lines, and the His202-Tyr218 interaction is a green arrow. c, closeup of the His202-Tyr218 interaction, showing the interaction geometry. Views parallel and perpendicular to the Tyr218 ring are shown in the left and right panels, respectively. d, superposition of the GalNAc subsite of QPDWG-HDRPY and HHL-1 (22), showing the similarities in structure. HHL-1 is shown with a green backbone and green bonds, QPDWG-HDRPY is shown with a blue backbone and side chains in gray bonds, and the GalNAc bound to QPDWG-HDRPY is shown with yellow bonds. Oxygen and nitrogen atoms are shown as red and blue spheres, respectively. Ca2+ is shown as a large blue-green sphere.

View larger version (24K): [in this window] [in a new window]   Fig. 2.   Coordination in the principal Ca2+ site of QPDWG-HDRPY. Carbon, nitrogen, oxygen, and calcium are represented as white, blue, red, and green spheres, respectively. Hydrogen bonds are shown as dashed black lines, and Ca2+ coordination bonds are solid green lines. a, GalNAc complex, copy A. b, native, copy A. c, native, copy C. The two alternate conformations of Asn210 are shown. d, native, copy B. e, stereo view of superimposed copy A of the GalNAc complex (white bonds) and native copy B (yellow bonds). f, schematic drawing of the 8-coordinate Ca2+ site in native copy A. g, schematic drawing of the rearranged, 7-coordinate Ca2+ site in native copy B. The diagrams in f and g are in approximately the same orientation shown in b and d, respectively, and emphasize the rotation of the pentagonal equatorial coordination plane.

There are several novel features of the interaction of GalNAc with QPDWG-HDRPY arising from additional contacts between the acetamido moiety and the residues that have been introduced into the MBP framework. First, there is a water-mediated hydrogen bond between the NH group of the sugar and Asp²¹² (Fig. 1, a and b). Asp²¹² and the water molecule are positioned by an elaborate network of hydrogen bonds involving the newly introduced Arg²¹⁶ and Tyr²¹⁸, the Ca²⁺ and sugar ligand Glu¹⁹⁸, and another water molecule (Fig. 1, a and b). The geometry of these interactions appears to be specifically optimized for interaction with the acetamido moiety. Second, the methyl group of GalNAc forms van der Waals' contacts with the distal edge of the His²⁰² ring as described previously (11). However, the imidazole ring is rotated (2) by approximately 60° with respect to its position in the QPDWG-H structure (Fig. 3). The repositioning of the His²⁰² ring appears to be due to its interaction with the aromatic ring of Tyr²¹⁸. The two rings are roughly parallel, but are laterally displaced with respect to one another, and are also slightly canted with their distal portions closer to one another (Fig. 1c). This arrangement places the partial positive charge of the His²⁰² side chain near the -electron system of the Tyr²¹⁸ ring (Fig. 1b), an electrostatically favorable interaction commonly found in proteins (21).

View larger version (36K): [in this window] [in a new window]   Fig. 3.   Comparison of His202 conformations. The positions of His202 and neighboring residues in QPDWG-HDRPY (gray bonds), QPDWG-H (cyan bonds) (11), and QPDWG-H with Ser154  Val (yellow bonds) (11) are shown after superposition of the three structures. Residues of QPDWG-HDRPY are labeled. Tyr218 of QPDWG-HDRPY is a histidine in QPDWG-H.

The crystal structure of the major subunit of the human hepatocyte asialoglycoprotein receptor (human hepatic lectin-1 (HHL-1)) in its uncomplexed form was recently solved (22). The structures of HHL-1 and QPDWG-HDRPY are virtually identical in the principal Ca²⁺-binding site and the glycine-rich loop (Fig. 1d). Of the residues that provide GalNAc specificity, His²⁰², Asp²¹², and Arg²¹⁶, as well as the water molecules positioned by these residues, are also identical to their HHL-1 counterparts. There are, however, two significant differences between HHL-1 and QPDWG-HDRPY; the ring of Tyr²¹⁸ is rotated approximately 20° with respect to Tyr²⁷² of HHL-1, and Ser¹⁵⁴, although in the same general vicinity as Asn²⁰⁸ of HHL-1, is positioned differently (Fig. 1d). The latter difference can be attributed to an insertion of one residue in this loop of HHL-1 relative to MBP-A, which moves the backbone slightly. The difference in the tyrosine ring position appears to be due to several effects. In HHL-1, Asn²⁰⁸ C is in van der Waals' contact with Tyr²⁷². Also, in QPDWG-HDRPY, the side chain of Arg¹¹⁸ would clash with the tyrosine if it were in the conformation seen in HHL-1. This region is more open in HHL-1 because of the presence of glycine at the position equivalent to Arg¹¹⁸ of QPDWG-HDRPY. These differences result in a relative shift in the tyrosine ring, so that Tyr²⁷² of HHL-1 does not make a direct cation- interaction with His²⁵⁶, unlike the Tyr²¹⁸-His²⁰² interaction in QPDWG-HDRPY. Despite these differences, Fig. 1d demonstrates that the mode of GalNAc binding observed in QPDWG-HDRPY provides a good structural mimic of the binding site in the hepatocyte asialoglycoprotein receptors.

A modest enhancement of GalNAc selectivity is achieved by addition of Asp²¹² to QPDWG-H, whereas further addition of the RPY loop greatly enhances selective GalNAc binding. These data suggest that the precise positioning of Asp²¹² through its interactions with Arg²¹⁶ and Tyr²¹⁸ is important in creating an energetically significant water-mediated hydrogen bond with the N-acetyl amide group. The structure of the QPDWG-HD mutant³ shows that Asp²¹² interacts with His²¹⁸ found in the parent MBP-A sequence, changing its position relative to that described here, so this mutant does not allow dissection of the structural role of Asp²¹² from the positioning effect of the RPY loop. The positioning of Tyr²¹⁸ by the network of interactions shown in Fig. 1b appears to orient His²⁰² optimally in the binding site. The strong preference of the mutant studied here for GalNAc suggests that the complete network of interactions is essential in creating a subsite for the N-acetyl group.

Structural Transitions in Ca²⁺ Binding-- The structure of QPDWG-HDRPY was determined in its sugar-free form in the presence of Ca²⁺. Unlike the case of the GalNAc complex, the three independent copies of the molecule in the asymmetric unit show significant differences in structure, with each copy in the native structure displaying a different conformation in the principal Ca²⁺- and sugar-binding site. In copy A, the conformation of the protein is the same as that in the GalNAc complex (Fig. 2, a and b). Two water molecules form the same Ca²⁺ coordination and hydrogen bonds as the 3- and 4-OH groups of GalNAc. The replacement of vicinal sugar hydroxyl groups by waters has been observed previously in wild type and mutant MBPs⁴ (7, 10, 16). Thus, copy A represents a conformation fully competent to bind to sugar ligands.

In copy C, the conformation is similar to copy A, except that in 50% of the molecules Asn²¹⁰ adopts a different 1 rotamer and is swung out of the Ca²⁺ site (Fig. 2c). A water molecule replaces the amide group of Asn²¹⁰ and forms hydrogen bonds with His²⁰². In this conformation, the Asn side chain would have to rotate back to bind Ca²⁺ and sugar. Moreover, in this conformation the Asn²¹⁰ side chain amide cannot form a hydrogen bond with His²⁰² (Fig. 1, a and b). In addition to the alternate conformation of Asn²¹⁰, Ser¹⁵⁴, which forms a hydrogen bond with the other side of the His²⁰² imidazole ring, adopts two conformations. In the ligand-bound conformation, the singly protonated His²⁰² gives an unambiguous arrangement of hydrogen bond donors and acceptors (Fig. 1b); His²⁰² is a hydrogen bond acceptor from Asn²¹⁰ and is a donor to the OH group of Ser¹⁵⁴. In the alternate Asn²¹⁰ conformation, however, the location of the proton on His²⁰² is not defined uniquely.

Copy B shows the most dramatic conformational differences with respect to the GalNAc-bound structure. Ca²⁺ prefers a pentagonal bipyramidal coordination state, with five oxygen atoms arranged in a pentagonal plane and two or three ligands at apices 90° away from the plane. In wild type and mutant MBP sugar complexes studied to date⁴ (5-7, 10, 11, 16), side chain oxygen atoms of Gln¹⁸⁵, Asp¹⁸⁷, Glu¹⁹⁸, and Asn²¹⁰, as well as the main chain carbonyl oxygen of Asp²¹¹, form the pentagonal equatorial plane; a side chain oxygen atom of Asp²¹¹ forms one apex, and the 3- and 4-OH groups of the sugar bisect the other apex to form an eight-coordinated Ca²⁺ (QPDWG-HDRPY numbering) (Fig. 2a). This eight-coordinate arrangement is found in copy A of the native QPDWG-HDRPY (Fig. 2b). In copy B, however, Asn²¹⁰ is rotated out of the site as observed in copy C, and a water molecule occupies a nearby coordination position (Fig. 2d). The position formerly occupied by the amide group of Asn²¹⁰ is replaced by a water molecule, which forms hydrogen bonds with His²⁰², Asp²¹², and another Ca²⁺-coordinating water molecule. The 3 angle of Glu¹⁹⁸ changes by approximately 75° (Fig. 2e). The 3 angle of Gln¹⁸⁵ also shows small differences relative to the sugar-bound structure (Fig. 2e). These changes produce an altered Ca²⁺ coordination geometry, such that the pentagonal equatorial plane of the eight-coordinated, ligand bound state (Fig. 2f) is rotated approximately 90° with respect to the sugar-binding conformation. Side chain oxygen atoms of Gln¹⁸⁵, Glu¹⁹⁸, and Asp²¹¹, along with two water molecules, form the equatorial pentagonal plane (Fig. 2g). The main chain carbonyl oxygen of Asp²¹¹ and a side chain oxygen of Asp¹⁸⁷ form the two apices, giving a seven-coordinate state. Thus, the coordination number and geometry is altered in copy B, with oxygen atoms from Asp¹⁸⁷ and Asp²¹¹ now, respectively, apical and equatorial, reversing their roles in the sugar-bound structure (Fig. 2, f and g).

In addition to the local changes in the principal Ca²⁺ site, the glycine-rich loop is dramatically rearrranged in copy B. The loop still adopts a well structured conformation, but it is displaced away from the protein (Fig. 4, a and b). As part of this change, Trp¹⁸⁹ changes position and is considerably more solvent exposed than when it is packed against the loop in the sugar-binding conformation. The loop rearrangement cannot be ascribed to a simple hinge motion, because many of the backbone Ramachandran angles differ between the two structures. The distal end of the loop forms contacts with neighboring molecules in the lattice, which may explain its order, but in any case the structure indicates that the loop is dynamic.

View larger version (39K): [in this window] [in a new window]   Fig. 4.   Conformational differences around the principal Ca2+ site. The color scheme is the same as in Fig. 1a. Ca2+ 1 and 2 are the auxiliary and principal sites, respectively. a, native QPDWG-HDRPY, copy A. b, native QPDWG-HDRPY, copy B. c, copy B of apo-MBP-C (23). d, superposition of QPDWG-HDRPY copy A (blue), QPDWG-HDRPY copy B (red), and apo-MBP-C copy B (green).

The rearrangement of the structure in copy B is reminiscent of changes in the equivalent region of mannose-binding protein C (MBP-C) upon loss of Ca²⁺ (23). In the crystal structure of apo-MBP-C, a conserved cis-proline in the Ca²⁺ site (position 194; equivalent to 186 in MBP-A) is observed to isomerize to the trans-form in some copies of the molecule. The equivalent Pro¹⁸⁶ of QPDWG-HDRPY retains the cis-configuration, and in this sense is most similar to copy B of the apo-MBP-C structure (Fig. 4c). Comparison of these structures (Fig. 4d) shows that the region equivalent to the glycine-rich loop moves in a similar direction. Thus, copy B may represent a structural rearrangement related to loss of Ca²⁺ from the CRD.

	DISCUSSION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

GalNAc Selectivity-- The 40-fold preference of QPDWG-HDRPY for GalNAc over Gal is nearly as great as the 60-fold preference shown by RHL-1. The QPDWG-HDRPY structure presented here reveals a specific subsite for the 2-acetamido group that is formed by an intricate network of interactions among His²⁰², Asp²¹², Arg²¹⁶, and Tyr²¹⁸, which are highly conserved in C-type lectins that display preferential binding to GalNAc. Comparison with the unliganded structure of the major subunit of the human hepatocyte asialoglycoprotein receptor (22) reveals that the present structure is virtually identical in the sugar-binding site. These observations indicate that the structure of QPDWG-HDRPY in complex with GalNAc is likely to represent faithfully the mode of interaction in these proteins.

Unlike the hepatocyte asialoglycoprotein receptor, the macrophage galactose receptor (MGR) shows no preference for GalNAc over Gal. All of the RHL-1 residues introduced into QPDWG to give RHL-1-like GalNAc selectivity, i.e. His²⁰², Asp²¹², Arg²¹⁶, Pro²¹⁷, and Tyr²¹⁸ (QPDWG numbering), are found in the MGR. However, it has been shown that position 208 of RHL-1 (230 in the MGR) influences the GalNAc selectivity of this receptor. In RHL-1, this position is asparagine. Replacement of this asparagine with the valine residue present in MGR or isoleucine almost abrogates GalNAc selectivity (24). The equivalent residue in MBP-A is Ser¹⁵⁴. Replacement of Ser¹⁵⁴ of QPDWG-H with Val reduces GalNAc selectivity from 9- to 3-fold (11). The structure of QPDWG-H containing Ser¹⁵⁴  Val showed that the -branched methyl group sterically forces the imidazole ring of His²⁰² to rotate 25°, but the van der Waals' contacts with the acetamido methyl group are retained (Fig. 3) (11). The relationship of the altered His²⁰² position to the reduced GalNAc affinity is unclear from this structure. It should be noted that the rotation of the His²⁰² ring in the presence of Val¹⁵⁴ relative to its position in QPDWG-H is opposite to the direction that would be needed to superimpose it on that in QPDWG-HDPRY (Fig. 3).

In QPDWG-HDRPY, rotation of the His²⁰² imidazole ring is restricted because of its interaction with Tyr²¹⁸. The presence of Val²³⁰ in the MGR may therefore be more disruptive to the GalNAc binding site than observed in the Ser¹⁵⁴  Val mutant of QPDWG-H (11). In particular, the steric clash between valine and the imidazole ring cannot be relieved without forcing the ring of Tyr²¹⁸ to move. This in turn would disrupt the intricate network of hydrogen bonds in the acetamido subsite. It must be noted that the natural galactose receptors contain an extra residue in the loop that contains Ser¹⁵⁴ in QPDWG-HDRPY, and the position of these residues is not strictly equivalent (Fig. 1d). Ultimately, structural analysis will be required to determine the effects of -branched amino acids at this position.

Structural Basis of Altered pH and Ca²⁺ Affinity-- The three conformations of the uncomplexed QPDWG-HDRPY observed in the present crystals may represent discrete structural states associated with Ca²⁺ binding and release by this protein. The crystals were grown at pH 8.0 at a nominal Ca²⁺ concentration of 15 mM. The effective Ca²⁺ affinity, K_Ca, obtained by assaying sugar ligand binding at pH 7.8 as a function of Ca²⁺ is 7.2 mM (12). Thus, the Ca²⁺ concentration is not much over the K_Ca, and it is plausible that three conformations represent intermediates between Ca²⁺-bound and -free forms found in solution. The fact that the three independent copies in the GalNAc-soaked crystals are identical reflects the fact that sugar and Ca²⁺ binding are linked equilibria, so that the effective Ca²⁺ affinity is higher in the presence of GalNAc. The change in Ca²⁺ coordination geometry and the fact that the movement of the glycine-rich loop in copy B is similar to changes in this region in Ca²⁺-free MBP-C (23) suggests that this conformation represents a structural state on the pathway to Ca²⁺ release.

Based on the available structural data, the following pathway of transitions from Ca²⁺ bound to Ca²⁺ free forms of C-type CRDs can be proposed. Copy A of the uncomplexed QPDWG-HDRPY is identical to the GalNAc bound structure, with the exception of the two water molecules that substitute for the 3- and 4-OH groups of the sugar. This structure therefore represents the fully bound Ca²⁺ site structure in a conformation competent to bind to sugar ligands. Copy C is identical to A, except that Asn²¹⁰ is rotated out of the site. The amide group of the Asn²¹⁰ side chain serves as a hydrogen bond donor to His²⁰². At acid pH, His²⁰² will be protonated, making it unable to accept the Asn²¹⁰ hydrogen bond. This electrostatic clash can be relieved by the Asn²¹⁰ side chain rotation observed in copy C, and this conformation would represent the first step in Ca²⁺ release. This would be followed by the side chain rotations of Gln¹⁸⁵ and Glu¹⁹³, the resultant change in coordination geometry and coordination number from 8 to 7 (Fig. 2, f and g), and the movement of the glycine-rich loop observed in copy B (Fig. 4). These changes may be sufficient to release sugar ligands from the protein. It is not known whether the Ca²⁺ is actually released, but if it is this pathway would ultimately produce a state like that observed in apo-MBP-C. The changes may be accompanied by loss of the auxiliary Ca²⁺. Previous work on the MBPs has shown that the Ca²⁺-free state corresponds to an ensemble of conformations. These include states in which Pro¹⁸⁶ of MBP-A (194 in MBP-C) has isomerized to the trans-configuration. Kinetic measurements of this transition have shown that 80% of the Ca²⁺-free molecules are in the trans-form (25), and the slow halftime (several minutes) of cis-trans-proline isomerization slows attainment of the cis-conformation required to bind Ca²⁺. It was proposed that this may serve as a kinetic trap to ensure that receptor and ligand can be sorted from one another (25).

In a recent structure of the fourth CRD from the macrophage mannose receptor, another C-type lectin, the principal Ca²⁺ site is occupied, but the auxiliary site is vacant (26). In this structure, the principal site is rearranged in a manner inconsistent with the geometry of mannose binding in the MBPs. Based on these observations, it was proposed that this CRD may use a different mechanism to release sugar ligands, in which loss of the auxiliary Ca²⁺ leads to changes in the principal site, rendering the latter unable to bind sugar. Although the macrophage mannose receptor and RHL-1 may differ in how they sense acid pH, these two distinct kinds of C-type CRDs may have in common the use of pH-dependent changes outside of the immediate coordination shell of the principal Ca²⁺ site to alter their ability to interact with sugar ligands.

pH Dependence of Ca²⁺ Binding-- Carbohydrate binding in the C-type lectins is strictly dependent on the precise 8-fold coordination found in the principal Ca²⁺ site (4) (Fig. 2, a, b, and f). This dependence couples sugar binding with pH. As the pH drops, a higher fraction of molecules become protonated, resulting in a reduced effective Ca²⁺ affinity. MBPs, which are not endocytic receptors, show a sharp pH dependence of ligand binding, in which binding to multivalent glycoprotein ligands is lost as the pH is lowered between 5.4 and 4.8. The pH_B, defined as the pH at which half-maximal sugar binding occurs at a given Ca²⁺ concentration, is 5.0 for the QPDWG mutant of MBP-A at 1 mM Ca²⁺ (12). This effect is likely due to direct protonation of one or more Ca²⁺ ligands. In contrast, endocytic receptors such as RHL-1 must release their ligands in more mildly acidic conditions and show a more gentle dependence of ligand binding on pH. Mutagenesis of RHL-1 (12) has implicated His²⁵⁶ as an important determinant of pH_B. Introduction of His²⁰², the equivalent of RHL-1 His²⁵⁶, into QPDWG raises pH_B. Introduction of Asp²¹² further raises pH_B, but Asp²¹² has no effect unless His²⁰² is present (12). These data imply that His²⁰² is largely responsible for the pH sensitivity of ligand binding.

Although pH_B is dependent on the Ca²⁺ concentration and is therefore not an intrinsic property of the protein, it is likely to be correlated with the pK_a of His²⁰². At 1 mM Ca²⁺, pH_B of QPDWG-H is 5.7. The solution pK_a of free histidine is approximately 6.5. The structures of GalNAc-bound and copy A of native QPDWG-HDRPY show that His²⁰² accepts a hydrogen bond from Asn²¹⁰. Protonation of His²⁰² will disrupt this interaction, so this arrangement would be expected to lower the effective pK_a of His²⁰². The addition of Asp²¹² to QPDWG-H further raises the pH_B to 6.1. The present structures show that Asp²¹² is approximately 3.9 Å from the N2 imidazole nitrogen of His²⁰². This distance is too long for a hydrogen bond interaction but would be expected to provide a significant perturbation of the electrostatic environment of His²⁰². In particular, the presence of negative charge would be predicted to favor protonation of His²⁰² and raise the pK_a.

Addition of the RPY loop to QPDWG-HD further raises the pH_B. Changes in pH dependence produced by introduction of these residues are likely due to a combination of effects. Arg²¹⁶ interacts directly with Asp²¹², which would be predicted to lessen the effect of the latter on the pK_a of His²⁰² by neutralizing the negative charge. It would be expected that the presence of Arg²¹⁶ in the vicinity of His²⁰² would lower the pK_a of the histidine. This notion is supported by the observation that mutation of Arg²⁷⁰ to leucine in RHL-1 raises the pH_B (12). On the other hand, there are two well ordered water molecules held in position by this arginine and two acidic residues (Fig. 1, a and b). The network of interactions (Fig. 1, a and b) serves to position Tyr²¹⁸, so that its delocalized -electron system forms an electrostatically favorable interaction with His²⁰². Formation of a hydrogen bond by the phenolic hydroxyl proton with Asp²¹² will enhance the partial negative charge of the aromatic system. Protonation of His²⁰² would be expected to enhance this interaction, as has been observed in other systems (27). As noted above, however, the position of Tyr²⁷⁰ in HHL-1 differs slightly from that of Tyr²¹⁸ in QPDWG-HDRPY (Fig. 1d), so that a direct cation- interaction with His²⁵⁶ does not exist in HHL-1. Nonetheless, the proximity of the delocalized  system of the tyrosine may provide a small electrostatic contribution that would tend to raise the pK_a of His²⁰². Finally, as discussed above, Val²³⁰ of the MGR, equivalent to Ser¹⁵⁴ of QPDWG-HDRPY, would be expected to disrupt this network, which may account for the fact that the pH_B of 6.3 (1 mM Ca²⁺) found for the MGR⁵ is lower than the pH_B of RHL-1. Collectively, these observations indicate that the interactions of the Asp²¹², Arg²¹⁶, Tyr²¹⁸, and water must influence the electrostatic environment of His²⁰² to alter its pK_a. A more detailed dissection of the contributions of these residues awaits direct measurement of the His²⁰² pK_a and detailed electrostatic calculations.

	ACKNOWLEDGEMENTS

We are grateful to Markus Meier and Peter Burkhard for providing the HHL-1 coordinates prior to general release. We thank Andy May and Katy Spink for data collection at Stanford Synchrotron Radiation Laboratory and for comments on the manuscript.

	FOOTNOTES

^* This work was supported by Grants 041845 and 054508 from the Wellcome Trust (to K. D.) and Grant GM50565 from the National Institutes of Health (to W. I. W.). This work is based upon research conducted at the Stanford Synchrotron Radiation Laboratory, which is funded by the Department of Energy and the National Institutes of Health (NCRR and NIGMS).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

The atomic coordinates and the structure factors (code 1FIF and 1FIH) have been deposited in the Protein Data Bank, Research Collaboratory for Structural Bioinformatics, Rutgers University, New Brunswick, NJ (http://www.rcsb.org/).

^¶ To whom correspondence should be addressed: Dept. of Structural Biology, Fairchild Bldg., Stanford University School of Medicine, 299 Campus Dr. West, Stanford, CA 94305-5126. E-mail: bill.weis@stanford.edu.

Published, JBC Papers in Press, August 7, 2000, DOI 10.1074/jbc.M005557200

² A. K. Powell and K. Drickamer, unpublished observations.

³ B. Zagrovic, H. Feinberg, A. Kolatkar, K. Drickamer, W. Weis, unpublished data.

⁴ A Kolatkar, K. Ng, S. Park-Snyder, K. Drickamer, W. Weis, manuscript in preparation.

⁵ H. Dobbyn and S. Wragg, unpublished observations.

	ABBREVIATIONS

The abbreviations used are: GalNAc, N-acetyl-D-galactosamine; CRD, carbohydrate recognition domain; HHL, human hepatic lectin; MBP, mannose-binding protein; RHL, rat hepatic lectin; MGR, macrophage galactose receptor.

	REFERENCES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

CiteULike

Complore

Connotea

Del.icio.us

Digg

Reddit

Technorati

This article has been cited by other articles:

				A. S. Powlesland, T. Fisch, M. E. Taylor, D. F. Smith, B. Tissot, A. Dell, S. Pohlmann, and K. Drickamer A Novel Mechanism for LSECtin Binding to Ebola Virus Surface Glycoprotein through Truncated Glycans J. Biol. Chem., January 4, 2008; 283(1): 593 - 602. [Abstract] [Full Text] [PDF]

				H. Feinberg, M. E. Taylor, and W. I. Weis Scavenger Receptor C-type Lectin Binds to the Leukocyte Cell Surface Glycan Lewisx by a Novel Mechanism J. Biol. Chem., June 8, 2007; 282(23): 17250 - 17258. [Abstract] [Full Text] [PDF]

				H. Yura, M. Ishihara, Y. Kanatani, B. Takase, H. Hattori, S. Suzuki, M. Kawakami, and T. Matsui Interaction Study between Synthetic Glycoconjugate Ligands and Endocytic Receptors Using Flow Cytometry. J. Biochem., April 1, 2006; 139(4): 637 - 643. [Abstract] [Full Text] [PDF]

				C. Appenzeller-Herzog, A.-C. Roche, O. Nufer, and H.-P. Hauri pH-induced Conversion of the Transport Lectin ERGIC-53 Triggers Glycoprotein Release J. Biol. Chem., March 26, 2004; 279(13): 12943 - 12950. [Abstract] [Full Text] [PDF]

				T. Hatakeyama, K. Shiba, N. Matsuo, T. Fujimoto, T. Oda, H. Sugawara, and H. Aoyagi Characterization of Recombinant CEL-I, a GalNAc-Specific C-Type Lectin, Expressed in Escherichia coli Using an Artificial Synthetic Gene J. Biochem., January 1, 2004; 135(1): 101 - 107. [Abstract] [Full Text] [PDF]

				A. J. Fadden, O. J. Holt, and K. Drickamer Molecular characterization of the rat Kupffer cell glycoprotein receptor Glycobiology, July 1, 2003; 13(7): 529 - 537. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) All Versions of this Article: 275/45/35176    most recent M005557200v1 Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Feinberg, H. Articles by Weis, W. I.