HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

J. Biol. Chem., Vol. 275, Issue 45, 35248-35255, November 10, 2000

This Article Abstract Full Text (PDF) All Versions of this Article: 275/45/35248    most recent M006041200v1 Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Guschin, D. Articles by Wade, P. A. Search for Related Content PubMed PubMed Citation Articles by Guschin, D. Articles by Wade, P. A. Social Bookmarking                      What's this?

Multiple ISWI ATPase Complexes from Xenopus laevis

FUNCTIONAL CONSERVATION OF AN ACF/CHRAC HOMOLOG^*

Dmitry Guschin^§, Theresa M. Geiman^¶, Nobuaki Kikyo^¶, David J. Tremethick, Alan P. Wolffe^§, and Paul A. Wade^**

From the  Laboratory of Molecular Embryology, NICHD, National Institutes of Health, Bethesda, Maryland 20892 and  John Curtin School of Medical Research, The Australian National University, Canberra, ACT 2601, Australia

Received for publication, July 10, 2000, and in revised form, August 7, 2000

	ABSTRACT

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

The nucleosomal ATPase ISWI is the catalytic subunit of several protein complexes that either organize or perturb chromatin structure in vitro. This work reports the cloning and biochemical characterization of a Xenopus ISWI homolog. Surprisingly, whereas we find four complex forms of ISWI in egg extracts, we find no functional homolog of NURF. One of these complexes, xACF, consists of ISWI, Acf1, and a previously uncharacterized protein of 175 kDa. Like both ACF and CHRAC, this complex organizes randomly deposited histones into a regularly spaced array. The remaining three forms include two novel ISWI complexes distinct from known ISWI complexes plus a histone-dependent ATPase complex. This comprehensive biochemical characterization of ISWI underscores the evolutionary conservation of the ACF/CHRAC family.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Nuclear DNA in eukaryotic cells is assembled into a nucleoprotein structure, chromatin, that imposes functional constraints on DNA. The nuclear processes of transcription (1, 2), replication (3), recombination (4, 5), and DNA repair (6, 7) are strongly influenced by chromatin architecture. At least two classes of enzymes remodel chromatin structure to facilitate DNA function, histone modification enzymes (2) and energy-dependent motor proteins (8). The latter category includes both polymerases (9, 10) and SNF2 superfamily ATPases (11-20). The prototypical member of the SNF2 family, the SWI2/SNF2 protein, is conserved from yeast to man (12, 15, 20). Both genetic and biochemical data tie SWI-SNF complex function to facilitation of transcription within chromatin (11-20). Other multiprotein complexes containing related SNF2 superfamily members have been described, including the Mi-2 complex (reviewed in Refs. 11 and 12) as well as several ISWI containing complexes (reviewed in Refs. 12, 19, and 20). The precise in vivo functions of the latter two categories of enzyme remain largely undefined.

Unlike SWI-SNF complexes that share a common core of subunits (11-20), ISWI homologs have been described in multiple, distinct complexes (12, 19-20). There are three examples in Drosophila embryo extracts as follows: NURF (21-22), CHRAC (23-24), and ACF (25-26). CHRAC and ACF share a common core of subunits, ISWI and Acf1 (26-28). Human cells contain functional homologs of CHRAC (27) and ACF (29-30), in addition to the RSF complex that has no known relatives in other organisms (31). Finally, yeast contains two forms of ISWI (32), although the relationship of these complexes to those found in metazoans is currently unknown. All these complexes, with the notable exception of NURF, share the ability to organize spaced nucleosomal arrays, suggesting roles for ISWI in chromatin assembly (21, 24, 25, 27, 29-32). Surprisingly, mutations in the two ISWI genes in yeast generate no obvious phenotypes (32), although defects in sporulation have been reported (33). In contrast, the single ISWI gene in Drosophila is essential for normal development, and mutations result in chromosomal defects (34).

In Xenopus laevis, early development proceeds from fertilization through a series of rapid embryonic cleavages in the absence of zygotic transcription (35-36). The structural components and enzymatic machinery for embryonic chromatin assembly are stored in the egg (37), representing a rich biochemical source. Historically, Xenopus egg (38-40) and oocyte extracts (41) have been utilized to assemble spaced chromatin in vitro for studies of transcription (42-43) and DNA repair (44). They contain activities competent for both spacing of nucleosomal arrays (45) and mononucleosome disruption (46). We have utilized classical biochemical techniques for a survey of ISWI from these extracts. This report outlines the purification of four ISWI complexes. Consistent with the demands for chromatin assembly during early Xenopus development, an ACF/CHRAC functional homolog was the most abundant form identified. In addition, we report the surprising absence of detectable quantities of NURF.

	EXPERIMENTAL PROCEDURES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Isolation of an ISWI cDNA-- RT-PCR¹ was performed under standard conditions (47) with Xenopus ovary RNA as template using the following oligonucleotides: sense, 5'CCCAAGCTTCATATGAACTA(T/C)GC(A/T)GTGGATGCCTA(C/T)TT3'; antisense, 5'AAGCTTCTCGAGTTCTTCATATAC(A/G)TT(C/T)TC(C/T)CT(A/G)TCAAA3'. The resulting PCR product was cloned into pGEM-T (Promega) and sequenced. The RT-PCR product was used as a probe for screening an oocyte cDNA library using standard methods (47). Two overlapping clones were isolated covering the entire ISWI open reading frame. These clones were sequenced on both strands using an ABI Prism 377 automated DNA sequencer.

Production of Anti-ISWI Antiserum-- The RT-PCR clone was excised from pGEM-T with NdeI and XhoI and cloned into the same sites of pET21a (Novagen). Protein production and purification under denaturing conditions were performed according to the manufacturer's instructions (Novagen). Antibodies were produced in New Zealand White rabbits using a standard immunization protocol (48).

Purification of ISWI Complexes-- Egg extract was prepared and fractionated through Bio-Rex 70 and MonoQ essentially as described (49). Eggs were obtained from mature female X. laevis and extracted by the crushed cell method (49). The resulting extracts were applied to Bio-Rex 70 (Na⁺ form, Bio-Rad) previously equilibrated in Buffer A (100 mM) (20 mM HEPES, pH 7.5, 5 mM KCl, 1.5 mM MgCl₂, 1 mM EGTA, 10 mM -glycerophosphate, 0.5 mM dithiothreitol, 10% glycerol, 0.2 mM phenylmethylsulfonyl fluoride, 1 µg/ml leupeptin, numbers in parentheses indicate millimolar concentration of NaCl) at a ratio of 10 mg of protein per ml packed bed volume. The column was washed with 4 volumes of Buffer A (100) and eluted with 3 volumes of Buffer A (500). Fractions containing approximately 80% of the eluted protein from the Buffer A (500) elution were pooled and dialyzed versus Buffer A (0) to a conductance equivalent to 100 mM NaCl. The protein pool was cleared by centrifugation and applied to a MonoQ 10/10 column previously equilibrated in Buffer A (100). The column was washed with 5 volumes of Buffer A (100) and eluted with a linear gradient from Buffer A (100) to A (500) in 20 column volumes. Fractions were analyzed for ISWI content by immunoblot.

The ISWI-A peak was further purified by sedimentation on a 5-20% sucrose gradient in Buffer A (49) for 28 h at 41,000 rpm in an SW 41 rotor.

The ISWI-B, ISWI-C, and ISWI-D complexes were each purified through gradient elution on MonoS and heparin-Sepharose. Peak fractions from the MonoQ column were dialyzed versus Buffer A (0 mM) to a conductance equivalent to 100 mM NaCl and applied to a MonoS 5/5 column previously equilibrated in Buffer A (100). The column was washed with 5 column volumes Buffer A (100) and eluted with a linear gradient from Buffer A (100) to A (500) in 20 column volumes. Fractions were analyzed for ISWI content by immunoblot. Elution positions for the individual ISWI complexes were as follows: ISWI-B, 360 mM NaCl; ISWI-C, 350 mM NaCl, ISWI-D, 330 mM NaCl. Each ISWI MonoS pool was dialyzed versus Buffer A (0 mM) containing 0.1% Triton X-100 to a conductance equivalent to 100 mM NaCl. Protein samples were cleared by centrifugation and applied to 1-ml heparin-Sepharose columns (HiTrap columns, Amersham Pharmacia Biotech) previously equilibrated in Buffer A (100) plus 0.1% Triton X-100. Columns were washed with 5 volumes A (100) and eluted with linear gradients from Buffer A (100) to Buffer A (1000) in 20 column volumes, buffers contained 0.1% Triton X-100. Elution positions for the respective ISWI complexes were as follows: ISWI-B, 540 mM NaCl; ISWI-C, 570 mM NaCl; ISWI-D, 540 mM NaCl.

ATPase assays were performed as described (49, 50).

Octamer Mobilization and Spacing Assays-- Nucleosome reconstitution and histone octamer mobilization experiments were performed as described (50) using the quantities indicated in the figure legends.

Chromatin assembly and spacing assays were performed as described (45). In the indicated reactions, 1 µl of anti-ISWI antiserum or preimmune serum from the same rabbit was included. Additional spacing assays with salt-dialyzed chromatin were performed essentially as described (25).

	RESULTS

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Cloning of Xenopus ISWI and Fractionation into Multiple Complexes-- We began our studies of ISWI in Xenopus by cloning an ISWI cDNA from an oocyte library. A single class of cDNA coding for a protein of 1037 amino acids was isolated (GenBank^TM accession number AF292095). Comparison of the predicted amino acid sequence of the Xenopus cDNA (see Fig. 1) revealed closest similarity to the human ISWI homolog hSNF2H (51). The Xenopus protein contains the conserved sequence blocks diagnostic of the SNF2 superfamily (52) in addition to considerable sequence identity with both human ISWI homologs in the carboxyl-terminal portion of the protein including the SANT domain (53). We utilized this highly conserved carboxyl-terminal region to elicit antibodies (amino acids 724-955). The antibody detects a protein of the predicted size in egg and oocyte extracts (data not shown); we have subsequently utilized it as a tool for the purification of ISWI from egg extracts.

View larger version (84K): [in this window] [in a new window]   Fig. 1.   Xenopus ISWI is homologous to hSNF2H. The deduced amino acid sequence of Xenopus ISWI (xISWI) was aligned manually with the amino acid sequences of hSNF2H, hSNF2L, and Drosophila ISWI (dm ISWI). The boxed regions numbered I-VI represent sequence blocks characteristic of the SNF2 superfamily (52). The conserved SANT domain (53) is boxed and labeled.

The first two steps of ISWI purification are outlined in Fig. 2A. All the detectable ISWI bound the initial cation exchange column and was eluted at moderate salt. Surprisingly, gradient elution of the 0.5 M Bio-Rex fraction on MonoQ reproducibly yielded four distinct peaks of ISWI by immunoblot that we provisionally named ISWI-A, -B, -C, and -D (see Fig. 2B). The ISWI-C peak was the most abundant on the MonoQ gradient. RbA p48/p46, a subunit of the Drosophila NURF complex (54), did not copurify with ISWI at this step. In fact, the prominent RbA p48/p46 peak on the MonoQ gradient is associated with the Xenopus Mi-2 complex (49).

View larger version (14K): [in this window] [in a new window]   Fig. 2.   Xenopus egg extracts contain multiple forms of ISWI. A, the fractionation scheme from egg extract is summarized in the diagram. The inset immunoblot depicts the elution of ISWI on the Bio-Rex 70 column. B, the panels depict immunoblots of selected fractions from the gradient elution on MonoQ. The individual ISWI peaks are indicated in the figure. C, ATPase assays were performed as described under "Experimental Procedures" using free DNA, purified core histones, or chicken erythrocyte mononucleosomes as substrates. The graph depicts picomoles of ATP hydrolyzed as a function of fraction number.

ATPase activity assays of the gradient fractions revealed a major peak of DNA-stimulated ATPase activity coincident with the peak of RbA p48/p46 in fractions 31-33. Although we do not currently know the identity of this ATPase, it is not associated with either Mi-2 or ISWI (data not shown (49)). Surprisingly, the ISWI-A peak coincided with ATPase activity stimulated by free histones. ISWI-D, as expected, copurified with nucleosome-stimulated ATPase activity. The ISWI-B and -C complexes were associated with minor peaks of nucleosome-stimulated ATPase, although their activities were partially obscured by the robust DNA-stimulated ATPase in this region of the gradient.

Purification of a Histone-dependent ATPase Complex-- ISWI-A was further purified by sedimentation on a sucrose gradient. Histone-stimulated ATPase activity was found in fractions 22-24 (see Fig. 3A) whereas immunoblots revealed ISWI in fractions 23-25 (Fig. 3B). ATPase activity precisely cosedimented with three polypeptides of 200, 21, and 15 kDa at a position consistent with a molecular mass of 250 kDa (Fig. 3A and data not shown). Although ISWI protein closely cosedimented with histone-dependent ATPase activity, it was not present at comparable stoichiometry to p200, p21, and p15. We are currently investigating the identity of p200, p21, and p15 in order to determine whether their copurification with ISWI is functionally relevant.

View larger version (20K): [in this window] [in a new window]   Fig. 3.   A novel histone-dependent ATPase activity copurifies with a three-polypeptide complex. A, histone-stimulated ATPase activity of sucrose gradient fractions is depicted in the graph. ATPase assays were performed as described under "Experimental Procedures." B, an immunoblot of selected sucrose gradient fractions was probed with anti-ISWI antibody. C, aliquots of the indicated sucrose gradient fractions were resolved on SDS-PAGE (4-20% acrylamide gradient) and stained with Coomassie Blue. Arrows indicate the 200-, 21-, and 15-kDa proteins cosedimenting with ATPase activity. D, an ATP cross-linking assay was performed with 8-azido-ATP. Two microliters of sucrose fraction 23 were incubated with or without core histones and 8-azido-ATP for 30 min at room temperature. Cross-linking was initiated with a Stratalinker, and samples were resolved in 4-20% gradient SDS gels that were subsequently dried and exposed to x-ray film.

To determine the relationship between these three polypeptides and ATPase activity, we performed a cross-linking assay using a radiolabeled ATP analog (8-azido-[-³²P]ATP). The 200-kDa polypeptide cross-linked to ATP in the presence of UV light in a reaction stimulated by core histones (see Fig. 3D). As histones represent the vast majority of protein in the reaction (roughly 5-6 orders of magnitude more abundant than ISWI-A), it is not surprising that they are nonspecifically cross-linked. We conclude that p200 represents a candidate ATPase stimulated by free histones. To our knowledge, this is the first description of an ATPase stimulated solely by free histones and not by DNA or nucleosomes. The biological relevance of this activity is currently unknown.

ISWI-C Represents a Functional Homolog of ACF-- ISWI-C was purified through the chromatographic steps summarized in Fig. 4A. Nucleosome-stimulated ATPase activity coeluted with ISWI in fractions 31-34 of the final column (data not shown). Three polypeptides of 185, 175, and 135 kDa, respectively, were present in the purified complex (see Fig. 4A), and higher percentage gels fail to reveal additional subunits (data not shown). This polypeptide composition is essentially identical to that reported for the Drosophila ACF complex (35-36). We confirmed the identity of the 135-kDa subunit as ISWI using immunoblots and by mass spectrometry (data not shown).

View larger version (42K): [in this window] [in a new window]   Fig. 4.   Xenopus ISWI-C a functional homolog of Drosophila ACF. A, the flow chart depicts the purification steps for the ISWI-C complex which we have renamed xACF. Aliquots of fractions from the heparin column were resolved on 6% SDS-PAGE and stained with silver. The bands corresponding to p185 (xACF1), p175, and ISWI are indicated in the figure. B, the mixture of positional isomers obtained following nucleosome assembly on the 250-base pair fragment of the Xenopus TRA promoter. The positions of histone octamers depicted in the cartoons were determined by micrococcal nuclease mapping (50). C, autoradiogram of a native polyacrylamide gel following nucleosome mobilization. The nucleosome at position 2 was isolated and used in an octamer mobilization assay. Positions of free DNA and unique nucleosome positions are indicated on the figure. Reactions were performed in the presence or absence of 1 mM MgATP, AMP-PNP, or GTP as indicated. 1 microliter (100 ng) of purified xACF (MonoS fraction) or 1 µl (120 ng) of recombinant Drosophila ISWI was added as indicated. In the indicated lanes, the K159R mutant Drosophila protein (61) was used. D, chromatin was assembled and analyzed by micrococcal nuclease digestion and agarose gel. Two time points of digestion are shown for each assembly reaction. ISWI antibody, preimmune serum, spacing fraction, and Xenopus ACF were added as depicted in the figure. E, histones were deposited on DNA by standard salt dialysis. The resulting minichromosomes were incubated with xACF in the presence or absence of 1 mM ATP as depicted in the figure. Arrowheads on the right indicate the migration of DNA fragments resulting from the production of mono, di, tri, tetra, and penta-nucleosomal particles.

Peptide sequence from the 185-kDa protein yielded a single peptide (KEREEAAARIRK) with an exact match to a human EST clone (GenBank^TM accession number AA112166). This EST clone was subsequently found to be contained in its entirety within a protein recently described by different groups as either WCRF180 (29), BAZ1A (55), or hAcf1 (27). We conclude that ISWI-C, based on the similarity in polypeptide profile as well as the chemical identification of p185 as a sequence relative of human and Drosophila Acf1, represents a new member of the ACF-CHRAC complex family.

The primary difference between the Xenopus and Drosophila ACF complexes and the recently described WCRF and hACF complexes is the presence of a p175 species in the Xenopus and Drosophila ACF complexes. The p175 component of Drosophila ACF has been identified as similar or identical to the Acf1 protein based on peptide chemistry and on immunoreactivity (26). We have compared peptide maps obtained by mass spectrometry of Xenopus p185 and p175. We find, in contrast to Drosophila ACF, that these two proteins are distinct (data not shown). We are currently pursuing the identity of the Xenopus p175 protein; there are no candidate sequences in the current data bases.

To assess the ability of Xenopus ACF (hereafter referred to as xACF) to perturb histone-DNA interactions, we utilized an octamer mobilization assay (reviewed in Ref. 56) previously used for Drosophila NURF and CHRAC (57-58). Nucleosomes were assembled by salt dialysis on a 250-base pair fragment of the Xenopus TRA promoter (59). The resulting uniquely positioned nucleosomes have been characterized by micrococcal nuclease mapping (50), and the positions are summarized in cartoon form in Fig. 4B. Following isolation of the unique position termed N2 by native polyacrylamide gel electrophoresis, we incubated this nucleosome with purified xACF complex. Recombinant Drosophila ISWI served as a positive control (57-58). As previously reported (57-58), recombinant ISWI shifted the position of the histone octamer to a new position, namely to the end of the DNA fragment (see Fig. 4C). In contrast, purified xACF shifted the octamer position toward the center (see Fig. 4C). This octamer mobilization required ATP hydrolysis because a non-hydrolyzable ATP analog did not promote this reaction nor did GTP. Additionally, as the reaction did not result in the accumulation of free DNA (see Fig. 4C), octamer movement must occur in cis. The Drosophila CHRAC complex mobilizes nucleosomes in a similar manner, albeit on an unrelated DNA fragment (58). The Drosophila NURF complex, on the other hand, moves octamers bidirectionally on DNA and prefers, on a fragment of the Drosophila hsp70 promoter, to reposition histones near the end of the fragment (57). Recombinant Drosophila ISWI preferentially repositions the octamer at the fragment end (57-58).

As Drosophila ACF was initially characterized as an energy-dependent chromatin assembly factor (25-26), we have investigated the ability of Xenopus ACF to organize nucleosomal arrays. We first utilized a chromatin assembly system from Xenopus oocyte extracts consisting of a partially purified H3·H4-N1·N2 complex, purified H2A/H2B heterodimers, and spacing activity provided by either crude oocyte extracts or the previously defined spacing fraction (45). As seen in Fig. 4D, this reconstituted system directs the assembly of a nucleosomal array with physiologic spacing (see 1st and 2nd lanes). The addition of anti-ISWI antibody, but not preimmune serum, results in a loss of chromatin organization. The spacing fraction can rescue the ISWI-depleted reaction (Fig. 4D), and immunoblot analysis reveals that ISWI is present in the spacing fraction (data not shown). Like the original spacing fraction, Xenopus ACF is capable of rescuing the spacing and assembly properties of the ISWI-depleted reaction (see Fig. 4D). Drosophila ACF can reorganize nucleosomes deposited by salt gradient dialysis (25). We tested xACF for similar activity in a system consisting solely of purified core histones deposited by salt dialysis and purified xACF1. Treatment of the resulting minichromosomes with xACF1 resulted in a regularly spaced nucleosomal array with up to five or six nucleosomes visible following micrococcal nuclease digestion (Fig. 4E). In addition, octamer spacing on the xACF-treated minichromosomes changes from a close-packed to a uniformly spaced configuration in an ATP-dependent manner (Fig. 4E).

ISWI-B and ISWI-D Represent Novel ISWI Complexes-- ISWI-B was purified through the chromatographic steps outlined in Fig. 5A. ISWI copurified with a single polypeptide of 200 kDa (Fig. 5A) and with nucleosome-stimulated ATPase activity in the final purification step, gradient elution on heparin-Sepharose (data not shown). Sedimentation analysis indicated a molecular mass of approximately 500 kDa (data not shown). Peptide mapping of p200 by tryptic digestion and mass spectrometry failed to generate matches to any proteins in the current data base (data not shown).

View larger version (20K): [in this window] [in a new window]   Fig. 5.   The ISWI-B complex consists of ISWI and a 200-kDa protein. A, the purification scheme for ISWI-B is outlined in the diagram. Aliquots from the heparin column were resolved on 10% SDS-PAGE and stained with Coomassie Blue. The bands corresponding to ISWI and p200 are indicated. B, nucleosome mobilization assays were performed as described under "Experimental Procedures." ATP, AMP-PNP, and GTP were added as indicated. ISWI-B complex (MonoS fraction) was added where indicated (1 µl, 80 ng). The positions of individual nucleosomes are indicated on the figure.

The final peak, ISWI-D, was purified through chromatography on MonoS and heparin (see Fig. 6A). A sharp peak of nucleosome-stimulated ATPase activity exactly coeluted with ISWI on the final purification step (data not shown). Polypeptides of 200, 135, and 70 kDa copurified in the ISWI-D complex (shown in Fig. 6A). However, electrophoresis of a greater quantity of protein on higher percentage gels revealed the presence of additional polypeptides of 55 and 17 kDa (see Fig. 6A). Peptide mapping for the p200, p70, and p55 ISWI-D polypeptides failed to generate matches in the current data bases. The p200 polypeptide found in the ISWI-B complex is distinct from the ISWI-D p200 protein by mass spectrometry (data not shown). Additionally, mass spectrometry rules out copurification of ISWI with Xenopus topoisomerase II as initially reported for Drosophila CHRAC (24). We were also unable to detect copurification of ISWI with topoisomerase II in any of these complexes by immunoblot analysis (data not shown) using -Xenopus topoisomerase II (60).

View larger version (36K): [in this window] [in a new window]   Fig. 6.   ISWI-D is a five-polypeptide complex. A, the purification scheme for ISWI-D is summarized in the diagram. Aliquots of fractions from the final purification step were resolved on 10% SDS-PAGE and stained with Coomassie Blue. The bands corresponding to p200, ISWI, and p70 are indicated in the figure. A higher percentage gel of the ISWI-D peak was loaded with severalfold more protein and stained with Coomassie to demonstrate the presence of p55 and p17. B, nucleosome mobilization was performed as described for ISWI-B and xACF. ATP, AMP-PNP, and GTP were added as indicated. ISWI-D (MonoS fraction) was added where indicated (1 µl, 40 ng). The positions of free DNA and individual nucleosomes are indicated on the figure.

We have also examined the capacity of the ISWI-B and ISWI-D complexes to mobilize histone octamers in our standard mobilization assay. Like xACF, both ISWI-B and ISWI-D move histone octamers in an ATP-dependent fashion (see Fig. 5B and Fig. 6B). Additionally, both complexes, like xACF, reposition octamers toward the center of the DNA fragment (see Fig. 6B). Comparison of the mobilization activities of these three complexes failed to reveal significant qualitative or quantitative differences.

	DISCUSSION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

This report describes the first systematic characterization of all major forms of ISWI from a vertebrate, X. laevis. The ISWI protein presented considerable biochemical complexity, fractionating into four forms with distinct biochemical properties and subunit composition. In Saccharomyces cerevisiae, the two ISWI genes form only two types of protein complex (32). In Drosophila embryos, three complexes containing ISWI have been described (reviewed in Refs. 12, 19, and 20), but two, ACF and CHRAC, are clearly related (26, 28). Undoubtedly, the developmental program of Xenopus, with an early period of rapid nuclear divisions, places a special burden on the machinery for chromatin assembly. The multiple ISWI complexes described here may reflect those specialized demands.

Human cells, Xenopus eggs, and Drosophila embryos all contain ISWI complexes featuring an Acf1 homolog (26-30). In addition, S. cerevisiae contains a homolog (YGL133w) suggesting that an ACF-like complex also exists in this organism. ACF is thus likely to represent a fundamental activity in eukaryotic nuclei. The differences in polypeptide composition found in the various members of the ACF/CHRAC family likely represent variations on a common theme. As depicted in Fig. 7, ISWI and Acf1 associate to form a common structural and functional module. Functionality, such as differential partitioning within the genome, may be added to this module by association with accessory proteins like the histone fold proteins of CHRAC or p175 of xACF. Elucidation of the precise variations in composition and function for this interesting family of chromatin-dependent ATPases should provide important clues into mechanisms for assembly of specialized chromatin structures.

View larger version (12K): [in this window] [in a new window]   Fig. 7.   The ACF/CHRAC family of chromatin remodeling complexes. The model describes the potential relationships of the known members of the ACF/CHRAC family of chromatin-remodeling enzymes. Additional features of the model are described in the text.

We have initiated an attempt to understand the functions of the Xenopus ISWI complexes by defining their nucleosome mobilization properties. Each complex, regardless of polypeptide composition, mobilized histone octamers toward the center of the DNA fragment like the Drosophila CHRAC complex (58) and unlike the Drosophila NURF complex (57). This repositioning of histones relative to DNA sequence required a hydrolyzable form of ATP, operated at moderate monovalent and divalent cation concentrations, and occurred in cis on a single DNA fragment. Mechanistically, we favor the model recently proposed by Wu and colleagues (57), which stipulates that nucleosome motion occurs in small, discrete steps. Central to this proposal is the notion that ATP hydrolysis by the ISWI ATPase leads to lowered activation energy for short translational sliding by the histone octamer. The NURF complex, based on the bidirectional character of its mobilization activity, is predicted to generate a relatively unrestricted random walk of histones to a thermodynamically favorable position (57). In marked contrast, the CHRAC complex (58) and all three Xenopus complexes exhibit strong directionality in their mobilization activity. We propose that proteins other than ISWI in the Xenopus ISWI complexes and in CHRAC restrict the potential locations available for octamer motion. This restriction serves functionally to maximize the amount of DNA protruding from each end of the nucleosome. This hypothesis predicts that proteins in the Xenopus ISWI complexes other than ISWI interact with extranucleosomal DNA. Activity of this nature on a mononucleosome is also predicted to translate into spacing in the context of a nucleosomal array where adjacent nucleosomes rather than DNA ends provide the limits for available positions. The definition, in molecular terms, of the remaining ISWI-associated proteins described in this work should prove valuable in the mechanistic determination of histone octamer mobilization by this class of enzymes as well as their roles in influencing chromatin structure and DNA function in vivo.

	ACKNOWLEDGEMENTS

Protein sequence determination was performed by the Protein/DNA Technology Center of the Rockefeller University. Mass spectrometry for the ISWI-B and ISWI-D polypeptides was performed at the Protein/DNA Technology Center of the Rockefeller University. Mass spectrometry of the xACF polypeptides was performed by Dr. Alfred Yergey of the Section on Mass Spectrometry and Metabolism, Laboratory of Cellular and Molecular Biophysics, NICHD. We thank Dr. Peter Becker for the kind gift of recombinant Drosophila ISWI expression clones and Dr. Dan Bogenhagen for the gift of topoisomerase II antisera. We thank the members of the Laboratory of Molecular Embryology for their help and advice throughout the course of this work.

	FOOTNOTES

^* The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

^§ Current address: Sangamo BioSciences, Inc., Point Richmond Tech Center, 501 Canal Blvd., Suite A100, Richmond, CA 94804.

^¶ Current address: Laboratory of Receptor Biology and Gene Expression, NCI, National Institutes of Health, Bethesda, MD 20892.

^** To whom correspondence should be addressed: Emory University, Dept. of Pathology, Woodruff Memorial Research Bldg., Rm. 7105-B, 1639 Pierce Dr., Atlanta, GA 30322. Tel.: 404-712-9666; Fax: 404-727-8540; E-mail pwade@emory.edu.

Published, JBC Papers in Press, August 14, 2000, DOI 10.1074/jbc.M006041200

	ABBREVIATIONS

The abbreviations used are: RT-PCR, reverse transcriptase-polymerase chain reaction; AMP-PNP, adenosine 5'-(,-imino)triphosphate; PAGE, polyacrylamide gel electrophoresis.

	REFERENCES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

CiteULike

Complore

Connotea

Del.icio.us

Digg

Reddit

Technorati

This article has been cited by other articles:

				W. Dang, M. N. Kagalwala, and B. Bartholomew The Dpb4 Subunit of ISW2 Is Anchored to Extranucleosomal DNA J. Biol. Chem., July 6, 2007; 282(27): 19418 - 19425. [Abstract] [Full Text] [PDF]

				M. D. Stewart, J. Sommerville, and J. Wong Dynamic Regulation of Histone Modifications in Xenopus Oocytes through Histone Exchange. Mol. Cell. Biol., September 1, 2006; 26(18): 6890 - 6901. [Abstract] [Full Text] [PDF]

				R. Schwanbeck, H. Xiao, and C. Wu Spatial Contacts and Nucleosome Step Movements Induced by the NURF Chromatin Remodeling Complex J. Biol. Chem., September 17, 2004; 279(38): 39933 - 39941. [Abstract] [Full Text] [PDF]

				A. D. McConnell, M. E. Gelbart, and T. Tsukiyama Histone Fold Protein Dls1p Is Required for Isw2-Dependent Chromatin Remodeling In Vivo Mol. Cell. Biol., April 1, 2004; 24(7): 2605 - 2613. [Abstract] [Full Text] [PDF]

				S. K. Davis and C. J. Bardeen The Connection between Chromatin Motion on the 100 nm Length Scale and Core Histone Dynamics in Live XTC-2 Cells and Isolated Nuclei Biophys. J., January 1, 2004; 86(1): 555 - 564. [Abstract] [Full Text] [PDF]

				A. Flaus and T. Owen-Hughes Dynamic Properties of Nucleosomes during Thermal and ATP-Driven Mobilization Mol. Cell. Biol., November 1, 2003; 23(21): 7767 - 7779. [Abstract] [Full Text] [PDF]

				A. Loyola, J.-Y. Huang, G. LeRoy, S. Hu, Y.-H. Wang, R. J. Donnelly, W. S. Lane, S.-C. Lee, and D. Reinberg Functional Analysis of the Subunits of the Chromatin Assembly Factor RSF Mol. Cell. Biol., October 1, 2003; 23(19): 6759 - 6768. [Abstract] [Full Text] [PDF]

				I. Whitehouse, C. Stockdale, A. Flaus, M. D. Szczelkun, and T. Owen-Hughes Evidence for DNA Translocation by the ISWI Chromatin-Remodeling Enzyme Mol. Cell. Biol., March 15, 2003; 23(6): 1935 - 1945. [Abstract] [Full Text] [PDF]

				J. C. Vary Jr., V. K. Gangaraju, J. Qin, C. C. Landel, C. Kooperberg, B. Bartholomew, and T. Tsukiyama Yeast Isw1p Forms Two Separable Complexes In Vivo Mol. Cell. Biol., January 1, 2003; 23(1): 80 - 91. [Abstract] [Full Text]

				D. V. Fyodorov and J. T. Kadonaga Binding of Acf1 to DNA Involves a WAC Motif and Is Important for ACF-Mediated Chromatin Assembly Mol. Cell. Biol., September 15, 2002; 22(18): 6344 - 6353. [Abstract] [Full Text] [PDF]

				J.-H. Lim, M. Bustin, V. V. Ogryzko, and Y. V. Postnikov Metastable Macromolecular Complexes Containing High Mobility Group Nucleosome-binding Chromosomal Proteins in HeLa Nuclei J. Biol. Chem., May 31, 2002; 277(23): 20774 - 20782. [Abstract] [Full Text] [PDF]

				G. Langst and P. B. Becker Nucleosome mobilization and positioning by ISWI-containing chromatin-remodeling factors J. Cell Sci., March 9, 2002; 114(14): 2561 - 2568. [Abstract] [Full Text] [PDF]

				A. Hamiche, J.-G. Kang, C. Dennis, H. Xiao, and C. Wu Histone tails modulate nucleosome mobility and regulate ATP-dependent nucleosome sliding by NURF PNAS, November 20, 2001; (2001) 251421398. [Abstract] [Full Text] [PDF]

				A. Loyola, G. LeRoy, Y.-H. Wang, and D. Reinberg Reconstitution of recombinant chromatin establishes a requirement for histone-tail modifications during chromatin assembly and transcription Genes & Dev., November 1, 2001; 15(21): 2837 - 2851. [Abstract] [Full Text] [PDF]

				T. G. Fazzio, C. Kooperberg, J. P. Goldmark, C. Neal, R. Basom, J. Delrow, and T. Tsukiyama Widespread Collaboration of Isw2 and Sin3-Rpd3 Chromatin Remodeling Complexes in Transcriptional Repression Mol. Cell. Biol., October 1, 2001; 21(19): 6450 - 6460. [Abstract] [Full Text] [PDF]

				A. Hamiche, J.-G. Kang, C. Dennis, H. Xiao, and C. Wu Histone tails modulate nucleosome mobility and regulate ATP-dependent nucleosome sliding by NURF PNAS, December 4, 2001; 98(25): 14316 - 14321. [Abstract] [Full Text] [PDF]

				D. E. MacCallum, A. Losada, R. Kobayashi, and T. Hirano ISWI Remodeling Complexes in Xenopus Egg Extracts: Identification as Major Chromosomal Components that Are Regulated by INCENP-aurora B Mol. Biol. Cell, January 1, 2002; 13(1): 25 - 39. [Abstract] [Full Text] [PDF]

This Article