JBC Ideal method for primary cell transfection

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M006612200 on August 30, 2000

J. Biol. Chem., Vol. 275, Issue 46, 35953-35959, November 17, 2000
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
275/46/35953    most recent
M006612200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wang, H.
Right arrow Articles by Wollheim, C. B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wang, H.
Right arrow Articles by Wollheim, C. B.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Hepatocyte Nuclear Factor 4alpha Regulates the Expression of Pancreatic beta -Cell Genes Implicated in Glucose Metabolism and Nutrient-induced Insulin Secretion*

Haiyan Wang, Pierre Maechler, Peter A. Antinozzi, Kerstin A. Hagenfeldt, and Claes B. WollheimDagger

From the Division de Biochimie Clinique, Départment de Médecine Interne, Centre Médical Universitaire, CH-1211 Geneva 4, Switzerland

Received for publication, July 25, 2000


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Mutations in the HNF4alpha gene are associated with the subtype 1 of maturity-onset diabetes of the young (MODY1), which is characterized by impaired insulin secretory response to glucose in pancreatic beta -cells. Hepatocyte nuclear factor 4alpha (HNF4alpha ) is a transcription factor critical for liver development and hepatocyte-specific gene expression. However, the role of HNF4alpha in the regulation of pancreatic beta -cell gene expression and its correlation with metabolism secretion coupling have not been previously investigated. The tetracycline-inducible system was employed to achieve tightly controlled expression of both wild type (WT) and dominant-negative mutant (DN) of HNF4alpha in INS-1 cells. The induction of WT-HNF4alpha resulted in a left shift in glucose-stimulated insulin secretion, whereas DN-HNF4alpha selectively impaired nutrient-stimulated insulin release. Induction of DN-HNF4alpha also caused defective mitochondrial function substantiated by reduced [14C]pyruvate oxidation, attenuated substrate-evoked mitochondrial membrane hyperpolarization, and blunted nutrient-generated cellular ATP production. Quantitative evaluation of HNF4alpha -regulated pancreatic beta -cell gene expression revealed altered mRNA levels of insulin, glucose transporter-2, L-pyruvate kinase, aldolase B, 2-oxoglutarate dehydrogenase E1 subunit, and mitochondrial uncoupling protein-2. The patterns of HNF4alpha -regulated gene expression are strikingly similar to that of its downstream transcription factor HNF1alpha . Indeed, HNF4alpha changed the HNF1alpha mRNA levels and HNF1alpha promoter luciferase activity through altered HNF4alpha binding. These results demonstrate the importance of HNF4alpha in beta -cell metabolism-secretion coupling.


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

The hepatocyte nuclear factor 4alpha (HNF4alpha ),1 a transcription factor of the nuclear hormone receptor superfamily, is expressed in liver, kidney, gut, and pancreatic islets (1-3). Mutations in the human HNF4alpha gene lead to maturity onset diabetes of the young subtype 1 (MODY1), which is characterized by autosomal dominant inheritance and impaired glucose-stimulated insulin secretion from pancreatic beta -cells (4-6). These MODY1 mutations located in various domains of the HNF4alpha protein result in defective function of the transcription factor (6). The clinical phenotype of MODY1 patients is indistinguishable from that of MODY3 patients who carry mutations in the HNF1alpha gene (5, 6). HNF4alpha acts upstream of HNF1alpha in a transcriptional cascade that drives liver-specific gene expression and hepatocyte differentiation (7-9). A naturally occurring mutation in the HNF4alpha -binding site of the HNF1alpha promoter identified in a MODY3 family (10) suggests that the transcriptional hierarchy could also be involved in pancreatic beta -cell gene expression and function.

HNF4alpha defines the expression of liver-specific genes encoding apolipoproteins, serum factors, cytochrome P-450 isoforms, and proteins involved in the metabolism of glucose, fatty acids, and amino acids (reviewed in Ref. 11). However, clinical characterization of MODY1 subjects reveals that the primary defect is impaired glucose-stimulated insulin secretion from pancreatic beta -cells rather than liver dysfunction (5, 12-14). Unfortunately, little is known as to how HNF4alpha regulates beta -cell-restricted gene expression and glucose metabolism and associated insulin secretion. Targeted disruption of the hnf4alpha gene results in defective gastrulation of mouse embryos due to dysfunction of the visceral endoderm (15). This early embryonic lethality prevents further analysis of the HNF4alpha function in pancreatic beta -cells. The precise role of HNF4alpha in pancreatic beta -cells would best be examined by conditional beta -cell-specific deletion of the mouse hnf4alpha gene. Another alternative is to up- and down-regulate HNF4alpha function in pancreatic beta -cell lines through gene manipulation.

In the present study, the wild type HNF4alpha (WT-HNF4alpha ) and its dominant-negative mutant (DN-HNF4alpha ) could be induced in INS-1 cells under tight control of the reverse tetracycline-dependent transactivator (16). DN-HNF4alpha represents the epitope Myc-tagged truncated HNF4alpha mutant protein lacking the first 111 amino acids (mycDelta 111HNF4alpha ) (17). The HNF4alpha protein consists of an N-terminal ligand-independent transactivation domain (amino acids 1-24), a DNA binding domain containing two zinc fingers (amino acids 51-117), and a large hydrophobic portion (amino acids 163-368) composed of the dimerization, ligand binding, cofactor binding, and ligand-dependent transactivation domain (18, 19). DN-HNF4alpha therefore suppresses the endogenous WT-HNF4alpha transcriptional activity by the formation of heterodimers lacking DNA binding capacity (17). We have investigated in a quantitative manner the consequences of altered HNF4alpha function on beta -cell-specific expression of genes implicated in glucose metabolism and insulin secretion. This allowed us to elucidate the molecular basis and HNF4alpha target genes responsible for impaired metabolism secretion coupling in beta -cells deficient in HNF4alpha function.

    EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Generation of Stable Cell Lines-- The rat insulinoma INS-1 cell line-derived stable clones were cultured in RPMI 1640 in 11 mM glucose, unless indicated otherwise (20). The establishment of the first step stable clone INS-r3, which expresses the reverse tetracycline-dependent transactivator, was reported previously (21). Plasmids used in the secondary stable transfection were constructed by subcloning the cDNAs encoding the rat WT-HNF4alpha (a generous gift from Dr. Darnell Jr., New York) and DN-HNF4alpha into the expression vector PUHD10-3 (a kind gift from Dr. H. Bujard, University Heidelberg, Germany). DN-HNF4alpha was PCR-amplified from WT-HNF4alpha using the following primers, ctaggatccttccgggctggcatgaagaaagaagcc and ccagaattcctgcagatggttgtcctttag. The PCR fragment was subcloned into pcDNA3.1myc (Invitrogen, Netherlands) and sequenced. Transfection, clone selection, and screening procedures were described previously (21).

Immunoblot-- Immunoblotting procedures were performed as described previously using enhanced chemiluminescence (Pierce) for detection (22). Dilutions for antibody against HNF4alpha (kindly supplied by Dr. F. M. Sladek, University of California, Riverside, CA) and anti-Myc tag (9E10) in myeloma SP2/0 culture medium were 1:6,000 and 1:10.

Insulin Secretion and Cellular Insulin Content-- Cells in 24-well dishes were cultured in 2.5 mM glucose medium with or without indicated doses of doxycycline for 14 or 48 h. Insulin secretion was measured over a period of 30 min, in Krebs-Ringer/bicarbonate-HEPES buffer (KRBH, 140 mM NaCl, 3.6 mM KCl, 0.5 mM NaH2PO4, 0.5 mM MgSO4, 1.5 mM CaCl2, 2 mM NaHCO3, 10 mM HEPES, 0.1% bovine serum albumin) containing indicated stimulators. Insulin content was determined after extraction with acid ethanol following the procedures of Asfari et al. (20). Insulin was detected by radioimmunoassay using rat insulin as standard (22).

Intracellular ATP-- Cells in 6-well dishes were cultured in 2.5 mM glucose medium with or without 500 ng/ml doxycycline for 48 h. The production of ATP was measured during 8 min of stimulation in KRBH. ATP assay was performed as reported previously (22).

[14C]Pyruvate Oxidation-- The production of 14CO2 from [1-14C]pyruvate or [2-14C]pyruvate was measured over 1 h in KRBH containing either 0.05 or 1.0 mM pyruvate as described previously (23, 24).

Mitochondrial Membrane Potential (Delta psi m)-- After a 48-h culture period in 2.5 mM glucose medium with or without 500 ng/ml doxycycline, cells were trypsinized (0.025% trypsin, 0.27 mM EDTA), and the cell suspension was maintained for 2 h in a spinner culture with 2.5 mM glucose RPMI 1640 plus 1% newborn calf serum at 37 °C. Mitochondrial membrane potential (Delta psi m) was measured as described (25). Briefly, after the spinner culture period, cells were loaded with 10 µg/ml rhodamine-123 (Rh-123) for 10 min at 37 °C. After centrifugation, the cells were resuspended and transferred to the fluorimeter cuvette at 37 °C with gentle stirring in an LS-50B fluorimeter (PerkinElmer Life Sciences), and fluorescence, excited at 490 nm, was measured at 530 nm.

Total RNA Isolation and Northern Blotting-- Cells in 10-cm dishes were cultured in 2.5 mM glucose medium with or without 500 ng/ml doxycycline for 14 or 48 h, followed by an additional 8 h in culture medium with 2.5, 6, 12, and 24 mM glucose. Total RNA was extracted and blotted to nylon membranes as described previously (22). The membrane was prehybridized and then hybridized to 32P-labeled random primer cDNA probes by the technique of Sambrook et al. (26). To ensure equal RNA loading and even transfer, all membranes were stripped and re-hybridized with the "housekeeping gene" probes such as beta -actin or cyclophilin. cDNA fragments used as probes for L-pyruvate kinase (L-PK), glucose transporter-2 (GLUT-2), glucokinase, insulin, PDX1, HNF4alpha , upstream stimulatory factors (USF), c-Jun, and C/EBPbeta mRNA detection were digested from corresponding expression vectors kindly provided by Drs. A. Kahn, B. Thorens, P. B. Iynedjian, J. Philippe, T. Edlund, J. E. Darnell, Jr., M. Sawadogo, W. Schlegel, and U. Schibler, respectively. cDNA probes for rat aldolase B, glyceraldehyde-3-phosphate dehydrogenase, dimerization cofactor for HNF1alpha (DcoH), mitochondrial adenine nucleotide translocator 1 and 2 (ANT1 and ANT2), mitochondrial uncoupling protein-2 (UCP-2), mitochondrial 2-oxoglutarate dehydrogenase (OGDH) E1 subunit, glutamate dehydrogenase (GDH), Pax4, Pax6, Nkx2.2, Nkx6.1, Isl1, insulin receptor substrate-2 (IRS2), cyclin-dependent kinase-4 (Cdk4), and cyclophilin were prepared by reverse transcriptase-PCR and confirmed by sequencing.

Nuclear Extract Preparation and Electrophoretic Mobility Shift Assay (EMSA)-- Cells in 10-cm dishes were grown in culture medium with or without 500 ng/ml doxycycline for 48 h. The following double-stranded oligonucleotides were used as probes, 5'-GGCTGAAGTCCAAAGTTCAGTCCCTTCGC-3' (8). EMSA procedures including conditions for nuclear extract preparation, probe labeling, binding reactions, unlabeled-probe competition, and antibody supershift were performed as reported previously (22).

Transient Transfection and Luciferase Assay-- The HNF1alpha gene promoter luciferase reporter plasmids, WT-HNF1alpha Luc (wild type) and Delta AHNF1alpha Luc (HNF4alpha -binding site deleted), were kindly provided by Dr. N. Miura (Akita University, Japan) (27).

Transient transfection experiments and luciferase reporter enzyme assays were carried out as previously reported (22).

    RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

WT-HNF4alpha or DN-HNF4alpha Protein Was Induced in INS-1 Cells in a Dose- and Time-dependent Manner-- We have obtained 10 and 8 clones positively expressing WT-HNF4alpha and DN-HNF4alpha , respectively. The clones designated as WT-HNF4alpha -28 and DN-HNF4alpha -26 that displayed highest induction levels of transgene proteins were chosen for the present study. The time course and dose response of doxycycline effect on WT-HNF4alpha and DN-HNF4alpha expression are illustrated in Fig. 1, A and B, respectively. WT-HNF4alpha protein could be induced within a range from 2- to 50-fold above the endogenous protein level (Fig. 1A). Thus, graded overexpression of WT-HNF4alpha could be achieved by culturing the WT-HNF4alpha -28 cells with varying doses of doxycycline in a defined period. Similar induction of DN-HNF4alpha protein was detected in the nuclear extracts from DN-HNF4alpha -26 cells (Fig. 1B). No leakage of this doxycycline-dependent promoter was observed, since the expression of DN-HNF4alpha protein was not detectable in non-induced DN-HNF4alpha -26 cells (Fig. 1B). Therefore, the dominant-negative suppression of HNF4alpha function in INS-1 cells could be rapidly achieved by culturing the DN-HNF4alpha -26 cells with a maximum dose of doxycycline (500 ng/ml).


View larger version (28K):
[in this window]
[in a new window]
  		Fig. 1.   Dose response and time course of doxycycline effect on WT-HNF4alpha (A) and DN-HNF4alpha (B) expression. For studying dose response, cells were cultured with the indicated doses of Dox for 48 h. For studying time course, cells were cultured in medium containing 500 ng/ml doxycycline and harvested for nuclear extracts at the indicated times. Nuclear extracts from WT-HNF4alpha -28 (50 µg/lane) (A) and DN-HNF4alpha -26 (10 µg/lane) (B) were resolved in 9% SDS-polyacrylamide gel electrophoresis, transferred to nitrocellulose, and immunoblotted with antibodies against HNF4alpha (A) and the Myc-tag (B), respectively.

Effects of WT-HNF4alpha and DN-HNF4alpha on Insulin Secretion-- Impaired glucose-stimulated insulin secretion from pancreatic beta -cells is the primary defect causing hyperglycemia in MODY1 patients carrying HNF4alpha mutations. We therefore examined the consequences of induction of WT-HNF4alpha and DN-HNF4alpha on insulin secretion in INS-1 cells. The graded overexpression of WT-HNF4alpha led to a left shift of glucose-stimulated insulin secretion (Fig. 2A). However, the maximal (above 12 mM) glucose-elicited insulin secretion remained unchanged (Fig. 2A).


View larger version (16K):
[in this window]
[in a new window]
  		Fig. 2.   HNF4alpha regulates nutrient-evoked insulin secretion in INS-1 cells. Insulin secretion was quantified as described under "Experimental Procedures" and normalized by cellular DNA content. A, glucose-stimulated insulin secretion in WT-HNF4alpha -28 cells induced with indicated doses of doxycycline for 14 h. Data represent the mean ± S.E. of six independent experiments. Statistical significance between doxycycline-induced and non-induced cells was obtained at 2.5 and 6 mM glucose (p < 0.001, unpaired Student's t test). B, glucose-, leucine-, and K+-elicited insulin secretion in DN-HNF4alpha -26 cells induced with 500 ng/ml doxycycline for 48 h. Insulin secretion was measured during 30 min of incubation with 2.5 mM (Basal) and 24 mM glucose in KRBH, or with 20 mM leucine and 20 mM KCl added in KRBH containing 2.5 mM glucose. Data are the mean ± S.E. of six separate experiments. Statistical significance between doxycycline-induced and non-induced cells was observed at 24 mM glucose- and 20 mM leucine-stimulated conditions (p < 0.001). Insulin content was reduced by 30 ± 8.2% after induction of DN-HNF4alpha .

Glucose generates ATP and other metabolic coupling factors important for insulin secretion through glycolysis and mitochondrial oxidation (28). The physiological insulin secretagogue, leucine, is transported directly into mitochondria to provide substrates for the tricarboxylic acid cycle (28). K+ causes insulin secretion by depolarization of the beta -cell membrane, resulting in an increase in cytosolic Ca2+ (28). We therefore examined the insulin secretory responses to these three secretagogues that act at different levels of the signal transduction cascade following induction of DN-HNF4alpha . As demonstrated in Fig. 2B, DN-HNF4alpha selectively inhibited glucose- and leucine-stimulated insulin secretion. This could be explained by defective glucose and leucine metabolism.

Effects of DN-HNF4alpha on Cellular ATP Production and Mitochondrial Oxidation-- To investigate whether impaired nutrient-evoked insulin secretion is correlated to defective cellular ATP production, we analyzed the impact of DN-HNF4alpha expression on the level of ATP generated by glucose and leucine. As shown in Fig. 3A, induction of DN-HNF4alpha indeed abolished the ATP generation by glucose and leucine. Since the mitochondrial substrate leucine failed to generate ATP after induction of DN-HNF4alpha , it would seem that HNF4alpha is required for maintaining normal mitochondrial function.


View larger version (17K):
[in this window]
[in a new window]
  		Fig. 3.   Induction of DN-HNF4alpha impairs cellular ATP production and mitochondrial oxidation. A, cellular ATP levels in DN-HNF4alpha -26 cells were measured after 8 min of incubation with 2.5 (Basal) and 24 mM glucose in KRBH or 20 mM leucine and 20 mM KCl added in KRBH containing 2.5 mM glucose. Data represent mean ± S.E. of three independent experiments. Glucose- and leucine-stimulated ATP production was significantly inhibited after treatment with 500 ng/ml doxycycline for 48 h (p < 0.005 and p < 0.001, respectively). B, [2-14C]pyruvate oxidation was measured during 1 h of incubation in KRBH containing 0.05 or 1 mM pyruvate. Data represent the mean ± S.E. performed in triplicate from one of four similar experiments. *p < 0.02. C, [1-14C]pyruvate oxidation was measured with identical conditions in the same preparation of cells as in B. Data represent the mean ± S.E. performed in triplicate from one of three similar experiments.

To test this hypothesis, we examined the consequences of DN-HNF4alpha induction on mitochondrial oxidation of pyruvate. Pyruvate-derived carbons enter the tricarboxylic acid cycle as either acetyl-CoA, catalyzed by pyruvate dehydrogenase, or oxaloacetate via pyruvate carboxylase. By using pyruvate radiolabeled at either the first or second carbon, the putative defects at various steps in pyruvate metabolism can be assessed. The radiolabeled carbon of [1-14C]pyruvate is lost to CO2 at the pyruvate dehydrogenase step as pyruvate is converted into acetyl-CoA. Alternatively, if pyruvate enters the tricarboxylic acid cycle via oxaloacetate, the label is lost to CO2 at isocitrate dehydrogenase within one turn of the cycle. Radiolabeled CO2 is generated from 2-14C at either OGDH or isocitrate dehydrogenase when pyruvate enters the tricarboxylic acid cycle as acetyl-CoA. Overexpression of DN-HNF4alpha reduced CO2 formation from [2-14C]pyruvate by 41% (Fig. 3B), whereas CO2 formation from [1-14C]pyruvate was not different between non- and induced conditions (Fig. 3C). These results suggest that the defect in mitochondrial metabolism is not at the point of entry of pyruvate into the tricarboxylic acid cycle, rather that the defect appears in reactions within the tricarboxylic acid cycle. This is in full agreement with the impairment of leucine stimulation of insulin secretion since leucine metabolism bypasses pyruvate and enters the tricarboxylic acid cycle solely as acetyl-CoA. Decreased isocitrate dehydrogenase activity would also be unlikely since impairment at this step would be observed by both [1-14C]pyruvate and [2-14C]pyruvate oxidation. These oxidation experiments suggest that steps following this reaction beginning with OGDH may be responsible for impaired [2-14C]pyruvate oxidation.

Effect of DN-HNF4a on Mitochondrial Membrane Potential (Delta psi m) in INS-1 Cells-- The Delta psi m was measured in a suspension of INS-1 cells by monitoring rhodamine-123 fluorescence. In control cells (-Dox) addition of 10 mM glucose (12.5 mM final) potently hyperpolarized Delta psi m, whereas 1 µM of the protonophore FCCP depolarized Delta psi m (Fig. 4A). In cells expressing DN-HNF4alpha (+Dox), the glucose response was inhibited by 65% (p < 0.02). Impaired hyperpolarization of Delta psi m was also observed when the glycolysis was bypassed by stimulating cells with the end product of glycolysis pyruvate (Fig. 4B), indicating mitochondrial dysfunction. Direct activation with methyl succinate of the electron transport chain at complex II resulted in a diminished response in DN-HNF4alpha -induced cells (Fig. 4C). The amplitude of complete Delta psi m depolarization by FCCP was also reduced in cells treated with doxycycline (-43%; p < 0.01), suggesting that the mitochondria were partially uncoupled by suppression of HNF4alpha function (Fig. 4D).


View larger version (26K):
[in this window]
[in a new window]
  		Fig. 4.   Effect of DN-HNF4alpha on mitochondrial membrane potential (Delta psi m) in INS-1 cells. The Delta psi m was measured in a suspension of 2 × 106 INS-1 cells per 2 ml of KRBH using rhodamine-123 (Rh-123) fluorescence after a spinner culture period. A, glucose-induced (12.5 mM final) hyperpolarization of Delta psi m was tested followed by the complete depolarization of Delta psi m using 1 µM of the uncoupler FCCP. B, the end product of glycolysis pyruvate (10 mM) was added 10 min before FCCP. C, the mitochondrial substrate methyl succinate (10 mM) was tested. The effects of these various substrates (5 min after addition) as well as that of FCCP are summarized with statistics in D. *, p < 0.05; **, p < 0.01. Each trace (A-C) is representative of 4-8 independent experiments.

Effects of WT-HNF4alpha and DN-HNF4alpha on Pancreatic beta -Cell Gene Expression-- The expression of genes involved in glucose metabolism (Fig. 5, A and B) or in pancreatic beta -cell development and differentiation (Fig. 5, C and D) was quantitatively evaluated in WT-HNF4alpha -28 (Fig. 5, A and C) and DN-HNF4alpha -26 cells (Fig. 5, B and D). As shown in Fig. 5A, WT-HNF4alpha mRNA could be induced by 2-, 8-, and 50-fold above the endogenous level. This graded overexpression of WT-HNF4alpha resulted in a stepwise increase in the expression of three glucose-responsive genes encoding, respectively, GLUT-2, L-PK, and aldolase B (Fig. 5A). However, the mRNA level of glyceraldehyde-3-phosphate dehydrogenase, which is also responsive to glucose, remained unaltered (Fig. 5A). Induction of WT-HNF4alpha also caused incremental expression of OGDH E1 subunit transcript (Fig. 5A). Consistently, The mRNA levels of GLUT-2, aldolase B, L-PK, and OGDH E1 subunit were significantly reduced after induction of DN-HNF4alpha (Fig. 5B). On the other hand, induction of DN-HNF4alpha led to increased UCP-2 mRNA expression (Fig. 5B). Therefore, HNF4alpha regulates the expression of genes involved in both glycolysis and mitochondrial metabolism. The profile of HNF4alpha -targeted genes is strikingly similar to that of HNF1alpha (29). HNF4alpha may regulate the expression of genes implicated in glucose metabolism through HNF1alpha function as in hepatocytes (7-9).


View larger version (55K):
[in this window]
[in a new window]
  		Fig. 5.   Effects of WT-HNF1alpha and DN-HNF1alpha on pancreatic beta -cell gene expression. Northern blotting was used to quantify the gene expression in WT-HNF4alpha -28 (A and C) and DN-HNF4alpha -26 (B and D) cells induced with indicated doses of doxycycline and cultured at given concentrations of glucose (detailed under "Experimental Procedures"). RNA samples were analyzed by hybridization with the indicated cDNA probes.

Since HNF4alpha is required for liver development and hepatocyte differentiation (9), we investigated whether HNF4alpha regulates the expression of genes important for the pancreatic beta -cell phenotype. Induction of WT-HNF4alpha (Fig. 5C) or DN-HNF4alpha (Fig. 5D) did not alter the expression patterns of PDX1, Pax4, Pax6, NKx2.2, NKx6.1, and Isl-1, which are necessary for normal pancreatic cell development or differentiation (30). Moreover, HNF4alpha did not regulate the mRNA levels of USF, c-Jun, and C/EBPbeta (Fig. 5, C and D). The expression of these transcription factors appeared to be responsive to glucose (Fig. 5, C and D). The expression of another glucose-responsive transcription factor, DcoH, was slightly affected by induction of WT-HNF4alpha but not by expression of DN-HNF4alpha (Fig. 5, C and D), suggesting the involvement of an indirect mechanism. Both Cdk4 and IRS2 are involved in pancreatic beta -cell development (31, 32), but their expression was not regulated by HNF4alpha (Fig. 5, C and D). Induction of DN-HNF4alpha for 48 h caused 50% reduction in insulin mRNA levels (Fig. 5D). This may be secondary to decreased HNF1alpha function, since HNF1alpha is required for insulin gene transcription (29).

HNF4alpha Regulates Pancreatic beta -Cell Gene Expression through HNF1alpha Function-- We performed EMSA for studying HNF4alpha binding activity to HNF1alpha promoter, luciferase reporter enzyme assay for HNF1alpha promoter activity, and Northern blotting for the HNF1alpha mRNA expression. Nuclear extracts were prepared from WT-HNF4alpha -28 and DN-HNF4alpha -26 cells cultured for 48 h in the presence or absence of 500 ng/ml doxycycline. The murine HNF1alpha promoter segment, which contains the HNF4alpha -binding site, was used as probe (8). Induction of WT-HNF4alpha resulted in a dramatic increase in the signal density of HNF4alpha binding (Fig. 6A). On the other hand, induction of DN-HNF4alpha almost completely abolished the binding activity of endogenous HNF4alpha to the HNF1alpha promoter (Fig. 6A). DN-HNF4alpha exerts its dominant-negative function by forming DN-HNF4alpha /WT-HNF4alpha heterodimers that lack DNA binding capacity (11). The retarded DNA binding complexes corresponding to endogenous WT-HNF4alpha and/or induced transgene WT-HNF4alpha homodimers were supershifted by a specific antibody against HNF4alpha (Fig. 6A).


View larger version (43K):
[in this window]
[in a new window]
  		Fig. 6.   Induction of WT-HNF1alpha and DN-HNF1alpha regulates the HNF1alpha mRNA expression and HNF1alpha promoter luciferase activity through altered HNF4alpha binding. EMSA (A), Northern blotting (B), and luciferase enzyme reporter activity (C) assays were performed in WT-HNF4alpha -28 and DN-HNF4alpha -26 cells cultured in the presence or absence of 500 ng/ml doxycycline for 48 h. A, for EMSA, the oligonucleotide duplex corresponding to the murine HNF1alpha promoter fragment containing HNF4alpha -binding site was used as probe. B, for Northern blot analysis, cells were cultured in 2.5 mM glucose medium for 48 h and continued for 8 h with indicated glucose concentrations. RNA samples from WT-HNF4alpha -28 (upper panel) and DN-HNF4alpha -26 (lower panel) cells were hybridized with HNF1alpha cDNA probe. C, cells were transiently transfected with HNF1alpha Luc or Delta AHNF1alpha Luc by calcium phosphate-DNA co-precipitation. Luciferase activity measured in non-induced cells was defined as 100%. Data are the mean ± S.E. of six separate experiments.

Consistently, induction of WT-HNF4alpha resulted in a 2-fold increase in endogenous HNF1alpha mRNA level, whereas DN-HNF4alpha completely eliminated the HNF1alpha expression (Fig. 6B). To confirm that HNF4alpha directly regulates HNF1alpha transcription, we transiently transfected WT-HNF4alpha -28 and DN-HNF4alpha -26 cells with a luciferase reporter construct containing either the wild type HNF1alpha gene promoter (HNF1alpha Luc) or a promoter that lacks a functional HNF4alpha -binding site (Delta AHNF1alpha Luc). As demonstrated in Fig. 6C, overexpression of WT-HNF4alpha caused a 2.5-fold increase in the luciferase reporter enzyme activity in WT-HNF4alpha -28 cells transfected with HNF1alpha Luc. Deletion of the HNF4alpha -binding site in the HNF1alpha promoter (Delta AHNF1alpha ) abolished the activation induced by WT-HNF4alpha (Fig. 6C). In contrast, induction of DN-HNF4alpha caused a 71% reduction in wild type HNF1alpha promoter activity (Fig. 6C). The inhibitory effect of DN-HNF4alpha was no longer present in DN-HNF4alpha -26 cells transfected with Delta AHNF1alpha Luc (Fig. 6C). Therefore, HNF4alpha directly controls HNF1alpha gene expression in pancreatic beta -cells as it does in hepatocytes.

    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

It has been demonstrated that HNF4alpha controls the expression of a large array of liver-specific genes encoding several apolipoproteins, metabolic proteins, and serum factors that are essential for hepatocyte differentiation and liver development (9). HNF4alpha is also required for HNF1alpha expression in hepatocytes (7-9). Another study in embryonic stem cell-differentiated embryoid bodies (33) shows that the absence of HNF4alpha affects the expression of genes encoding GLUT-2, aldolase B, and L-PK, which are involved in glucose transport and glycolysis. However, little is known as to how HNF4alpha regulates pancreatic beta -cell gene expression. The primary cause of the MODY1 phenotype is impaired glucose-stimulated insulin secretion from pancreatic beta -cells (5). The present study was therefore designed to investigate the role of HNF4alpha in the regulation of the expression of beta -cell genes implicated in glucose metabolism and associated insulin secretion.

We found that overexpression of WT-HNF4alpha caused a left shift of glucose-stimulated insulin secretion, whereas dominant-negative suppression of HNF4alpha selectively blunted the insulin release induced by glucose and leucine but not by K+ depolarization. The diminished nutrient-evoked insulin secretion is associated with reduced ATP production in DN-HNF4alpha -expressing cells. The physiological insulin secretagogue leucine raises the cytosolic and mitochondrial Ca2+ concentrations through mitochondrial metabolism downstream of glycolysis (28, 34). Therefore, we suggest that loss of HNF4alpha function leads to defective mitochondrial metabolism and, as a consequence, impaired insulin secretion. The reduced mitochondrial oxidation of [2-14C]pyruvate and the abrogation of mitochondrial membrane hyperpolarization elicited by glucose, pyruvate, and methyl succinate indicate impaired mitochondrial tricarboxylic acid cycle enzyme activity and partial uncoupling of the mitochondrial respiratory chain.

Quantitative Northern blot analysis allows us to identify HNF4alpha target genes responsible for defective metabolism-secretion coupling. HNF4alpha indeed regulates the expression of genes encoding GLUT-2, aldolase B, and L-PK in pancreatic beta -cells (Fig. 5), as inferred from previous studies in hepatocytes and embryonic stem cell-differentiated embryoid bodies (8, 9). Most importantly, we demonstrate that HNF4alpha alters the mRNA expression of mitochondrial OGDH E1 subunit and UCP-2 (Fig. 5), which may indeed contribute more significantly to the impaired metabolism-secretion coupling. The phenotype and gene expression patterns in DN-HNF4alpha -expressing cells are strikingly similar to those of DN-HNF1alpha -expressing cells (22, 29). This prompted us to investigate whether HNF4alpha regulates beta -cell expression through HNF1alpha function, as in hepatocytes (9). We provide unprecedented evidence that HNF4alpha is required for HNF1alpha expression in pancreatic beta -cells.

This conclusion is based on the use of an artificial dominant-negative hnf4alpha mutation. The naturally occurring human mutations of HNF4alpha do not function in a dominant-negative manner (6, 35). It is to be expected that a mutation with such repressive action on the endogenous HNF4alpha function would cause embryonic lethality, as is the case in the hnf4alpha knock-out mouse (15). Haploinsufficiency or reduced gene dosage of HNF4alpha may thus explain the mechanism leading to the MODY1 phenotype (33). The INS-1 cell line expressing DN-HNF4alpha provides a convenient model to explore the impact of impaired HNF4alpha function on beta -cell gene expression and metabolism-secretion coupling. This goal cannot be achieved by the introduction of one of the human HNF4alpha mutations into beta -cell lines. In fact, the induction of a nonsense mutation HNF4alpha Q268X to a level similar to DN-HNF4alpha had no detectable consequences on beta -cell gene expression and metabolism-secretion coupling.2

MODY1 patients display secretory defects not only in beta -cells but also in the glucagon-secreting alpha -cells and the pancreatic polypeptide-secreting cells (36, 37). However, this general effect on islet hormone release does not seem due to an effect on the development and differentiation of the endocrine pancreas, since altered HNF4alpha function did not affect the expression of PDX1 and other transcription factors determining pancreatic phenotype. On the other hand, loss of HNF4alpha function may cause reduced beta -cell insulin content secondary to defective HNF1alpha function (22, 29).

    ACKNOWLEDGEMENTS

We are grateful to D. Harry, G. Chaffard, C. Bartley, and E.-J. Sarret for expert technical assistance. We are indebted to Drs. F. M. Sladek (HNF4alpha antibody), J. E. Darnell, Jr. (HNF4alpha cDNA), W. Schlegel (c-Jun cDNA), P. B. Iynedjian (glucokinase cDNA), U. Schibler (C/EBPbeta cDNA), T. Edlund (PDX1 cDNA), M. Sawadogo (USF cDNA), A. Kahn (L-PK cDNA), B. Thorens (GLUT-2 cDNA), J. Philippe (insulin I cDNA), H. Bujard (PUHD 10-3 plasmid), and N. Quintrell (pTKhygro plasmid).

    FOOTNOTES

* This work was supported by Swiss National Science Foundation Grant 32-49755.96, by a European Union Network grant (through the Swiss Federal Office for Education and Science), and by a research grant from Eli Lilly.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Dagger To whom correspondence should be addressed. Tel.: 41 22 702 5548; Fax: 41 22 702 5543; E-mail: Claes.Wollheim@medicine.unige.ch.

Published, JBC Papers in Press, August 30, 2000, DOI 10.1074/jbc.M006612200

2 H. Wang and C. B. Wollheim, unpublished results.

    ABBREVIATIONS

The abbreviations used are: HNF4alpha , hepatocyte nuclear factor 4alpha ; MODY, maturity-onset diabetes of the young; WT, wild type; DN, dominant-negative; PCR, polymerase chain reaction; USF, upstream stimulatory factors; OGDH, 2-oxoglutarate dehydrogenase; L-PK, L-pyruvate kinase; EMSA, electrophoretic mobility shift assay; FCCP, carbonyl cyanide p-trifluoromethoxyphenylhydrazone; Dox, doxycycline.

    REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

1. Sladek, F. M., Zhong, W., Lai, E., and Darnell, J. E., Jr. (1990) Genes Dev. 4, 2353-2365
2. Taraviras, S., Monaghan, P. A., Schütz, G., and Kelsey, G. (1994) Mech. Dev. 48, 67-79
3. Miquerol, L., Lopez, S., Cartier, N., Tulliez, M., Raymondjean, M., and Kahn, A. (1994) J. Biol. Chem. 269, 8944-8951
4. Yamagata, K., Furuta, H., Oda, N., Kaisaki, P., Menzel, S., Cox, N. J., Fajans, S. S., Signorini, S., Stoffel, M., and Bell, G. I. (1996) Nature 384, 458-460
5. Hattersley, A. T. (1998) Diabetic Med. 15, 15-24
6. Lausen, J., Thomas, H., Lemm, I., Bulman, M., Borgschulze, M., Lingott, A., Hattersley, A. T., and Ryffel, G. U. (2000) Nucleic Acids Res. 28, 430-437
7. Tian, J.-M., and Schibler, U. (1991) Genes Dev. 5, 2225-2234
8. Kuo, C. J., Conley, P. B., Chen, L., Sladek, F. M., Darnell, J. E., Jr., and Crabtree, G. R. (1992) Nature 355, 457-461
9. Li, J., Ning, G., and Duncan, S. A. (2000) Genes Dev. 14, 464-474
10. Gragnoli, C., Lindner, T., Cockburn, B. N., Kaisaki, P. J., Gragnoli, F., Marozzi, G., and Bell, G. I. (1997) Diabetes 46, 1648-1651
11. Sladek, F. M. (1994) in Liver-specific Gene Expression (Tronche, F. , and Yaniv, M., eds) , pp. 207-230, R. G. Landes Co., Austin, TX
12. Byne, M. M., Sturis, J., Fanjans, S. S., Ortiz, F. J., Stoltz, A., Stoffel, M., Smith, M. J., Bell, G. I., Halter, J. B., and Polonski, K. S. (1995) Diabetes 44, 699-704
13. Linder, T., Gragnoli, C., Furuta, H., Cockburn, B. N., Petzold, C., Rietzsch, H., Weibeta , U., Schulze, J., and Bell, G. I. (1997) J. Clin. Invest. 100, 1400-1405
14. Lehto, M., Bitzén, P.-O., Isomaa, B., Wipemo, C., Wessman, Y., Forsblom, C., Toumi, T., Taskinen, M.-R., and Groop, L. (1999) Diabetes 48, 423-425
15. Chen, W. S., Manova, K., Weinstein, D. C., Duncan, S. A., Plump, A. S., Prezioso, V. R., Bachvarova, R. F., and Darnell, J. E., Jr. (1994) Genes Dev. 8, 2466-2477
16. Gossen, M., Freundlieb, S., Bender, G., Müller, G., Hillen, W., and Bujard, H. (1995) Science 268, 1766-1769
17. Fraser, J. D., Keller, D., Martinez, V., Santiso-Mere, D., Straney, R., and Briggs, M. R. (1997) J. Biol. Chem. 272, 13892-13898
18. Hadzopoulou-Cladaras, M., Kistanova, E., Evagelopoulou, C., Zeng, S., Cladaras, C., and Ladias, J. A. A. (1997) J. Biol. Chem. 272, 539-550
19. Sladek, F. M., Ruse, M. D., Jr., Nepomuceno, L., Huang, S.-M., and Stallcup, M. R. (1999) Mol. Cell. Biol. 19, 6509-6522
20. Asfari, M., Janjic, D., Meda, P., Li, G., Halban, P. A., and Wollheim, C. B. (1992) Endocrinology 130, 167-178
21. Wang, H., and Iynedjian, P. B. (1997) Proc. Natl. Acad. Sci. U. S. A. 99, 4372-4377
22. Wang, H., Maechler, P., Hagenfeldt, K. A., and Wollheim, C. B. (1998) EMBO J. 17, 6701-6713
23. Noel, R. J., Antinozzi, P. A., McGarry, J. D., and Newgard, C. B. (1997) J. Biol. Chem. 272, 18621-18627
24. Antinozzi, P. A., Segall, L., Prentki, M., McGarry, J. D., and Newgard, C. B. (1998) J. Biol. Chem. 273, 16146-16154
25. Maechler, P., Kennedy, E. D., Pozzan, T., and Wollheim, C. B. (1997) EMBO J. 16, 3833-3841
26. Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual , pp. 7.3-7.84, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
27. Muira, N., and Tanaka, K. (1993) Nucleic Acids Res. 21, 3731-3736
28. Wollheim, C. B. (2000) Diabetologia 43, 265-277
29. Wang, H., Antinozzi, P. A., Hagenfeldt, K. A., Maechler, P., and Wollheim, C. B. (2000) EMBO J. 19, 1-8
30. Edlund, H. (1998) Diabetes 47, 1817-1823
31. Rane, G. R., Dubus, P., Mettus, R. V., Galbreath, E. J., Boden, G., Reddy, E. P., and Barbacid, M. (1999) Nat. Genet. 22, 44-52
32. Withers, D. J., Burks, D. J., Towery, H. H., Altamuro, S. L., Flint, C. L., and White, M. F. (1999) Nat. Genet. 23, 32-40
33. Stoffel, M., and Duncan, S. A. (1997) Proc. Natl. Acad. Sci. U. S. A. 94, 13209-31214
34. Kennedy, E. D., and Wollheim, C. B. (1998) Diabetes Metab. 24, 15-24
35. Hani, E.-H., Suaud, L., Boutin, P., Chèvre, J.-C., Durand, E., Philippi, A., Demenais, F., Vionnet, N., Furuta, H., Velho, G., Bell, G. I., and Laine, B. (1998) J. Clin. Invest. 101, 521-526
36. Herman, W. H., Fajans, S. S., Smith, M. J., Polonsky, K. S., Bell, G. I., and Halter, J. B. (1997) Diabetes 46, 1749-1754
37. Ilag, L. L., Tabaei, B. P., Herman, W. H., Zawacki, C. M., D'Souza, E., Bell, G. I., and Fajans, S. S. (2000) Diabetes 49, 961-968

Copyright © 2000 by The American Society for Biochemistry and Molecular Biology, Inc.
Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
 Mol. Cell. Biol.Home page
A. Perilhou, C. Tourrel-Cuzin, P. Zhang, I. Kharroubi, H. Wang, V. Fauveau, D. K. Scott, C. B. Wollheim, and M. Vasseur-Cognet
The MODY1 Gene for Hepatocyte Nuclear Factor 4{alpha} and a Feedback Loop Control COUP-TFII Expression in Pancreatic Beta Cells
Mol. Cell. Biol., July 15, 2008; 28(14): 4588 - 4597.
[Abstract] [Full Text] [PDF]

Home page
 DiabetesHome page
R. R. Kapoor, J. Locke, K. Colclough, J. Wales, J. J. Conn, A. T. Hattersley, S. Ellard, and K. Hussain
Persistent Hyperinsulinemic Hypoglycemia and Maturity-Onset Diabetes of the Young Due to Heterozygous HNF4A Mutations
Diabetes, June 1, 2008; 57(6): 1659 - 1663.
[Abstract] [Full Text] [PDF]

Home page
 DiabetesHome page
J. Holmkvist, P. Almgren, V. Lyssenko, C. M. Lindgren, K.-F. Eriksson, B. Isomaa, T. Tuomi, P. Nilsson, and L. Groop
Common Variants in Maturity-Onset Diabetes of the Young Genes and Future Risk of Type 2 Diabetes
Diabetes, June 1, 2008; 57(6): 1738 - 1744.
[Abstract] [Full Text] [PDF]

Home page
 DiabetesHome page
M. Niehof and J. Borlak
HNF4{alpha} and the Ca-Channel TRPC1 Are Novel Disease Candidate Genes in Diabetic Nephropathy
Diabetes, April 1, 2008; 57(4): 1069 - 1077.
[Abstract] [Full Text] [PDF]

Home page
 EndocrinologyHome page
A. J. Casal, S. Ryser, A. M. Capponi, and C. F. Wang-Buholzer
Angiotensin II-Induced Mitogen-Activated Protein Kinase Phosphatase-1 Expression in Bovine Adrenal Glomerulosa Cells: Implications in Mineralocorticoid Biosynthesis
Endocrinology, November 1, 2007; 148(11): 5573 - 5581.
[Abstract] [Full Text] [PDF]

Home page
 Genes Dev.Home page
R. K. Gupta, N. Gao, R. K. Gorski, P. White, O. T. Hardy, K. Rafiq, J. E. Brestelli, G. Chen, C. J. Stoeckert Jr., and K. H. Kaestner
Expansion of adult beta-cell mass in response to increased metabolic demand is dependent on HNF-4{alpha}
Genes & Dev., April 1, 2007; 21(7): 756 - 769.
[Abstract] [Full Text] [PDF]

Home page
 DiabetesHome page
D. M. Lehman, D. K. Richardson, C. P. Jenkinson, K. J. Hunt, T. D. Dyer, R. J. Leach, R. Arya, H. E. Abboud, J. Blangero, R. Duggirala, et al.
P2 Promoter Variants of the Hepatocyte Nuclear Factor 4{alpha} Gene Are Associated With Type 2 Diabetes in Mexican Americans
Diabetes, February 1, 2007; 56(2): 513 - 517.
[Abstract] [Full Text] [PDF]