|
Originally published In Press as doi:10.1074/jbc.M004293200 on August 28, 2000
J. Biol. Chem., Vol. 275, Issue 46, 36316-36323, November 17, 2000
Covalent Modification of p73 by SUMO-1
TWO-HYBRID SCREENING WITH p73 IDENTIFIES NOVEL
SUMO-1-INTERACTING PROTEINS AND A SUMO-1 INTERACTION MOTIF*
Adrian
Minty ,
Xavier
Dumont,
Mourad
Kaghad, and
Daniel
Caput
From the Molecular and Functional Genomics Department,
Sanofi-Synthélabo Recherche, 31676 Labège, France
Received for publication, May 18, 2000, and in revised form, August 16, 2000
 |
ABSTRACT |
Two-hybrid screening in yeast with p73
isolated SUMO-1 (small ubiquitin-like
modifier 1), the enzyme responsible for its conjugation, Ubc-9, and a number of novel SUMO-1-interacting proteins, including thymine DNA glycosylase, PM-Scl75, PIASx, PKY, and CHD3/ZFH. A subset of these proteins contain a common motif,
hhXSXS/Taaa, where h is
a hydrophobic amino acid and a is an acidic amino acid, that is shown to interact with SUMO-1 in the two-hybrid system. We show
here that p73 , but not p73 , can be covalently modified by SUMO-1.
The major SUMO-1-modified residue in p73 is the C-terminal lysine
(Lys627). The sequence surrounding this lysine conforms to
a consensus SUMO-1 modification site
b(X)XXhKXE, where
b is a basic amino acid. SUMO-1-modified p73 is more
rapidly degraded by the proteasome than unmodified p73, although SUMO-1
modification is not required for p73 degradation. SUMO-1 modification
does not affect the transcriptional activity of p73 on an
RGC-luciferase reporter gene in SK-N-AS cells. Instead, SUMO-1
modification may alter the subcellular localization of p73, because
SUMO-1-modified p73 is preferentially found in detergent-insoluble
fractions. Alternatively, it may modulate the interaction of p73 with
other proteins that are substrates for SUMO-1 modification or which
interact with SUMO-1, such as those identified here.
 |
INTRODUCTION |
Covalent modification of proteins is widely used as a way of
modifying their stability, activity, or localization. Examples of this
are phosphorylation, acetylation, lipid modification, or glycosylation.
Modification by covalent linkage to a second "tagging" protein was
first observed with ubiquitin, a 76-amino acid polypeptide that is
covalently linked to lysine residues in an acceptor protein by an
enzymatic system involving two to three ubiquitin-activating and
-conjugating enzymes (E1, E2, and E3).1 Subsequent
poly-ubiquitination usually signals the modified protein for
degradation by the proteasome (1). Alternate outcomes for ubiquitinated
proteins are activation or transport via an intracellular membrane
vesicular system (2).
It has now become apparent that several other "ubiquitin-like"
tagging molecules exist that are conjugated using enzymatic systems
similar but nonidentical to those used by ubiquitin (3, 4). Two groups
initially determined the nature of a modification of the Ran
GTPase-activating protein (RanGAP1) involved in the interaction of this
protein with RanBP2/Nup358 at the nuclear pore complex (5, 6). They
called the modifying molecule GMP1
(GAP-modifying protein
1) or SUMO-1 (small ubiquitin-like modifier 1). SUMO-1 has since been identified
several times as an interacting partner in the yeast two-hybrid system
and given different names: with the promyelocytic leukemia gene product (PML) (PIC-1) (7), with the death domain of the FAS antigen or
TNF-receptor (sentrin, DAP-1) (8, 9), and with the RAD51 and RAD52
proteins involved in DNA recombination and repair (UBL-1) (10).
A budding yeast homologue of SUMO-1 (Smt3p) was identified by Meluh and
Koshland (11) as a suppressor of mutations in Mif2 (mitotic instability factor
2), a protein thought to be the yeast equivalent of the
CENP-C mammalian centromere protein. One putative role for SUMO-1/Smt3p
is thus in assembly or maintenance of the centromere/kinetochore
structure involved in chromosome segregation. Similarly, the fission
yeast (Schizosaccharomyces pombe) equivalent of
Smt3p, Pmt3p, has recently been shown to be involved in chromosomal segregation and the control of telomere length (12).
Enzymes involved in Smt3p/SUMO-1 conjugation have been identified in
yeast and mammalian cells (13-15). The SUMO-1-activating enzyme (E1)
consists of a heterodimer of the Aos1p/SAE1 and Uba2p/SAE2 proteins
that together reconstitute the equivalent of the ubiquitin-activating enzyme Uba1 (13). The SUMO-1-conjugating enzyme (E2) in yeast, mammalian cells, and Xenopus is Ubc9 (14, 15). So far no E3 enzymes have been identified. Ubc9, originally thought to be a ubiquitin-conjugating enzyme, was shown to be essential gene in yeast
(16) because temperature-sensitive mutants of Ubc9 arrested in mitosis,
as did mutants of a SUMO-1-cleaving protease Ulp1 (17).
In yeast and mammalian cells, there is very little free Smt3p/SUMO-1.
Most (>90%) of the SUMO-1 detected on Western analysis of extracts
from mammalian cells is conjugated to the RanGAP1 nuclear pore protein
(18). Other proteins subject to modification by SUMO-1 are the PML and
Sp100 proteins, which form part of the nuclear structures known as PODs
(PML oncogenic domains) or nd10s (19). For PML, it has been shown that
SUMO-1 modification is essential for its localization in PODs, with
free PML being found in the nucleoplasm. Another substrate for SUMO-1
is I  (20), an inhibitor of NF , which is modified by
SUMO-1 on the lysine residue also modified by ubiquitin. SUMO-1
modification prevents ubiquitination and thus results in stabilization
of I  and consequently in inhibition of NF- (20).
In the present communication, we describe SUMO-1 modification of the
p53-related p73 protein. p53 is the most widely studied tumor
suppressor and is mutated in over 50% of human tumors (21). It plays a
key role in both the regulation of cell cycle checkpoints and the
initiation of apoptotic cell death in response to DNA damage. The
activity of p53 has been shown to be finely tuned by a variety of
post-translational modifications (phosphorylation, acetylation, and
glycosylation) and to be highly sensitive to conformational changes
(22). The p53 molecule contains a number of well defined domains
including an N-terminal transcriptional activation domain and a central
core, corresponding to the DNA-binding domain, which is highly
conserved in evolution and which contains the majority of the mutation
hot spots in cancer cells. The rest of the molecule contains a linker
region including the major nuclearization signal, an oligomerization
domain, and a regulatory C-terminal region containing multiple
phosphorylation and acetylation sites (21, 22). Recently, this region
has been shown to contain a lysine residue (386) that can be covalently
modified by SUMO-1 (23, 24).
We previously reported the existence of a p53-related gene, p73,
mapping to a chromosomal locus (1p36.3) often deleted in neuroectodermal human cancers such as neuroblastomas (24). Subsequent work from several laboratories has described the existence of another
p53 family member, more closely related to p73 than to p53, variously
described as p63, KET, and p51 (25). p73 shows structural similarities
with p53, including the presence of transcription-activating, DNA-binding, and oligomerization domains. It exists as multiple isoforms, resulting from differential splicing of C-terminal exons, of
which the two major forms are the and isoforms containing 636 and 499 amino acids (25, 26). p73 differs from p53 in that its levels
of expression are not elevated in response to environmental stresses
such as UV irradiation and actinomycin D treatment (25). However, in
interaction with the protein kinase c-Abl it mediates an apoptotic
response to ionizing radiation and to genotoxic agents such as
cisplatin (27).
In contrast to p53, no functionally significant p73 mutations have so
far been reported in cancer cells, but a monoallelic pattern of
expression is sometimes observed (26). Analysis of p73 knock-out mice
does not show an increased susceptibility to spontaneous tumorigenesis
(28). However, these studies reveal that p73 plays key roles in a
number of developmental processes that are nonoverlapping with the
roles played by other p53 family members (28). The activities of
p73 may be exerted at multiple levels. Firstly, p73 is a
transcriptional activator eliciting a response different from that
obtained with p53 (29). Secondly, the major form of p73 is often an
N-terminally truncated form that would be incapable of transcriptional
activation (28), suggesting the possibility of other nontranscriptional
roles for p73.
During yeast two-hybrid screens using p73 as a bait, we isolated the
cDNA for SUMO-1. Here we show that p73 can be covalently modified
by SUMO-1, with the major modification occurring on the terminal lysine
residue. A number of other SUMO-1-interacting proteins were isolated in
the p73 two-hybrid screening, and we have been able to deduce and
confirm a novel SUMO-1 interaction motif. The nature of the proteins
identified here suggests that one role for SUMO-1 may be in
transcriptional regulation, perhaps co-ordinating this with other key
cellular processes such as cell cycle checkpoints, chromosome
segregation, DNA recombination and repair, and the induction of apoptosis.
 |
EXPERIMENTAL PROCEDURES |
Cell Lines and Culture--
The SK-N-AS neuroblastoma cell line
(30) and the 293 embryonic kidney cell line (American Type Culture
Collection CRL 1573) were grown in Dulbecco's modified Eagle's medium
(Life Technologies, Inc.) containing 1 mM sodium pyruvate
and 10% fetal calf serum. The U937 monocytic cell line (American Type
Culture Collection CRL 1593) was grown in RPMI (Life Technologies,
Inc.) containing 10% fetal calf serum.
RNA Preparation and cDNA Library Construction--
Total
cellular RNA was extracted from SK-N-AS and U937 cells by the
guaninidium thiocyanate/acid phenol method (31). Poly(A)+
RNAs were isolated using oligo(dT) magnetic beads (Dynal). 1 µg of
each poly(A)+ RNA was transcribed into cDNA using
reverse transcriptase (Superscript, Life Technologies, Inc.) and the
primer
GATCCGGGCCCATTTTCTAC[ACGT][ACGT][ACGT][ACGT][ACGT][ACGT]. cDNAs were fractionated on Sephacryl S400 (Amersham Pharmacia Biotech), and fractions containing cDNA of approximately 500-1500 nucleotides were selected for cloning in the pJGC cloning vector, derived from the pJG4-5 activation domain vector (32) by insertion of a
polylinker containing ApaI and BamHI cloning
sites between the EcoRI and HindIII sites.
cDNA libraries were constructed by the primer adapter method
(33).
Bait Plasmid Construction and Two-hybrid Screening of cDNA
Libraries--
Sequences corresponding to p73 (amino acids
85-636), p73 (amino acids 85-499), and p53 (amino acids 73-393)
were inserted in the pEG202 vector between either the EcoRI
or BamHI sites and the XhoI site (32) creating
fusion proteins with the LexA DNA-binding domain. The pEG202.p73
bait was introduced using lithium acetate/polyethylene glycol
transformation with sheared single-stranded DNA carrier (34) into the
EGY48 strain of Saccharomyces cerevisiae (containing the
LEU2 gene under the control of six LexA operators) along with a
reporter plasmid pSH18-34 containing the LacZ gene under the control of
eight LexA operators. cDNA libraries were then similarly introduced, and yeast colonies were selected on Yeast Nitrogen Base
(Difco) medium containing 2% glucose and leucine (but lacking tryptophan, histidine, and uracil). Approximately 106
transformed yeast were obtained with the U937 library and 2 × 106 transformed yeast with the SK-N-AS library. After 3-4
days, colonies were replicated to nitrocelulose filters (Protran BA85;
Schleicher & Schull), replated on dishes containing 2% galactose, 1%
raffinose, 1 mg/ml 5-bromo-4-chloro-3-indolyl
-D-galactopyranoside (X-gal) (Life Technologies, Inc.)
lacking leucine, and grown for 4-5 days. 20 yeast colonies from each
cDNA library transformation showing a blue coloration were selected
for further study.
Plasmid Identification--
Plasmid DNA was extracted using a
glass bead disruption method (35), and cDNA inserts in the pJGC
plasmid were amplified by polymerase chain reaction using
oligonucleotides flanking the cDNA insert and sequenced. The pJGC
plasmid was isolated by selection in the KC8 bacterium in minimal A
medium containing vitamin B1 and supplemented with uracil, histidine,
and leucine but lacking tryptophan. It was then tested for interaction
with the p73 , p73 , and p53 pEG202 bait plasmids by measurements
of the -galactosidase levels in transformed EGY48 24 h after
galactose induction of the GAL1 promoter in pJGC, as described by
Kippert (36).
Site-directed Mutagenesis--
Amino acid substitutions were
performed by limited polymerase chain reaction amplification of plasmid
DNA using Pfu DNA polymerase and oligonucleotides
containing the mutated codons, followed by digestion of remaining input
plasmid DNA using the methylation sensitive enzyme Dpn1 (QuikChange; Stratagene).
Transient Transfection of Animal Cells--
The p73 , p73 ,
p53, and SUMO-1 cDNAs were introduced into the pcDNA3 vector
(Invitrogen) or an epitope-tagged vector derived from pcDNA3 by
insertion of an optimalized ATG codon (CCACCATGGCG) and a c-Myc 9E10
epitope (EQKLISEEDL) between the HindIII and EcoRI sites. Plasmid DNA preparations were performed using
the QIAfilter Plasmid Midi Kit (Qiagen). Approximately 106
cells were transfected in six-well dishes using 1-2 µg of plasmid DNA and LipofectAMINE Plus reagents (Life Technologies, Inc.) as
described by the manufacturer. Cells were scraped from the dish 20-30
h after transfection, resuspended in denaturing SDS gel buffer
(Bio-Rad) with 0.7 M  mercaptoethanol and analyzed on
SDS-polyacrylamide gels.
Immunoblotting and Antibodies--
Proteins were transferred
from polyacrylamide gels to nitrocellulose membranes (Hybond-C-extra;
Amersham Pharmacia Biotech). These were analyzed with the following
primary antibodies: anti-c-Myc (9E10) (Santa Cruz or Invitrogen),
anti-GMP1 (anti-SUMO-1) (Zymed Laboratories Inc.),
anti-p73 (a rabbit polyclonal antibody: (25)), anti-PCNA (Santa
Cruz), and secondary anti-mouse IgG and anti-rabbit IgG coupled to
horseradish peroxidase (Transduction Laboratories) and visualized by
enhanced chemiluminesence (Amersham Pharmacia Biotech). The anti-p73
antibody was generated against a C-terminal p73 ()
glutathione S-transferase fusion protein (25). p73 forms were quantified by scanning of different film exposures and analysis using BioImage (Kodak) software.
Dual Luciferase Assays--
SK-N-AS cells were transfected in
six-well dishes as described above using the RGC firefly luciferase
reporter gene (200 ng) and a pRL-CMV Renilla luciferase control (100 ng) (Promega). 20 h after transfection, cells were scraped in 250 µl of Passive Lysis Buffer (Promega) and subjected to two cycles of
freeze-thawing. 20 µl of cell extract were analyzed with the Dual
Luciferase Reporter Assay system, using a Lumistar luminometer.
Luciferase activities of the RGC-luciferase vector were normalized
based on the luciferase activities of the co-transfected pRL-CMV, to
correct for variations in cell number and/or transfection efficiency
between wells.
 |
RESULTS |
Two-hybrid Screening with p73 Isolates SUMO-1 and
SUMO-1-interacting Proteins--
While performing two-hybrid screens
using a p73 protein sequence fused to the LexA DNA binding domain
(32), we isolated cDNAs encoding SUMO-1, Ubc9 (the
SUMO-1-conjugating enzyme), and a SUMO-1-activating enzyme SAE2 (15).
Both SUMO-1 and Ubc-9 were found to interact with p73 and p53 but
not with p73 (Fig. 1A).

View larger version (32K):
[in this window]
[in a new window]
|
Fig. 1.
Interaction of p73 ,
p73 , p53, and SUMO-1 with proteins encoded by
cDNAs isolated in the p73 two-hybrid
screen. A, Ubc9 (U45328; amino acids 1-143), SUMO-1
(U61937; amino acids 4-101), and p73 (amino acids 85-499) in the
pJGC vector were transformed in the yeast EGY48 along with pSH18-34 and
different pEG202 bait proteins (p53, p73 , p73 , and SUMO-1).
Interactions were measured by -galactosidase levels (36) 24 h
after galactose induction of the GAL1 promoter in the pJGC vector and
expressed as a percentage of the -galactosidase level obtained for
the dimerization of p53 (amino acids 73-393) in this system.
B, thymine DNA glycosylase (TDG) (42) (U51166)
amino acids 127-410; PM-Scl75 (41) (U09215) amino acids 258-361;
PIASx (37) (AF077953) amino acids 107-572; PKY (38) (AF004849) amino
acids 646-1055 and ZFH/CHD3 (39, 40) (U91543/AF006515) amino acids
1863-2000, were similarly assessed for interactions with p53, p73 ,
p73 , and SUMO-1.
|
|
Surprisingly, most of the other proteins isolated in the p73
two-hybrid screen also showed interaction with p73 and p53 but not
with p73 (Fig. 1B). These proteins include PIASx (37), PKY (38), CHD3/ZFH (39, 40), PM-Scl75 (41), and thymine DNA glycosylase
(42). This suggested that these proteins may have been isolated via
interaction with p73 modified by the yeast SUMO-1 equivalent (Smt3p),
because higher molecular mass forms of p73 are detected in these yeast
(not shown). Indeed, when tested directly with a SUMO-1 bait, all of
these proteins gave a positive result (Fig. 1B).
A SUMO-1 Interaction Motif--
When the cDNA sequences of the
SUMO-1-interacting proteins were examined for the presence of common
sequences, an 11-amino acid motif was detected in a subset of the
proteins. This contained a central serine doublet separated by one
amino acid (SXS), within which one serine was replaced by
threonine in the human PKY cDNA (Fig.
2A). This SXS
triplet is flanked on the N-terminal side by predominantly hydrophobic
amino acids and on the C-terminal side by acidic amino acids (D/E)
(Fig. 2A). This motif is evolutionarily conserved in the PKY
and PIAS gene families (Fig. 2A). In view of the subsequent
mutagenesis experiments (see below), it is unclear whether the motif in
SAE2 that served to derive this consensus would in fact be sufficient
on its own to interact with SUMO-1.

View larger version (27K):
[in this window]
[in a new window]
|
Fig. 2.
Identification and testing of a SUMO-1
interaction motif. A, the cDNAs described in Fig. 1
and two other cDNAs also identified in the p73 two-hybrid screen
PML-3 (81) (M79464) and the SUMO-1-activating enzyme SAE2 (13)
(AF090384) were compared in order to identify potential common motifs.
One such motif was identified and found to be evolutionarily conserved.
Sequences are from PKY (38), PKM (61), homeodomain-interacting protein
kinases (62), PIAS (37), SAE2 (13), PML-3 (81), and PM-Scl75 (41).
B, this motif from the PM-Scl75 protein was inserted in the
pEG202 vector and tested with SUMO-1 in the pJGC vector in the
two-hybrid system. Different amino acids in this motif were substituted
with alanine, and the interaction with SUMO-1 was again tested by
measuring -galactosidase levels. These were normalized to that for
the initial interaction of the PM-Scl75 motif. A similar motif from the
protein furin (43) was also tested (sequence b).
|
|
The motif from the PM-Scl75 protein was used to construct a
LexA-SXS motif fusion protein, which showed a very strong
interaction with SUMO-1 in the two-hybrid system (equivalent to that of
the dimerization of p53/p53 and stronger than the initial
PM-Scl75/SUMO-1 interaction). Critical residues were identified by
alanine replacement. Such an analysis shows that both serine residues
are necessary (Fig. 2B, sequences c and
d), as is the one amino acid spacing between these residues;
either no or two amino acid spacing destroys SUMO-1 interaction (Fig.
2B, sequences e and f). The acidic
C-terminal residues are also crucial. Mutation of E8 or E10 completely
destroys SUMO-1 interaction (Fig. 2B, sequences g
and i), and mutation of E9 drastically reduces interaction.
(Fig. 2B, sequence h). Although expression levels
of the different mutants were not tested, it seems unlikely that
differential expression of the mutant proteins (corresponding to single
amino acid substitutions, additions or deletions) can explain the
almost complete loss of the capacity to interact with SUMO-1. The
SXS motif resembles one previously identified in the C
terminus of the endopeptidase furin, which is implicated in its
translocation into the trans Golgi network (43). However, the furin
motif, which also has an acidic N terminus, does not interact with
SUMO-1 (Fig. 2B, sequence b), indicating the
potential importance of the hydrophobic residues (1-4) in the
SXS motif.
p73 Can Be Covalently Modified by SUMO-1--
We tested whether
p73 might be covalently modified with SUMO-1 by co-transfection of
SK-N-AS neuroblastoma cells with p73 and SUMO-1. In the presence of
p73 and SUMO-1, a prominent novel protein species was formed, showing a
molecular mass approximately 20 kDa more than p73 ,
both for the full-length and N-terminally truncated forms of p73
(Fig. 3, lanes b and
d). This corresponds to the apparent molecular size
difference for SUMO-1-modified forms of RanGAP1 and PML seen on
SDS-polyacrylamide gel electrophoresis (5, 6, 18). A similar high
molecular mass endogenous p73 species was observed in cell and tissue
extracts, such as those from primary cultures of epithelial cells,
isolated from human nasal polyps (a cell extract provided by Dr. F. Tournier, University of Paris VII) (44) (Fig. 3, lane
f).

View larger version (63K):
[in this window]
[in a new window]
|
Fig. 3.
Covalent modification of p73 by SUMO-1.
Lanes a-e, SK-N-AS neuroblastoma cells were transfected
with c-Myc-tagged full-length p73 (lanes c and
d) and N-terminally deleted p73 (amino acids 85-636)
(lanes a and b) in the presence (lanes
b and d) or absence (lanes a and
c) of c-Myc-tagged SUMO-1. Lane e is a control
with SUMO-1 alone. Higher molecular mass forms of p73 are detected
using an anti-c-Myc antibody in the presence of SUMO-1 (lanes
b and d). Lane f, a similar high molecular
mass form of p73 is seen in total cell extracts from primary cultures
of human nasal epithelial cells analyzed with an anti-p73 antibody.
Lanes g-j, p73 sequences lacking the N-terminal activation
domain (amino acids 1-84) and with differing lengths of C-terminal
deletions and an N-terminal c-Myc tag were co-transfected with
c-Myc-tagged SUMO-1 into SK-N-AS cells. SUMO-1-modified and unmodified
p73 forms were detected using an anti-c-Myc antibody. The major
SUMO-1-modified form of p73 is indicated by the double
asterisk and minor forms are indicated by a single
asterisk.
|
|
In addition to the major modified species (Fig. 3, lane h,
indicated with **), several minor higher molecular mass species were
seen in the p73 transfected cells (Fig. 3, lane h, indicated with *), which were of variable intensity from one experiment to
another (Fig. 3, lanes b and h, and Fig.
4, lane a). The fact that the
lysine in ubiquitin used for polyubiquitination is absent from SUMO-1
suggests the possibility of multiple sites for SUMO-1 modification.

View larger version (24K):
[in this window]
[in a new window]
|
Fig. 4.
SUMO-1 modification of the C-terminal lysine
residue of p73 . A, the
C-terminal lysine of p73 (Lys627) was modified to arginine
by site-directed mutagenesis, and this mutant was tested for SUMO-1
modification by co-transfection in 293 cells with SUMO-1, as described
in Fig. 3. The major SUMO-1-modified form of p73 is indicated by a
double asterisk. B, comparison of the sequences
surrounding the modified lysines in p53 and p73 with those
identified in other SUMO-1-modified proteins (45) reveals a consensus
for glutamic acid at position +2, a hydrophobic amino acid at position
1, and a basic amino acid (His, Arg, or Lys) at position 4 or 5.
A predicted SUMO-1 modification site in p63 (49) is also
indicated.
|
|
The Principal SUMO-1 Modification Site in p73 Is the C-terminal
Lysine--
When p73 and p73 were transfected into SK-N-AS
cells, SUMO-1-modified forms were detected for p73 but not for
p73 (Fig. 3, lanes h and i). Similarly, after
C-terminal deletion up to amino acid 450, p73 no longer showed SUMO-1
modification (Fig. 3, lane g). After deletion of the last 18 amino acids of p73 , no major SUMO-1-modified form was seen, but
minor forms were still apparent (Fig. 3, lane j).
The major modification site in the last 18 amino acids of p73 was
identified by site-directed mutagenesis as being the final lysine
residue, number 627 (Fig. 4A). Similar experiments on p53 identified the C-terminal lysine residue (Lys386) as being
the major SUMO-1 modification site (23, 24). In agreement with all but
one of the previously identified SUMO-1 modification sites, the p53
lysine 386 and the p73 lysine 627 have a glutamic acid at +2 and a
hydrophobic amino acid at position 1 (Fig. 4B). In
addition, as suggested by Sternsdorf et al. (45), a basic
residue (arginine, lysine, or histidine) is found at position 4 or
5 (Fig. 4B). A similar consensus sequence is found for the
C-terminal lysine of p63 (Fig. 4B).
SUMO-1 Modification Potentiates but Does Not Dictate p73
Instability--
Lee and La Thangue (46) reported that p73 and
p73 isoforms undergo differential degradation by the proteasome,
with p73 being sensitive and p73 insensitive to this degradation.
We have investigated whether the SUMO-1 modification on lysine 627 plays a role in this instability by transfecting p73 expression
plasmids into SK-N-AS cells and following the accumulation of the
different p73 protein forms in the presence and absence of the
proteasome inhibitor MG-132. p73 containing a mutation of the major
SUMO-1 modification site (lysine 627) to arginine shows a similar small but reproducible (1.5-3-fold) increase in accumulation in the presence
of MG132 as the wild-type p73 (Fig.
5A). Both SUMO-1-modified and
unmodified forms of p73 are increased by MG132 treatment (Fig. 5,
A and B), whereas the levels of SUMO-modified
RanGAP1 and of PCNA are unchanged (Fig. 5, C and
D).

View larger version (30K):
[in this window]
[in a new window]
|
Fig. 5.
Effect of the proteasome inhibitor MG132 on
the accumulation of SUMO-1-modified and unmodified forms of p73, and
detergent extraction of these forms. A, wild-type
p73 and p73 K627R were transfected into SK-N-AS cells, and 20 h after transfection the cells were cultured for a further 8 h in
the presence and absence of 5 µM MG132 (Calbiochem). p73
accumulation was detected, using an anti-p73 antibody, in total cell
extracts prepared by direct lysis in denaturing SDS gel buffer
(Bio-Rad). One experiment is shown for p73 K627R (lanes a
and b) and two experiments are shown for p73 (lanes
c and d and lanes e and f).
B-D, p73 and SUMO-1 were transfected into SK-N-AS cells,
and 20 h after transfection the cells were cultured for a further
8 h in the presence or absence of 5 µM MG132
(Calbiochem). Cell extracts were prepared by direct lysis in denaturing
SDS gel buffer (Bio-Rad) for the total extract (T) or lysis
in RIPA buffer (50 mM Tris pH8, 150 mM NaCl,
1% Nonidet P-40, 0.5% sodium deoxycholate, 1 mM
dithiothreitol) containing complete protease inhibitor mixture (Roche
Molecular Biochemicals) for 15 min at 4 °C and centrifugation at
15,000 rpm to separate insoluble pellet (P) and soluble
(S) fractions. Following solubilization of the pellet
fraction by boiling in SDS gel buffer, samples were analyzed on
denaturing SDS-acrylamide gels. The presence in the different fractions
of p73 was detected using an anti-p73 antibody (B), that
of SUMO-1-modified RanGAP1 and p73 was detected with an anti-SUMO-1
antibody (C), and that of PCNA was detected with an
anti-PCNA antibody (D). E, SK-N-AS cells were
transfected as in B and cultured without MG132. Cell
extracts were prepared as in B in the presence and absence
of the thiol protease inhibitor N-ethylmaleimide
(NEM) (1 µM). The presence in the different
fractions of p73 was detected using an anti-p73 antibody.
|
|
Quantification of the modified and unmodified p73 forms in several
experiments showed that the amount of SUMO-1-modified p73 is increased
to a greater extent in the presence of MG132 (5-10-fold) than is that
of the unmodified p73 (1.5-3-fold) (Fig. 5, A and B). Although the interconvertibility of the two p73 forms
complicates the analysis, this result would suggest that SUMO-1
modification potentiates proteasomal degradation of p73.
SUMO-1 Modification May Alter p73 Localization--
When
performing detergent extractions using RIPA (1% Nonidet P-40, 0.5%
sodium deoxycholate) buffer to prepare cell extracts, we often
found that the SUMO-1-modified form of p73 was preferentially recovered
in the detergent insoluble pellet fraction (Fig. 5B), whereas the nonmodified p73 was found in both soluble and pellet fractions. Treatment of cells with MG132 leads primarily to an increase
in p73 accumulation in the pellet fraction (Fig. 5B). In
contrast, the SUMO-modified form of RanGAP1 (Fig. 5C), which accumulates in nuclear pore complexes, and other nuclear proteins such
as PCNA (Fig. 5D) are very efficiently extracted in the
detergent-soluble fraction.
The preferential recovery of SUMO-1-modified p73 in the insoluble
fraction may thus result from targeting of p73 modified by SUMO-1 to
particular subcellular structures, although SUMO-1 modification is not
required for the presence of p73 in this fraction because the mutant
p73K627R distributes in a similar fashion to unmodified wild-type p73
(not shown). Alternatively, it may represent differential SUMO-1
modification of p73 in different cellular compartments or differential
SUMO-1 cleavage during extraction. We have attempted to reduce
isopeptidase cleavage during extraction by the addition of protease
inhibitor mixtures. In addition, in certain experiments
N-ethylmaleimide was included at concentrations from 10 nM to 1 µM in both washing and extraction
buffers to inhibit the thiol protease activities reported for SUMO-1
hydrolases (47). This addition did not affect the preferential recovery
of SUMO-1-modified p73 in the pellet fraction (Fig. 5E).
SUMO-1 Modification Does Not Affect the Transcriptional Activity of
p73--
To test the potential modulation of the transcriptional
activities of p73 , we measured the activation of an RGC-luciferase reporter gene in SK-N-AS cells by different p73 forms in the presence or absence of SUMO-1. As can be seen in Fig.
6, the level of activation of the
reporter gene by p73 is not affected by co-transfection with a large
excess of a SUMO-1 expressing plasmid in these experiments. A similar
result was found for activation by p53 (not shown). The transcriptional
activities of p73 and of the mutant p73 K627R in these
experiments are equivalent and are lower than that of p73 (Fig.
6).

View larger version (31K):
[in this window]
[in a new window]
|
Fig. 6.
Lack of effect of SUMO-1 on the
transcriptional activity of p73 in SK-N-AS neuroblastoma cells.
SK-N-AS cells were co-transfected with the RGC-luciferase gene (200 ng), the CMV-Renilla luciferase gene (100 ng), a plasmid expressing a
p73 isoform ( , , K627R) (5, 50, or 200 ng), with 1 µg of
either the SUMO-1 expression plasmid or the equivalent vector without
cDNA insert. After 20 h, cell lysates were prepared and
activities of the firefly (RGC) and Renilla (CMV) luciferases measured.
Shown are the means and ranges of values for three experiments for the
RGC-luciferase, normalized to that of the Renilla luciferase, and then
further normalized to the maximum 100% value for p73 in each
experiment.
|
|
 |
DISCUSSION |
p73 Is Modified by SUMO-1, but p73 Is Not--
We show here
that p73 is a novel substrate for SUMO-1 modification. It is of
interest that of the two p73 isoforms (which differ only in their C
termini), p73 is a good substrate for SUMO-1 modification, whereas
p73 is not. Accordingly, deletion experiments show that the lysines
involved in SUMO-1 modification are contained in the C-terminal region
of p73 not present in p73 . It remains to be determined whether
p73 is also a substrate for modification by SUMO-2/3 (48).
p73 shows one major SUMO-1-modified form and several minor modified
forms. Because the lysine in ubiquitin used for polyubiquitination (lysine 48) is absent from SUMO-1, this suggests that there is one
major site and several minor sites for SUMO-1 modification. Site-directed mutagenesis shows that the major modification site of
p73 is the extreme C-terminal lysine. Similarly, the C-terminal lysine residue of p53 (lysine 386) has recently been identified as the
major SUMO-1 modification site (23, 24). When the amino acid sequences
surrounding lysine 386 of p53 and lysine 627 of p73 are compared
with those of SUMO-1-modified lysines in other proteins (45), they show
a consensus for glutamic acid at the position +2, a hydrophobic amino
acid at position 1, and a basic amino acid (lysine, arginine, or
histidine) at position 4 or 5 (Fig. 4B). A similar
consensus sequence is found for the C-terminal lysine of p63 (49) (Fig.
4B).
Is SUMO-1 Modification Involved in Regulating the Stability or
Localization of p73?--
Ubiquitin modification is primarily, though
not exclusively, involved in regulating protein stability, including
that of p53 (1, 2). We investigated whether SUMO-1 modification plays a
role in modulating the stability of p73, because Lee and La Thangue
(46) reported that p73 is sensitive to degradation by the
proteasome, whereas p73 is not. Our results, using an inhibitor of
proteasomal degradation, MG132, show that both SUMO-1-modified and
nonmodified p73 are degraded via the proteasome. p73 mutated in
the major SUMO-1 modification site and wild-type p73 show similar
up-regulation by MG132 treatment. SUMO-1 modification would thus not
seem to be a major factor influencing p73 degradation by the
proteasome. However, SUMO-1-modified p73 was stabilized to a greater
extent than unmodified p73 by treatment with MG132, suggesting that
SUMO-1 modification potentiates proteasomal degradation. Although
some proteins have been shown to be stabilized by SUMO-1 modification
because of a resulting inhibition of ubiquitination on the modified
lysine residue (20, 50), other SUMO-1-conjugates have been shown to be
degraded via the proteasome (51, 52). SUMO-1 modification may
induce conformational changes potentiating ubiquitination or may
influence protein degradation via modulation of E3 ubiquitin ligases,
as found for the ubiquitin-like modifier Rub1 in yeast (3).
As for PML (19), SUMO-1-modified p73 may have a particular subcellular
localization because we have found that SUMO-1-modified p73 is
preferentially isolated in the detergent insoluble fraction. We
attempted to exclude the possibility that this result reflects preferential SUMO-1 cleavage in the soluble fraction during cell lysis
by addition of protease inhibitor mixtures and by the detection of
SUMO-1-modified RanGAP1 in the soluble fraction. However, RanGAP1 and
PML have recently been reported to be differentially sensitive in
vivo to the nuclear SUMO-1 hydrolase SENP1 (53). We cannot thus
completely rule out a differential isopeptidase sensitivity of
p73-SUMO-1 in the soluble and insoluble fractions as an explanation for
our results, although the inclusion in cell washing and lysis buffers
of N-ethylmaleimide, which has been shown to inhibit SUMO-1 hydrolases in vitro (47), did not increase the amount of
SUMO-1-modified p73 in the soluble fraction.
We have so far been unable to identify p73 accumulation in PODs that
contain a large amount of nuclear SUMO-1 after MG132 treatment.
However, the low percentage of p73 that is modified by SUMO-1 makes
identification of this fraction uncertain. For p53, nuclear aggregates
induced by leptomycin B treatment (which prevents nuclear export), have
recently been localized adjacent to PODs (54).
Is SUMO-1 Modification Involved in the Transcriptional Activity of
p73 ?--
Two recent reports (23, 24) show that SUMO-1 modification
of p53 on lysine 386 increases the transactivation activity of p53 on
reporter genes. We did not find this result examining activation by
p73 , or by p53, of the RGC p53-responsive element in SK-N-AS cells.
This may reflect experimental differences in promoter constructs, in
cell types, or in levels of SUMO-1 modification.
We find here, as previously reported (46, 56), that the isoform,
which is not subject to SUMO-1 modification, is more transcriptionally
active than the isoform, which can be SUMO-1-modified. The
C-terminal region of p73 has been shown to modulate its
transcriptional and growth regulatory properties (55-57), acting both
as a positive and negative regulator. Although our experiments do not
provide evidence for a direct effect of SUMO-1 modification on the
transcriptional activity of transfected p73, such a modification could
indirectly modulate activation of the endogenous p73 protein by
influencing interaction with other co-regulatory proteins such as the
c-Abl tyrosine kinase (27) or the histone deactetylation complex (see below).
Novel SUMO-1-interacting Proteins and a SUMO-1-interacting
Motif--
Among the proteins we originally isolated in our p73
two-hybrid screen, the majority were subsequently found to interact
with SUMO-1. These include PML, PM-Scl 75, thymine DNA glycosylase, PIASx, PKY, CHD3/ZFH, and one of the SUMO-1-activating enzymes, SEA2.
Five of the protein sequences interacting in the two-hybrid system with
SUMO-1 contained a motif with a central SXS (or
SXT) triplet preceded by predominantly hydrophobic amino
acids and followed by predominantly acidic amino acids (Fig.
2A). We have confirmed that this motif can interact with
SUMO-1 in the two-hybrid system. The serine/threonine and acidic
residues essential for this interaction constitute a double CKII kinase
site ((S/T)XX(D/E)) (58), and the interaction may thus be
regulated by phosphorylation.
Screening DNA sequence data bases for other proteins containing the
SXS motif identified RanBP2/Nup358. Although the fit to our
consensus sequence is not ideal (KKPEDSPS DDDVL), in that acidic
amino acids are found at positions normally constituted by hydrophobic
amino acids (Fig. 2A), this sequence maps to the minimal
domain determined for RanGAP1-SUMO-1 binding: 2550-2837 (59). A number
of other potential SUMO-1-interacting proteins have been identified.
These include c-Myc, DNA repair proteins (XPG, XRCC1, and the Ku70
regulatory subunit of the DNA protein kinase), centromeric proteins
(CENP-B), components of the origin of replication (ORC1 and ORC2), and
viral proteins such as the cytomegalovirus IE2 protein. In the latter
case, this protein has been recently shown to be SUMO-1-conjugated
(60).
The SXS motif has been functionally implicated in SUMO-1
interaction using the yeast two-hybrid system, where it may be
interacting directly with SUMO-1 or indirectly via Ubc9 or one of the
SUMO-1-activating enzymes. Recent experiments on the mouse homologue of
PKY-related kinase PKM (61), the homeodomain-interacting protein kinase 2 (62) (Fig. 2A), show that the SXS motif is part
of a sequence that specifies localization of mouse
homeodomain-interacting protein kinase 2 in nuclear speckles and that
interacts in vitro with Ubc9 (63). The SXS motif
is also conserved in the PIAS transcription factor family (Fig.
2A), including the androgen receptor-interacting protein
ARIP (64) and the protein Miz-1, a N-terminally truncated form of
PIASx that interacts with the homeobox domain protein Msx2 (65).
These and other (66) findings suggest that global modulation of SUMO-1
levels might co-ordinately regulate transcription of diverse genetic programs.
SUMO-1-interacting Proteins and Transcriptional
Repression--
Another of the SUMO-1-interacting proteins is the
CHD3/ZFH zinc finger-containing helicase, whose expression is
associated with cell growth (39, 40). This protein does not contain an SXS motif but may be modified by SUMO-1 since it contains a
potential SUMO-1 modification site (VKKE) within the 140 C-terminal
amino acids identified here as the SUMO-1-interacting region. CHD3 has been shown to be present in histone deacetylase complexes (HDAC) (67),
which have been implicated in transcriptional repression by p53 (68).
This interaction between p53 and HDAC is indirect and is mediated at
least in part by the co-repressor Sin3a. In the case of the lymphoid
lineage-determining factors of the Ikaros gene family, interactions
with HDAC have been shown to proceed both through Sin3 and through
NURD/Mi-2 complexes (69, 70), the latter containing CHD3. In view of
the interactions detected here, p73-CHD3 and p53-CHD3 interactions via
SUMO-1 may also participate in transcriptional repression mediated by
these proteins.
Other proteins interacting with both SUMO-1 and HDAC complexes include
the homeodomain-interacting protein kinase 2 (62, 71) and unliganded
nuclear receptors such as the androgen receptor and the glucocorticoid
receptor (72-74). This may also be the case for retinoic acid
receptors that were found to interact in two-hybrid studies with
thymine DNA glycosylase (75), which we show here to interact with
SUMO-1. The Drosophila transcriptional repressor Tramtrack
69 is also modified by SUMO-1 (76). SUMO-1 modification may play a key
role in the balance between transcriptional activation and repression.
If this is true for p73 and its homologue p63, this may offer one
explanation for the finding of N-terminally truncated forms of the
-isoforms of p63 and p73 (28, 77), which would be unable to activate
transcription of target genes. These N-terminally truncated forms are,
however, still able to bind to DNA, and could thus mediate
transcriptional repression via SUMO-1-modulated interaction with HDAC
complexes. Transcriptional repression by p53 is involved in the
apoptotic activity of this protein (68), and this could also be the
case for the apoptotic activity of p73 (24, 25), implicating both
full-length and N-terminally truncated forms. Alternatively,
N-terminally truncated forms can act as dominant negative inhibitors of
p53- or p73-induced transcription and apoptosis (28, 48, 78, 79). The
role of the different p73 forms in modulating apoptosis during
development (80) and the contribution of SUMO-1 modification remain to
be fully investigated.
 |
FOOTNOTES |
*
The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
To whom correspondence should be addressed. Tel.:
33-5-61-00-41-67; Fax: 33-5-61-00-40-01; E-mail:
adrian.minty@sanofi-synthelabo.com.
Published, JBC Papers in Press, August 28, 2000, DOI 10.1074/jbc.M004293200
 |
ABBREVIATIONS |
The abbreviations used are:
E1, ubiquitin-activating enzyme;
E2, ubiquitin;
E3, ubiquitin-protein
isopeptide ligase;
PML, promyelocytic leukemia gene product;
POD, PML
oncogenic domain;
HDAC, histone deacetylase complex.
 |
REFERENCES |
| 1.
|
Ciechanover, A.
(1998)
EMBO J.
17,
7151-7160
|
| 2.
|
Hochstrasser, M.
(1996)
Cell
84,
813-815
|
| 3.
|
Hochstrasser, M.
(1998)
Genes Dev.
12,
901-907
|
| 4.
|
Saitoh, H.,
Pu, R. T.,
and Dasso, M.
(1997)
Trends Biochem. Sci.
22,
374-376
|
| 5.
|
Matunis, M. J.,
Coutavas, E.,
and Blobel, G.
(1996)
J. Cell Biol.
135,
1457-1470
|
| 6.
|
Mahajan, R.,
Delphin, C.,
Guan, T.,
Gerace, L.,
and Melchior, F.
(1997)
Cell
88,
97-107
|
| 7.
|
Brody, M. N.,
Howe, K.,
Etkin, L. D.,
Solomon, E.,
and Freemont, P. S.
(1996)
Oncogene
13,
971-982
|
| 8.
|
Okura, T.,
Gong, L.,
Kamitani, T.,
Wada, T.,
Okura, I.,
Wei, C. F.,
Chang, H. M.,
and Yeh, E. T.
(1996)
J. Immunol.
157,
4277-4281
|
| 9.
|
Liou, M.-L.,
and Liou, H.-C.
(1999)
J. Biol. Chem.
274,
10145-10153
|
| 10.
|
Shen, Z.,
Pardington-Purtymun, P. E.,
Comeaux, J. C.,
Moyzis, R. K.,
and Chen, D. J.
(1996)
Genomics
37,
183-186
|
| 11.
|
Meluh, P. B.,
and Koshland, D.
(1997)
Genes Dev.
11,
3401-3412
|
| 12.
|
Tanaka, K.,
Nishide, J.,
Okazaki, K.,
Kato, H.,
Niwa, O.,
Nakagawa, T.,
Matsuda, H.,
Kawamukai, M.,
and Murakami, Y.
(1999)
Mol. Cell. Biol.
19,
8660-8672
|
| 13.
|
Desterro, J. M. P,
Rodriguez, M. S.,
Kemp, G. D.,
and Hay, R. T.
(1999)
J. Biol. Chem.
274,
10618-10624
|
| 14.
|
Johnson, E. S.,
and Blobel, G.
(1997)
J. Biol. Chem.
272,
26799-26802
|
| 15.
|
Desterro, J. M. P.,
Thomson, J.,
and Hay, R. T.
(1997)
FEBS Lett.
417,
297-300
|
| 16.
|
Seufert, W.,
Futcher, B.,
and Jentsch, S.
(1995)
Nature
373,
78-81
|
| 17.
|
Li, S.-J.,
and Hochstrasser, M.
(1999)
Nature
398,
246-251
|
| 18.
|
Kamitani, T.,
Nguyen, H. P.,
and Yeh, E. T. H.
(1997)
J. Biol. Chem.
272,
14001-14004
|
| 19.
|
Seeler, J. S.,
and Dejean, A.
(1999)
Curr. Opin. Genet. Dev.
9,
362-367
|
| 20.
|
Desterro, J. M.,
Rodriguez, M. S.,
and Hay, R. T.
(1998)
Mol. Cell
2,
233-239
|
| 21.
|
May, P.,
and May, E.
(1999)
Oncogene
18,
7621-7636
|
| 22.
|
Lakin, N. D.,
and Jackson, S. P.
(1999)
Oncogene
18,
7644-7655
|
| 23.
|
Rodriguez, M. S.,
Desterro, J. M. P.,
Lain, S.,
Midgley, C. A.,
Lane, D. P.,
and Hay, R. T.
(1999)
EMBO J.
18,
6455-6461
|
| 24.
|
Gostissa, M.,
Hengstermann, A.,
Fogal, V.,
Sandy, P.,
Schwartz, S. E.,
Scheffner, M.,
and Del Sal, G.
(1999)
EMBO J.
18,
6462-6471
|
| 25.
|
Kaghad, M.,
Bonnet, H.,
Yang, A.,
Creancier, L.,
Biscan, J.-C.,
Valent, A.,
Minty, A.,
Chalon, P.,
Lelias, J.-M.,
Dumont, X.,
Ferrara, P.,
McKeon, F.,
and Caput, D.
(1997)
Cell
90,
809-819
|
| 26.
|
Kaelin, W. G.
(1999)
Oncogene
18,
7701-7705
|
| 27.
|
White, E.,
and Prives, C.
(1999)
Nature
399,
734-737
|
| 28.
|
Yang, A.,
Walker, N.,
Bronson, R.,
Kaghad, M.,
Oosterwegel, M.,
Bonnin, J .,
Vagner, C.,
Bonnet, H.,
Dikkes, P.,
Sharpe, A.,
McKeon, F.,
and Caput, D.
(2000)
Nature
404,
99-103
|
| 29.
|
Yu, J.,
Zhang, L.,
Hwang, P. M.,
Rago, C.,
Kinzler, K. W.,
and Vogelstein, B.
(1999)
Proc. Natl. Acad. Sci. U. S. A.
96,
14517-14522
|
| 30.
|
Sugimoto, T.,
Tatsumi, E.,
Kemshead, T.,
and Helson, L.
(1984)
J. Natl. Cancer Inst.
73,
51-57
|
| 31.
|
Chomczynski, P.,
and Sacchi, N.
(1987)
Anal. Biochem.
162,
156-159
|
| 32.
|
Gyuris, J.,
Golemis, E.,
Chertkov, H.,
and Brent, R.
(1993)
Cell
75,
791-803
|
| 33.
|
Caput, D.,
Beutler, B.,
Hartog, K.,
Thayer, R.,
Brown-Shimer, S.,
and Cerami, A.
(1986)
Proc. Natl. Acad. Sci. U. S. A.
83,
1670-1674
|
| 34.
|
Schiestl, R. H.,
and Gietz, R. D.
(1989)
Curr. Genet.
16,
339-346
|
| 35.
|
Hoffman, C. S.,
and Winston, F.
(1987)
Gene (Amst.)
57,
267-272
|
| 36.
|
Kippert, F.
(1995)
FEMS Microbiol. Lett.
128,
201-206
|
| 37.
|
Liu, B.,
Liao, J.,
Rao, X.,
Kushner, S. A.,
Chung, C. D.,
Chang, D. D.,
and Shuai, K.
(1998)
Proc. Natl. Acad. Sci. U. S. A.
95,
10626-10631
|
| 38.
|
Begley, D. A.,
Berkenpas, M. B.,
Sampson, K. E.,
and Abraham, I.
(1997)
Gene (Amst.)
200,
35-43
|
| 39.
|
Aubry, F.,
Matthei, M. G.,
and Galibert, F.
(1998)
Eur. J. Biochem.
254,
558-564
|
| 40.
|
Woodage, T.,
Basrai, M. A.,
Baxevanis, A. D.,
Hieter, P.,
and Collins, F.
(1997)
Proc. Natl. Acad. Sci. U. S. A.
94,
11472-11477
|
| 41.
|
Alderuccio, F.,
Chan, E. K. L.,
and Tan, E. M.
(1991)
J. Exp. Med.
173,
941-952
|
| 42.
|
Neddermann, P.,
Gallinari, P.,
Lettieri, T.,
Schmid, D.,
Truong, O.,
Hsuan, J. J.,
Wiebauer, K.,
and Jiricny, J.
(1996)
J. Biol. Chem.
271,
12767-12774
|
| 43.
|
Voorhees, P.,
Deignan, E.,
van Donselaar, E.,
Humphrey, J.,
Marks, M. S.,
Peters, P. J.,
and Bonifacino, J. S.
(1995)
EMBO J.
14,
4961-4975
|
| 44.
|
Million, K.,
Larcher, J.,
Laoukili, J.,
Bourguinon, D.,
Marano, F.,
and Tournier, F.
(1999)
J. Cell Sci.
112,
4357-4366
|
| 45.
|
Sternsdorf, T.,
Jensen, K.,
Reich, B.,
and Will, H.
(1999)
J. Biol. Chem.
274,
12555-12566
|
| 46.
|
Lee, C.-W.,
and La Thangue, N. B.
(1999)
Oncogene
18,
4171-4181
|
| 47.
|
Susuki, T.,
Ichiyama, A.,
Saitoh, H.,
Kawakami, T.,
Omata, M.,
Chung, C. H.,
Kimura, M.,
Shimbara, N.,
and Tanaka, K.
(1999)
J. Biol. Chem.
274,
31131-31134
|
| 48.
|
Saitoh, H.,
and Hinchey, J.
(2000)
J. Biol. Chem.
275,
6252-6258
|
| 49.
|
Yang, A.,
Kaghad, M.,
Wang, Y.,
Gillett, E.,
Fleming, M. D.,
Dotsch, V.,
Andrews, N. C.,
Caput, D.,
and McKeon, F.
(1998)
Mol. Cell
2,
305-316
|
| 50.
|
Buschmann, T.,
Fuchs, S. Y.,
Lee, C.-G.,
Pan, Z.-Q.,
and Ronai, Z.
(2000)
Cell
101,
753-762
|
| 51.
|
Everett, R. D.,
Freemont, P.,
Saitoh, H.,
Dasso, M.,
Orr, A.,
Kathoria, M.,
and Parkinson, J.
(1998)
J. Virol.
72,
6581-6591
|
| 52.
|
Chelbi-Alix, M. K.,
and de Thé, H.
(1999)
Oncogene
18,
935-941
|
| 53.
|
Gong, L.,
Millas, S.,
Maul, G. G.,
and Yeh, E. T. H.
(2000)
J. Biol. Chem.
275,
3355-3359
|
| 54.
|
Lain, S.,
Midgley, C.,
Sparks, A.,
Lane, E. B.,
and Lane, D. P.
(1999)
Exp. Cell Res.
248,
457-472
|
| 55.
|
De Laurenzi, V.,
Costanzo, A.,
Barcaroli, D.,
Terrinoni, A.,
Falco, M.,
Annicchiarico-Petruzzelli, M.,
Levrero, M.,
and Melino, G.
(1998)
J. Exp. Med.
188,
1763-1768
|
| 56.
|
Ueda, Y.,
Hijikata, M .,
Takagi, S.,
Chiba, T.,
and Shimotohno, K.
(1999)
Oncogene
18,
4993-4998
|
| 57.
|
Ozaki, T.,
Naka, M.,
Takada, N.,
Tada, M.,
Sakiyama, S.,
and Nakagawara, A.
(1999)
Cancer Res.
59,
5902-5907
|
| 58.
|
Meggio, F.,
Marin, O.,
and Pinna, L. A.
(1994)
Cell. Mol. Biol. Res.
40,
401-409
|
| 59.
|
Matunis, M. J.,
Wu, J.,
and Blobel, G.
(1998)
J. Cell Biol.
140,
499-509
|
| 60.
|
Hofmann, H.,
Floss, S.,
and Stamminger, T.
(2000)
J. Virol.
74,
2510-2524
|
| 61.
|
Trost, M.,
Kochs, G.,
and Haller, O.
(2000)
J. Biol. Chem.
275,
7373-7377
|
| 62.
|
Kim, Y. H.,
Choi, C. Y.,
Lee, S.-J.,
Conti, M. A.,
and Kim, Y.
(1998)
J. Biol. Chem.
273,
25875-25879
|
| 63.
|
Kim, Y. H.,
Choi, C. Y.,
and Kim, Y.
(1999)
Proc. Natl. Acad. Sci. U. S. A.
96,
12350-12355
|
| 64.
|
Moilanen, A.-M.,
Karvonen, U.,
Poukka, H.,
Yan, W.,
Toppari, J.,
Janne, O. A.,
and Palvimo, J. J.
(1999)
J. Biol. Chem.
274,
3700-3704
|
| 65.
|
Wu, L.,
Wu, H.,
Sangiorgi, F.,
Wu, N.,
Bell, J. R.,
Lyons, G. E.,
and Maxson, R.
(1997)
Mechanisms Dev.
65,
3-17
|
| 66.
|
Zhong, S.,
Salomoni, P.,
and Pandolfi, P. P.
(2000)
Nat. Cell Biol.
2,
E85-E95
|
| 67.
|
Tong, J. K.,
Hassig, C. A.,
Schnitzler, G. R.,
Kingston, R. E.,
and Schreiber, S. L.
(1998)
Nature
395,
917-921
|
| 68.
|
Murphy, M.,
Ahn, J.,
Walker, K. K.,
Hoffman, W. H.,
Evans, R. M.,
Levine, A. J.,
and George, D. L.
(1999)
Genes Dev.
13,
2490-2501
|
| 69.
|
Koipally, J.,
Renold, A.,
Kim, J.,
and Georgopoulos, K.
(1999)
EMBO J.
18,
3090-3100
|
| 70.
|
Kim, J.,
Sif, S.,
Jones, B.,
Jackson, A.,
Koipally, J.,
Heller, E.,
Winandy, S.,
Viel, A.,
Sawyer, A.,
Ikeda, T.,
Kingston, R.,
and Georgopoulos, K.
(1999)
Immunity
10,
345-355
|
| 71.
|
Choi, C. Y.,
Kim, Y. H.,
Kwon, H. J.,
and Kim, Y.
(1999)
J. Biol. Chem.
274,
33194-33197
|
| 72.
|
Poukka, H.,
Arnisalo, P.,
Karvonen, U.,
Palvimo, J. J.,
and Janne, O. A.
(1999)
J. Biol. Chem.
274,
19441-19446
|
| 73.
|
Gottlicher, M.,
Heck, S.,
Doucas, V.,
Wade, E.,
Kullmann, M.,
Cato, A. C.,
Evans, R. M.,
and Herrlich, P.
(1996)
Steroids
61,
257-262
|
| 74.
|
Xu, L.,
Glass, C. K.,
and Rosenfeld, M. G.
(1999)
Curr. Opin. Genet. Dev.
9,
140-147
|
| 75.
|
Um, S.,
Harbers, M.,
Beneke, A.,
Pierrat, B.,
Losson, R.,
and Chambon, P.
(1998)
J. Biol. Chem.
273,
20728-20736
|
| 76.
|
Lehembre, F.,
Badenhorst, P.,
Muller, S.,
Travers, A.,
Schweisguth, F.,
and Dejean, A.
(2000)
Mol. Cell Biol.
20,
1072-1082
|
| 77.
|
Yang, A.,
Schweitzer, R.,
Sun, D.,
Kaghad, M.,
Walker, N.,
Bronson, R. T.,
Tabin, C.,
Sharpe, A.,
Caput, D.,
Crum, C.,
and McKeon, F.
(1999)
Nature
398,
714-718
|
| 78.
|
Vikhanskaya, F.,
D'Incalci, M.,
and Broggini, M.
(2000)
Nucleic Acids Res.
28,
513-519
|
| 79.
|
De Laurenzi, V.,
Raschella, G.,
Baracoli, D.,
Annicchiarico-Petruzzelli, M.,
Ranalli, M.,
Catani, M. V.,
Tanno, B.,
Costanzo, A.,
Levero, M.,
and Melino, G.
(2000)
J. Biol. Chem.
275,
15226-15231
|
| 80.
|
Pozniak, C. D.,
Radinovic, S.,
Yang, A.,
McKeon, F.,
Kaplan, D. R.,
and Miller, F. D.
(2000)
Science
289,
304-306
|
| 81.
|
de Thé, H.,
Lavau, C.,
Marchio, A.,
Chomienne, C.,
Degos, L.,
and Dejean, A.
(1991)
Cell
66,
675-684
|
Copyright © 2000 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
W.S. Layman, D.P. McEwen, L.A. Beyer, S.R. Lalani, S.D. Fernbach, E. Oh, A. Swaroop, C.C. Hegg, Y. Raphael, J.R. Martens, et al.
Defects in neural stem cell proliferation and olfaction in Chd7 deficient mice indicate a mechanism for hyposmia in human CHARGE syndrome
Hum. Mol. Genet.,
June 1, 2009;
18(11):
1909 - 1923.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Z. Wang and G. Prelich
Quality Control of a Transcriptional Regulator by SUMO-Targeted Degradation
Mol. Cell. Biol.,
April 1, 2009;
29(7):
1694 - 1706.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Miura, J. Lee, J. B. Jin, C. Y. Yoo, T. Miura, and P. M. Hasegawa
Sumoylation of ABI5 by the Arabidopsis SUMO E3 ligase SIZ1 negatively regulates abscisic acid signaling
PNAS,
March 31, 2009;
106(13):
5418 - 5423.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Zhu, S. Zhu, C. M. Guzzo, N. A. Ellis, K. S. Sung, C. Y. Choi, and M. J. Matunis
Small Ubiquitin-related Modifier (SUMO) Binding Determines Substrate Recognition and Paralog-selective SUMO Modification
J. Biol. Chem.,
October 24, 2008;
283(43):
29405 - 29415.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Tozluoglu, E. Karaca, T. Haliloglu, and R. Nussinov
Cataloging and organizing p73 interactions in cell cycle arrest and apoptosis
Nucleic Acids Res.,
September 1, 2008;
36(15):
5033 - 5049.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Kuwata and T. Nakamura
BCL11A is a SUMOylated protein and recruits SUMO-conjugation enzymes in its nuclear body
Genes Cells,
September 1, 2008;
13(9):
931 - 940.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Badawi, Y. V. Reddy, Z. Agharbaoui, Y. Tominaga, J. Danyluk, F. Sarhan, and M. Houde
Structure and Functional Analysis of Wheat ICE (Inducer of CBF Expression) Genes
Plant Cell Physiol.,
August 1, 2008;
49(8):
1237 - 1249.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. Mauri, L. M. McNamee, A. Lunardi, F. Chiacchiera, G. Del Sal, M. H. Brodsky, and L. Collavin
Modification of Drosophila p53 by SUMO Modulates Its Transactivation and Pro-apoptotic Functions
J. Biol. Chem.,
July 25, 2008;
283(30):
20848 - 20856.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J.-A. T. Tan, Y. Sun, J. Song, Y. Chen, T. G. Krontiris, and L. K. Durrin
SUMO Conjugation to the Matrix Attachment Region-binding Protein, Special AT-rich Sequence-binding Protein-1 (SATB1), Targets SATB1 to Promyelocytic Nuclear Bodies Where It Undergoes Caspase Cleavage
J. Biol. Chem.,
June 27, 2008;
283(26):
18124 - 18134.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. A. Park, Y.-J. Seok, G. Jeong, and J.-S. Lee
SUMO1 negatively regulates BRCA1-mediated transcription, via modulation of promoter occupancy
Nucleic Acids Res.,
January 17, 2008;
36(1):
263 - 283.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Siatecka, L. Xue, and J. J. Bieker
Sumoylation of EKLF Promotes Transcriptional Repression and Is Involved in Inhibition of Megakaryopoiesis
Mol. Cell. Biol.,
December 15, 2007;
27(24):
8547 - 8560.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Uzunova, K. Gottsche, M. Miteva, S. R. Weisshaar, C. Glanemann, M. Schnellhardt, M. Niessen, H. Scheel, K. Hofmann, E. S. Johnson, et al.
Ubiquitin-dependent Proteolytic Control of SUMO Conjugates
J. Biol. Chem.,
November 23, 2007;
282(47):
34167 - 34175.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. E. Sillibourne, B. Delaval, S. Redick, M. Sinha, and S. J. Doxsey
Chromatin Remodeling Proteins Interact with Pericentrin to Regulate Centrosome Integrity
Mol. Biol. Cell,
September 1, 2007;
18(9):
3667 - 3680.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Z. Deng, M. Wan, and G. Sui
PIASy-Mediated Sumoylation of Yin Yang 1 Depends on Their Interaction but Not the RING Finger
Mol. Cell. Biol.,
May 15, 2007;
27(10):
3780 - 3792.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Miura, J. B. Jin, J. Lee, C. Y. Yoo, V. Stirm, T. Miura, E. N. Ashworth, R. A. Bressan, D.-J. Yun, and P. M. Hasegawa
SIZ1-Mediated Sumoylation of ICE1 Controls CBF3/DREB1A Expression and Freezing Tolerance in Arabidopsis
PLANT CELL,
April 1, 2007;
19(4):
1403 - 1414.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. L. H. Miller, E. L. Scappini, and J. O'Bryan
Ubiquitin-interacting Motifs Inhibit Aggregation of PolyQ-expanded Huntingtin
J. Biol. Chem.,
March 30, 2007;
282(13):
10096 - 10103.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. D. Benson, Q.-J. Li, K. Kieckhafer, D. Dudek, M. R. Whorton, R. K. Sunahara, J. A. Iniguez-Lluhi, and J. R. Martens
SUMO modification regulates inactivation of the voltage-gated potassium channel Kv1.5
PNAS,
February 6, 2007;
104(6):
1805 - 1810.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. D. Raffa, J. Wohlschlegel, J. R. Yates III, and M. N. Boddy
SUMO-binding Motifs Mediate the Rad60-dependent Response to Replicative Stress and Self-association
J. Biol. Chem.,
September 22, 2006;
281(38):
27973 - 27981.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Uchimura, T. Ichimura, J. Uwada, T. Tachibana, S. Sugahara, M. Nakao, and H. Saitoh
Involvement of SUMO Modification in MBD1- and MCAF1-mediated Heterochromatin Formation
J. Biol. Chem.,
August 11, 2006;
281(32):
23180 - 23190.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C.-M. Hecker, M. Rabiller, K. Haglund, P. Bayer, and I. Dikic
Specification of SUMO1- and SUMO2-interacting Motifs
J. Biol. Chem.,
June 9, 2006;
281(23):
16117 - 16127.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Yueh, J. Leung, S. Bhattacharyya, L. A. Perrone, K. de los Santos, S.-y. Pu, and S. P. Goff
Interaction of Moloney Murine Leukemia Virus Capsid with Ubc9 and PIASy Mediates SUMO-1 Addition Required Early in Infection
J. Virol.,
January 1, 2006;
80(1):
342 - 352.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Song, Z. Zhang, W. Hu, and Y. Chen
Small Ubiquitin-like Modifier (SUMO) Recognition of a SUMO Binding Motif: A REVERSAL OF THE BOUND ORIENTATION
J. Biol. Chem.,
December 2, 2005;
280(48):
40122 - 40129.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Cui, T. T. Nguyen, J. H. Taube, S. A. Stratton, M. H. Feuerman, and M. C. Barton
Family Members p53 and p73 Act Together in Chromatin Modification and Direct Repression of {alpha}-Fetoprotein Transcription
J. Biol. Chem.,
November 25, 2005;
280(47):
39152 - 39160.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Takahashi and Y. Kikuchi
Yeast PIAS-type Ull1/Siz1 Is Composed of SUMO Ligase and Regulatory Domains
J. Biol. Chem.,
October 28, 2005;
280(43):
35822 - 35828.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
U. Nyman, A. Sobczak-Pluta, P. Vlachos, T. Perlmann, B. Zhivotovsky, and B. Joseph
Full-length p73{alpha} Represses Drug-induced Apoptosis in Small Cell Lung Carcinoma Cells
J. Biol. Chem.,
October 7, 2005;
280(40):
34159 - 34169.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Amini, G. Mameli, L. Del Valle, A. Skowronska, K. Reiss, B. B. Gelman, M. K. White, K. Khalili, and B. E. Sawaya
p73 Interacts with Human Immunodeficiency Virus Type 1 Tat in Astrocytic Cells and Prevents Its Acetylation on Lysine 28
Mol. Cell. Biol.,
September 15, 2005;
25(18):
8126 - 8138.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Miura, A. Rus, A. Sharkhuu, S. Yokoi, A. S. Karthikeyan, K. G. Raghothama, D. Baek, Y. D. Koo, J. B. Jin, R. A. Bressan, et al.
The Arabidopsis SUMO E3 ligase SIZ1 controls phosphate deficiency responses
PNAS,
May 24, 2005;
102(21):
7760 - 7765.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. Liu and X. Chen
The C-terminal Sterile {alpha} Motif and the Extreme C Terminus Regulate the Transcriptional Activity of the {alpha} Isoform of p73
J. Biol. Chem.,
May 20, 2005;
280(20):
20111 - 20119.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Takahashi, S. Hatakeyama, H. Saitoh, and K. I. Nakayama
Noncovalent SUMO-1 Binding Activity of Thymine DNA Glycosylase (TDG) Is Required for Its SUMO-1 Modification and Colocalization with the Promyelocytic Leukemia Protein
J. Biol. Chem.,
February 18, 2005;
280(7):
5611 - 5621.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. T. Hannich, A. Lewis, M. B. Kroetz, S.-J. Li, H. Heide, A. Emili, and M. Hochstrasser
Defining the SUMO-modified Proteome by Multiple Approaches in Saccharomyces cerevisiae
J. Biol. Chem.,
February 11, 2005;
280(6):
4102 - 4110.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C.-Y. Li, J. Zhu, and J. Y. J. Wang
Ectopic Expression of p73{alpha}, but Not p73{beta}, Suppresses Myogenic Differentiation
J. Biol. Chem.,
January 21, 2005;
280(3):
2159 - 2164.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Gurer, L. Berthoux, and J. Luban
Covalent Modification of Human Immunodeficiency Virus Type 1 p6 by SUMO-1
J. Virol.,
January 15, 2005;
79(2):
910 - 917.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. Munarriz, D. Barcaroli, A. Stephanou, P. A. Townsend, C. Maisse, A. Terrinoni, M. H. Neale, S. J. Martin, D. S. Latchman, R. A. Knight, et al.
PIAS-1 Is a Checkpoint Regulator Which Affects Exit from G1 and G2 by Sumoylation of p73
Mol. Cell. Biol.,
December 15, 2004;
24(24):
10593 - 10610.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. I. Aqeilan, A. Palamarchuk, R. J. Weigel, J. J. Herrero, Y. Pekarsky, and C. M. Croce
Physical and Functional Interactions between the Wwox Tumor Suppressor Protein and the AP-2{gamma} Transcription Factor
Cancer Res.,
November 15, 2004;
64(22):
8256 - 8261.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Song, L. K. Durrin, T. A. Wilkinson, T. G. Krontiris, and Y. Chen
Identification of a SUMO-binding motif that recognizes SUMO-modified proteins
PNAS,
October 5, 2004;
101(40):
14373 - 14378.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. Gill
SUMO and ubiquitin in the nucleus: different functions, similar mechanisms?
Genes & Dev.,
September 1, 2004;
18(17):
2046 - 2059.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
U. M. Moll and N. Slade
p63 and p73: Roles in Development and Tumor Formation
Mol. Cancer Res.,
July 1, 2004;
2(7):
371 - 386.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. Bernassola, P. Salomoni, A. Oberst, C. J. Di Como, M. Pagano, G. Melino, and P. P. Pandolfi
Ubiquitin-dependent Degradation of p73 Is Inhibited by PML
J. Exp. Med.,
June 7, 2004;
199(11):
1545 - 1557.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. Kadare, M. Toutant, E. Formstecher, J.-C. Corvol, M. Carnaud, M.-C. Boutterin, and J.-A. Girault
PIAS1-mediated Sumoylation of Focal Adhesion Kinase Activates Its Autophosphorylationn
J. Biol. Chem.,
November 28, 2003;
278(48):
47434 - 47440.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Gonzalez, C. Prives, and C. Cordon-Cardo
p73{alpha} Regulation by Chk1 in Response to DNA Damage
Mol. Cell. Biol.,
November 15, 2003;
23(22):
8161 - 8171.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Watanabe, T. Ichimura, N. Fujita, S. Tsuruzoe, I. Ohki, M. Shirakawa, M. Kawasuji, and M. Nakao
Methylated DNA-binding domain 1 and methylpurine-DNA glycosylase link transcriptional repression and DNA repair in chromatin
PNAS,
October 28, 2003;
100(22):
12859 - 12864.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Ben-Yehoyada, I. Ben-Dor, and Y. Shaul
c-Abl Tyrosine Kinase Selectively Regulates p73 Nuclear Matrix Association
J. Biol. Chem.,
September 5, 2003;
278(36):
34475 - 34482.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. K. C. Tsai and Z.-M. Yuan
c-Abl Stabilizes p73 by a Phosphorylation-augmented Interaction
Cancer Res.,
June 15, 2003;
63(12):
3418 - 3424.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Hirano, S. Murata, K. Tanaka, M. Shimizu, and R. Sato
Sterol Regulatory Element-binding Proteins Are Negatively Regulated through SUMO-1 Modification Independent of the Ubiquitin/26 S Proteasome Pathway
J. Biol. Chem.,
May 2, 2003;
278(19):
16809 - 16819.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. M. Comerford, M. O. Leonard, J. Karhausen, R. Carey, S. P. Colgan, and C. T. Taylor
Small ubiquitin-related modifier-1 modification mediates resolution of CREB-dependent responses to hypoxia
PNAS,
February 4, 2003;
100(3):
986 - 991.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. J. Baker
Small Unstable Apoptotic Protein, an Apoptosis-associated Protein, Suppresses Proliferation of Myeloid Cells
Cancer Res.,
February 1, 2003;
63(3):
705 - 712.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Z. Serber, H. C. Lai, A. Yang, H. D. Ou, M. S. Sigal, A. E. Kelly, B. D. Darimont, P. H. G. Duijf, H. van Bokhoven, F. McKeon, et al.
A C-Terminal Inhibitory Domain Controls the Activity of p63 by an Intramolecular Mechanism
Mol. Cell. Biol.,
December 15, 2002;
22(24):
8601 - 8611.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Tojo, K. Matsuzaki, T. Minami, Y. Honda, H. Yasuda, T. Chiba, H. Saya, Y. Fujii-Kuriyama, and M. Nakao
The Aryl Hydrocarbon Receptor Nuclear Transporter Is Modulated by the SUMO-1 Conjugation System
J. Biol. Chem.,
November 22, 2002;
277(48):
46576 - 46585.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. Rallabhandi, K. Hashimoto, Y.-Y. Mo, W. T. Beck, P. K. Moitra, and P. D'Arpa
Sumoylation of Topoisomerase I Is Involved in Its Partitioning between Nucleoli and Nucleoplasm and Its Clearing from Nucleoli in Response to Camptothecin
J. Biol. Chem.,
October 11, 2002;
277(42):
40020 - 40026.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Le Drean, N. Mincheneau, P. Le Goff, and D. Michel
Potentiation of Glucocorticoid Receptor Transcriptional Activity by Sumoylation
Endocrinology,
September 1, 2002;
143(9):
3482 - 3489.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E.-J. Kim, J.-S. Park, and S.-J. Um
Identification and Characterization of HIPK2 Interacting with p73 and Modulating Functions of the p53 Family in Vivo
J. Biol. Chem.,
August 23, 2002;
277(35):
32020 - 32028.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. J. Eloranta and H. C. Hurst
Transcription Factor AP-2 Interacts with the SUMO-conjugating Enzyme UBC9 and Is Sumolated in Vivo
J. Biol. Chem.,
August 16, 2002;
277(34):
30798 - 30804.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Allart, H. Martin, C. Detraves, J. Terrasson, D. Caput, and C. Davrinche
Human Cytomegalovirus Induces Drug Resistance and Alteration of Programmed Cell Death by Accumulation of Delta N-p73alpha
J. Biol. Chem.,
August 2, 2002;
277(32):
29063 - 29068.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Kotaja, U. Karvonen, O. A. Janne, and J. J. Palvimo
PIAS Proteins Modulate Transcription Factors by Functioning as SUMO-1 Ligases
Mol. Cell. Biol.,
July 15, 2002;
22(14):
5222 - 5234.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K.-i. Watanabe, T. Ozaki, T. Nakagawa, K. Miyazaki, M. Takahashi, M. Hosoda, S. Hayashi, S. Todo, and A. Nakagawara
Physical Interaction of p73 with c-Myc and MM1, a c-Myc-binding Protein, and Modulation of the p73 Function
J. Biol. Chem.,
April 19, 2002;
277(17):
15113 - 15123.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. Schmidt and S. Muller
Members of the PIAS family act as SUMO ligases for c-Jun and p53 and repress p53 activity
PNAS,
February 20, 2002;
(2002)
52559499.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Douc-Rasy, M. Barrois, M. Echeynne, M. Kaghad, E. Blanc, G. Raguenez, D. Goldschneider, M.-J. Terrier-Lacombe, O. Hartmann, U. Moll, et al.
{Delta}N-p73{alpha} Accumulates in Human Neuroblastic Tumors
Am. J. Pathol.,
February 1, 2002;
160(2):
631 - 639.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Sachdev, L. Bruhn, H. Sieber, A. Pichler, F. Melchior, and R. Grosschedl
PIASy, a nuclear matrix-associated SUMO E3 ligase, represses LEF1 activity by sequestration into nuclear bodies
Genes & Dev.,
December 1, 2001;
15(23):
3088 - 3103.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. S. Irwin and W. G. Kaelin
p53 Family Update: p73 and p63 Develop Their Own Identities
Cell Growth Differ.,
July 1, 2001;
12(7):
337 - 349.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. L. Kurtzman and N. Schechter
Ubc9 interacts with a nuclear localization signal and mediates nuclear localization of the paired-like homeobox protein Vsx-1 independent of SUMO-1 modification
PNAS,
April 25, 2001;
(2001)
101129698.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
J.-H. Ahn, Y. Xu, W.-J. Jang, M. J. Matunis, and G. S. Hayward
Evaluation of Interactions of Human Cytomegalovirus Immediate-Early IE2 Regulatory Protein with Small Ubiquitin-Like Modifiers and Their Conjugation Enzyme Ubc9
J. Virol.,
April 15, 2001;
75(8):
3859 - 3872.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
T. Megidish, J. H. Xu, and C. W. Xu
Activation of p53 by Protein Inhibitor of Activated Stat1 (PIAS1)
J. Biol. Chem.,
March 1, 2002;
277(10):
8255 - 8259.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Strano, E. Munarriz, M. Rossi, L. Castagnoli, Y. Shaul, A. Sacchi, M. Oren, M. Sudol, G. Cesareni, and G. Blandino
Physical Interaction with Yes-associated Protein Enhances p73 Transcriptional Activity
J. Biol. Chem.,
April 27, 2001;
276(18):
15164 - 15173.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Buschmann, D. Lerner, C.-G. Lee, and Z.'e. Ronai
The Mdm-2 Amino Terminus Is Required for Mdm2 Binding and SUMO-1 Conjugation by the E2 SUMO-1 Conjugating Enzyme Ubc9
J. Biol. Chem.,
October 26, 2001;
276(44):
40389 - 40395.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Missero, M. T. Pirro, S. Simeone, M. Pischetola, and R. Di Lauro
The DNA Glycosylase T:G Mismatch-specific Thymine DNA Glycosylase Represses Thyroid Transcription Factor-1-activated Transcription
J. Biol. Chem.,
August 31, 2001;
276(36):
33569 - 33575.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. Schmidt and S. Muller
Members of the PIAS family act as SUMO ligases for c-Jun and p53 and repress p53 activity
PNAS,
March 5, 2002;
99(5):
2872 - 2877.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. L. Kurtzman and N. Schechter
Ubc9 interacts with a nuclear localization signal and mediates nuclear localization of the paired-like homeobox protein Vsx-1 independent of SUMO-1 modification
PNAS,
May 8, 2001;
98(10):
5602 - 5607.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 2000 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|