Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Originally published In Press as doi:10.1074/jbc.M004293200 on August 28, 2000

J. Biol. Chem., Vol. 275, Issue 46, 36316-36323, November 17, 2000
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
275/46/36316    most recent
M004293200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Minty, A.
Right arrow Articles by Caput, D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Minty, A.
Right arrow Articles by Caput, D.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Covalent Modification of p73alpha by SUMO-1

TWO-HYBRID SCREENING WITH p73 IDENTIFIES NOVEL SUMO-1-INTERACTING PROTEINS AND A SUMO-1 INTERACTION MOTIF*

Adrian MintyDagger, Xavier Dumont, Mourad Kaghad, and Daniel Caput

From the Molecular and Functional Genomics Department, Sanofi-Synthélabo Recherche, 31676 Labège, France

Received for publication, May 18, 2000, and in revised form, August 16, 2000


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Two-hybrid screening in yeast with p73alpha isolated SUMO-1 (small ubiquitin-like modifier 1), the enzyme responsible for its conjugation, Ubc-9, and a number of novel SUMO-1-interacting proteins, including thymine DNA glycosylase, PM-Scl75, PIASx, PKY, and CHD3/ZFH. A subset of these proteins contain a common motif, hhXSXS/Taaa, where h is a hydrophobic amino acid and a is an acidic amino acid, that is shown to interact with SUMO-1 in the two-hybrid system. We show here that p73alpha , but not p73beta , can be covalently modified by SUMO-1. The major SUMO-1-modified residue in p73alpha is the C-terminal lysine (Lys627). The sequence surrounding this lysine conforms to a consensus SUMO-1 modification site b(X)XXhKXE, where b is a basic amino acid. SUMO-1-modified p73 is more rapidly degraded by the proteasome than unmodified p73, although SUMO-1 modification is not required for p73 degradation. SUMO-1 modification does not affect the transcriptional activity of p73alpha on an RGC-luciferase reporter gene in SK-N-AS cells. Instead, SUMO-1 modification may alter the subcellular localization of p73, because SUMO-1-modified p73 is preferentially found in detergent-insoluble fractions. Alternatively, it may modulate the interaction of p73 with other proteins that are substrates for SUMO-1 modification or which interact with SUMO-1, such as those identified here.


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Covalent modification of proteins is widely used as a way of modifying their stability, activity, or localization. Examples of this are phosphorylation, acetylation, lipid modification, or glycosylation. Modification by covalent linkage to a second "tagging" protein was first observed with ubiquitin, a 76-amino acid polypeptide that is covalently linked to lysine residues in an acceptor protein by an enzymatic system involving two to three ubiquitin-activating and -conjugating enzymes (E1, E2, and E3).1 Subsequent poly-ubiquitination usually signals the modified protein for degradation by the proteasome (1). Alternate outcomes for ubiquitinated proteins are activation or transport via an intracellular membrane vesicular system (2).

It has now become apparent that several other "ubiquitin-like" tagging molecules exist that are conjugated using enzymatic systems similar but nonidentical to those used by ubiquitin (3, 4). Two groups initially determined the nature of a modification of the Ran GTPase-activating protein (RanGAP1) involved in the interaction of this protein with RanBP2/Nup358 at the nuclear pore complex (5, 6). They called the modifying molecule GMP1 (GAP-modifying protein 1) or SUMO-1 (small ubiquitin-like modifier 1). SUMO-1 has since been identified several times as an interacting partner in the yeast two-hybrid system and given different names: with the promyelocytic leukemia gene product (PML) (PIC-1) (7), with the death domain of the FAS antigen or TNF-receptor (sentrin, DAP-1) (8, 9), and with the RAD51 and RAD52 proteins involved in DNA recombination and repair (UBL-1) (10).

A budding yeast homologue of SUMO-1 (Smt3p) was identified by Meluh and Koshland (11) as a suppressor of mutations in Mif2 (mitotic instability factor 2), a protein thought to be the yeast equivalent of the CENP-C mammalian centromere protein. One putative role for SUMO-1/Smt3p is thus in assembly or maintenance of the centromere/kinetochore structure involved in chromosome segregation. Similarly, the fission yeast (Schizosaccharomyces pombe) equivalent of Smt3p, Pmt3p, has recently been shown to be involved in chromosomal segregation and the control of telomere length (12).

Enzymes involved in Smt3p/SUMO-1 conjugation have been identified in yeast and mammalian cells (13-15). The SUMO-1-activating enzyme (E1) consists of a heterodimer of the Aos1p/SAE1 and Uba2p/SAE2 proteins that together reconstitute the equivalent of the ubiquitin-activating enzyme Uba1 (13). The SUMO-1-conjugating enzyme (E2) in yeast, mammalian cells, and Xenopus is Ubc9 (14, 15). So far no E3 enzymes have been identified. Ubc9, originally thought to be a ubiquitin-conjugating enzyme, was shown to be essential gene in yeast (16) because temperature-sensitive mutants of Ubc9 arrested in mitosis, as did mutants of a SUMO-1-cleaving protease Ulp1 (17).

In yeast and mammalian cells, there is very little free Smt3p/SUMO-1. Most (>90%) of the SUMO-1 detected on Western analysis of extracts from mammalian cells is conjugated to the RanGAP1 nuclear pore protein (18). Other proteins subject to modification by SUMO-1 are the PML and Sp100 proteins, which form part of the nuclear structures known as PODs (PML oncogenic domains) or nd10s (19). For PML, it has been shown that SUMO-1 modification is essential for its localization in PODs, with free PML being found in the nucleoplasm. Another substrate for SUMO-1 is Ikappa beta alpha (20), an inhibitor of NFkappa beta , which is modified by SUMO-1 on the lysine residue also modified by ubiquitin. SUMO-1 modification prevents ubiquitination and thus results in stabilization of Ikappa beta alpha and consequently in inhibition of NF-kappa beta (20).

In the present communication, we describe SUMO-1 modification of the p53-related p73alpha protein. p53 is the most widely studied tumor suppressor and is mutated in over 50% of human tumors (21). It plays a key role in both the regulation of cell cycle checkpoints and the initiation of apoptotic cell death in response to DNA damage. The activity of p53 has been shown to be finely tuned by a variety of post-translational modifications (phosphorylation, acetylation, and glycosylation) and to be highly sensitive to conformational changes (22). The p53 molecule contains a number of well defined domains including an N-terminal transcriptional activation domain and a central core, corresponding to the DNA-binding domain, which is highly conserved in evolution and which contains the majority of the mutation hot spots in cancer cells. The rest of the molecule contains a linker region including the major nuclearization signal, an oligomerization domain, and a regulatory C-terminal region containing multiple phosphorylation and acetylation sites (21, 22). Recently, this region has been shown to contain a lysine residue (386) that can be covalently modified by SUMO-1 (23, 24).

We previously reported the existence of a p53-related gene, p73, mapping to a chromosomal locus (1p36.3) often deleted in neuroectodermal human cancers such as neuroblastomas (24). Subsequent work from several laboratories has described the existence of another p53 family member, more closely related to p73 than to p53, variously described as p63, KET, and p51 (25). p73 shows structural similarities with p53, including the presence of transcription-activating, DNA-binding, and oligomerization domains. It exists as multiple isoforms, resulting from differential splicing of C-terminal exons, of which the two major forms are the alpha  and beta  isoforms containing 636 and 499 amino acids (25, 26). p73 differs from p53 in that its levels of expression are not elevated in response to environmental stresses such as UV irradiation and actinomycin D treatment (25). However, in interaction with the protein kinase c-Abl it mediates an apoptotic response to ionizing radiation and to genotoxic agents such as cisplatin (27).

In contrast to p53, no functionally significant p73 mutations have so far been reported in cancer cells, but a monoallelic pattern of expression is sometimes observed (26). Analysis of p73 knock-out mice does not show an increased susceptibility to spontaneous tumorigenesis (28). However, these studies reveal that p73 plays key roles in a number of developmental processes that are nonoverlapping with the roles played by other p53 family members (28). The activities of p73 may be exerted at multiple levels. Firstly, p73 is a transcriptional activator eliciting a response different from that obtained with p53 (29). Secondly, the major form of p73 is often an N-terminally truncated form that would be incapable of transcriptional activation (28), suggesting the possibility of other nontranscriptional roles for p73.

During yeast two-hybrid screens using p73 as a bait, we isolated the cDNA for SUMO-1. Here we show that p73 can be covalently modified by SUMO-1, with the major modification occurring on the terminal lysine residue. A number of other SUMO-1-interacting proteins were isolated in the p73 two-hybrid screening, and we have been able to deduce and confirm a novel SUMO-1 interaction motif. The nature of the proteins identified here suggests that one role for SUMO-1 may be in transcriptional regulation, perhaps co-ordinating this with other key cellular processes such as cell cycle checkpoints, chromosome segregation, DNA recombination and repair, and the induction of apoptosis.

    EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Cell Lines and Culture-- The SK-N-AS neuroblastoma cell line (30) and the 293 embryonic kidney cell line (American Type Culture Collection CRL 1573) were grown in Dulbecco's modified Eagle's medium (Life Technologies, Inc.) containing 1 mM sodium pyruvate and 10% fetal calf serum. The U937 monocytic cell line (American Type Culture Collection CRL 1593) was grown in RPMI (Life Technologies, Inc.) containing 10% fetal calf serum.

RNA Preparation and cDNA Library Construction-- Total cellular RNA was extracted from SK-N-AS and U937 cells by the guaninidium thiocyanate/acid phenol method (31). Poly(A)+ RNAs were isolated using oligo(dT) magnetic beads (Dynal). 1 µg of each poly(A)+ RNA was transcribed into cDNA using reverse transcriptase (Superscript, Life Technologies, Inc.) and the primer GATCCGGGCCCATTTTCTAC[ACGT][ACGT][ACGT][ACGT][ACGT][ACGT]. cDNAs were fractionated on Sephacryl S400 (Amersham Pharmacia Biotech), and fractions containing cDNA of approximately 500-1500 nucleotides were selected for cloning in the pJGC cloning vector, derived from the pJG4-5 activation domain vector (32) by insertion of a polylinker containing ApaI and BamHI cloning sites between the EcoRI and HindIII sites. cDNA libraries were constructed by the primer adapter method (33).

Bait Plasmid Construction and Two-hybrid Screening of cDNA Libraries-- Sequences corresponding to p73alpha (amino acids 85-636), p73beta (amino acids 85-499), and p53 (amino acids 73-393) were inserted in the pEG202 vector between either the EcoRI or BamHI sites and the XhoI site (32) creating fusion proteins with the LexA DNA-binding domain. The pEG202.p73alpha bait was introduced using lithium acetate/polyethylene glycol transformation with sheared single-stranded DNA carrier (34) into the EGY48 strain of Saccharomyces cerevisiae (containing the LEU2 gene under the control of six LexA operators) along with a reporter plasmid pSH18-34 containing the LacZ gene under the control of eight LexA operators. cDNA libraries were then similarly introduced, and yeast colonies were selected on Yeast Nitrogen Base (Difco) medium containing 2% glucose and leucine (but lacking tryptophan, histidine, and uracil). Approximately 106 transformed yeast were obtained with the U937 library and 2 × 106 transformed yeast with the SK-N-AS library. After 3-4 days, colonies were replicated to nitrocelulose filters (Protran BA85; Schleicher & Schull), replated on dishes containing 2% galactose, 1% raffinose, 1 mg/ml 5-bromo-4-chloro-3-indolyl beta -D-galactopyranoside (X-gal) (Life Technologies, Inc.) lacking leucine, and grown for 4-5 days. 20 yeast colonies from each cDNA library transformation showing a blue coloration were selected for further study.

Plasmid Identification-- Plasmid DNA was extracted using a glass bead disruption method (35), and cDNA inserts in the pJGC plasmid were amplified by polymerase chain reaction using oligonucleotides flanking the cDNA insert and sequenced. The pJGC plasmid was isolated by selection in the KC8 bacterium in minimal A medium containing vitamin B1 and supplemented with uracil, histidine, and leucine but lacking tryptophan. It was then tested for interaction with the p73alpha , p73beta , and p53 pEG202 bait plasmids by measurements of the beta -galactosidase levels in transformed EGY48 24 h after galactose induction of the GAL1 promoter in pJGC, as described by Kippert (36).

Site-directed Mutagenesis-- Amino acid substitutions were performed by limited polymerase chain reaction amplification of plasmid DNA using Pfu DNA polymerase and oligonucleotides containing the mutated codons, followed by digestion of remaining input plasmid DNA using the methylation sensitive enzyme Dpn1 (QuikChange; Stratagene).

Transient Transfection of Animal Cells-- The p73alpha , p73beta , p53, and SUMO-1 cDNAs were introduced into the pcDNA3 vector (Invitrogen) or an epitope-tagged vector derived from pcDNA3 by insertion of an optimalized ATG codon (CCACCATGGCG) and a c-Myc 9E10 epitope (EQKLISEEDL) between the HindIII and EcoRI sites. Plasmid DNA preparations were performed using the QIAfilter Plasmid Midi Kit (Qiagen). Approximately 106 cells were transfected in six-well dishes using 1-2 µg of plasmid DNA and LipofectAMINE Plus reagents (Life Technologies, Inc.) as described by the manufacturer. Cells were scraped from the dish 20-30 h after transfection, resuspended in denaturing SDS gel buffer (Bio-Rad) with 0.7 M beta -mercaptoethanol and analyzed on SDS-polyacrylamide gels.

Immunoblotting and Antibodies-- Proteins were transferred from polyacrylamide gels to nitrocellulose membranes (Hybond-C-extra; Amersham Pharmacia Biotech). These were analyzed with the following primary antibodies: anti-c-Myc (9E10) (Santa Cruz or Invitrogen), anti-GMP1 (anti-SUMO-1) (Zymed Laboratories Inc.), anti-p73alpha (a rabbit polyclonal antibody: (25)), anti-PCNA (Santa Cruz), and secondary anti-mouse IgG and anti-rabbit IgG coupled to horseradish peroxidase (Transduction Laboratories) and visualized by enhanced chemiluminesence (Amersham Pharmacia Biotech). The anti-p73 antibody was generated against a C-terminal p73alpha () glutathione S-transferase fusion protein (25). p73 forms were quantified by scanning of different film exposures and analysis using BioImage (Kodak) software.

Dual Luciferase Assays-- SK-N-AS cells were transfected in six-well dishes as described above using the RGC firefly luciferase reporter gene (200 ng) and a pRL-CMV Renilla luciferase control (100 ng) (Promega). 20 h after transfection, cells were scraped in 250 µl of Passive Lysis Buffer (Promega) and subjected to two cycles of freeze-thawing. 20 µl of cell extract were analyzed with the Dual Luciferase Reporter Assay system, using a Lumistar luminometer. Luciferase activities of the RGC-luciferase vector were normalized based on the luciferase activities of the co-transfected pRL-CMV, to correct for variations in cell number and/or transfection efficiency between wells.

    RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Two-hybrid Screening with p73alpha Isolates SUMO-1 and SUMO-1-interacting Proteins-- While performing two-hybrid screens using a p73alpha protein sequence fused to the LexA DNA binding domain (32), we isolated cDNAs encoding SUMO-1, Ubc9 (the SUMO-1-conjugating enzyme), and a SUMO-1-activating enzyme SAE2 (15). Both SUMO-1 and Ubc-9 were found to interact with p73alpha and p53 but not with p73beta (Fig. 1A).


View larger version (32K):
[in this window]
[in a new window]
 
Fig. 1.   Interaction of p73alpha , p73beta , p53, and SUMO-1 with proteins encoded by cDNAs isolated in the p73alpha two-hybrid screen. A, Ubc9 (U45328; amino acids 1-143), SUMO-1 (U61937; amino acids 4-101), and p73beta (amino acids 85-499) in the pJGC vector were transformed in the yeast EGY48 along with pSH18-34 and different pEG202 bait proteins (p53, p73alpha , p73beta , and SUMO-1). Interactions were measured by beta -galactosidase levels (36) 24 h after galactose induction of the GAL1 promoter in the pJGC vector and expressed as a percentage of the beta -galactosidase level obtained for the dimerization of p53 (amino acids 73-393) in this system. B, thymine DNA glycosylase (TDG) (42) (U51166) amino acids 127-410; PM-Scl75 (41) (U09215) amino acids 258-361; PIASx (37) (AF077953) amino acids 107-572; PKY (38) (AF004849) amino acids 646-1055 and ZFH/CHD3 (39, 40) (U91543/AF006515) amino acids 1863-2000, were similarly assessed for interactions with p53, p73alpha , p73beta , and SUMO-1.

Surprisingly, most of the other proteins isolated in the p73alpha two-hybrid screen also showed interaction with p73alpha and p53 but not with p73beta (Fig. 1B). These proteins include PIASx (37), PKY (38), CHD3/ZFH (39, 40), PM-Scl75 (41), and thymine DNA glycosylase (42). This suggested that these proteins may have been isolated via interaction with p73 modified by the yeast SUMO-1 equivalent (Smt3p), because higher molecular mass forms of p73 are detected in these yeast (not shown). Indeed, when tested directly with a SUMO-1 bait, all of these proteins gave a positive result (Fig. 1B).

A SUMO-1 Interaction Motif-- When the cDNA sequences of the SUMO-1-interacting proteins were examined for the presence of common sequences, an 11-amino acid motif was detected in a subset of the proteins. This contained a central serine doublet separated by one amino acid (SXS), within which one serine was replaced by threonine in the human PKY cDNA (Fig. 2A). This SXS triplet is flanked on the N-terminal side by predominantly hydrophobic amino acids and on the C-terminal side by acidic amino acids (D/E) (Fig. 2A). This motif is evolutionarily conserved in the PKY and PIAS gene families (Fig. 2A). In view of the subsequent mutagenesis experiments (see below), it is unclear whether the motif in SAE2 that served to derive this consensus would in fact be sufficient on its own to interact with SUMO-1.


View larger version (27K):
[in this window]
[in a new window]
 
Fig. 2.   Identification and testing of a SUMO-1 interaction motif. A, the cDNAs described in Fig. 1 and two other cDNAs also identified in the p73 two-hybrid screen PML-3 (81) (M79464) and the SUMO-1-activating enzyme SAE2 (13) (AF090384) were compared in order to identify potential common motifs. One such motif was identified and found to be evolutionarily conserved. Sequences are from PKY (38), PKM (61), homeodomain-interacting protein kinases (62), PIAS (37), SAE2 (13), PML-3 (81), and PM-Scl75 (41). B, this motif from the PM-Scl75 protein was inserted in the pEG202 vector and tested with SUMO-1 in the pJGC vector in the two-hybrid system. Different amino acids in this motif were substituted with alanine, and the interaction with SUMO-1 was again tested by measuring beta -galactosidase levels. These were normalized to that for the initial interaction of the PM-Scl75 motif. A similar motif from the protein furin (43) was also tested (sequence b).

The motif from the PM-Scl75 protein was used to construct a LexA-SXS motif fusion protein, which showed a very strong interaction with SUMO-1 in the two-hybrid system (equivalent to that of the dimerization of p53/p53 and stronger than the initial PM-Scl75/SUMO-1 interaction). Critical residues were identified by alanine replacement. Such an analysis shows that both serine residues are necessary (Fig. 2B, sequences c and d), as is the one amino acid spacing between these residues; either no or two amino acid spacing destroys SUMO-1 interaction (Fig. 2B, sequences e and f). The acidic C-terminal residues are also crucial. Mutation of E8 or E10 completely destroys SUMO-1 interaction (Fig. 2B, sequences g and i), and mutation of E9 drastically reduces interaction. (Fig. 2B, sequence h). Although expression levels of the different mutants were not tested, it seems unlikely that differential expression of the mutant proteins (corresponding to single amino acid substitutions, additions or deletions) can explain the almost complete loss of the capacity to interact with SUMO-1. The SXS motif resembles one previously identified in the C terminus of the endopeptidase furin, which is implicated in its translocation into the trans Golgi network (43). However, the furin motif, which also has an acidic N terminus, does not interact with SUMO-1 (Fig. 2B, sequence b), indicating the potential importance of the hydrophobic residues (1-4) in the SXS motif.

p73alpha Can Be Covalently Modified by SUMO-1-- We tested whether p73 might be covalently modified with SUMO-1 by co-transfection of SK-N-AS neuroblastoma cells with p73alpha and SUMO-1. In the presence of p73 and SUMO-1, a prominent novel protein species was formed, showing a molecular mass approximately 20 kDa more than p73alpha , both for the full-length and N-terminally truncated forms of p73alpha (Fig. 3, lanes b and d). This corresponds to the apparent molecular size difference for SUMO-1-modified forms of RanGAP1 and PML seen on SDS-polyacrylamide gel electrophoresis (5, 6, 18). A similar high molecular mass endogenous p73 species was observed in cell and tissue extracts, such as those from primary cultures of epithelial cells, isolated from human nasal polyps (a cell extract provided by Dr. F. Tournier, University of Paris VII) (44) (Fig. 3, lane f).


View larger version (63K):
[in this window]
[in a new window]
 
Fig. 3.   Covalent modification of p73 by SUMO-1. Lanes a-e, SK-N-AS neuroblastoma cells were transfected with c-Myc-tagged full-length p73alpha (lanes c and d) and N-terminally deleted p73alpha (amino acids 85-636) (lanes a and b) in the presence (lanes b and d) or absence (lanes a and c) of c-Myc-tagged SUMO-1. Lane e is a control with SUMO-1 alone. Higher molecular mass forms of p73alpha are detected using an anti-c-Myc antibody in the presence of SUMO-1 (lanes b and d). Lane f, a similar high molecular mass form of p73 is seen in total cell extracts from primary cultures of human nasal epithelial cells analyzed with an anti-p73 antibody. Lanes g-j, p73 sequences lacking the N-terminal activation domain (amino acids 1-84) and with differing lengths of C-terminal deletions and an N-terminal c-Myc tag were co-transfected with c-Myc-tagged SUMO-1 into SK-N-AS cells. SUMO-1-modified and unmodified p73 forms were detected using an anti-c-Myc antibody. The major SUMO-1-modified form of p73 is indicated by the double asterisk and minor forms are indicated by a single asterisk.

In addition to the major modified species (Fig. 3, lane h, indicated with **), several minor higher molecular mass species were seen in the p73 transfected cells (Fig. 3, lane h, indicated with *), which were of variable intensity from one experiment to another (Fig. 3, lanes b and h, and Fig. 4, lane a). The fact that the lysine in ubiquitin used for polyubiquitination is absent from SUMO-1 suggests the possibility of multiple sites for SUMO-1 modification.


View larger version (24K):
[in this window]
[in a new window]
 
Fig. 4.   SUMO-1 modification of the C-terminal lysine residue of p73alpha . A, the C-terminal lysine of p73 (Lys627) was modified to arginine by site-directed mutagenesis, and this mutant was tested for SUMO-1 modification by co-transfection in 293 cells with SUMO-1, as described in Fig. 3. The major SUMO-1-modified form of p73 is indicated by a double asterisk. B, comparison of the sequences surrounding the modified lysines in p53 and p73alpha with those identified in other SUMO-1-modified proteins (45) reveals a consensus for glutamic acid at position +2, a hydrophobic amino acid at position -1, and a basic amino acid (His, Arg, or Lys) at position -4 or -5. A predicted SUMO-1 modification site in p63alpha (49) is also indicated.

The Principal SUMO-1 Modification Site in p73 Is the C-terminal Lysine-- When p73alpha and p73beta were transfected into SK-N-AS cells, SUMO-1-modified forms were detected for p73alpha but not for p73beta (Fig. 3, lanes h and i). Similarly, after C-terminal deletion up to amino acid 450, p73 no longer showed SUMO-1 modification (Fig. 3, lane g). After deletion of the last 18 amino acids of p73alpha , no major SUMO-1-modified form was seen, but minor forms were still apparent (Fig. 3, lane j).

The major modification site in the last 18 amino acids of p73alpha was identified by site-directed mutagenesis as being the final lysine residue, number 627 (Fig. 4A). Similar experiments on p53 identified the C-terminal lysine residue (Lys386) as being the major SUMO-1 modification site (23, 24). In agreement with all but one of the previously identified SUMO-1 modification sites, the p53 lysine 386 and the p73alpha lysine 627 have a glutamic acid at +2 and a hydrophobic amino acid at position -1 (Fig. 4B). In addition, as suggested by Sternsdorf et al. (45), a basic residue (arginine, lysine, or histidine) is found at position -4 or -5 (Fig. 4B). A similar consensus sequence is found for the C-terminal lysine of p63alpha (Fig. 4B).

SUMO-1 Modification Potentiates but Does Not Dictate p73alpha Instability-- Lee and La Thangue (46) reported that p73alpha and p73beta isoforms undergo differential degradation by the proteasome, with p73alpha being sensitive and p73beta insensitive to this degradation. We have investigated whether the SUMO-1 modification on lysine 627 plays a role in this instability by transfecting p73 expression plasmids into SK-N-AS cells and following the accumulation of the different p73 protein forms in the presence and absence of the proteasome inhibitor MG-132. p73alpha containing a mutation of the major SUMO-1 modification site (lysine 627) to arginine shows a similar small but reproducible (1.5-3-fold) increase in accumulation in the presence of MG132 as the wild-type p73alpha (Fig. 5A). Both SUMO-1-modified and unmodified forms of p73 are increased by MG132 treatment (Fig. 5, A and B), whereas the levels of SUMO-modified RanGAP1 and of PCNA are unchanged (Fig. 5, C and D).


View larger version (30K):
[in this window]
[in a new window]
 
Fig. 5.   Effect of the proteasome inhibitor MG132 on the accumulation of SUMO-1-modified and unmodified forms of p73, and detergent extraction of these forms. A, wild-type p73alpha and p73alpha K627R were transfected into SK-N-AS cells, and 20 h after transfection the cells were cultured for a further 8 h in the presence and absence of 5 µM MG132 (Calbiochem). p73 accumulation was detected, using an anti-p73alpha antibody, in total cell extracts prepared by direct lysis in denaturing SDS gel buffer (Bio-Rad). One experiment is shown for p73alpha K627R (lanes a and b) and two experiments are shown for p73alpha (lanes c and d and lanes e and f). B-D, p73alpha and SUMO-1 were transfected into SK-N-AS cells, and 20 h after transfection the cells were cultured for a further 8 h in the presence or absence of 5 µM MG132 (Calbiochem). Cell extracts were prepared by direct lysis in denaturing SDS gel buffer (Bio-Rad) for the total extract (T) or lysis in RIPA buffer (50 mM Tris pH8, 150 mM NaCl, 1% Nonidet P-40, 0.5% sodium deoxycholate, 1 mM dithiothreitol) containing complete protease inhibitor mixture (Roche Molecular Biochemicals) for 15 min at 4 °C and centrifugation at 15,000 rpm to separate insoluble pellet (P) and soluble (S) fractions. Following solubilization of the pellet fraction by boiling in SDS gel buffer, samples were analyzed on denaturing SDS-acrylamide gels. The presence in the different fractions of p73 was detected using an anti-p73alpha antibody (B), that of SUMO-1-modified RanGAP1 and p73 was detected with an anti-SUMO-1 antibody (C), and that of PCNA was detected with an anti-PCNA antibody (D). E, SK-N-AS cells were transfected as in B and cultured without MG132. Cell extracts were prepared as in B in the presence and absence of the thiol protease inhibitor N-ethylmaleimide (NEM) (1 µM). The presence in the different fractions of p73 was detected using an anti-p73alpha antibody.

Quantification of the modified and unmodified p73 forms in several experiments showed that the amount of SUMO-1-modified p73 is increased to a greater extent in the presence of MG132 (5-10-fold) than is that of the unmodified p73 (1.5-3-fold) (Fig. 5, A and B). Although the interconvertibility of the two p73 forms complicates the analysis, this result would suggest that SUMO-1 modification potentiates proteasomal degradation of p73.

SUMO-1 Modification May Alter p73 Localization-- When performing detergent extractions using RIPA (1% Nonidet P-40, 0.5% sodium deoxycholate) buffer to prepare cell extracts, we often found that the SUMO-1-modified form of p73 was preferentially recovered in the detergent insoluble pellet fraction (Fig. 5B), whereas the nonmodified p73 was found in both soluble and pellet fractions. Treatment of cells with MG132 leads primarily to an increase in p73 accumulation in the pellet fraction (Fig. 5B). In contrast, the SUMO-modified form of RanGAP1 (Fig. 5C), which accumulates in nuclear pore complexes, and other nuclear proteins such as PCNA (Fig. 5D) are very efficiently extracted in the detergent-soluble fraction.

The preferential recovery of SUMO-1-modified p73 in the insoluble fraction may thus result from targeting of p73 modified by SUMO-1 to particular subcellular structures, although SUMO-1 modification is not required for the presence of p73 in this fraction because the mutant p73K627R distributes in a similar fashion to unmodified wild-type p73 (not shown). Alternatively, it may represent differential SUMO-1 modification of p73 in different cellular compartments or differential SUMO-1 cleavage during extraction. We have attempted to reduce isopeptidase cleavage during extraction by the addition of protease inhibitor mixtures. In addition, in certain experiments N-ethylmaleimide was included at concentrations from 10 nM to 1 µM in both washing and extraction buffers to inhibit the thiol protease activities reported for SUMO-1 hydrolases (47). This addition did not affect the preferential recovery of SUMO-1-modified p73 in the pellet fraction (Fig. 5E).

SUMO-1 Modification Does Not Affect the Transcriptional Activity of p73-- To test the potential modulation of the transcriptional activities of p73alpha , we measured the activation of an RGC-luciferase reporter gene in SK-N-AS cells by different p73 forms in the presence or absence of SUMO-1. As can be seen in Fig. 6, the level of activation of the reporter gene by p73alpha is not affected by co-transfection with a large excess of a SUMO-1 expressing plasmid in these experiments. A similar result was found for activation by p53 (not shown). The transcriptional activities of p73alpha and of the mutant p73alpha K627R in these experiments are equivalent and are lower than that of p73beta (Fig. 6).


View larger version (31K):
[in this window]
[in a new window]
 
Fig. 6.   Lack of effect of SUMO-1 on the transcriptional activity of p73 in SK-N-AS neuroblastoma cells. SK-N-AS cells were co-transfected with the RGC-luciferase gene (200 ng), the CMV-Renilla luciferase gene (100 ng), a plasmid expressing a p73 isoform (alpha , beta , alpha K627R) (5, 50, or 200 ng), with 1 µg of either the SUMO-1 expression plasmid or the equivalent vector without cDNA insert. After 20 h, cell lysates were prepared and activities of the firefly (RGC) and Renilla (CMV) luciferases measured. Shown are the means and ranges of values for three experiments for the RGC-luciferase, normalized to that of the Renilla luciferase, and then further normalized to the maximum 100% value for p73beta in each experiment.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

p73alpha Is Modified by SUMO-1, but p73beta Is Not-- We show here that p73alpha is a novel substrate for SUMO-1 modification. It is of interest that of the two p73 isoforms (which differ only in their C termini), p73alpha is a good substrate for SUMO-1 modification, whereas p73beta is not. Accordingly, deletion experiments show that the lysines involved in SUMO-1 modification are contained in the C-terminal region of p73alpha not present in p73beta . It remains to be determined whether p73alpha is also a substrate for modification by SUMO-2/3 (48).

p73alpha shows one major SUMO-1-modified form and several minor modified forms. Because the lysine in ubiquitin used for polyubiquitination (lysine 48) is absent from SUMO-1, this suggests that there is one major site and several minor sites for SUMO-1 modification. Site-directed mutagenesis shows that the major modification site of p73alpha is the extreme C-terminal lysine. Similarly, the C-terminal lysine residue of p53 (lysine 386) has recently been identified as the major SUMO-1 modification site (23, 24). When the amino acid sequences surrounding lysine 386 of p53 and lysine 627 of p73alpha are compared with those of SUMO-1-modified lysines in other proteins (45), they show a consensus for glutamic acid at the position +2, a hydrophobic amino acid at position -1, and a basic amino acid (lysine, arginine, or histidine) at position -4 or -5 (Fig. 4B). A similar consensus sequence is found for the C-terminal lysine of p63 (49) (Fig. 4B).

Is SUMO-1 Modification Involved in Regulating the Stability or Localization of p73?-- Ubiquitin modification is primarily, though not exclusively, involved in regulating protein stability, including that of p53 (1, 2). We investigated whether SUMO-1 modification plays a role in modulating the stability of p73, because Lee and La Thangue (46) reported that p73alpha is sensitive to degradation by the proteasome, whereas p73beta is not. Our results, using an inhibitor of proteasomal degradation, MG132, show that both SUMO-1-modified and nonmodified p73alpha are degraded via the proteasome. p73alpha mutated in the major SUMO-1 modification site and wild-type p73alpha show similar up-regulation by MG132 treatment. SUMO-1 modification would thus not seem to be a major factor influencing p73alpha degradation by the proteasome. However, SUMO-1-modified p73alpha was stabilized to a greater extent than unmodified p73 by treatment with MG132, suggesting that SUMO-1 modification potentiates proteasomal degradation. Although some proteins have been shown to be stabilized by SUMO-1 modification because of a resulting inhibition of ubiquitination on the modified lysine residue (20, 50), other SUMO-1-conjugates have been shown to be degraded via the proteasome (51, 52). SUMO-1 modification may induce conformational changes potentiating ubiquitination or may influence protein degradation via modulation of E3 ubiquitin ligases, as found for the ubiquitin-like modifier Rub1 in yeast (3).

As for PML (19), SUMO-1-modified p73 may have a particular subcellular localization because we have found that SUMO-1-modified p73 is preferentially isolated in the detergent insoluble fraction. We attempted to exclude the possibility that this result reflects preferential SUMO-1 cleavage in the soluble fraction during cell lysis by addition of protease inhibitor mixtures and by the detection of SUMO-1-modified RanGAP1 in the soluble fraction. However, RanGAP1 and PML have recently been reported to be differentially sensitive in vivo to the nuclear SUMO-1 hydrolase SENP1 (53). We cannot thus completely rule out a differential isopeptidase sensitivity of p73-SUMO-1 in the soluble and insoluble fractions as an explanation for our results, although the inclusion in cell washing and lysis buffers of N-ethylmaleimide, which has been shown to inhibit SUMO-1 hydrolases in vitro (47), did not increase the amount of SUMO-1-modified p73 in the soluble fraction.

We have so far been unable to identify p73 accumulation in PODs that contain a large amount of nuclear SUMO-1 after MG132 treatment. However, the low percentage of p73 that is modified by SUMO-1 makes identification of this fraction uncertain. For p53, nuclear aggregates induced by leptomycin B treatment (which prevents nuclear export), have recently been localized adjacent to PODs (54).

Is SUMO-1 Modification Involved in the Transcriptional Activity of p73alpha ?-- Two recent reports (23, 24) show that SUMO-1 modification of p53 on lysine 386 increases the transactivation activity of p53 on reporter genes. We did not find this result examining activation by p73alpha , or by p53, of the RGC p53-responsive element in SK-N-AS cells. This may reflect experimental differences in promoter constructs, in cell types, or in levels of SUMO-1 modification.

We find here, as previously reported (46, 56), that the beta  isoform, which is not subject to SUMO-1 modification, is more transcriptionally active than the alpha  isoform, which can be SUMO-1-modified. The C-terminal region of p73alpha has been shown to modulate its transcriptional and growth regulatory properties (55-57), acting both as a positive and negative regulator. Although our experiments do not provide evidence for a direct effect of SUMO-1 modification on the transcriptional activity of transfected p73, such a modification could indirectly modulate activation of the endogenous p73alpha protein by influencing interaction with other co-regulatory proteins such as the c-Abl tyrosine kinase (27) or the histone deactetylation complex (see below).

Novel SUMO-1-interacting Proteins and a SUMO-1-interacting Motif-- Among the proteins we originally isolated in our p73 two-hybrid screen, the majority were subsequently found to interact with SUMO-1. These include PML, PM-Scl 75, thymine DNA glycosylase, PIASx, PKY, CHD3/ZFH, and one of the SUMO-1-activating enzymes, SEA2. Five of the protein sequences interacting in the two-hybrid system with SUMO-1 contained a motif with a central SXS (or SXT) triplet preceded by predominantly hydrophobic amino acids and followed by predominantly acidic amino acids (Fig. 2A). We have confirmed that this motif can interact with SUMO-1 in the two-hybrid system. The serine/threonine and acidic residues essential for this interaction constitute a double CKII kinase site ((S/T)XX(D/E)) (58), and the interaction may thus be regulated by phosphorylation.

Screening DNA sequence data bases for other proteins containing the SXS motif identified RanBP2/Nup358. Although the fit to our consensus sequence is not ideal (KKPEDSPS DDDVL), in that acidic amino acids are found at positions normally constituted by hydrophobic amino acids (Fig. 2A), this sequence maps to the minimal domain determined for RanGAP1-SUMO-1 binding: 2550-2837 (59). A number of other potential SUMO-1-interacting proteins have been identified. These include c-Myc, DNA repair proteins (XPG, XRCC1, and the Ku70 regulatory subunit of the DNA protein kinase), centromeric proteins (CENP-B), components of the origin of replication (ORC1 and ORC2), and viral proteins such as the cytomegalovirus IE2 protein. In the latter case, this protein has been recently shown to be SUMO-1-conjugated (60).

The SXS motif has been functionally implicated in SUMO-1 interaction using the yeast two-hybrid system, where it may be interacting directly with SUMO-1 or indirectly via Ubc9 or one of the SUMO-1-activating enzymes. Recent experiments on the mouse homologue of PKY-related kinase PKM (61), the homeodomain-interacting protein kinase 2 (62) (Fig. 2A), show that the SXS motif is part of a sequence that specifies localization of mouse homeodomain-interacting protein kinase 2 in nuclear speckles and that interacts in vitro with Ubc9 (63). The SXS motif is also conserved in the PIAS transcription factor family (Fig. 2A), including the androgen receptor-interacting protein ARIP (64) and the protein Miz-1, a N-terminally truncated form of PIASxbeta that interacts with the homeobox domain protein Msx2 (65). These and other (66) findings suggest that global modulation of SUMO-1 levels might co-ordinately regulate transcription of diverse genetic programs.

SUMO-1-interacting Proteins and Transcriptional Repression-- Another of the SUMO-1-interacting proteins is the CHD3/ZFH zinc finger-containing helicase, whose expression is associated with cell growth (39, 40). This protein does not contain an SXS motif but may be modified by SUMO-1 since it contains a potential SUMO-1 modification site (VKKE) within the 140 C-terminal amino acids identified here as the SUMO-1-interacting region. CHD3 has been shown to be present in histone deacetylase complexes (HDAC) (67), which have been implicated in transcriptional repression by p53 (68). This interaction between p53 and HDAC is indirect and is mediated at least in part by the co-repressor Sin3a. In the case of the lymphoid lineage-determining factors of the Ikaros gene family, interactions with HDAC have been shown to proceed both through Sin3 and through NURD/Mi-2 complexes (69, 70), the latter containing CHD3. In view of the interactions detected here, p73-CHD3 and p53-CHD3 interactions via SUMO-1 may also participate in transcriptional repression mediated by these proteins.

Other proteins interacting with both SUMO-1 and HDAC complexes include the homeodomain-interacting protein kinase 2 (62, 71) and unliganded nuclear receptors such as the androgen receptor and the glucocorticoid receptor (72-74). This may also be the case for retinoic acid receptors that were found to interact in two-hybrid studies with thymine DNA glycosylase (75), which we show here to interact with SUMO-1. The Drosophila transcriptional repressor Tramtrack 69 is also modified by SUMO-1 (76). SUMO-1 modification may play a key role in the balance between transcriptional activation and repression.

If this is true for p73 and its homologue p63, this may offer one explanation for the finding of N-terminally truncated forms of the alpha -isoforms of p63 and p73 (28, 77), which would be unable to activate transcription of target genes. These N-terminally truncated forms are, however, still able to bind to DNA, and could thus mediate transcriptional repression via SUMO-1-modulated interaction with HDAC complexes. Transcriptional repression by p53 is involved in the apoptotic activity of this protein (68), and this could also be the case for the apoptotic activity of p73 (24, 25), implicating both full-length and N-terminally truncated forms. Alternatively, N-terminally truncated forms can act as dominant negative inhibitors of p53- or p73-induced transcription and apoptosis (28, 48, 78, 79). The role of the different p73 forms in modulating apoptosis during development (80) and the contribution of SUMO-1 modification remain to be fully investigated.

    FOOTNOTES

* The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Dagger To whom correspondence should be addressed. Tel.: 33-5-61-00-41-67; Fax: 33-5-61-00-40-01; E-mail: adrian.minty@sanofi-synthelabo.com.

Published, JBC Papers in Press, August 28, 2000, DOI 10.1074/jbc.M004293200

    ABBREVIATIONS

The abbreviations used are: E1, ubiquitin-activating enzyme; E2, ubiquitin; E3, ubiquitin-protein isopeptide ligase; PML, promyelocytic leukemia gene product; POD, PML oncogenic domain; HDAC, histone deacetylase complex.

    REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

1. Ciechanover, A. (1998) EMBO J. 17, 7151-7160
2. Hochstrasser, M. (1996) Cell 84, 813-815
3. Hochstrasser, M. (1998) Genes Dev. 12, 901-907
4. Saitoh, H., Pu, R. T., and Dasso, M. (1997) Trends Biochem. Sci. 22, 374-376
5. Matunis, M. J., Coutavas, E., and Blobel, G. (1996) J. Cell Biol. 135, 1457-1470
6. Mahajan, R., Delphin, C., Guan, T., Gerace, L., and Melchior, F. (1997) Cell 88, 97-107
7. Brody, M. N., Howe, K., Etkin, L. D., Solomon, E., and Freemont, P. S. (1996) Oncogene 13, 971-982
8. Okura, T., Gong, L., Kamitani, T., Wada, T., Okura, I., Wei, C. F., Chang, H. M., and Yeh, E. T. (1996) J. Immunol. 157, 4277-4281
9. Liou, M.-L., and Liou, H.-C. (1999) J. Biol. Chem. 274, 10145-10153
10. Shen, Z., Pardington-Purtymun, P. E., Comeaux, J. C., Moyzis, R. K., and Chen, D. J. (1996) Genomics 37, 183-186
11. Meluh, P. B., and Koshland, D. (1997) Genes Dev. 11, 3401-3412
12. Tanaka, K., Nishide, J., Okazaki, K., Kato, H., Niwa, O., Nakagawa, T., Matsuda, H., Kawamukai, M., and Murakami, Y. (1999) Mol. Cell. Biol. 19, 8660-8672
13. Desterro, J. M. P, Rodriguez, M. S., Kemp, G. D., and Hay, R. T. (1999) J. Biol. Chem. 274, 10618-10624
14. Johnson, E. S., and Blobel, G. (1997) J. Biol. Chem. 272, 26799-26802
15. Desterro, J. M. P., Thomson, J., and Hay, R. T. (1997) FEBS Lett. 417, 297-300
16. Seufert, W., Futcher, B., and Jentsch, S. (1995) Nature 373, 78-81
17. Li, S.-J., and Hochstrasser, M. (1999) Nature 398, 246-251
18. Kamitani, T., Nguyen, H. P., and Yeh, E. T. H. (1997) J. Biol. Chem. 272, 14001-14004
19. Seeler, J. S., and Dejean, A. (1999) Curr. Opin. Genet. Dev. 9, 362-367
20. Desterro, J. M., Rodriguez, M. S., and Hay, R. T. (1998) Mol. Cell 2, 233-239
21. May, P., and May, E. (1999) Oncogene 18, 7621-7636
22. Lakin, N. D., and Jackson, S. P. (1999) Oncogene 18, 7644-7655
23. Rodriguez, M. S., Desterro, J. M. P., Lain, S., Midgley, C. A., Lane, D. P., and Hay, R. T. (1999) EMBO J. 18, 6455-6461
24. Gostissa, M., Hengstermann, A., Fogal, V., Sandy, P., Schwartz, S. E., Scheffner, M., and Del Sal, G. (1999) EMBO J. 18, 6462-6471
25. Kaghad, M., Bonnet, H., Yang, A., Creancier, L., Biscan, J.-C., Valent, A., Minty, A., Chalon, P., Lelias, J.-M., Dumont, X., Ferrara, P., McKeon, F., and Caput, D. (1997) Cell 90, 809-819
26. Kaelin, W. G. (1999) Oncogene 18, 7701-7705
27. White, E., and Prives, C. (1999) Nature 399, 734-737
28. Yang, A., Walker, N., Bronson, R., Kaghad, M., Oosterwegel, M., Bonnin, J ., Vagner, C., Bonnet, H., Dikkes, P., Sharpe, A., McKeon, F., and Caput, D. (2000) Nature 404, 99-103
29. Yu, J., Zhang, L., Hwang, P. M., Rago, C., Kinzler, K. W., and Vogelstein, B. (1999) Proc. Natl. Acad. Sci. U. S. A. 96, 14517-14522
30. Sugimoto, T., Tatsumi, E., Kemshead, T., and Helson, L. (1984) J. Natl. Cancer Inst. 73, 51-57
31. Chomczynski, P., and Sacchi, N. (1987) Anal. Biochem. 162, 156-159
32. Gyuris, J., Golemis, E., Chertkov, H., and Brent, R. (1993) Cell 75, 791-803
33. Caput, D., Beutler, B., Hartog, K., Thayer, R., Brown-Shimer, S., and Cerami, A. (1986) Proc. Natl. Acad. Sci. U. S. A. 83, 1670-1674
34. Schiestl, R. H., and Gietz, R. D. (1989) Curr. Genet. 16, 339-346
35. Hoffman, C. S., and Winston, F. (1987) Gene (Amst.) 57, 267-272
36. Kippert, F. (1995) FEMS Microbiol. Lett. 128, 201-206
37. Liu, B., Liao, J., Rao, X., Kushner, S. A., Chung, C. D., Chang, D. D., and Shuai, K. (1998) Proc. Natl. Acad. Sci. U. S. A. 95, 10626-10631
38. Begley, D. A., Berkenpas, M. B., Sampson, K. E., and Abraham, I. (1997) Gene (Amst.) 200, 35-43
39. Aubry, F., Matthei, M. G., and Galibert, F. (1998) Eur. J. Biochem. 254, 558-564
40. Woodage, T., Basrai, M. A., Baxevanis, A. D., Hieter, P., and Collins, F. (1997) Proc. Natl. Acad. Sci. U. S. A. 94, 11472-11477
41. Alderuccio, F., Chan, E. K. L., and Tan, E. M. (1991) J. Exp. Med. 173, 941-952
42. Neddermann, P., Gallinari, P., Lettieri, T., Schmid, D., Truong, O., Hsuan, J. J., Wiebauer, K., and Jiricny, J. (1996) J. Biol. Chem. 271, 12767-12774
43. Voorhees, P., Deignan, E., van Donselaar, E., Humphrey, J., Marks, M. S., Peters, P. J., and Bonifacino, J. S. (1995) EMBO J. 14, 4961-4975
44. Million, K., Larcher, J., Laoukili, J., Bourguinon, D., Marano, F., and Tournier, F. (1999) J. Cell Sci. 112, 4357-4366
45. Sternsdorf, T., Jensen, K., Reich, B., and Will, H. (1999) J. Biol. Chem. 274, 12555-12566
46. Lee, C.-W., and La Thangue, N. B. (1999) Oncogene 18, 4171-4181
47. Susuki, T., Ichiyama, A., Saitoh, H., Kawakami, T., Omata, M., Chung, C. H., Kimura, M., Shimbara, N., and Tanaka, K. (1999) J. Biol. Chem. 274, 31131-31134
48. Saitoh, H., and Hinchey, J. (2000) J. Biol. Chem. 275, 6252-6258
49. Yang, A., Kaghad, M., Wang, Y., Gillett, E., Fleming, M. D., Dotsch, V., Andrews, N. C., Caput, D., and McKeon, F. (1998) Mol. Cell 2, 305-316
50. Buschmann, T., Fuchs, S. Y., Lee, C.-G., Pan, Z.-Q., and Ronai, Z. (2000) Cell 101, 753-762
51. Everett, R. D., Freemont, P., Saitoh, H., Dasso, M., Orr, A., Kathoria, M., and Parkinson, J. (1998) J. Virol. 72, 6581-6591
52. Chelbi-Alix, M. K., and de Thé, H. (1999) Oncogene 18, 935-941
53. Gong, L., Millas, S., Maul, G. G., and Yeh, E. T. H. (2000) J. Biol. Chem. 275, 3355-3359
54. Lain, S., Midgley, C., Sparks, A., Lane, E. B., and Lane, D. P. (1999) Exp. Cell Res. 248, 457-472
55. De Laurenzi, V., Costanzo, A., Barcaroli, D., Terrinoni, A., Falco, M., Annicchiarico-Petruzzelli, M., Levrero, M., and Melino, G. (1998) J. Exp. Med. 188, 1763-1768
56. Ueda, Y., Hijikata, M ., Takagi, S., Chiba, T., and Shimotohno, K. (1999) Oncogene 18, 4993-4998
57. Ozaki, T., Naka, M., Takada, N., Tada, M., Sakiyama, S., and Nakagawara, A. (1999) Cancer Res. 59, 5902-5907
58. Meggio, F., Marin, O., and Pinna, L. A. (1994) Cell. Mol. Biol. Res. 40, 401-409
59. Matunis, M. J., Wu, J., and Blobel, G. (1998) J. Cell Biol. 140, 499-509
60. Hofmann, H., Floss, S., and Stamminger, T. (2000) J. Virol. 74, 2510-2524
61. Trost, M., Kochs, G., and Haller, O. (2000) J. Biol. Chem. 275, 7373-7377
62. Kim, Y. H., Choi, C. Y., Lee, S.-J., Conti, M. A., and Kim, Y. (1998) J. Biol. Chem. 273, 25875-25879
63. Kim, Y. H., Choi, C. Y., and Kim, Y. (1999) Proc. Natl. Acad. Sci. U. S. A. 96, 12350-12355
64. Moilanen, A.-M., Karvonen, U., Poukka, H., Yan, W., Toppari, J., Janne, O. A., and Palvimo, J. J. (1999) J. Biol. Chem. 274, 3700-3704
65. Wu, L., Wu, H., Sangiorgi, F., Wu, N., Bell, J. R., Lyons, G. E., and Maxson, R. (1997) Mechanisms Dev. 65, 3-17
66. Zhong, S., Salomoni, P., and Pandolfi, P. P. (2000) Nat. Cell Biol. 2, E85-E95
67. Tong, J. K., Hassig, C. A., Schnitzler, G. R., Kingston, R. E., and Schreiber, S. L. (1998) Nature 395, 917-921
68. Murphy, M., Ahn, J., Walker, K. K., Hoffman, W. H., Evans, R. M., Levine, A. J., and George, D. L. (1999) Genes Dev. 13, 2490-2501
69. Koipally, J., Renold, A., Kim, J., and Georgopoulos, K. (1999) EMBO J. 18, 3090-3100
70. Kim, J., Sif, S., Jones, B., Jackson, A., Koipally, J., Heller, E., Winandy, S., Viel, A., Sawyer, A., Ikeda, T., Kingston, R., and Georgopoulos, K. (1999) Immunity 10, 345-355
71. Choi, C. Y., Kim, Y. H., Kwon, H. J., and Kim, Y. (1999) J. Biol. Chem. 274, 33194-33197
72. Poukka, H., Arnisalo, P., Karvonen, U., Palvimo, J. J., and Janne, O. A. (1999) J. Biol. Chem. 274, 19441-19446
73. Gottlicher, M., Heck, S., Doucas, V., Wade, E., Kullmann, M., Cato, A. C., Evans, R. M., and Herrlich, P. (1996) Steroids 61, 257-262
74. Xu, L., Glass, C. K., and Rosenfeld, M. G. (1999) Curr. Opin. Genet. Dev. 9, 140-147
75. Um, S., Harbers, M., Beneke, A., Pierrat, B., Losson, R., and Chambon, P. (1998) J. Biol. Chem. 273, 20728-20736
76. Lehembre, F., Badenhorst, P., Muller, S., Travers, A., Schweisguth, F., and Dejean, A. (2000) Mol. Cell Biol. 20, 1072-1082
77. Yang, A., Schweitzer, R., Sun, D., Kaghad, M., Walker, N., Bronson, R. T., Tabin, C., Sharpe, A., Caput, D., Crum, C., and McKeon, F. (1999) Nature 398, 714-718
78. Vikhanskaya, F., D'Incalci, M., and Broggini, M. (2000) Nucleic Acids Res. 28, 513-519
79. De Laurenzi, V., Raschella, G., Baracoli, D., Annicchiarico-Petruzzelli, M., Ranalli, M., Catani, M. V., Tanno, B., Costanzo, A., Levero, M., and Melino, G. (2000) J. Biol. Chem. 275, 15226-15231
80. Pozniak, C. D., Radinovic, S., Yang, A., McKeon, F., Kaplan, D. R., and Miller, F. D. (2000) Science 289, 304-306
81. de Thé, H., Lavau, C., Marchio, A., Chomienne, C., Degos, L., and Dejean, A. (1991) Cell 66, 675-684


Copyright © 2000 by The American Society for Biochemistry and Molecular Biology, Inc.
Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
Hum Mol GenetHome page
W.S. Layman, D.P. McEwen, L.A. Beyer, S.R. Lalani, S.D. Fernbach, E. Oh, A. Swaroop, C.C. Hegg, Y. Raphael, J.R. Martens, et al.
Defects in neural stem cell proliferation and olfaction in Chd7 deficient mice indicate a mechanism for hyposmia in human CHARGE syndrome
Hum. Mol. Genet., June 1, 2009; 18(11): 1909 - 1923.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
Z. Wang and G. Prelich
Quality Control of a Transcriptional Regulator by SUMO-Targeted Degradation
Mol. Cell. Biol., April 1, 2009; 29(7): 1694 - 1706.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
K. Miura, J. Lee, J. B. Jin, C. Y. Yoo, T. Miura, and P. M. Hasegawa
Sumoylation of ABI5 by the Arabidopsis SUMO E3 ligase SIZ1 negatively regulates abscisic acid signaling
PNAS, March 31, 2009; 106(13): 5418 - 5423.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. Zhu, S. Zhu, C. M. Guzzo, N. A. Ellis, K. S. Sung, C. Y. Choi, and M. J. Matunis
Small Ubiquitin-related Modifier (SUMO) Binding Determines Substrate Recognition and Paralog-selective SUMO Modification
J. Biol. Chem., October 24, 2008; 283(43): 29405 - 29415.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
M. Tozluoglu, E. Karaca, T. Haliloglu, and R. Nussinov
Cataloging and organizing p73 interactions in cell cycle arrest and apoptosis
Nucleic Acids Res., September 1, 2008; 36(15): 5033 - 5049.
[Abstract] [Full Text] [PDF]


Home page
GENES CELLSHome page
T. Kuwata and T. Nakamura
BCL11A is a SUMOylated protein and recruits SUMO-conjugation enzymes in its nuclear body
Genes Cells, September 1, 2008; 13(9): 931 - 940.
[Abstract] [Full Text] [PDF]


Home page
Plant Cell PhysiolHome page
M. Badawi, Y. V. Reddy, Z. Agharbaoui, Y. Tominaga, J. Danyluk, F. Sarhan, and M. Houde
Structure and Functional Analysis of Wheat ICE (Inducer of CBF Expression) Genes
Plant Cell Physiol., August 1, 2008; 49(8): 1237 - 1249.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
F. Mauri, L. M. McNamee, A. Lunardi, F. Chiacchiera, G. Del Sal, M. H. Brodsky, and L. Collavin
Modification of Drosophila p53 by SUMO Modulates Its Transactivation and Pro-apoptotic Functions
J. Biol. Chem., July 25, 2008; 283(30): 20848 - 20856.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J.-A. T. Tan, Y. Sun, J. Song, Y. Chen, T. G. Krontiris, and L. K. Durrin
SUMO Conjugation to the Matrix Attachment Region-binding Protein, Special AT-rich Sequence-binding Protein-1 (SATB1), Targets SATB1 to Promyelocytic Nuclear Bodies Where It Undergoes Caspase Cleavage
J. Biol. Chem., June 27, 2008; 283(26): 18124 - 18134.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
M. A. Park, Y.-J. Seok, G. Jeong, and J.-S. Lee
SUMO1 negatively regulates BRCA1-mediated transcription, via modulation of promoter occupancy
Nucleic Acids Res., January 17, 2008; 36(1): 263 - 283.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
M. Siatecka, L. Xue, and J. J. Bieker
Sumoylation of EKLF Promotes Transcriptional Repression and Is Involved in Inhibition of Megakaryopoiesis
Mol. Cell. Biol., December 15, 2007; 27(24): 8547 - 8560.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
K. Uzunova, K. Gottsche, M. Miteva, S. R. Weisshaar, C. Glanemann, M. Schnellhardt, M. Niessen, H. Scheel, K. Hofmann, E. S. Johnson, et al.
Ubiquitin-dependent Proteolytic Control of SUMO Conjugates
J. Biol. Chem., November 23, 2007; 282(47): 34167 - 34175.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
J. E. Sillibourne, B. Delaval, S. Redick, M. Sinha, and S. J. Doxsey
Chromatin Remodeling Proteins Interact with Pericentrin to Regulate Centrosome Integrity
Mol. Biol. Cell, September 1, 2007; 18(9): 3667 - 3680.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
Z. Deng, M. Wan, and G. Sui
PIASy-Mediated Sumoylation of Yin Yang 1 Depends on Their Interaction but Not the RING Finger
Mol. Cell. Biol., May 15, 2007; 27(10): 3780 - 3792.
[Abstract] [Full Text] [PDF]


Home page
Plant CellHome page
K. Miura, J. B. Jin, J. Lee, C. Y. Yoo, V. Stirm, T. Miura, E. N. Ashworth, R. A. Bressan, D.-J. Yun, and P. M. Hasegawa
SIZ1-Mediated Sumoylation of ICE1 Controls CBF3/DREB1A Expression and Freezing Tolerance in Arabidopsis
PLANT CELL, April 1, 2007; 19(4): 1403 - 1414.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. L. H. Miller, E. L. Scappini, and J. O'Bryan
Ubiquitin-interacting Motifs Inhibit Aggregation of PolyQ-expanded Huntingtin
J. Biol. Chem., March 30, 2007; 282(13): 10096 - 10103.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
M. D. Benson, Q.-J. Li, K. Kieckhafer, D. Dudek, M. R. Whorton, R. K. Sunahara, J. A. Iniguez-Lluhi, and J. R. Martens
SUMO modification regulates inactivation of the voltage-gated potassium channel Kv1.5
PNAS, February 6, 2007; 104(6): 1805 - 1810.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
G. D. Raffa, J. Wohlschlegel, J. R. Yates III, and M. N. Boddy
SUMO-binding Motifs Mediate the Rad60-dependent Response to Replicative Stress and Self-association
J. Biol. Chem., September 22, 2006; 281(38): 27973 - 27981.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y. Uchimura, T. Ichimura, J. Uwada, T. Tachibana, S. Sugahara, M. Nakao, and H. Saitoh
Involvement of SUMO Modification in MBD1- and MCAF1-mediated Heterochromatin Formation
J. Biol. Chem., August 11, 2006; 281(32): 23180 - 23190.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C.-M. Hecker, M. Rabiller, K. Haglund, P. Bayer, and I. Dikic
Specification of SUMO1- and SUMO2-interacting Motifs
J. Biol. Chem., June 9, 2006; 281(23): 16117 - 16127.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
A. Yueh, J. Leung, S. Bhattacharyya, L. A. Perrone, K. de los Santos, S.-y. Pu, and S. P. Goff
Interaction of Moloney Murine Leukemia Virus Capsid with Ubc9 and PIASy Mediates SUMO-1 Addition Required Early in Infection
J. Virol., January 1, 2006; 80(1): 342 - 352.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. Song, Z. Zhang, W. Hu, and Y. Chen
Small Ubiquitin-like Modifier (SUMO) Recognition of a SUMO Binding Motif: A REVERSAL OF THE BOUND ORIENTATION
J. Biol. Chem., December 2, 2005; 280(48): 40122 - 40129.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
R. Cui, T. T. Nguyen, J. H. Taube, S. A. Stratton, M. H. Feuerman, and M. C. Barton
Family Members p53 and p73 Act Together in Chromatin Modification and Direct Repression of {alpha}-Fetoprotein Transcription
J. Biol. Chem., November 25, 2005; 280(47): 39152 - 39160.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y. Takahashi and Y. Kikuchi
Yeast PIAS-type Ull1/Siz1 Is Composed of SUMO Ligase and Regulatory Domains
J. Biol. Chem., October 28, 2005; 280(43): 35822 - 35828.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
U. Nyman, A. Sobczak-Pluta, P. Vlachos, T. Perlmann, B. Zhivotovsky, and B. Joseph
Full-length p73{alpha} Represses Drug-induced Apoptosis in Small Cell Lung Carcinoma Cells
J. Biol. Chem., October 7, 2005; 280(40): 34159 - 34169.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
S. Amini, G. Mameli, L. Del Valle, A. Skowronska, K. Reiss, B. B. Gelman, M. K. White, K. Khalili, and B. E. Sawaya
p73 Interacts with Human Immunodeficiency Virus Type 1 Tat in Astrocytic Cells and Prevents Its Acetylation on Lysine 28
Mol. Cell. Biol., September 15, 2005; 25(18): 8126 - 8138.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
K. Miura, A. Rus, A. Sharkhuu, S. Yokoi, A. S. Karthikeyan, K. G. Raghothama, D. Baek, Y. D. Koo, J. B. Jin, R. A. Bressan, et al.
The Arabidopsis SUMO E3 ligase SIZ1 controls phosphate deficiency responses
PNAS, May 24, 2005; 102(21): 7760 - 7765.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
G. Liu and X. Chen
The C-terminal Sterile {alpha} Motif and the Extreme C Terminus Regulate the Transcriptional Activity of the {alpha} Isoform of p73
J. Biol. Chem., May 20, 2005; 280(20): 20111 - 20119.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
H. Takahashi, S. Hatakeyama, H. Saitoh, and K. I. Nakayama
Noncovalent SUMO-1 Binding Activity of Thymine DNA Glycosylase (TDG) Is Required for Its SUMO-1 Modification and Colocalization with the Promyelocytic Leukemia Protein
J. Biol. Chem., February 18, 2005; 280(7): 5611 - 5621.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. T. Hannich, A. Lewis, M. B. Kroetz, S.-J. Li, H. Heide, A. Emili, and M. Hochstrasser
Defining the SUMO-modified Proteome by Multiple Approaches in Saccharomyces cerevisiae
J. Biol. Chem., February 11, 2005; 280(6): 4102 - 4110.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C.-Y. Li, J. Zhu, and J. Y. J. Wang
Ectopic Expression of p73{alpha}, but Not p73{beta}, Suppresses Myogenic Differentiation
J. Biol. Chem., January 21, 2005; 280(3): 2159 - 2164.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
C. Gurer, L. Berthoux, and J. Luban
Covalent Modification of Human Immunodeficiency Virus Type 1 p6 by SUMO-1
J. Virol., January 15, 2005; 79(2): 910 - 917.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
E. Munarriz, D. Barcaroli, A. Stephanou, P. A. Townsend, C. Maisse, A. Terrinoni, M. H. Neale, S. J. Martin, D. S. Latchman, R. A. Knight, et al.
PIAS-1 Is a Checkpoint Regulator Which Affects Exit from G1 and G2 by Sumoylation of p73
Mol. Cell. Biol., December 15, 2004; 24(24): 10593 - 10610.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
R. I. Aqeilan, A. Palamarchuk, R. J. Weigel, J. J. Herrero, Y. Pekarsky, and C. M. Croce
Physical and Functional Interactions between the Wwox Tumor Suppressor Protein and the AP-2{gamma} Transcription Factor
Cancer Res., November 15, 2004; 64(22): 8256 - 8261.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
J. Song, L. K. Durrin, T. A. Wilkinson, T. G. Krontiris, and Y. Chen
Identification of a SUMO-binding motif that recognizes SUMO-modified proteins
PNAS, October 5, 2004; 101(40): 14373 - 14378.
[Abstract] [Full Text] [PDF]


Home page
Genes Dev.Home page
G. Gill
SUMO and ubiquitin in the nucleus: different functions, similar mechanisms?
Genes & Dev., September 1, 2004; 18(17): 2046 - 2059.
[Abstract] [Full Text] [PDF]


Home page
Mol Cancer ResHome page
U. M. Moll and N. Slade
p63 and p73: Roles in Development and Tumor Formation
Mol. Cancer Res., July 1, 2004; 2(7): 371 - 386.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
F. Bernassola, P. Salomoni, A. Oberst, C. J. Di Como, M. Pagano, G. Melino, and P. P. Pandolfi
Ubiquitin-dependent Degradation of p73 Is Inhibited by PML
J. Exp. Med., June 7, 2004; 199(11): 1545 - 1557.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
G. Kadare, M. Toutant, E. Formstecher, J.-C. Corvol, M. Carnaud, M.-C. Boutterin, and J.-A. Girault
PIAS1-mediated Sumoylation of Focal Adhesion Kinase Activates Its Autophosphorylationn
J. Biol. Chem., November 28, 2003; 278(48): 47434 - 47440.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
S. Gonzalez, C. Prives, and C. Cordon-Cardo
p73{alpha} Regulation by Chk1 in Response to DNA Damage
Mol. Cell. Biol., November 15, 2003; 23(22): 8161 - 8171.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
S. Watanabe, T. Ichimura, N. Fujita, S. Tsuruzoe, I. Ohki, M. Shirakawa, M. Kawasuji, and M. Nakao
Methylated DNA-binding domain 1 and methylpurine-DNA glycosylase link transcriptional repression and DNA repair in chromatin
PNAS, October 28, 2003; 100(22): 12859 - 12864.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Ben-Yehoyada, I. Ben-Dor, and Y. Shaul
c-Abl Tyrosine Kinase Selectively Regulates p73 Nuclear Matrix Association
J. Biol. Chem., September 5, 2003; 278(36): 34475 - 34482.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
K. K. C. Tsai and Z.-M. Yuan
c-Abl Stabilizes p73 by a Phosphorylation-augmented Interaction
Cancer Res., June 15, 2003; 63(12): 3418 - 3424.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y. Hirano, S. Murata, K. Tanaka, M. Shimizu, and R. Sato
Sterol Regulatory Element-binding Proteins Are Negatively Regulated through SUMO-1 Modification Independent of the Ubiquitin/26 S Proteasome Pathway
J. Biol. Chem., May 2, 2003; 278(19): 16809 - 16819.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
K. M. Comerford, M. O. Leonard, J. Karhausen, R. Carey, S. P. Colgan, and C. T. Taylor
Small ubiquitin-related modifier-1 modification mediates resolution of CREB-dependent responses to hypoxia
PNAS, February 4, 2003; 100(3): 986 - 991.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
S. J. Baker
Small Unstable Apoptotic Protein, an Apoptosis-associated Protein, Suppresses Proliferation of Myeloid Cells
Cancer Res., February 1, 2003; 63(3): 705 - 712.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
Z. Serber, H. C. Lai, A. Yang, H. D. Ou, M. S. Sigal, A. E. Kelly, B. D. Darimont, P. H. G. Duijf, H. van Bokhoven, F. McKeon, et al.
A C-Terminal Inhibitory Domain Controls the Activity of p63 by an Intramolecular Mechanism
Mol. Cell. Biol., December 15, 2002; 22(24): 8601 - 8611.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Tojo, K. Matsuzaki, T. Minami, Y. Honda, H. Yasuda, T. Chiba, H. Saya, Y. Fujii-Kuriyama, and M. Nakao
The Aryl Hydrocarbon Receptor Nuclear Transporter Is Modulated by the SUMO-1 Conjugation System
J. Biol. Chem., November 22, 2002; 277(48): 46576 - 46585.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
P. Rallabhandi, K. Hashimoto, Y.-Y. Mo, W. T. Beck, P. K. Moitra, and P. D'Arpa
Sumoylation of Topoisomerase I Is Involved in Its Partitioning between Nucleoli and Nucleoplasm and Its Clearing from Nucleoli in Response to Camptothecin
J. Biol. Chem., October 11, 2002; 277(42): 40020 - 40026.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
Y. Le Drean, N. Mincheneau, P. Le Goff, and D. Michel
Potentiation of Glucocorticoid Receptor Transcriptional Activity by Sumoylation
Endocrinology, September 1, 2002; 143(9): 3482 - 3489.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
E.-J. Kim, J.-S. Park, and S.-J. Um
Identification and Characterization of HIPK2 Interacting with p73 and Modulating Functions of the p53 Family in Vivo
J. Biol. Chem., August 23, 2002; 277(35): 32020 - 32028.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. J. Eloranta and H. C. Hurst
Transcription Factor AP-2 Interacts with the SUMO-conjugating Enzyme UBC9 and Is Sumolated in Vivo
J. Biol. Chem., August 16, 2002; 277(34): 30798 - 30804.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. Allart, H. Martin, C. Detraves, J. Terrasson, D. Caput, and C. Davrinche
Human Cytomegalovirus Induces Drug Resistance and Alteration of Programmed Cell Death by Accumulation of Delta N-p73alpha
J. Biol. Chem., August 2, 2002; 277(32): 29063 - 29068.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
N. Kotaja, U. Karvonen, O. A. Janne, and J. J. Palvimo
PIAS Proteins Modulate Transcription Factors by Functioning as SUMO-1 Ligases
Mol. Cell. Biol., July 15, 2002; 22(14): 5222 - 5234.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
K.-i. Watanabe, T. Ozaki, T. Nakagawa, K. Miyazaki, M. Takahashi, M. Hosoda, S. Hayashi, S. Todo, and A. Nakagawara
Physical Interaction of p73 with c-Myc and MM1, a c-Myc-binding Protein, and Modulation of the p73 Function
J. Biol. Chem., April 19, 2002; 277(17): 15113 - 15123.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
D. Schmidt and S. Muller
Members of the PIAS family act as SUMO ligases for c-Jun and p53 and repress p53 activity
PNAS, February 20, 2002; (2002) 52559499.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
S. Douc-Rasy, M. Barrois, M. Echeynne, M. Kaghad, E. Blanc, G. Raguenez, D. Goldschneider, M.-J. Terrier-Lacombe, O. Hartmann, U. Moll, et al.
{Delta}N-p73{alpha} Accumulates in Human Neuroblastic Tumors
Am. J. Pathol., February 1, 2002; 160(2): 631 - 639.
[Abstract] [Full Text] [PDF]


Home page
Genes Dev.Home page
S. Sachdev, L. Bruhn, H. Sieber, A. Pichler, F. Melchior, and R. Grosschedl
PIASy, a nuclear matrix-associated SUMO E3 ligase, represses LEF1 activity by sequestration into nuclear bodies
Genes & Dev., December 1, 2001; 15(23): 3088 - 3103.
[Abstract] [Full Text] [PDF]


Home page
Cell Growth Differ.Home page
M. S. Irwin and W. G. Kaelin
p53 Family Update: p73 and p63 Develop Their Own Identities
Cell Growth Differ., July 1, 2001; 12(7): 337 - 349.
[Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
A. L. Kurtzman and N. Schechter
Ubc9 interacts with a nuclear localization signal and mediates nuclear localization of the paired-like homeobox protein Vsx-1 independent of SUMO-1 modification
PNAS, April 25, 2001; (2001) 101129698.
[Abstract] [Full Text]


Home page
J. Virol.Home page
J.-H. Ahn, Y. Xu, W.-J. Jang, M. J. Matunis, and G. S. Hayward
Evaluation of Interactions of Human Cytomegalovirus Immediate-Early IE2 Regulatory Protein with Small Ubiquitin-Like Modifiers and Their Conjugation Enzyme Ubc9
J. Virol., April 15, 2001; 75(8): 3859 - 3872.
[Abstract] [Full Text]


Home page
J. Biol. Chem.Home page
T. Megidish, J. H. Xu, and C. W. Xu
Activation of p53 by Protein Inhibitor of Activated Stat1 (PIAS1)
J. Biol. Chem., March 1, 2002; 277(10): 8255 - 8259.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. Strano, E. Munarriz, M. Rossi, L. Castagnoli, Y. Shaul, A. Sacchi, M. Oren, M. Sudol, G. Cesareni, and G. Blandino
Physical Interaction with Yes-associated Protein Enhances p73 Transcriptional Activity
J. Biol. Chem., April 27, 2001; 276(18): 15164 - 15173.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
T. Buschmann, D. Lerner, C.-G. Lee, and Z.'e. Ronai
The Mdm-2 Amino Terminus Is Required for Mdm2 Binding and SUMO-1 Conjugation by the E2 SUMO-1 Conjugating Enzyme Ubc9
J. Biol. Chem., October 26, 2001; 276(44): 40389 - 40395.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C. Missero, M. T. Pirro, S. Simeone, M. Pischetola, and R. Di Lauro
The DNA Glycosylase T:G Mismatch-specific Thymine DNA Glycosylase Represses Thyroid Transcription Factor-1-activated Transcription
J. Biol. Chem., August 31, 2001; 276(36): 33569 - 33575.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
D. Schmidt and S. Muller
Members of the PIAS family act as SUMO ligases for c-Jun and p53 and repress p53 activity
PNAS, March 5, 2002; 99(5): 2872 - 2877.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
A. L. Kurtzman and N. Schechter
Ubc9 interacts with a nuclear localization signal and mediates nuclear localization of the paired-like homeobox protein Vsx-1 independent of SUMO-1 modification
PNAS, May 8, 2001; 98(10): 5602 - 5607.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
275/46/36316    most recent
M004293200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Minty, A.
Right arrow Articles by Caput, D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Minty, A.
Right arrow Articles by Caput, D.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2000 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement