HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

J. Biol. Chem., Vol. 275, Issue 47, 36676-36682, November 24, 2000

This Article Abstract Full Text (PDF) All Versions of this Article: 275/47/36676    most recent M002041200v1 Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Xu, W. Articles by DeLisle, S. Search for Related Content PubMed PubMed Citation Articles by Xu, W. Articles by DeLisle, S. Social Bookmarking                      What's this?

Calreticulin Modulates Capacitative Ca²⁺ Influx by Controlling the Extent of Inositol 1,4,5-Trisphosphate-induced Ca²⁺ Store Depletion^*

Wen Xu, Frank J. Longo^§¶, Mary R. Wintermantel^¶, Xueying Jiang, Robert A. Clark, and Sylvain DeLisle^**

From the  Veterans Affairs Medical Center and Departments of Medicine and Physiology, University of Maryland School of Medicine, Baltimore, Maryland 21201, the ^§ Department of Anatomy, ^¶ University of Iowa College of Medicine, Iowa City, Iowa 52242, and the  Department of Medicine, South Texas Veterans Health Care System and University of Texas Health Science Center, San Antonio, Texas 78230

Received for publication, March 10, 2000, and in revised form, September 5, 2000

	ABSTRACT

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS AND DISCUSSION REFERENCES

Calreticulin (CRT) is a highly conserved Ca²⁺-binding protein that resides in the lumen of the endoplasmic reticulum (ER). We overexpressed CRT in Xenopus oocytes to determine how it could modulate inositol 1,4,5-trisphosphate (InsP₃)-induced Ca²⁺ influx. Under conditions where it did not affect the spatially complex elevations in free cytosolic Ca²⁺ concentration ([Ca²⁺]_i) due to InsP₃-induced Ca²⁺ release, overexpressed CRT decreased by 46% the Ca²⁺-gated Cl current due to Ca²⁺ influx. Deletion mutants revealed that CRT requires its high capacity Ca²⁺-binding domain to reduce the elevations of [Ca²⁺]_i due to Ca²⁺ influx. This functional domain was also required for CRT to attenuate the InsP₃-induced decline in the free Ca²⁺ concentration within the ER lumen ([Ca²⁺]_ER), as monitored with a "chameleon" indicator. Our data suggest that by buffering [Ca²⁺]_ER near resting levels, CRT may prevent InsP₃ from depleting the intracellular stores sufficiently to activate Ca²⁺ influx.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS AND DISCUSSION REFERENCES

Since it was first isolated a quarter of a century ago (1), the protein calreticulin (CRT)¹ has been identified in a great variety of cells, implying an essential biological activity (2). Although CRT may be critical for cardiac development (3), to date, the nature of the cellular function of CRT remains poorly understood. CRT binds to steroid receptors (4, 5) and to integrins (6, 7) and thus could modulate gene transcription (8, 9) or cellular adhesion (2, 10-12). To reach these targets, however, CRT would need to be present both in the nucleus and the cytosol. Although CRT has been reported in these cellular compartments (see Refs. 2 and 10 but also see Ref. 13), the bulk of the protein clearly resides elsewhere, i.e. inside the endoplasmic reticulum (ER). Within the ER lumen, CRT may assist in the folding and assembly of glycoproteins (14-17). ER CRT may also act as a repository of readily releasable Ca²⁺, with each mole of CRT binding as many as 20-25 mol of Ca²⁺. Since Ca²⁺ release from the ER is controlled mainly by the second messenger inositol 1,4,5-trisphosphate (InsP₃), CRT emerges as a potential regulator of this ubiquitous signal transduction pathway.

The InsP₃-induced Ca²⁺ signal has two main components, the release of Ca²⁺ from the intracellular stores (InsP₃-induced Ca²⁺ release, or IICR) and the influx of Ca²⁺ across the plasma membrane (InsP₃-induced Ca²⁺ influx, or IICI). IICR starts when InsP₃ binds to its intracellular receptor (InsP₃R), a ligand-gated Ca²⁺ channel that traverses the lipid membrane surrounding the ER. The resulting discharge of ER Ca²⁺ into the cytosol is often spatially complex, with periodic focal release of Ca²⁺ actively spreading to the rest of the cell through mechanisms that remain incompletely understood (18). IICI commonly follows IICR, thereby allowing cells to recharge their internal stores. Stimulation of Ca²⁺ influx appears closely linked to the depletion of the intracellular Ca²⁺ stores, a relationship known as capacitative Ca²⁺ entry. We do not yet understand how Ca²⁺ store depletion stimulates Ca²⁺ influx. Store depletion could communicate with the plasma membrane through a diffusible messenger (19, 20), through secretion-like vesicular docking (21, 22), or through protein-protein interactions that may involve the InsP₃R itself (23-25).

Even though Ca²⁺ storage was the first function ascribed to CRT (1), we do not yet know what role, if any, CRT plays in the regulation of the InsP₃-induced Ca²⁺ signal. Whereas gene knock-out experiments indicate that CRT is not essential for IICR (11), overexpression of CRT has been associated with a decrease in the magnitude of IICI in mammalian cell lines (26-28). These results have prompted the hypothesis that CRT reduces capacitative Ca²⁺ entry by buffering the free Ca²⁺ concentration within the ER lumen ([Ca²⁺]_ER) above the levels required to trigger capacitative Ca²⁺ influx. In this work, our objective was to put this hypothesis to a rigorous test by directly measuring [Ca²⁺]_ER in a widely used model cell, the Xenopus oocyte. Our data indicate that CRT requires its high capacity Ca²⁺-binding domain both to attenuate the InsP₃-induced decrease in [Ca²⁺]_ER and to reduce the elevations of [Ca²⁺]_i due to IICI. The ability of CRT to buffer [Ca²⁺]_ER may thus be functionally relevant to the InsP₃-induced Ca²⁺ signal.

	EXPERIMENTAL PROCEDURES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS AND DISCUSSION REFERENCES

CRT and CRT Deletion Mutant Expression Vectors-- We inserted the CRT cDNA cloned from the HL60 human leukemia cell line (29) between the PstI and SalI sites of the pMT3 plasmid vector (30). We used the polymerase chain reaction (PCR) to build CRT mutants lacking functional domains. To remove the C-domain (CRT-C), we amplified the N and P domains of CRT (amino acids 2-315) and added a KDEL ER retrieval sequence at the C terminus (primers 1 and 2). The PCR fragment was digested with MluI and EcoRI and inserted between those sites in a modified pMT3. For the construct lacking the P-domain (CRT-P), we amplified the N-domain (amino acids 2-197, primers 1 and 3) and the C-domain (amino acids 316-401, primers 4 and 5) separately. The PCR fragments were then respectively digested with MluI/SpeI and with SpeI/EcoRI and ligated between the MluI and the EcoRI sites of pMT3. Primers sequence were as follows, from 5' to 3': primer 1, GTCACGCGTCTGCTATCCGTGCCGCTG; primer 2, CGGAATTCTCAGAGTTCATCCTTGCCCAGCACGCCAAAGTTATC; primer 3, CGTACTAGTTTCCAAGGAGCCGGAC; primer 4, GTCACTAGTCTGGATCTCTGGCAAGTCAAGTCTGG; primer 5, CGGAATTCTCATTCGAGTCTCACAGAGAC.

cDNA-directed Protein Expression and Western Blotting-- We prepared stage V-VI oocytes from albino Xenopus laevis and injected the DNA constructs into the nucleus as described previously (31, 32). Oocyte microsome purification, protein solubilization, SDS-polyacrylamide gel electrophoresis, and transfer to nitrocellulose were as outlined in the past (33). For immunoblotting, we used a polyclonal antibody raised against the full-length recombinant HL60 CRT (29). We performed all our functional studies 48-72 h after plasmid injection, when CRT expression level was found to be maximal in preliminary experiments.

Electrophysiology-- We assayed [Ca²⁺]_i by measuring Ca²⁺-activated Cl currents with the two-electrode voltage clamp technique (31). This assay has been validated using Ca²⁺-sensitive electrodes (34-36) and fluorescent Ca²⁺ indicators (31, 37-41). We performed intracellular injections and calibrated the injection pipettes as we had done in the past (31). Bath solution contained (in mM) the following: 116 NaCl, 2.0 KCl, 1.8 CaCl₂, 1 MgCl₂, 5 HEPES, pH 7.4. In the experiments where Ca²⁺ stores were to be irreversibly depleted, oocytes were incubated with 2 µM thapsigargin (Calbiochem) for 3 h (42, 43). Cells were then microinjected with 4 nmol of either EGTA (Sigma) or 1,2-bis(2-aminophenoxy)ethane-N,N,N',N'-tetraacetic acid (Molecular Probes, Eugene, OR) to prevent [Ca²⁺]_i elevations from activating the Ca²⁺-activated Cl currents. Cells were then put into a bath solution (in mM, either 70 MgCl₂ or 70 CaCl₂, 10 HEPES, pH 7.2), and the inward Ca²⁺ currents resulting from the influx of extracellular Ca²⁺ were directly measured with the two-electrode voltage clamp technique (43).

To ensure that the individual cells studied electrophysiologically expressed the protein of interest, plasmid cDNA coding for CRT or CRT mutants was co-injected with pMT3-sg25 (20:1 concentration ratio), a vector coding for an enhanced green fluorescent protein (GFP). We performed electrophysiology experiments on those live cells that showed the highest GFP fluorescence.

Monitoring [Ca²⁺]_ER with Fluorescence Resonance Energy Transfer (FRET)-- We excised the "yellow chameleon-3er or -4er" (3er or 4er) cDNAs (gifts from Dr. Roger Y. Tsien, Howard Hughes Medical Institute, University of California, San Diego, CA) from the pcDNA vector and inserted them between the NotI and EcoRI sites of pMT3. The 3er/4er Ca²⁺ indicators contain two mutated GFP yielding cyan (CFP) or yellow (YFP) fluorescence (44). The amino acids linking YFP to CFP include the sequences for CaM and for the M13 CaM-binding peptide. Upon Ca²⁺ binding, CaM enfolds M13 thereby creating FRET between YFP and CFP. To enable measurements of the relatively high [Ca²⁺]_ER, CaM sequences of 3er and 4er were modified to lower their affinity for Ca²⁺ (44). 3er and 4er also include sequences from CRT that allow their retrieval into the ER lumen. To measure FRET, we illuminated oocytes expressing 3er/4er ( = 440 ± 15 nm, DeltaRam monochromator, Photon Technology International, Monmouth Junction, NJ, 455DCLP dichroic mirror) and recorded the emission intensity at two wavelengths, 485 and 535 nm, using separate photomultiplier tubes (520DCLP dichroic mirror, D485/40M and D5356/30M emission filters, Chroma Technology, Brattleboro, VT). If we could not calibrate 3er in vivo, we could nevertheless use the 535/485 fluorescence ratio to compare [Ca²⁺]_ER among cells submitted to identical illumination. In these experiments, the gains of the photomultiplier tubes were carefully matched, and neutral black levels were determined experimentally (45).

Immunolocalization-- Oocyte cryosections (5 µm thick) were incubated for 30 min first with 1/200-1/500 dilutions of the anti-CRT antibody and then with a fluorescein isothiocyanate-conjugated anti-rabbit secondary antibody, and examined with a fluorescence microscope as described before (32). For ultrastructural studies, cryosections (10 µm thick) were fixed, incubated for 1 h in anti-CRT antibody and then overnight in anti-rabbit antibody conjugated to 5 nm gold particles (Janssen Life Sciences Products, Piscataway, NJ), and prepared for examination under in a Hitachi 7000 electron microscope (Hitachi Ltd., Tokyo) as described previously (32).

⁴⁵Ca²⁺ Uptake-- Oocytes injected either with pMT3 alone or with pMT3-CRT were incubated in ⁴⁵Ca²⁺-containing solution (8 µCi/ml). ⁴⁵Ca²⁺-related counts increased gradually and reached a plateau at 36-48 h, indicating equilibration across the Ca²⁺-binding compartments of the oocyte. After a 72-h incubation period, chosen to ensure isotopic equilibrium, intact oocytes were washed 5 times in cold solution and individually transferred to scintillation vials for counting. Alternatively, the washed oocytes were combined and homogenized, and their microsomes were purified and recovered on filter paper prior to counting, as per our previously published methodology (33).

Calcium Imaging and Confocal Microscopy-- Oocytes were injected with either fluo 3 alone (250 µM), Ca²⁺ orange alone (250 µM), or a mixture of fluo 3 (100 µM) and fura red (300 µM) (Molecular Probes). They were then stimulated with a 30-nl droplet of Ins(2,4,5)P₃ (10 µM) and the resulting fluorescence visualized on a confocal microscope as described previously (46). Ca²⁺ wave amplitude, velocity, frequency, as well as rates of rise/decrease in [Ca²⁺]_i at the wave fronts were determined as detailed before (32). To compare [Ca²⁺]_i between different cells using visible excitation wavelengths, we ratioed the simultaneously measured fluorescence signal from fluo 3 and fura red (45). The detailed validation of this technique in the oocyte has been previously published (32). Image analysis was performed using the NIH Image version 1.61 software.

	RESULTS AND DISCUSSION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS AND DISCUSSION REFERENCES

Overexpression of CRT in Xenopus Oocytes-- On a Western blot of microsomal proteins from which we have previously purified CRT, the ER lumenal protein calsequestrin and the InsP₃R (33, 47), an anti-CRT antibody (29), labeled an ~60-kDa protein (Fig. 1, 1st lane). After injection with pMT3-CRT, the density of this band increased significantly, indicating overexpression of CRT (Fig. 1, 2nd lane). Immunostaining revealed reticular fluorescence that increased from the vegetal to the animal pole of the cell in a pattern similar to that of control cells, but much brighter (Fig. 2). We observed a similar fluorescence pattern with overexpressed InsP₃R (32). Under electron microscopy using a gold-labeled secondary antibody targeted at an anti-CRT primary antibody, the gold particles were found in association with membranous cisternae most likely representing elements of the ER (Fig. 3). There was no label associated with mitochondria or with other organelles. Given CRT's ER retrieval sequences and lack of hydrophobic regions that can stretch across lipid bilayers, our data suggest that CRT is overexpressed within the ER lumen.

View larger version (64K): [in this window] [in a new window]   Fig. 1.   Overexpression of CRT in Xenopus oocyte. A, each lane represents an identical amount of solubilized microsomal protein submitted to SDS-polyacrylamide gel electrophoresis, transferred to nitrocellulose, and blotted with a polyclonal antibody against HL60-CRT. When compared with controls (1st lane), CRT (bands facing the closed arrow) was increased in cells microinjected with pMT3-CRT (2nd lane). Note the appearance of new bands (open arrow) in cells microinjected with pMT3-CRT-P (doublet in 3rd lane) or pMT3-CRT-C (4th lane).

View larger version (142K): [in this window] [in a new window]   Fig. 2.   Localization of CRT by immunofluorescence. Anti-CRT staining shows a marked increase in fluorescence signal in CRT-expressing oocytes (lower panels) compared with controls (upper panels). The reticular pattern, the subcortical columns (arrowheads), and the decreasing fluorescence from the animal pole (A and D) to the equatorial region (B and E) and to the vegetal pole (C and F) is typical of the ER distribution in oocytes. Oocytes exposed only to the secondary antibody were negative.

View larger version (116K): [in this window] [in a new window]   Fig. 3.   Localization of CRT by immunogold staining. Electron microscopy at the animal pole of an oocyte overexpressing CRT is indicated. Gold particles targeted against an anti-CRT antibody are associated with cisternae of endoplasmic reticulum (arrowheads).

CRT Decreases the [Ca²⁺]_i Elevations Due to Ca²⁺ Influx-- To investigate the effect of CRT overexpression on Ca²⁺ influx, we microinjected either pMT3 or pMT3-CRT in oocytes. We then stimulated the cells with a saturating concentration of InsP₃ (10 nl of 10³ M solution or a 10 µM average concentration) and assayed [Ca²⁺]_i by measuring Ca²⁺-gated Cl current with the two-electrode voltage clamp technique. The Ca²⁺-gated Cl current reflects [Ca²⁺]_i just beneath the plasma membrane (48, 49), where it is most likely to be affected by Ca²⁺ influx. The assay integrates the submembranous [Ca²⁺]_i changes across the entire surface of the plasma membrane, thereby maximizing our ability to detect changes in the magnitude of Ca²⁺ influx. In control cells, microinjection of InsP₃ (10³ M in the pipette) causes a biphasic response; there is a short initial increase in [Ca²⁺]_i followed by a slow increase (Fig. 4A). The fast initial component of the response, which is not affected by the removal of extracellular Ca²⁺, is due to the release of Ca²⁺ from the intracellular stores (50, 51). In contrast, the slow component of the response can be inhibited by decreasing the extracellular Ca²⁺ concentration or by adding inorganic Ca²⁺ channel blockers (Mn²⁺, Ni²⁺, and La³⁺) to the bath and thus depends on Ca²⁺ influx (50-52). Although the magnitude of the Cl currents due to IICR was similar to that of control cells (272 ± 28 nA in CRT versus 247 ± 23 nA in controls, n = 31 pairs of cells), the Ca²⁺ influx-dependent Cl current was reduced almost in half in cells overexpressing CRT (77 ± 15 nA versus 143 ± 19 nA in controls, n = 31 matched pairs of cells, one of which is shown in Fig. 4, p < 0.001). These results, which are consistent with those obtained in mammalian cell lines (26, 27), indicate that CRT reduces the rise in [Ca²⁺]_i due to Ca²⁺ influx. Direct measurements of whole cell current due to Ca²⁺ or Ba²⁺ entry have indicated that the Ca²⁺-gated Cl current assay has a high sensitivity for measuring the magnitude of Ca²⁺ influx (22, 43). Thus, our results suggest that CRT overexpression reduces the rate at which extracellular Ca²⁺ enters the cell.

View larger version (13K): [in this window] [in a new window]   Fig. 4.   Effect of CRT overexpression on the [Ca2+]i elevations due to Ca2+ influx. Successive experiments performed in a control cell (A) and a CRT-overexpressing cell (B) are shown. Each tracing represent the Cl current response to an intracellular injection of Ins(1,4,5)P3 (arrow) as a function of time. Downward deflection (inward current) represents an increase in [Ca2+]i. Note that the slow component of the biphasic response in the control cell (A) can be inhibited by lowering the extracellular [Ca2+] from 6 to 0.1 mM (bar) and is therefore due to Ca2+ influx. The Cl current due to Ca2+ influx is markedly diminished in the cell overexpressing CRT (B).

CRT Attenuates the InsP₃-induced Decline in [Ca²⁺]_ER-- In the context of capacitative Ca²⁺ entry, CRT could reduce IICI by buffering [Ca²⁺]_ER to levels above those required to stimulate Ca²⁺ influx. Because neither the precise value of [Ca²⁺]_ER nor the degree to which CRT contributes to the overall Ca²⁺-binding properties of the ER lumenal milieu is presently known, we could not confidently predict if/how altered CRT levels affect [Ca²⁺]_ER. To test this hypothesis, we therefore monitored [Ca²⁺]_ER directly with an ER-targeted FRET indicator, chameleon 3er (3er) (44). At base line, the 535/485 fluorescence emission ratios in cells co-expressing 3er and CRT were similar to the ratios found in cells expressing 3er alone (1.08 ± 0.07 versus 1.09 ± 0.07, n = 16 matched cell pairs). Because the 3er indicator saturates at [Ca²⁺] in excess of 100 µM (44), we repeated the experiments, this time expressing a lower affinity indicator, 4er, that could report [Ca²⁺]_ER between 10⁴ and 10² M. The 535/485 ratios in cells co-expressing 4er and CRT were also similar to the ratios found in control cells (0.79 ± 0.04 versus 0.81 ± 0.05, n = 6 matched cell pairs). These data indicate that overexpressed CRT does not measurably change the resting [Ca²⁺]_ER.

When microinjected with InsP₃ (10⁴ M in the pipette), the control oocyte showed a reversible decrease in the 535/485 fluorescence emission ratio of 3er, indicating a decrease in [Ca²⁺]_ER (see Fig. 5A). As shown in Fig. 5B, cells co-expressing CRT reached a smaller InsP₃-induced decline in the 535/485 emission ratio of 3er than did control cells (2.8 ± 0.8% versus 8.3 ± 0.6%, n = 16 matched cell pairs, p < 10⁵), suggesting that CRT overexpression attenuates the InsP₃-induced decline in [Ca²⁺]_ER.

View larger version (23K): [in this window] [in a new window]   Fig. 5.   Effect of CRT-overexpression on [Ca2+]ER. A, in a cell expressing the 3er FRET indicator and injected with InsP3 (arrow), the emission intensity increases at 485 nm (upper tracing, left axis) and decreases at 535 nm (middle tracing, left axis). Thus, the 535/485 fluorescence intensity ratio (lower tracing, right axis) decreases reversibly as function of time, indicating a decrease in [Ca2+]ER. B, peak decline in the 535/485 ratio of 3er due to an injection of InsP3 is more pronounced in cells expressing 3er alone (closed circles on the left) than in cells co-expressing 3er and CRT (open circles on the right). Base-line 535/485 ratio was normalized to 1.

The ability of CRT to maintain [Ca²⁺]_ER near resting levels uncouples Ca²⁺ store depletion from intracellular InsP₃ levels in a novel way; unlike the Ca²⁺ ATPase inhibitor thapsigargin, which deplete the stores at basal InsP₃ levels, overexpressed CRT prevented store depletion despite high InsP₃ levels. Recent evidence suggests that the role played by the InsP₃R in Ca²⁺ influx extends beyond simply lowering [Ca²⁺]_ER (25). In this context, our direct measurements of [Ca²⁺]_ER serve as a reminder that store depletion is required to stimulate Ca²⁺ influx and that elevated InsP₃, by itself, is not sufficient.

Effect of CRT on IICR-- The simplest mechanism by which CRT could prevent the InsP₃-induced decrease in [Ca²⁺]_ER would be to inhibit IICR. However, our data suggested that this was not the case with saturating concentrations of InsP₃; in the cells where CRT had decreased the Ca²⁺ influx-related Cl current, there was no change in the initial Cl currents due to IICR. Yet, in oocytes, CRT was previously reported to inhibit the Ca²⁺ waves triggered by sub-maximal concentrations of Ins(1,4,5)P₃ (53). To test the effect of CRT on the spatial aspects of IICR under experimental conditions where it could reduce Ca²⁺ influx, we microinjected sub-maximal InsP₃ concentrations into oocytes loaded with fluorescent Ca²⁺ indicators and visualized the resulting Ca²⁺ waves with a confocal microscope (46, 54). As shown in Fig. 6A, overexpression of CRT did not affect the amplitude, the velocity, or the frequency of the repetitive Ca²⁺ waves. To determine whether an increase in CRT levels changes the rate at which Ca²⁺ is released from intracellular stores, we examined the fluorescence intensity along a narrow linear path running perpendicular to the wave front; by multiplying the average slope of the increasing fluorescence values at the wave front (F/ distance) by the instantaneous speed of the wave ( distance/ time), we obtained the rate at which [Ca²⁺] rises at the wave front (F/ time) (32). The rate of rise in fluorescence intensity over base line at the wave front was 38 ± 4% s¹ for control cells and 36 ± 2% s¹ for CRT-expressing cells (19 wave pairs were randomly chosen from 8 CRT/control cell pairs) suggesting a similar rate of Ca²⁺ release at the wave front (Fig. 6A). Although our results that CRT expression did not change the amplitude of the Ca²⁺ waves agree with those of Camacho and Lechleiter (53), we did not find that CRT decreases Ca²⁺ waves frequency. Many reasons could explain this difference. 1) We studied our cells 2-3 days after DNA injection, whereas Camacho's group studied theirs after 5-7 days. Although we studied our cells at a time when CRT was already expressed maximally and could reduce Ca²⁺ influx, we may have missed a time-dependent effect of CRT on the Ca²⁺ waves. 2) We studied only those cells that had proven exogenous protein expression and that had preserved plasma membrane electrical resistance. Camacho and Lechleiter (53) did not screen individual cells for protein overexpression or for plasma membrane electrical integrity. Thus, the reported decrease in the frequency of Ca²⁺ waves could not be unequivocally ascribed to an increase in CRT levels and may have been restricted to cells that were electrically leaky. 3) Most of the experimental data reported by Camacho and Lechleiter (53) were obtained in cells co-expressing the Ca²⁺-ATPase SERCA2b. In a later publication, the same group (55) reported that CRT-C, which had inhibited the Ca²⁺ waves in cells co-expressing SERCA2b, had no effect on the Ca²⁺ waves in cells co-expressing SERCAs lacking an ER-lumenal glycosylation site. Thus, their results may mainly reflect an interplay between CRT and SERCA2b (55). Our results suggest that under conditions where an increased amount of CRT within the ER can reduce the InsP₃-induced decline in [Ca²⁺]_ER, CRT does not materially affect the mechanisms that initiate and propagate Ca²⁺ waves. Thus, CRT does not appear to diminish the InsP₃-induced decline in [Ca²⁺]_ER by inhibiting IICR.

View larger version (14K): [in this window] [in a new window]   Fig. 6.   Effect of CRT overexpression on InsP3-induced Ca2+ waves and on Ca2+ uptake. Each bar represent the mean value of a measured parameter in CRT-overexpressing cells as a percent of control values. A, effect of CRT overexpression on InsP3-induced Ca2+ waves. The five parameters measured were (bars from left to right) as follows: 1) basal [Ca2+] before the passage of a Ca2+ wave; 2) peak [Ca2+] at the wave front; 3) instantaneous wave velocity; 4) frequency of the repetitive waves; 5) rate of Ca2+ release at the wave front. B, effect of CRT overexpression on Ca2+ reuptake/extrusion. The three parameters measured were the rate at which peak [Ca2+]i decreases following either the passage of a Ca2+ wave (1st bar) or an intracellular injection of CaCl2 (2nd bar) and the ATP-dependent 45Ca2+ accumulation into purified microsomes (3rd bar). The number of Ca2+ wave pairs compared across 8-11 matched cell pairs is indicated above the 5 bars of A and the 1st bar of B. Number of experimental pairs is indicated above the 4th bar of A and the 2nd and 3rd bars of B. Asterisk indicates statistically significant difference compared with controls (p < 0.05). Except for slowing the return to basal [Ca2+]i following a Ca2+ injection, CRT overexpression affected none of the measured parameters.

Effect of CRT on Ca²⁺ Uptake and/or Ca²⁺ Extrusion-- CRT could blunt the InsP₃-induced decrease in [Ca²⁺]_ER if it accelerated the reuptake of cytosolic Ca²⁺ into the ER lumen. To investigate this alternative hypothesis, we first estimated the rate at which [Ca²⁺]_i returns to base line following the passage of a Ca²⁺ wave front using an analysis similar to that described in the preceding paragraph. We found that the rate of [Ca²⁺]_i decline was not accelerated in cells expressing CRT (Fig. 6B). Next, we scanned the site of an intracellular injection of CaCl₂ (1 nl, 50 mM) with a single laser line (scanning rate = 500 Hz) in oocytes loaded with fluo 3. Fluorescence due to this exogenous addition of Ca²⁺ returned to base line at a slower rate in oocytes expressing CRT (Fig. 6B). To assay more specifically Ca²⁺ uptake into the intracellular stores, we compared the ATP-dependent ⁴⁵Ca²⁺ uptake into microsomes isolated either from cells overexpressing CRT or from control cells. At 3 min, the time that the microsomes reach 50% of their total ATP-dependent ⁴⁵Ca²⁺ uptake (33), we found a trend toward lower ⁴⁵Ca²⁺ accumulation in microsomes from cells overexpressing CRT (Fig. 6B, p < 0.06). Together with the Ca²⁺ injections experiments, these last results suggest that CRT overexpression slows the rate of Ca²⁺ uptake into filled stores. In contrast, our data with the Ca²⁺ waves suggest that CRT does not measurably affect the rate of Ca²⁺ reuptake into InsP₃-depleted stores. Our results are thus compatible with a previous report of CRT inhibiting the ER Ca²⁺ ATPase (55) but further suggest that this inhibition can be overcome when [Ca²⁺]_ER decreases. Overall, these data do not support our alternative hypothesis that CRT reduces the InsP₃-induced decline in [Ca²⁺]_ER by accelerating Ca²⁺ reuptake/extrusion.

CRT Increases Cellular and Microsomal Ca²⁺-binding Capacity-- If CRT increases neither the magnitude of IICR nor the rate at which Ca²⁺ is retrieved back into the ER, then CRT could attenuate the InsP₃-induced decrease in [Ca²⁺]_ER simply by increasing the Ca²⁺-buffering capacity of the store; with more Ca²⁺ to start with, more Ca²⁺ should remain in the stores following InsP₃ stimulation. To measure the impact of CRT overexpression on cellular Ca²⁺ content, we incubated oocytes with ⁴⁵Ca²⁺ for 72 h, a time sufficient for the isotope to equilibrate across the Ca²⁺-binding compartments of the cell; ⁴⁵Ca²⁺-related counts were 52 ± 14% higher in cells expressing CRT than they were in control cells (84 cell pairs from five different frogs, p < 0.02). Microsomes purified from groups of 10 CRT-expressing oocytes had ⁴⁵Ca²⁺-related counts that were 59.3 ± 10% greater than controls (n = 4, p < 0.007). These data indicate that CRT overexpression increases whole cell and microsomal Ca²⁺ content and thus support the notion that CRT acts as a high capacity Ca²⁺ buffer in vivo. Because 80% of the ionomycin-releasable Ca²⁺ in these microsomes is InsP₃-sensitive (33), these data further suggest that CRT levels can influence the capacity of the InsP₃-sensitive Ca²⁺ pools of the oocyte.

High Capacity Ca²⁺-binding Domain of CRT Is Required to Prevent InsP₃-induced Store Depletion and to Reduce IICI-- To probe the relationship between Ca²⁺-buffering properties of CRT and its ability to curb the InsP₃-induced decrease in [Ca²⁺]_ER, we deleted the C-terminal domain, or C-domain (CRT-C), which is responsible for the high Ca²⁺-binding capacity of CRT (13). To serve as a control, and to investigate the alternative possibility that CRT could regulate the InsP₃-induced Ca²⁺ signal by sensing a decrease in [Ca²⁺]_ER (53), we also made a mutant lacking the P-domain (CRT-P), which contains the only high affinity Ca²⁺-binding site of CRT (13). Successful expression of both deletion mutants was confirmed by Western blotting (Fig. 1, 3rd and 4th lanes).

At isotopic equilibrium, whole oocytes or microsomes extracted from oocytes expressing CRT-C had ⁴⁵Ca²⁺-related counts that were no different from controls (respectively 103 ± 8% (25 cell pairs) and 91 ± 6% (n = 3) of controls (100%)). In contrast, oocytes or microsomes from oocytes expressing CRT-P had greater ⁴⁵Ca²⁺ counts than did controls (respectively, 148 ± 13% (25 cell pairs, p < 0.004) and 174 ± 14% (n = 3, p < 0.01) of controls (100%)) (Fig. 7A). Thus, CRT-P increased cellular and microsomal Ca²⁺-binding capacity to an extent similar to that observed with wild-type CRT. These results confirm that it is the C-domain that confers on CRT the ability to bind large quantities of Ca²⁺. Because this additional Ca²⁺ binds to the C-domain with low affinity (K_d ~2 mM), it should therefore be readily available for release into the cytosol upon opening of the InsP₃R. Yet, CRT overexpression did not affect the elevations in [Ca²⁺]_i due to IICR. Thus, additional releasable Ca²⁺ appears to have little impact on the magnitude of IICR in cells that already own substantial intracellular Ca²⁺ reserves.

View larger version (23K): [in this window] [in a new window]   Fig. 7.   The C-domain mediates the functional effects of CRT. The consequence of overexpressing either full-length CRT, CRT-P, or CRT-C on 45Ca2+ uptake into whole cells (filled bars) or microsomes (open bars), expressed as a percent of control values (A); the InsP3-induced decrease in [Ca2+]ER, expressed as a percent decrease from the base-line 535/485 emission ratio of 3er (B); and the magnitude of the Ca2+-gated Cl current due to IICR (closed bars) or IICI (hatched bars), expressed as a percent of control values (C). Asterisk indicates statistically significant difference (p < 0.01). Note that CRT-P, but not CRT-C, matches the ability of CRT to increase the cellular and microsomal Ca2+-binding capacity (A), prevent the InsP3-induced decline in [Ca2+]ER (B), and the [Ca2+]i elevations due to IICI (C).

The InsP₃-induced decline in the 535/485 emission ratio of 3er was smaller in cells co-expressing CRT-P than it was either in cells co-expressing CRT-C (2.6 ± 0.9% versus 8.3 ± 1.4% decline, respectively, n = 11 pairs, p < 0.002) or in control cells (7.9 ± 0.8%, n = 11) (Fig. 7B). As shown in Fig. 7C, CRT-P reduced the Cl currents due to Ca²⁺ influx, whereas CRT-C did not; neither protein changed the magnitude of the initial Cl current due to intracellular Ca²⁺ release. Taken together, these data indicate that CRT relies on the C-domain both to blunt the InsP₃-induced decline in [Ca²⁺]_ER and to reduce the [Ca²⁺]_i elevations due to IICI.

CRT Does Not Prevent Thapsigargin-induced Store Depletion from Fully Activating Ca²⁺ Influx-- If CRT acts primarily as a Ca²⁺ buffer to reduce Ca²⁺ influx, then a prolonged depletion of the Ca²⁺ stores should eventually lead to a full activation of Ca²⁺ influx. To test this hypothesis, we incubated oocytes with the Ca²⁺-ATPase inhibitor thapsigargin for 3 h (42), and we directly measured the resulting whole cell Ca²⁺ influx current according to the protocol of Yao and Tsien (43). As the tracings in Fig. 8A exemplify, the magnitude of the thapsigargin-induced Ca²⁺ influx current in cells overexpressing CRT was similar to that of controls (aggregate data for 7 cell pairs shown in Fig. 8B). Experiments with 3er-expressing oocytes confirmed that thapsigargin exposure decreases [Ca²⁺]_ER to a similar extent in control and in CRT-expressing cells (Fig. 8C). By demonstrating that store depletion can still fully stimulate Ca²⁺ influx in cells overexpressing CRT, these data further support the hypothesis that CRT controls InsP₃-induced Ca²⁺ influx by buffering [Ca²⁺]_ER.

View larger version (12K): [in this window] [in a new window]   Fig. 8.   Thapsigargin decreases [Ca2+]ER and fully activates Ca2+ influx in CRT-expressing cells. A and B, following thapsigargin exposure, an inward current (downward deflection) is induced by switching the divalent cation in the bath solution from Mg2+ (70 mM) to Ca2+ (70 mM) (bar in A). Note that this current is of similar magnitude in control (left tracing in A, closed bar in B) and in CRT-expressing oocytes (right tracing in A, open bar in B); C, thapsigargin induced a similar decline in the 535/485 fluorescence ratio of 3er in control (closed bar, n = 10) and CRT-expressing oocytes (open bar, n = 12).

In summary, our results establish that an increase in calreticulin levels can reduce the InsP₃-induced decline in [Ca²⁺]_ER, thereby confirming the proposal originally put forth by Pozzan and co-workers (26, 28). The experimental results also link the high Ca²⁺-buffering capacity of CRT to its ability both to prevent Ca²⁺ store depletion and to reduce Ca²⁺ influx. Taken together, the results directly support the notion that changing levels of CRT can alter [Ca²⁺]_ER within ranges that are relevant to the cellular mechanisms that control InsP₃-induced Ca²⁺ influx.

	FOOTNOTES

^* This work was supported by grants from the Department of Veterans Affairs (to S. D. and R. A. C.).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

^** Established Investigator at the American Heart Association. To whom correspondence should be addressed: Depts. of Medicine and Physiology, University of Maryland, 3B-185 Veterans Affairs Medical Center, 10 N. Greene St., Baltimore MD 21201. Tel.: 410-605-7000 (ext. 6449); Fax: 410-605-7957; E-mail: sdelisle@umaryland.edu.

Published, JBC Papers in Press, September 5, 2000, DOI 10.1074/jbc.M002041200

	ABBREVIATIONS

The abbreviations used are: CRT, calreticulin; CaM, calmodulin; ER, endoplasmic reticulum; [Ca²⁺], Ca²⁺ concentration; [Ca²⁺]_i, free cytosolic [Ca²⁺]; [Ca²⁺]_ER, free ER lumenal [Ca²⁺]; FRET, fluorescence resonance energy transfer; GFP, YFP, and CFP, green, yellow, and cyan fluorescent protein, respectively; IICI, InsP₃-induced Ca²⁺ influx; IICR, InsP₃-induced Ca²⁺ release; InsP₃, D-myo-inositol 1,4,5-trisphosphate; InsP₃R, inositol 1,4,5-trisphosphate receptor; PCR, polymerase chain reaction.

	REFERENCES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS AND DISCUSSION REFERENCES

CiteULike

Complore

Connotea

Del.icio.us

Digg

Reddit

Technorati

This article has been cited by other articles:

				Y. Hayashida, Y. Urata, E. Muroi, T. Kono, Y. Miyata, K. Nomata, H. Kanetake, T. Kondo, and Y. Ihara Calreticulin Represses E-cadherin Gene Expression in Madin-Darby Canine Kidney Cells via Slug J. Biol. Chem., October 27, 2006; 281(43): 32469 - 32484. [Abstract] [Full Text] [PDF]

				Y. Ihara, Y. Urata, S. Goto, and T. Kondo Role of calreticulin in the sensitivity of myocardiac H9c2 cells to oxidative stress caused by hydrogen peroxide Am J Physiol Cell Physiol, January 1, 2006; 290(1): C208 - C221. [Abstract] [Full Text] [PDF]

				Z. Wilczynska, K. Happle, A. Muller-Taubenberger, C. Schlatterer, D. Malchow, and P. R. Fisher Release of Ca2+ from the Endoplasmic Reticulum Contributes to Ca2+ Signaling in Dictyostelium discoideum Eukaryot. Cell, September 1, 2005; 4(9): 1513 - 1525. [Abstract] [Full Text] [PDF]

				A. Mery, F. Aimond, C. Menard, K. Mikoshiba, M. Michalak, and M. Puceat Initiation of Embryonic Cardiac Pacemaker Activity by Inositol 1,4,5-Trisphosphate-dependent Calcium Signaling Mol. Biol. Cell, May 1, 2005; 16(5): 2414 - 2423. [Abstract] [Full Text] [PDF]

				S. Treves, C. Franzini-Armstrong, L. Moccagatta, C. Arnoult, C. Grasso, A. Schrum, S. Ducreux, M. X. Zhu, K. Mikoshiba, T. Girard, et al. Junctate is a key element in calcium entry induced by activation of InsP3 receptors and/or calcium store depletion J. Cell Biol., August 16, 2004; 166(4): 537 - 548. [Abstract] [Full Text] [PDF]

				S. Arnaudeau, M. Frieden, K. Nakamura, C. Castelbou, M. Michalak, and N. Demaurex Calreticulin Differentially Modulates Calcium Uptake and Release in the Endoplasmic Reticulum and Mitochondria J. Biol. Chem., November 22, 2002; 277(48): 46696 - 46705. [Abstract] [Full Text] [PDF]

				W. Ding, B. Albrecht, R. E. Kelley, N. Muthusamy, S.-J. Kim, R. A. Altschuld, and M. D. Lairmore Human T-Cell Lymphotropic Virus Type 1 p12I Expression Increases Cytoplasmic Calcium To Enhance the Activation of Nuclear Factor of Activated T Cells J. Virol., September 11, 2002; 76(20): 10374 - 10382. [Abstract] [Full Text] [PDF]

				R. A. Clark, S.-L. Li, D. W. Pearson, K. G. Leidal, J. R. Clark, G. M. Denning, R. Reddick, K.-H. Krause, and A. J. Valente Regulation of Calreticulin Expression during Induction of Differentiation in Human Myeloid Cells. EVIDENCE FOR REMODELING OF THE ENDOPLASMIC RETICULUM J. Biol. Chem., August 23, 2002; 277(35): 32369 - 32378. [Abstract] [Full Text] [PDF]

				K. Kageyama, Y. Ihara, S. Goto, Y. Urata, G. Toda, K. Yano, and T. Kondo Overexpression of Calreticulin Modulates Protein Kinase B/Akt Signaling to Promote Apoptosis during Cardiac Differentiation of Cardiomyoblast H9c2 Cells J. Biol. Chem., May 24, 2002; 277(22): 19255 - 19264. [Abstract] [Full Text] [PDF]

				S. Persson, S. E. Wyatt, J. Love, W. F. Thompson, D. Robertson, and W. F. Boss The Ca2+ Status of the Endoplasmic Reticulum Is Altered by Induction of Calreticulin Expression in Transgenic Plants Plant Physiology, July 1, 2001; 126(3): 1092 - 1104. [Abstract] [Full Text] [PDF]