HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

J. Biol. Chem., Vol. 275, Issue 47, 37137-37149, November 24, 2000

This Article Abstract Full Text (PDF) All Versions of this Article: 275/47/37137    most recent M003941200v1 Submit a Letter to Editor Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Ghanshani, S. Articles by Chandy, K. G. Search for Related Content PubMed PubMed Citation Articles by Ghanshani, S. Articles by Chandy, K. G. Social Bookmarking                      What's this?

Up-regulation of the IKCa1 Potassium Channel during T-cell Activation

MOLECULAR MECHANISM AND FUNCTIONAL CONSEQUENCES^*

Sanjiv Ghanshani, Heike Wulff^§, Mark J. Miller, Heike Rohm, Amber Neben, George A. Gutman^¶, Michael D. Cahalan, and K. George Chandy

From the  Department of Physiology and Biophysics, and ^¶ Department of Microbiology and Molecular Genetics, University of California, Irvine, California 92697

Received for publication, May 9, 2000, and in revised form, August 10, 2000

	ABSTRACT

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

We used whole cell recording to evaluate functional expression of the intermediate conductance Ca²⁺-activated K⁺ channel, IKCa1, in response to various mitogenic stimuli. One to two days following engagement of T-cell receptors to trigger both PKC- and Ca²⁺-dependent events, IKCa1 expression increased from an average of 8 to 300-800 channels/cell. Selective stimulation of the PKC pathway resulted in equivalent up-regulation, whereas a calcium ionophore was relatively ineffective. Enhancement in IKCa1 mRNA levels paralleled the increased channel number. The genomic organization of IKCa1, SKCa2, and SKCa3 were defined, and IK_Ca and SK_Ca genes were found to have a remarkably similar intron-exon structure. Mitogens enhanced IKCa1 promoter activity proportional to the increase in IKCa1 mRNA, suggesting that transcriptional mechanisms underlie channel up-regulation. Mutation of motifs for AP1 and Ikaros-2 in the promoter abolished this induction. Selective Kv1.3 inhibitors ShK-Dap²², margatoxin, and correolide suppressed mitogenesis of resting T-cells but not preactivated T-cells with up-regulated IKCa1 channel expression. Selectively blocking IKCa1 channels with clotrimazole or TRAM-34 suppressed mitogenesis of preactivated lymphocytes, whereas resting T-cells were less sensitive. Thus, Kv1.3 channels are essential for activation of quiescent cells, but signaling through the PKC pathway enhances expression of IKCa1 channels that are required for continued proliferation.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Lymphocyte activation involves two key intracellular signaling pathways, the calcium-signaling cascade and protein kinase C (PKC)¹-dependent events. Stimulation of either of these pathways is capable of triggering different gene transcription events, and both are required for complete lymphocyte activation. A recent gene-chip survey of T-cells stimulated with a variety of mitogens, detected the induction of hundreds of genes (1). The rise in intracellular calcium ([Ca²⁺]_i) activates calcineurin, a phosphatase that dephosphorylates the cytoplasmic transcription factor NFAT (nuclear factor of activated T-cells), enabling it to translocate to the nucleus and bind to NFAT-response elements of several genes, including the T-cell growth factor interleukin-2 (IL-2) (2, 3). The immunosuppressive drug, cyclosporin A (CsA), blocks this pathway by interacting with calcineurin and thereby suppresses activation (3, 4). In a separate pathway, activation of PKC leads to phosphorylation of numerous substrates and results in assembly of Fos/Jun heterodimers that bind to activation protein-1 (AP1) elements on an overlapping set of genes via activation of the Ras and JNK (c-Jun N-terminal kinase) pathways. The functional significance of PKC, in particular, has been recently demonstrated (5, 6). Cross-talk between these signaling pathways integrates the activation response. For example, the JNK pathway is co-activated by increases in cytoplasmic calcium (7). Sustained [Ca²⁺]_i signaling, mediated by calcium entry through calcium release-activated Ca²⁺ (CRAC) channels, and PKC activation are both essential for complete activation.

Two potassium channels, the voltage-gated K⁺ channel Kv1.3 and the calcium-activated K⁺ channel IKCa1 (also known as KCNN4, IK1, hKCa4, and hSK4) (8-10), modulate calcium influx through CRAC channels by regulating the membrane potential and hence the driving force for calcium entry (11). Freshly isolated resting human T-cells functionally express on average ~300 Kv1.3 channels (11-13) along with ~10 IKCa1 channels (14). During activation with phytohemagglutinin (PHA), expression of IKCa1 channels is strongly enhanced, while levels of Kv1.3 exhibit a modest enhancement (13, 14). Changes in expression levels of K⁺ channels during activation have also been noted in murine T-cells (15) and in human and murine B cells (16, 17). A recent gene chip survey (1) revealed a reduction in Kv1.3 mRNA levels in activated compared to resting T-cells, suggesting that post-transcriptional mechanisms contribute to the up-regulation of this channel.

In this study, we define the pathway leading to IKCa1 up-regulation using phorbol myristate acetate (PMA) to trigger PKC selectively or ionomycin to stimulate the calcium-dependent cascade, and other mitogens (anti-CD3 Ab or PHA) that stimulate both pathways. By combining electrophysiological and molecular methods we show that stimulation of the PKC pathway alone is sufficient to enhance IKCa1 channel expression via transcriptional activation of the IKCa1 promoter. A reporter gene assay combined with mutational analysis defined the minimally active promoter region of the IKCa1 gene, demonstrating the importance of AP1, the PKC-dependent site of binding by Fos/Jun heterodimers. Using selective Kv1.3 and IKCa1 inhibitors we demonstrate an important functional role of Kv1.3 channels in resting T-cells and IKCa1 channels in activated T-cells.

	EXPERIMENTAL PROCEDURES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Reagents-- CsA, clotrimazole, econazole, ketoconazole, and tetraethylammonium chloride were from Sigma, nifedipine, nimodipine, and nitrendipine were from RBI (Natick, MA), PHA was from DIFCO (Detroit, MI), PMA was from Calbiochem (La Jolla, CA), monoclonal mouse anti-human CD3 Ab was from Biomeda (Foster City, CA), charybdotoxin (ChTX), ChTX-Glu³², ShK (Stichodactyla helianthus) toxin, ShK-Dap²², and margatoxin were from BACHEM (King of Prussia, PA). TRAM-34 ([1-(2-chlorophenyldiphenyl)methyl]1H-pyrazole) was described previously (18). Correolide was a gift from Dr. Maria L. Garcia (Merck, Rahway, NJ).

Reporter Constructs-- Luciferase reporter gene plasmids, pGL2-enhancer (pGL2-e) and pGL2-basic (pGL2-b), were purchased from Promega (Madison, WI). Parent luciferase constructs correspond to a 5'-flanking subfragment (1877/+395) in pGL2-e and pGL2-b vectors in both orientations. Deletion fragments, generated by polymerase chain reaction, were engineered in both orientations into pGL2-e or pGL2-b. Ik-2 (TTGCTGGGAGTT), AP1 (GTGAGTCAC), and Ik-2/AP1 (TTGCTGGGAGTTGTGAGTCAC) sites in the 117/+34 fragment (Fig. 8) were mutated to the following sequences: Ik-2 mutant, ACCCCTTTTTTT; AP1 mutant, TTGGGGGGG; and Ik-2M/AP1M, ACCCCAAAAAAAAACCCAACC. The orientation and integrity of all constructs were confirmed by sequencing. The IL-2-pGL2-e construct (19) was a gift from Dr. C. Hughes (University of California, Irvine, CA).

Genomic Organization of IKCa1-- 1.1 × 10⁶ plaques from a human EMBL3 genomic  library (CLONTECH, Palo Alto, CA) were screened with a human IKCa1 (accession number AF033021) coding region probe to a final stringency of 1 × SSC and 0.1% SDS at 65 °C for 45 min. Five clones were isolated and two of these, KCNN4-9 and KCNN4-16 (which hybridized to both the 5' and 3' fragments of the probe) were further characterized. Precise location of the exon/intron boundaries was established by sequencing across the junctions in genomic DNA with primers derived from the cDNA sequence.

Northern Blot Analysis-- Northern blots (CLONTECH) were hybridized to an IKCa1-specific probe in Expresshyb solution (CLONTECH), washed at a final stringency of 0.1 × SSC, 0.1% SDS for 40 min at 55 °C, and exposed to x-ray film at 80 °C with an intensifying screen for 3-5 days. The IKCa1 probe corresponds to amino acid residues 380-427 and includes ~490 bp of 3' noncoding sequence. Blots were stripped and re-probed with the control -actin probe (CLONTECH). For Northern blot experiments on peripheral blood lymphocytes, poly(A)⁺ RNA was isolated from resting (2 × 10⁸ cells) and mitogen-activated human MNC (9 × 10⁷ cells) using the Ambion Pure mRNA Isolation kit (Ambion, Austin, TX). Cells were activated for 24 h with PHA (5 µg/ml) or PMA (40 nM). A Northern blot containing 2 µg of mRNA/lane was probed and washed as described. Northern blots were scanned and the intensity of bands determined by densitometry. The IKCa1 mRNA levels were normalized against the control probe, LEF (lymphoid enhancing factor).

Primer Extension-- The Primer Extension System (Promega) was used to define the transcription initiation site. Briefly, an antisense primer (5'-ATGGGCTTTGTCACACACAATGG-3') located 52 bases downstream of the 5'-end of the previously reported IKCa1 cDNA (accession number AF022797) was end-labeled using T4 polynucleotide kinase. In parallel reactions, 0.4 pmols labeled primer was annealed to either 20 µg of human placental total RNA (Ambion) or 10 µg of yeast tRNA at 68 °C for 20 min and cooled for 10 min at room temperature. The annealed primer was next extended at 48 °C for 30 min in the presence of AMV Primer Extension Buffer (50 mM Tris-HCl, pH 8.3, 50 mM KCl, 10 mM MgCl₂, 10 mM dithiothreitol, 1 mM of each of four dNTPs, and 0.5 mM spermidine), 3 mM sodium pyrophosphate, and 20 units of AMV reverse transcriptase. Extension products were concentrated, and loaded onto a 6% polyacrylamide gel adjacent to a sequencing reaction of genomic DNA primed with the same oligonucleotide. In vitro transcribed kanamycin RNA and the control primer (Promega) produced an extension product that served as a positive control for the reaction.

Transfection of Human Peripheral Blood T Lymphocytes-- In order to transfect primary T-cells, we stimulated them with a submitogenic dose of PHA (1 µg/ml) which induces these cells to pass through a "window" (at 19.5-20.5 h) of transfection competency without concomitant cytokine production or cell proliferation (20, 21). Normal human peripheral blood MNC, isolated by density sedimentation (Accuspin System-Histopaque-1077 tubes; Sigma Diagnostics), were grown (3 × 10⁶ cells/ml) for ~19.5 h in complete RPMI medium (RPMI 1640 supplemented with 10% fetal calf serum, 2 mM glutamine, 1 mM Na⁺ pyruvate, 1% nonessential amino acids, 100 units/ml penicillin, 100 µg/ml streptomycin, 50 µM -mercaptoethanol) and 1 µg/ml PHA to induce transfection competence (20). They were re-counted to determine the number of living cells, centrifuged, and re-suspended in fresh medium at 2 × 10⁷ cells/ml. Aliquots of 0.25 ml were electroporated at room temperature with 25 µg of DNA of each IKCa1 construct in a Bio-Rad Gene Pulser at 250 volts and 960 microfarads (21), transferred to 10 ml of medium and allowed to rest for 1-2 h at 37 °C. Viable cells were counted and re-suspended in fresh medium at 3 × 10⁶ cells/ml.

Luciferase Assays-- Luciferase activity was measured in triplicate in aliquots of transfected peripheral blood human T-cells (~3 × 10⁵ cells in 100 µl) or human Jurkat T-cells (>8 × 10⁵ in 1 ml) at various times after transfection and/or mitogen (5 µg/ml PHA or 40 nM PMA, or both in combination) stimulation. Cells were lysed in Reporter Lysis Buffer (Promega), harvested, and cleared of debris by centrifugation. 40 µl of supernatant was mixed with Luciferase Assay Reagent (Promega) and the reaction monitored for 10 s in a Monolight 2010 luminometer (Analytical Luminescence Laboratory, San Diego, CA). To monitor equal transfection efficiency of deletion constructs, in initial experiments we co-transfected the pTRACER construct (containing green fluorescent protein) and counted fluorescent cells. These experiments showed that all constructs were transfected with approximately equal efficiency of ~5%.

Electrophoretic Mobility Shift Assay-- Sequences of oligonucleotides used in the gel shift assay are as follows: AP1 wt sense, 5'-CTGGGAGTTGTGAGTCACTCTGTG-3'; AP1 mut sense, 5'-CTGGGAGTTAACCCATCCTCTGTG-3'; AP1 wt antisense, 5'-CACAGAGTGACTCACAACTCCCAG-3'; AP1 mut antisense, 5'-CACAGAGGATGGGTTAACTCCCAG-3'. Double-stranded Commercial-AP1 oligonucleotide (Promega): 5'-CGCTTGATGAGTCAGCCGGAA-3' and 3'-GCGAACTACTCAGTCGGCCTT-5'. IKCa1 double-stranded probes were prepared by annealing equimolar amounts of complementary single-stranded oligonucleotides in a thermal cycler with the following protocol: 5 min at 94 °C, 20 min at 60 °C, 25 min at 45 °C, 30 min at 30 °C, 30 min at 15 °C; ramp between steps of 0.1 °C/s. Typically, 4 pmol of double-stranded oligonucleotide were end-labeled using T4 polynucleotide kinase and diluted to a concentration of 20 fmol/µl. Binding reactions (10 µl) contained 5 µg of HeLa cell extracts (Promega), 100-250 ng of poly[dI-dC] (Amersham Pharmacia Biochem), gel shift binding buffer (10 mM Tris-HCl, pH 7.5, 1 mM MgCl₂, 0.5 mM EDTA, 4% glycerol, 0.5 mM dithiothreitol, 100 mM NaCl), and 20 fmol of labeled oligonucleotide. Reactions were preincubated 15 min at room temperature (or at 4 °C) without probe and an additional 15 min at room temperature (or at 4 °C) after addition of labeled probe. An additional 15-min incubation at room temperature was included when unlabeled competitor oligonucleotides (100-fold molar excess) were introduced to the binding reaction. After binding, 1 µl of loading dye was added and the reactions were electrophoresed at room temperature on a nondenaturing 4% polyacrylamide gel in 0.5 × Tris-Borate-EDTA buffer for 4 h at 140 V. Gels were dried and exposed to film at 80 °C with an intensifying screen.

Electrophysiological Analysis-- COS-7 cells were transiently transfected with N-terminal green fluorescent protein-tagged hIKCa1 cDNA with FuGene^TM 6 (Roche) according to the manufacturer's protocol. For other experiments, RBL cells were microinjected with IKCa1 cRNA as described previously (22). All experiments were carried out in the whole cell configuration of the patch clamp technique with a holding potential of 80 mV. An internal pipette solution consisting of (in mM): 145 potassium aspartate, 10 K₂EGTA, 8.5 CaCl₂, 2.0 MgCl_2, 10 HEPES, pH 7.2, 290-310 mOsm, with a calculated free [Ca²⁺]_i of 1 µM was used to activate the IKCa1 channel. Data were corrected for a liquid junction potential of 13 mV caused by an aspartate-based internal solution, with normal Ringer as the bath solution containing (in mM) 160 NaCl, 4.5 KCl, 2 CaCl₂, 1 MgCl₂, 10 HEPES, pH 7.4. Currents during voltage ramps from 160 to +40 mV over 200 ms were recorded every 10 s. In other experiments, ramp currents were elicited by 225-ms voltage ramps from 120 to +30 mV every 5 s before and during the application of K⁺-Ringer or Rb⁺-Ringer.

Human MNCs were either nylon-wool purified and then activated with 5 µg/ml PHA, 40 nM PMA, 10 nM PMA + 175 nM ionomycin, or 175 nM ionomycin; or activated with 5 ng/ml anti-CD3 Ab and then nylon-wool purified directly before the experiments. The same aspartate-based pipette solution as above was used with Na⁺-aspartate Ringer as an external solution (in mM: 160 Na⁺ aspartate, 4.5 KCl, 2 CaCl₂, 1 MgCl₂, 5 HEPES, pH 7.4). Voltage ramps from 120 to +40 mV over 200 ms were applied every 30 s. Kv1.3 currents in activated T lymphocytes were measured in normal Ringer with an internal pipette solution containing (in mM) 134 KF, 2 MgCl₂, 10 HEPES, 10 EGTA. 200-ms depolarizing pulses to 40 mV were applied every 30 s and K_d values were determined by fitting the Hill equation to the reduction of peak current.

[³H]Thymidine Incorporation Assay-- Resting or 2-day activated (5 ng/ml anti-CD3 Ab) cells were washed 3 times, re-suspended and seeded at 2 × 10⁵ cells/well in culture medium in flat-bottom 96-well plates (final volume 200 µl). These cells were preincubated with drug (60 min), and then stimulated with mitogen (5 ng/ml anti-CD3 Ab) for 48 h. [³H]Thymidine (1 µCi/well) was added for the last 6 h. Cells were harvested onto glass fiber filters and radioactivity measured in a scintillation counter.

Intracellular Fluorescence Activated Cell Sorter Assay for IL-2 and Interferon- (IFN-)-- MNCs were washed 3 times in complete RPMI medium, re-suspended at a concentration of 3 × 10⁶ cells/ml, and allowed to rest overnight in an upright costar T-75 tissue culture flask. Cells were placed in small Falcon tubes (1 × 10⁶/ml) and stimulated with 10 nM PMA, 10 nM PMA + 175 nM ionomycin, PMA + ionomycin + 25 nM CsA, or PMA + ionomycin + 1 µM TRAM-34. After 48 h stimulation, cells were treated with brefelden A (Golgi Plug, Pharmingen BD) for 12 h to inhibit intracellular transport. Cells were pelleted at 1200 × g, vortexed, fixed, and permeablized with Cytofix/Cytoperm solution (Pharmingen BD) and washed 2 times in Perm/Wash solution (Pharmingen BD). The cells were then stained with anti-CD4-PE antibodies along with either anti-IL-2-fluorescein isothiocyanate or IFN--fluorescein isothiocyanate antibodies, re-washed 3 times and then analyzed using a Becton Dickinson FACScan flow cytometer. The number of CD4+ T-cells (red channel) that expressed intracellular IL-2 or IFN- (green channel) was determined. The green/red channel compensation and gain were set using singly stained samples and isotype matched controls.

	RESULTS

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Pharmacological Profile of the Cloned IKCa1 Channel Matches the IK_Ca Channel in Human T Cells-- We initially compared characteristics of the cloned intermediate-conductance calcium-activated channel, IKCa1, expressed in COS or RBL cells, with native IK_Ca currents in resting and activated human T lymphocytes. Cloned IKCa1 channels and native IK_Ca current both exhibit a P_Rb/P_K permeability ratio of 1.2 (Fig. 1A) and are blocked in a voltage-dependent manner by 10 mM Ba²⁺ (Fig. 1B) and 16 mM Cs⁺ (data not shown) (14). In Fig. 1C we show that the cloned IKCa1 channel is also blocked by peptides ChTX and ShK, and by a ChTX analog, ChTX-Glu³², designed to target the IKCa1 channel specifically (23). Several structurally diverse small molecules also block the cloned channel (Fig. 1C), including clotrimazole, TRAM-34, nitrendipine, nimodipine, nifedipine, econazole, ketoconazole, and tetraethylammonium chloride, with potencies similar to that of the endogenous channel in T-cells. The close similarity in ion selectivity and pharmacological characteristics, here using 11 channel blockers spanning 7 log units of potency, strongly suggests that the native channel is a homotetramer of IKCa1 subunits, in agreement with previous reports (10, 14, 22, 24).

View larger version (27K): [in this window] [in a new window]   Fig. 1.   Expression of the IKCa1 channel in mammalian cells. A, selectivity sequence of monovalent cations for the IKCa1 channel expressed in RBL cells. B, Ba2+ block of IKCa1. IKCa1 channels were activated as in A and ramp currents recorded with the bath solution changed from K+-Ringer to a K+-Ringer solution containing 10 mM Ba2+. C, dose-dependent block of IKCa1 current in RBL or COS-7 cells by inhibitors: ChTX (, Kd = 3 ± 2 nM, RBL), TRAM-34 (, Kd = 20 ± 3 nM; COS-7), ShK toxin (, Kd = 30 ± 7 nM; RBL), ChTX-Glu32 (, Kd = 33 ± 8 nM; RBL), clotrimazole (, Kd = 70 ± 10 nM; COS-7), nitrendipine (, Kd = 0.9 ± 0.1 µM; COS-7), nimodipine (, Kd = 1 ± 0.1 µM; COS-7), nifedipine (, Kd = 4 + 0.3 µM; COS-7), econazole (, Kd = 12 ± 1 µM; COS-7), ketoconazole (×, Kd = 30 ± 4 µM; COS-7), and tetraethylammonium chloride (, Kd = 24 mM; RBL). IKCa1 currents were activated as in A and ramp currents were elicited every 10 s in normal Ringer solution and then in the presence of varying amounts of each blocker. Kd values for each blocker (n = 3, mean ± S.D.) were determined from the reduction of slope conductance at 80 mV.

Mitogen-induced Up-regulation of IKCa1 Channels in Human T-cells-- To determine the effect of mitogen stimulation on IKCa1 expression, whole cell patch clamp measurements were performed on lymphocytes pre-stimulated to activate either the calcium signaling cascade, PKC-dependent events, or both. As an example, Fig. 2 illustrates up-regulation of IKCa1 currents in T-cells pre-stimulated through the T-cell receptor by the anti-CD3 Ab to trigger both calcium signaling and PKC. Two components of K⁺ current can be observed during voltage ramps in T-cells dialyzed with 1 µM free Ca²⁺ in the pipette. At potentials more negative than 40 mV, IKCa1 currents are induced rapidly upon break-in to achieve whole cell dialysis with 1 µM free Ca²⁺ in the pipette, as illustrated by changes in slope conductance with a reversal potential of 80 mV (Fig. 2A). At depolarized potentials, K⁺ currents are carried by a combination of IKCa1 and Kv1.3 channels. With 50 nM Ca²⁺ in the pipette, only Kv1.3 currents are observed (Fig. 2B). Clotrimazole selectively blocks the IKCa1 current, while ShK-Dap²² (25) selectively blocks the residual Kv1.3 current (Fig. 2C), pharmacologically confirming the channels' identity in resting and activated T-cells. In cells activated with anti-CD3 Ab for 2 days, the increased slope conductance near 80 mV indicates a dramatic enhancement in IKCa1 conductance, compared with resting cells (Fig. 2D). A similar enhancement of IKCa1 current is observed in cells pretreated with PMA for 48 h (Figs. 2, E and F). Kv1.3 currents are also enhanced in both anti-CD3 Ab- and PMA-activated cells (Fig. 2, D and F) in agreement with previous results (13, 14). Acute treatment of resting T-cells with PMA (1-4 h) did not augment IKCa1 conductance (0.022 ± 0.029 nS; 0.009 ± 0.009 nS/pF; mean ± S.D.) compared with resting T-cells (Fig. 3), suggesting that the enhanced IKCa1 conductance is most likely due to an increase in channel number induced by the activation stimulus, rather than modulation of existing channels.

View larger version (27K): [in this window] [in a new window]   Fig. 2.   Up-regulation of IKCa1 currents in human T-cells stimulated with PMA, anti-CD3 or PHA. A-C, currents from 2-day anti-CD3 Ab activated cells. A, following break-in with 1 µM free Ca2+ in the pipette IKCa1 currents develop with time. B, IKCa1 currents are seen with 1 µM free Ca2+ in the pipette but not with 50 nM Ca2+. C, effect of clotrimazole and ShK-Dap22 on K+ currents in T lymphocytes activated with anti-CD3 Ab. D, currents from a resting T-cell compared with those from 1- and 2-day anti-CD3 Ab-activated T-cells. E, effect of clotrimazole and ShK-Dap22 on K+ currents in 2-day PMA-activated T lymphocytes. F, currents from a resting T-cell compared with those from 1- and 2-day PMA-activated T-cells.

View larger version (35K): [in this window] [in a new window]   Fig. 3.   Increased IKCa1 conductance following T-cell activation. IKCa1 conductance on days 1 and 2 in cells stimulated with anti-CD3 Ab (5 ng/ml), PHA (5 µg/ml), PMA (40 nM), or ionomycin (175 nM), or a combination of PMA and ionomycin compared with the IKCa1 conductance in quiescent cells. Also shown is the effect of 100 nM CsA on IKCa1 up-regulation by PMA and ionomycin. The mean ± S.D. for IKCa1 conductance, channel number, membrane capacitance, normalized IKCa1 conductance, and channel density are shown below each column. Also included in the table below each column are the counts for [3H]thymidine incorporation (a measure of DNA synthesis) on days 1 and 2 for each stimulus (± S.D.).

Fig. 3 summarizes experiments with a variety of stimuli, assaying the expression of IKCa1 channels. The number of channels per cell was computed by dividing the whole cell conductance by the measured single-channel conductance of 11 pS (14). Resting T-cells have an average IKCa1 conductance of ~0.1 nS, corresponding to an average of 8 channels/cell. As described previously (14), the mitogenic lectin PHA augments IKCa1 expression dramatically (second and third columns). The average IKCa1 conductance 24 h after PHA stimulation is 0.37 nS (34 channels/cell), representing a 4-fold increase that is statistically significant (p = 0.006). By day 2, the IKCa1 conductance increases substantially to ~5.7 nS, corresponding to 520 channels/cell (a 65-fold increase). In comparison, following stimulation with anti-CD3 Ab, the conductance increases more rapidly, to ~1.25 nS (113 channels/cell) on day 1 and to ~5.69 nS (516 channels/cell) on day 2 (fourth and fifth columns, Fig. 3). Since lymphocytes enlarge during activation, we measured membrane capacitance to determine each cell's surface area and surface density of IKCa1 channels. The surface area of T-cells increases 3-fold following PHA or anti-CD3 Ab stimulation (Fig. 3). When normalized for membrane capacitance, the normalized IKCa1 conductance in resting cells is 0.05 nS/pF, representing a very low channel density of 0.04 channels/µm². The channel density increases 15-20-fold following PHA or anti-CD3 Ab stimulation. We conclude that the up-regulation of IKCa1 channel expression more than compensates for the increased membrane surface area, resulting in a substantial increase in surface density.

T-cells were treated with either the phorbol ester PMA (triggers PKC pathway) or with ionomycin (activates calcium cascade) for 1 and 2 days and then analyzed by whole cell patch clamp to determine if either pathway alone is sufficient for IKCa1 up-regulation. PMA dramatically enhances IKCa1 conductance on days 1 and 2 (sixth and seventh columns, Fig. 3). Within 1 day of PMA activation, the IKCa1 channel number increases to ~100 channels/cell (1.12 nS), and by day 2 the number is ~370 channels/cell (4.1 nS). Interestingly, PMA-induced up-regulation of IKCa1 on day 1 is not accompanied by measurable changes in membrane capacitance, although by day 2 the increase in IKCa1 current is accompanied by a modest enhancement in membrane capacitance (Figs. 3 and 4). The selective enhancement of IKCa1 conductance is best illustrated by Fig. 4, demonstrating that PMA can increase conductance values relative to resting T-cells, without increasing membrane capacitance. When normalized for membrane capacitance, PMA augments IKCa1 channel density about 10-fold to 0.5 channels/µm² (normalized conductance = 0.59 nS/pF) on day 1, increasing further to 1.2 channels/µm² (normalized conductance = 1.43 nS/pF on day 2). Up-regulation of IKCa1 conductance occurs prior to cell enlargement (Fig. 4), and in the absence of cell DNA synthesis (measured by [³H]thymidine incorporation, Fig. 3), or production of IL-2 (2-day PMA-treated cells = 12% IL-2⁺; resting cells = 15% IL-2⁺) or IFN- (2 day PMA-treated cells = 11% IFN-⁺; resting = 10% IFN-⁺). Taken together, these results indicate that activation of the PKC-dependent signaling pathway alone leads to an increase in IKCa1 expression equivalent to the augmentation found when both pathways are triggered by anti-CD3 Ab or PHA, and this up-regulation is a relatively early event during T-cell mitogenesis.

View larger version (10K): [in this window] [in a new window]   Fig. 4.   IKCa1 conductance versus membrane capacitance. Resting cells (, n = 24), 1-day PMA-activated cells (, n = 19), 1-day anti-CD3 antibody stimulated cells (+, n = 19).

Activation of the calcium pathway by the calcium ionophore, ionomycin, has a smaller effect on IKCa1 expression, compared with PMA stimulation (sixth, seventh, and ninth columns, Fig. 3). Two days after activation with ionomycin, the average number of IKCa1 channels increases 3-fold to 24 channels/cell (conductance = 0.3 nS), with a corresponding small increase in membrane capacitance (Fig. 3). Activation of both pathways with a combination of PMA and ionomycin enhances the total number of IKCa1 channels per cell, compared with PMA-activated cells, without affecting the channel density (Fig. 3), although ionomycin alone is a very weak stimulus. CsA (100 nM), an immunosuppressant that blocks the NFAT pathway, partially suppresses the PMA + ionomycin-induced enhancement in IKCa1 expression (135 channels/cell; normalized conductance 0.40 nS/pF; column 10, Fig. 3), but not to the level in resting cells. This concentration of CsA suppresses mitogen-induced [³H]thymidine incorporation (Fig. 3) and intracellular expression of the cytokines IL-2 (quiescent cells = 15% IL-2⁺; 2 day PMA + ionomycin-treated cells = 47% IL-2⁺; PMA + ionomycin + CsA-treated cells = 21% IL-2⁺) and IFN- (resting: 10% IFN-⁺; 2 day PMA + ionomycin = 63% IFN-⁺; 2 day PMA + ionomycin + CsA = 29% IFN-⁺). Collectively, these data indicate that IKCa1 channel up-regulation is mediated primarily through the PKC pathway, with calcium signaling events potentiating the PMA-induced channel up-regulation.

New Synthesis Contributes to the Up-regulation of IKCa1 in Mitogen-activated Lymphocytes-- Mitogen up-regulation of IKCa1 might be a consequence of new synthesis of the IKCa1 mRNA and/or protein, or due to the recruitment and activation of pre-existing IKCa1 molecules in the cell. In earlier studies, IKCa1 mRNAs measured by Northern blot analysis or RNase protection were found to be increased ~10-fold 24 h after activation with PHA (10, 26), suggesting that new synthesis of IKCa1 proteins may underlie the up-regulation of functional IKCa1 channels. To investigate this issue in more detail, we examined the distribution of IKCa1 mRNAs in six different human lymphoid tissues and discovered three IKCa1 mRNA species (2.2, 2.5, 4.5 kb). IKCa1 mRNAs are expressed abundantly in the spleen, lymph node, bone marrow, and fetal liver, while the thymus and peripheral blood leukocytes have lower levels (Fig. 5A). The 2.2-kb mRNA is the major band in the spleen, whereas the 4.5-kb transcript predominates in lymph nodes. Bone marrow and fetal liver, tissues containing immature hematopoietic cells, express roughly equivalent levels of the 2.2- and 2.5-kb mRNAs and very little of the large transcript. All three transcripts are expressed at roughly equivalent levels in thymus and peripheral blood leukocytes. Analysis of other human tissues reveals abundant expression of the 2.2-kb transcript in placenta and smaller amounts in lung and pancreas. Human heart, brain, liver, and skeletal muscle do not exhibit this transcript in any appreciable amount (Fig. 5B). The larger 4.5-kb IKCa1 transcript is detected in some tissues. Several transformed cell lines also express IKCa1 transcripts (Fig. 5C). Thus, IKCa1 has a wide tissue distribution.

View larger version (73K): [in this window] [in a new window]   Fig. 5.   IKCa1 mRNA in resting and mitogen-activated cells. A, human lymphoid tissues. Molecular sizes are indicated in kilobases (kb). B, multiple human tissues. C, transformed human cell lines; HL-60 (promyelocytic leukemia), S3 (HeLa, cervical cancer), K-562 (chronic myelogenous leukemia), MOLT-4 (lymphoblastic leukemia), Raji (Burkitt's lymphoma), SW480 (colorectal adenocarcinoma), A549 (lung carcinoma), and G361 (melanoma). Shown at the bottom of each panel is the -actin control blot. D, Northern blot of resting and PHA-activated T-cells hybridized to an IKCa1-selective probe. The LEF signal is shown for comparison at the bottom of the gel. E, identification of the transcription initiation site of the 2.2-kb IKCa1 mRNA. An oligonucleotide primer, complementary to the sequence shown in bold in the 5' NCR (Fig. 5), was used to prime synthesis with reverse transcriptase from placental RNA (lane 5) or yeast tRNA (lane 3). Primer-extended product (indicated by a closed arrowhead, lane 5) corresponds to an "A" in the genomic DNA sequence (lanes 7-10). The open arrowhead indicates the nucleotide "G" (lane 8) at the start of the known cDNA (AF022797). Shown in lane 1 is the positive control extension product of kanamycin RNA. The left- and right-halves of the gel represent 3- and 1-day exposures, respectively. The sequencing lanes are labeled with the nucleotide corresponding to that present in the mRNA "sense" strand.

In keeping with earlier reports (10, 26), IKCa1 transcripts are almost undetectable in resting peripheral blood lymphocytes, while cells stimulated with PHA for 48 h enhance expression of the 2.2-kb IKCa1 mRNA (Fig. 5D). Although equal amounts of mRNA (2 µg/lane) were loaded in both lanes, as an additional control, the blot was probed with LEF, a T-cell specific transcription factor that is not significantly up-regulated following T-cell activation (27). Since we observed a ~3-fold increase in the LEF signal by densitometric scanning in activated versus resting cells (Fig. 5D, bottom), we normalized the LEF signal to be the same in both lanes and obtained a corrected estimate of the IKCa1 mRNA levels. PHA activation for 48 h augments IKCa1 mRNA levels ~10-fold compared with resting cells. In separate experiments, cells stimulated with PHA for 24 h had ~4-fold more IKCa1 mRNAs than resting cells, while PMA enhanced IKCa1 expression ~18-fold (data not shown). These results, in combination with earlier published data (10, 26), indicate that new synthesis of IKCa1 channels contribute to the increased IKCa1 channel numbers observed during T-cell activation.

Mitogen-stimulated Transcription Contributes to Enhanced IKCa1 Expression in Activated Cells-- The PMA- and PHA-stimulated increases in IKCa1 mRNA levels might be a consequence of enhanced transcription of the gene and/or mRNA stability. The presence of ATTTA motifs in 3' non-coding regions (NCR) destabilize many transcripts, including those of T-cell cytokine genes (28, 29) and the potassium channel Kv1.4 (30), and their removal enhances mRNA stability. The 3' NCR of IKCa1 lacks ATTTA motifs indicating that this mechanism does not underlie the mitogen-stimulated increase in IKCa1 mRNA expression. If transcriptional mechanisms are responsible for the up-regulation, both mitogens might be expected to enhance IKCa1 promoter activity to roughly the same extent as the increase in IKCa1 mRNAs and currents. To address this possibility, we determined the genomic organization of the major 2.2-kb IKCa1 transcript (the mRNA that is increased in both PHA- and PMA-stimulated cells), mapped the IKCa1 promoter elements, and ascertained whether promoter activity in transfected human T-cells was augmented by PMA and PHA. Since the known IKCa1 cDNAs (AF033021 and AF022797) are 2226-bp long, roughly the length of the 2.2-kb transcript, the transcription start site for this message must lie at or close to the beginning of the known cDNA sequence. To test this idea, primers close to the 5' end of the cDNA were used in primer extension assays to map the IKCa1 transcription start site (Fig. 5E). We used mRNA from the placenta for this purpose since this tissue primarily expresses the 2.2-kb transcript (Fig. 5B). The transcriptional start site lies three nucleotides upstream of the first nucleotide in the published cDNA sequences. An identical start site was found (data not shown) using mRNA from MOLT-4 and HL-60 cells that predominantly express the 2.2-kb mRNA (Fig. 5C). From the transcription start site to the polyadenylation signal the IKCa1 mRNA is 2229 bp long and is composed of 399 bp of 5' non-coding sequence, 1284 bp of coding region, and 546 bp of 3' NCR.

We next screened a human genomic  library with a human IKCa1-specific probe and isolated two overlapping genomic clones. Analysis of these clones shows that IKCa1 is encoded by nine exons (Fig. 6). We also determined the genomic organization of the related human small conductance calcium-activated K⁺ channels, SKCa2/KCNN2 and SKCa3/KCNN3, by BLAST analysis and sequence alignments of known cDNAs with genomic contigs (Fig. 6). The intron-exon structure of SKCa2/KCNN2 was ascertained by comparing the sequences of the chromosome 5 contigs, AC021415 and AC0121085 with the rat cDNA U69882, while the genomic organization of SKCa3/KCNN3 was discerned by the sequence alignment of human cDNA AF031815 with chromosome 1 contigs AC034149, AC027645, and AC025385. Comparison of the intron-exon organization of these three genes and that of SKCa1/KCNN1 (31) reveals a conserved intron-exon placement (Fig. 6). Fig. 7 shows the sequences at the seven-conserved intron-exon junctions for IKCa1, SKCa2, and SKCa3 genes. The conservation of the genomic organization of these four genes is unexpected since IKCa1 shares only ~40% sequence similarity with the SKCa1-3 channels, has a significantly different pharmacological and biophysical fingerprint, and is located at a different locus in the genome (19q13.2) than SKCa1 (19p13.1), SKCa2 (5q23.1-23.2), and SKCa3 (1q21). SKCa1 has an additional exon, not present in IKCa1, SKCa2, or SKCa3 (Fig. 6), that encodes three additional residues, Ala-Gln-Lys, in the calmodulin-binding segment (22), suggesting that this exon is a relatively recent acquisition. Collectively, these results indicate that the SKCa1-3 and IKCa1 genes have a conserved genomic structure, which must predate the divergence of these two families from a common ancestral gene. Since IKCa1 (Fig. 5, A and D), SKCa2 (32), and SKCa3 (EST accession numbers numbers AA767647 and AA731772) are present in human lymphoid cells, their common intron placement may be a factor in regulating the lymphoid expression of these genes. The genomic organization of the SKCa1-3 and IKCa1 genes differs from that of the Slo gene that encodes the BK_Ca channel (33).

View larger version (24K): [in this window] [in a new window]   Fig. 6.   Genomic organization of the IKCa1 2.2-kb transcript. Restriction map of the 22 kb of human genomic DNA containing nine exons that encode the 2.2-kb IKCa1 cDNA. The locations of NcoI (N) and SacI (S) restriction endonuclease sites are shown. The putative transmembrane segments (S1-S6) in the coding region and the 5' and 3' NCR, as well as the exons to which different parts of the cDNA correspond are indicated. The sizes of the introns in IKCa1 are as follows: intron 1, 4.14 kb; intron 2, 1.96 kb; intron 3, 2.1 kb; intron 4, 2.25 kb; intron 5, 0.16 kb; intron 6, 0.41 kb; intron 7, 1.26 kb; intron 8, 0.45 kb. Shown for comparison are the intron-exon junctions (arrowheads) in the coding regions of SKCa1/KCNN1 (31), SKCa2/KCNN2 (AC021415 and AC0121085), and SKCa3/KCNN3 (AC034149, AC027645, and AC025385). The chromosomal locations of IKCa1 (19q13.2) (52), SKCa1 (19p13.1) (31), SKCa2 (5q23.1-23.2; personal communication Dr. Jan-Fang Cheng; Lawrence Berkeley laboratory human Genome Sequencing Center), and SKCa3 (1q21) (53) are shown to the right of each figure. The additional exon in SKCa1 encoding the sequence AQK is also shown. The exonic sequences have been submitted to GenBank (accession number AF305731-AF305735 and AH009923).

View larger version (45K): [in this window] [in a new window]   Fig. 7.   Intron-exon junctions. Donor and acceptor splice site sequences at each of the conserved exon-intron boundaries (uppercase) are shown for IKCa1 and SKCa3. Consensus GT-AG (5'-3') splice site sequences are observed at each junction. The corresponding amino acids are aligned below genomic DNA sequence. Numbers above the sequence at each junction refer to nucleotide positions in the 2,229-bp IKCa1 transcript, in the SKCa3 or hSKCa2 cDNA sequences.

The 5' NCR and 5'-flanking sequences are shown in Fig. 8. No canonical TATA box is present in the 50 bp upstream of the transcript's origin as has been shown for other K⁺ channel genes (30, 34, 35). To identify the human IKCa1 promoter, 5'-flanking fragments in the luciferase-enhancer (pGL2-e) or basic (pGL2-b) vectors were transfected into human T-cells in parallel with negative control plasmids pGL2-e or pGL2-b. Luciferase activity was measured at varying times after transfection.

View larger version (55K): [in this window] [in a new window]   Fig. 8.   IKCa1 5'-NCR and 5'-flanking nucleotide sequence. 1877 bp of 5'-flanking sequence, 399 bp of 5' NCR, and the first 60 bp of the coding region are shown (accession number AF305731). Selected putative cis-acting core motifs (bold) are labeled above the sequence. The nucleotide at which transcription initiates is indicated by "+1." Ends of the three smallest deletion fragments are indicated (5' termini at 300, 205, and 117, and their common 3' end at +34).

Sense fragments (1877/+395 and 300/+34) exhibit strong promoter activity in human lymphocytes, while the 300/+34 antisense fragment is minimally active (Fig. 9A). Two additional deletion fragments (205/+34 and 117/+34) show activities roughly equivalent to the longer fragment, indicating that the promoter lies between nucleotides 117 and +34. Similar results were obtained when these constructs were expressed in human Jurkat T-cells (data not shown). Since the 117 to +34 region contains putative sites for the DNA-binding proteins AP1 and Ik-2 (Fig. 8), we mutated each site separately and together. Mutation of either motif individually results in a significant decrease in promoter activity, while the combined deletion reduces activity further (Fig. 9B). Thus, the basal promoter required for transcription in human T lymphocytes lies between nucleotides 117 and +34, and the AP1 and Ik-2 motifs are both essential for promoter activity.

View larger version (26K): [in this window] [in a new window]   Fig. 9.   IKCa1 promoter activity in human lymphocytes. A, deletion analysis. Luciferase activity measured in triplicate 10 h after transfection with 1877/+395 (sense), 300/+34 (sense), 300/+34 (antisense), 205/+34 (sense), 117/+34 (sense) or pGL2-b is shown. A scale of the 5' NCR and flanking region and location of the transcription start site are shown at the top. Two of three experiments with similar results are shown. B, effect of AP1 and Ik-2 mutations. Luciferase activity measured in triplicate 10 h following transfection of 117/+34 (sense) and AP1, Ik-2, and Ik-2/AP1 mutant fragments. Data from one additional experiment (not shown) showed similar results.

If transcriptional mechanisms underlie the mitogen-stimulated enhancement in IKCa1 mRNA expression, PMA would be expected to enhance IKCa1 promoter activity more potently than PHA on day-1, paralleling the effects of these mitogens on the expression of IKCa1 mRNAs and currents (Figs. 3 and 5D). Furthermore, since PMA enhances IKCa1 expression prior to an increase in membrane capacitance (Fig. 3), this mitogen would be predicted to augment IKCa1 promoter activity early in the activation cascade. To test these ideas, human lymphocytes were first transfected with the IKCa1 promoter constructs and then stimulated with PMA, PHA, or a combination of these two mitogens for 3-24 h, and luciferase activity measured. Consistent with our expectation, PMA enhances activity of the 300/+34 and 1877/+395 sense fragments at the earliest time point measured (3 h), peak levels being detected at 10-15 h post-stimulation, while the antisense 300/+34 fragment is inactive (Fig. 10A). Activity of all four sense fragments (1877/+395, 300/+34, 205/+34, and 117/+34) increases ~5-7-fold following PMA stimulation for 10 h (Fig. 10B), which is roughly proportional to the increase in IKCa1 mRNA and IKCa1 channel number/cell measured at 24 h. Similar results were obtained with PHA, the ~4-6-fold augmentation of IKCa1 currents and mRNA levels on day 1 being accompanied by a ~3-fold increase in promoter activity (Fig. 10B). A combination of the two mitogens increases promoter activity to a greater extent than either mitogen alone. The parallel increases in IKCa1 conductance, IKCa1 mRNA expression, and IKCa1 promoter activity by both mitogens strongly suggest that transcriptional mechanisms contribute to the channel up-regulation that accompanies T-cell activation.

View larger version (50K): [in this window] [in a new window]   Fig. 10.   Mitogen induction of IKCa1 promoter in normal human lymphocytes. A, time course of IKCa1 promoter activity following PMA stimulation. MNCs were transfected with 1877/+395 (sense), 300/+34 (sense), 300/+34 (antisense), or pGL2-e, and were then left in media or treated with PMA (40 nM). Luciferase activity was measured at various times after stimulation with PMA. Data are representative of one of three experiments with similar results. B, mitogen inducibility of the IKCa1 promoter. MNC were transfected with 1877/+395 (sense), 300/+34 (sense), 205/+34 (sense), or 117/+34 (sense), and then incubated in media or treated with PHA (5 µg/ml), PMA (40 nM), or a combination of the two mitogens for 10 h. Data are representative of one of four experiments with similar results. C, effect of AP1 and Ik-2 mutations on mitogen inducibility of the promoter. Lymphocytes were transfected with 117/+34 (sense) or mutants of this fragment. Luciferase activity was measured 10 h following stimulation with PMA (40 nM), PHA (5 µg/ml), or a combination of both mitogens. Control cells were left in media. Data are representative of one of four experiments with similar results.

We next analyzed AP1 and Ik-2 mutants to determine whether they are required for mitogen-dependent up-regulation. As shown in Fig. 10C, the AP1 mutant exhibits substantially diminished PMA responsiveness relative to the wild-type fragment (117/+34) and to its activity in resting T-cells. Although the Ik-2 mutant is less effective in reducing PMA inducibility of the promoter than the AP1 mutant, a double AP1/Ik-2 knockout decreases PMA responsiveness to a greater extent than either mutant alone. These results suggest that AP1, and to a lesser extent Ik-2, is essential for PMA inducibility of the IKCa1 promoter. Either mutant alone attenuates the PHA-stimulated enhancement of promoter responsiveness to PMA (Fig. 10C), indicating that the AP1 and Ik-2 sites are required for this effect. Thus, AP1 and Ik-2-dependent transcriptional mechanisms contribute to the IKCa1 up-regulation during human T-cell activation.

Since the putative AP1 site is critical for IKCa1 promoter activity, we examined whether this site could bind AP1 protein. HeLa cell extracts (Promega, Madison, WI), previously characterized for AP1 binding, interact with a ³²P-labeled commercially available AP1 oligonucleotide probe in gel-shift assays (Fig. 11, lane 2). This binding is competed by 100-fold excess unlabeled AP1 probe (lane 3) and by a 24-bp IKCa1 probe spanning the AP1 site (lane 4), but not by an IKCa1 probe in which the AP1 site is mutated (lane 5). HeLa cell extracts also bind to the IKCa1 AP1 site (lane 7), but not to the mutated site (lane 11). This interaction is specific since it can be competed by 100-fold excess of the AP1 probe (lane 8) and by the IKCa1-AP1 wild-type probe (lane 9), but not by the IKCa1-AP1 mutant probe (lane 10).

View larger version (56K): [in this window] [in a new window]   Fig. 11.   IKCa1 promoter specifically binds AP1 protein in HeLa cell extracts. Lanes 1, 6, and 12, AP1 DNA probe, IKCa1-AP1 wild type (wt.) and IKCa1-AP1 mutant (mut.) probes alone. Lanes 2, 7, and 11, 32P-labeled AP1, IKCa1-AP1 wt, and IKCa1-AP1 mut. probes with HeLa extracts. Lanes 3 and 8, competition by unlabeled AP1 probe. Lanes 4 and 9, competition by unlabeled IKCa1-AP1 wt. Lanes 5 and 10, competition by unlabeled IKCa1-AP1 mut. The arrow indicates the specific AP1-retarded band.

CsA (100 nM) partially suppresses mitogen-induced up-regulation of IKCa1 currents (Fig. 3). Is this suppression due to direct inhibition of the IKCa1 promoter activity via a NFAT-dependent step? Two NFAT consensus motifs are present in the 5'-flanking region of IKCa1 (Fig. 8). However, simultaneous deletion of both these NFAT motifs does not diminish basal promoter activity (e.g. 300/+34 sense fragment) or the promoter's responsiveness to mitogens (Figs. 9 and 10). To test the effect of CsA on IKCa1 promoter activity more directly, human T-cells were transfected with the IKCa1 promoter constructs, then activated with PHA in the presence or absence of CsA (100 nM) for 24 h, and luciferase activity measured. As a control, cells were transfected with the CsA-sensitive IL-2-promoter and subjected to the same activation protocol. CsA does not suppress mitogen induction of the IKCa1 promoter (mitogen, 7,738 ± 1008 light units; mitogen + CsA, 6,722 ± 406 light units) while potently inhibiting mitogen-stimulated up-regulation of the IL-2 promoter (mitogen, 45,061 ± 7,180 light units; mitogen + CsA, 2728 ± 302 light units). These results suggest that the observed partial suppression of mitogen-induced channel up-regulation by 100 nM CsA (Fig. 3) is not mediated via direct inhibition of the IKCa1 promoter, and may involve a post-transcriptional mechanism.

Kv1.3 Blockers Suppress Mitogen-stimulated [³H]Thymidine Incorporation by Human Lymphocytes, whereas IKCa1 Blockers Suppress Mitogen-stimulated [³H]Thymidine Incorporation by Pre-activated Cells-- To examine the relative functional roles of Kv1.3 and IKCa1 channels in resting and activated lymphocytes, we compared the effects of potent and selective Kv1.3 and IKCa1 inhibitors of anti-CD3 Ab-induced [³H]thymidine incorporation. ShK-Dap²², margatoxin, and correolide are potent inhibitors of the Kv1.3 channel (Fig. 12A), while TRAM-34 and clotrimazole block the IKCa1 channel at low nanomolar concentrations (Fig. 12B). In confirmation of several published studies (12, 25, 36-41), all three Kv1.3 blockers, at concentrations that block the channel (Fig. 12A), potently suppress [³H]thymidine incorporation in freshly isolated T-cells stimulated for 48 h with anti-CD3 Ab (Fig. 12C). On the contrary, blockade of IKCa1 suppresses T-cell proliferation (Fig. 12C) only at concentrations (IC₅₀ = ~3-5 µM) that are ~70-250 times the dose required for 50% block of the channel, possibly via nonspecific mechanisms (18, 26, 42). Thus, resting T-cells containing ~300 Kv1.3 channels and ~8 IKCa1 channels are dependent on Kv1.3 and not IKCa1 for activation.

View larger version (30K): [in this window] [in a new window]   Fig. 12.   Suppression of T-cell proliferation by K+ channel blockers. A, dose-dependent inhibition of Kv1.3 currents in activated human T-cells by ShK-Dap22 (, Kd = 52 ± 10 pM), margatoxin (, Kd = 110 ± 16 pM), and correolide (, Kd = 90 ± 15 nM). B, dose-dependent inhibition of IKCa1 in activated T-cells by TRAM-34 (, Kd = 25 ± 5 nM) and in COS-7 cells by clotrimazole (, Kd = 70 ± 10 nM). C, [3H]thymidine incorporation into T-cells activated with anti-CD3 Ab (5 ng/ml) for 48 h in the presence or absence of Kv1.3 blockers (solid lines) (margatoxin (, EC50 = 300 ± 42 pM), ShK-Dap22 (, EC50 = 4.0 ± 0.5 nM), correolide (, EC50 = 400 ± 72 nM)) or IKCa1 blockers (dashed lines) (clotrimazole (, EC50 = 3 ± 0.5 µM) or TRAM-34 (, 5.5 ± 1 µM)). Four donors were used for these studies. Means ± S.D. are shown. Our results with margatoxin and correolide are consistent with those previously reported by Koo et al. (41) for human T-cells (margatoxin: EC50 = 290 pM; correolide: EC50 = 307 nM). D, [3H]thymidine incorporation into anti-CD3 Ab (5 ng/ml) preactivated T-cells that were reactivated with anti-CD3 Ab for a further 48 h in the presence or absence of channel blockers. The EC50 values for IKCa1 blockers are 250 ± 40 nM for TRAM-34 () and 320 ± 60 nM for clotrimazole () (mean ± S.D. from six donors). Kv1.3 blockers produced little or no suppression.

The situation is reversed in mitogen-activated lymphocytes that express 300-800 IKCa1 channels along with 400-500 Kv1.3 channels (Refs. 10, 13, 14, 18, and 26, this paper). Cells were preactivated with anti-CD3 Ab for 48 h (to up-regulate IKCa1) and then reactivated for a further 48 h with the same mitogen in the presence or absence of channel blockers. Both IKCa1 inhibitors suppress [³H]thymidine incorporation at concentrations (IC₅₀ = ~300 nM) that block 80-90% of the IKCa1 channels, whereas Kv1.3 inhibitors are ineffective under these circumstances (compare Fig. 12, A and B with D). At a concentration (1 µM) that suppresses proliferation of preactivated lymphocytes, TRAM-34 also significantly inhibits the intracellular expression of IL-2 (resting: 1.8 ± 0.7% IL-2⁺ cells; mean ± S.D. from 3 donors; PMA + ionomycin: 23.1 ± 16.6% IL-2⁺ cells; PMA + ionomycin + TRAM-34: 7.9 ± 2.9% IL-2⁺ cells) and IFN- (resting: 1.1 + 0.9% IFN-⁺ cells, mean ± S.D. from 3 donors; PMA + ionomycin: 17.6 ± 7.1% IFN-⁺ cells; PMA + ionomycin + TRAM-34: 9.5 ± 5.1% IFN-⁺ cells). These results suggest that activated cells require IKCa1 but not Kv1.3 channels for the re-activation response.

	DISCUSSION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

To investigate the molecular mechanism of IKCa1 channel up-regulation in T lymphocytes, we determined the genomic organizations of IKCa1, SKCa2, and SKCa3, and functionally mapped the promoter of IKCa1. The striking similarity in intron-exon boundaries suggests a common evolutionary origin of IKCa1 and SKCa1-3 genes. IKCa1 functional expression is enhanced by treatment with PHA, anti-CD3 Ab, PMA, or PMA + ionomycin (Fig. 3). This increase is in direct proportion to the increase in IKCa1 transcripts (Fig. 5) and to the enhanced activity of the IKCa1 promoter. The PMA-triggered IKCa1 up-regulation is an early event in the T-cell activation cascade. Enhanced IKCa1 promoter activity is detected as early as 3 h after activation (Fig. 10), and augmented channel expression is observed prior to increase in cell size, onset of DNA synthesis, or cytokine production (Figs. 3 and 4). Thus, transcriptional mechanisms are likely to underlie the increased IKCa1 expression in activated lymphocytes, although post-transcriptional mechanisms (including increased channel trafficking) may also contribute. Within the promoter region of the IKCa1 gene, several potential transcription factor-binding sites were identified and functionally probed by deletion and mutational analysis. Mutagenesis and gel-shift studies suggest that the AP1 and Ik-2 transcription factors, but not NFAT, are required for basal transcription of the IKCa1 gene and mediate the transcriptional augmentation of IKCa1 expression during the T-cell activation response. These results may be relevant to B lymphocytes (16) and T-cell subsets (43) in which levels of IKCa1 channels are up-regulated during mitogenesis. Recent studies have reported Ras-induced up-regulation of IKCa1 in fibroblasts (44, 45), which may be mediated via the AP1-dependent pathway described below in human T lymphocytes (Fig. 13).

View larger version (29K): [in this window] [in a new window]   Fig. 13.   Cartoon showing signaling pathways influencing IKCa1 expression. The number of channels expressed in resting and activated T-cells is indicated next to each channel type. The IKCa1 channel is complexed with calmodulin (CAM).

Fig. 13 summarizes the signaling pathways that likely contribute to IKCa1 up-regulation in T lymphocytes. Anti-CD3 Ab or PMA augment IKCa1 transcription in an AP1-dependent manner via stimulation of the PKC and downstream Ras and JNK pathways. The resulting AP1 (c-Fos/c-Jun heterodimer) complex binds to the IKCa1 promoter (as shown in Fig. 11) and initiates transcription of the IKCa1 message in conjunction with the transcription factor, Ik-2. Ik-2 is a nuclear factor that sets a threshold for T-cell mitogenesis; in activated T-cells, Ik-2 co-localizes with the DNA replication machinery and modulates cell entry into the S-phase (46). Increased IKCa1 mRNA levels lead to enhanced expression of functional IKCa1 channels on the cell membrane tightly complexed to calmodulin, which serves as the calcium sensor for these channels (22). Interestingly, calmodulin expression is also augmented during human T-cell activation, especially the CAM-III mRNA and protein (47). CsA partially suppresses the mitogen-stimulated increase in IKCa1 expression (Fig. 3), but this is not due to inhibition of the IKCa1 promoter, and may instead result from blockade of a post-transcriptional step. Ionomycin by itself fails to increase IKCa1 expression significantly, most likely due to its inability to stimulate AP1 production, whereas its enhancement of PMA-induced up-regulation of IKCa1 (Figs. 2, 3, and 12) may be due to co-activation of the JNK pathway via an increase in cytoplasmic calcium (Fig. 13). The up-regulation of IKCa1 channels during human T-cell activation parallels the recently described ~10-fold increase in numbers of the CRAC channels induced by PHA and PMA, but not ionomycin (48), raising the possibility that these two channels involved in calcium signaling could be coordinately regulated.

Calcium-entry through CRAC channels is promoted by membrane hyperpolarization due to the opening of IKCa1 and Kv1.3 channels (11). Since quiescent human T lymphocytes contain on average roughly ~300-400 Kv1.3 channels/cell and only ~8 IKCa1 channels, the membrane potential of quiescent cells is thought to be mainly dependent on the voltage-gated channel with the IKCa1 channels playing a minimal role (11). In keeping with this idea, blockade of Kv1.3 by specific and potent inhibitors attenuates the calcium signaling response and suppresses the activation response of resting human T-cells both in vitro and in vivo (25, 38, 39, 41) (Fig. 12C). In contrast, clotrimazole and TRAM-34, both potent IKCa1 inhibitors, suppress the activation of resting human T-cells (Fig. 12, B and C) (18, 26, 42) only at concentrations (~5 µM) that are 70-250 times the channel-blocking dose, perhaps through nonspecific mechanisms.

The relative numbers of the two K⁺ channels change in activated human T-cells. T-cells stimulated for 48-72 h with mitogens have 300-800 IKCa1 channels along with 400-500 Kv1.3 channels (Figs. 2 and 3) (13, 14). Khanna and colleagues (26), reported that PHA-induced proliferation of PHA preactivated T-cells was potently suppressed by clotrimazole tested at a single dose of 250 nM. We have extended these studies by using a complete range of concentrations of clotrimazole and TRAM-34 and showing that these inhibitors potently suppress reactivation of anti-CD3 Ab- or PMA preactivated lymphocytes at submicromolar concentrations consistent with their channel-blocking dose (Fig. 12, B and D (18)). Our results taken together with earlier studies (10, 14, 26) suggest that different mitogens (PHA, anti-CD3 Ab, PMA, PMA + ionomycin) augment IKCa1 channel expression in lymphocytes and this induction is functionally important. The parallel enhancement of IKCa1 and CRAC channels might allow the activated T-cell to fine-tune its regulation of membrane potential in response to subtle changes in cytoplasmic calcium, which in turn would modulate calcium entry. Consistent with this notion, previous studies on activated T-cells have shown coupling between IK_Ca channels and membrane potential (49, 50). More recently, we have found that the IKCa1 peptide inhibitor, ChTX-Glu³² (23), suppresses thapsigargin-induced calcium entry into activated human T-cells (51). Thus, the concerted action of the two potassium channels regulates the entry of calcium through CRAC channels in quiescent and activated T-cells and thereby modulates the immune response.

	ACKNOWLEDGEMENTS

We thank Annabelle Chialing Wu and Dr. Luette Forrest for excellent technical assistance. We are grateful to Drs. Marian Waterman and Chris Hughes for valuable discussions, suggestions, and reagents. We thank Drs. Adrienne Dubin and Jan-Fang Cheng for drawing our attention to the human chromosome 5 and chromosome 1 contigs containing the hSKCa2 and hSKCa3 sequences.

	FOOTNOTES

^* This work was supported in part by National Institutes of Health Grants GM54221 (to K. G. C.) and NS14609 (to M. D. C.), and by a gift from Merck Sharpe and Dohme (to K. G. C.).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

The nucleotide sequence(s) reported in this paper has been submitted to the GenBank^TM/EMBL Data Bank with accession number(s) AF305731-AF305735 and AH009923.

^§ Supported by Deutsche Forschungsgemeinschaft Grant Wu 320/1-1 and postdoctoral fellowship number 9920014Y from the Western States Affiliate of the American Heart Association. To whom correspondence should be addressed: Rm. 291, Joan Irvine Smith Hall, Medical School, University of California Irvine, Irvine, CA 92697. Tel.: 949-824-2133; Fax: 949-824-3143; E-mail: hwulff@uci.edu.

Published, JBC Papers in Press, August 28, 2000, DOI 10.1074/jbc.M003941200

	ABBREVIATIONS

The abbreviations used are: PKC, protein kinase C; NFAT, nuclear factor of activated T-cells; IL-2, interleukin-2; CsA, cyclosporin; AP1, activation protein-1; JNK, c-Jun N-terminal kinase; CRAC, calcium-release activated calcium; PHA, phytohemagglutinin; PMA, phorbol myristate acetate; Ik-2, Ikaros-2; ChTX, charybdotoxin; ShK, Stichodactyla helianthus toxin; LEF, lymphoid enhancing factor; MNC, mononuclear cells; INF-, interferon-; NCR, non-coding region; bp, base pair(s); kb, kilobase pair(s); [Ca²⁺]_i, intracellular [Ca²⁺]; RBL, rat basophilic leukemia.

	REFERENCES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

CiteULike

Complore

Connotea

Del.icio.us

Digg

Reddit

Technorati

This article has been cited by other articles:

				Y. Matsushita, S. Ohya, Y. Suzuki, H. Itoda, T. Kimura, H. Yamamura, and Y. Imaizumi Inhibition of Kv1.3 potassium current by phosphoinositides and stromal-derived factor-1{alpha} in Jurkat T cells Am J Physiol Cell Physiol, May 1, 2009; 296(5): C1079 - C1085. [Abstract] [Full Text] [PDF]

				V. G. Romanenko, K. S. Roser, J. E. Melvin, and T. Begenisich The role of cell cholesterol and the cytoskeleton in the interaction between IK1 and maxi-K channels Am J Physiol Cell Physiol, April 1, 2009; 296(4): C878 - C888. [Abstract] [Full Text] [PDF]

				R. Tao, C.-P. Lau, H.-F. Tse, and G.-R. Li Regulation of cell proliferation by intermediate-conductance Ca2+-activated potassium and volume-sensitive chloride channels in mouse mesenchymal stem cells Am J Physiol Cell Physiol, November 1, 2008; 295(5): C1409 - C1416. [Abstract] [Full Text] [PDF]

				K. M. Lounsbury Preventing Stenosis by Local Inhibition of KCa3.1: A Finger on the Phenotypic Switch Arterioscler. Thromb. Vasc. Biol., June 1, 2008; 28(6): 1036 - 1038. [Full Text] [PDF]

				D.L. Tharp, B.R. Wamhoff, H. Wulff, G. Raman, A. Cheong, and D.K. Bowles Local Delivery of the KCa3.1 Blocker, TRAM-34, Prevents Acute Angioplasty-Induced Coronary Smooth Muscle Phenotypic Modulation and Limits Stenosis Arterioscler. Thromb. Vasc. Biol., June 1, 2008; 28(6): 1084 - 1089. [Abstract] [Full Text] [PDF]

				E. L. Lee, Y. Hasegawa, T. Shimizu, and Y. Okada IK1 channel activity contributes to cisplatin sensitivity of human epidermoid cancer cells Am J Physiol Cell Physiol, June 1, 2008; 294(6): C1398 - C1406. [Abstract] [Full Text] [PDF]

				S. G. Meuth, S. Bittner, P. Meuth, O. J. Simon, T. Budde, and H. Wiendl TWIK-related Acid-sensitive K+ Channel 1 (TASK1) and TASK3 Critically Influence T Lymphocyte Effector Functions J. Biol. Chem., May 23, 2008; 283(21): 14559 - 14570. [Abstract] [Full Text] [PDF]

				C. Beeton, B. J. Smith, J. K. Sabo, G. Crossley, D. Nugent, I. Khaytin, V. Chi, K. G. Chandy, M. W. Pennington, and R. S. Norton The D-Diastereomer of ShK Toxin Selectively Blocks Voltage-gated K+ Channels and Inhibits T Lymphocyte Proliferation J. Biol. Chem., January 11, 2008; 283(2): 988 - 997. [Abstract] [Full Text] [PDF]

				O. Dellis, A. M. Rossi, S. G. Dedos, and C. W. Taylor Counting Functional Inositol 1,4,5-Trisphosphate Receptors into the Plasma Membrane J. Biol. Chem., January 11, 2008; 283(2): 751 - 755. [Abstract] [Full Text] [PDF]

				S. R. J. Taylor, M. Gonzalez-Begne, S. Dewhurst, G. Chimini, C. F. Higgins, J. E. Melvin, and J. I. Elliott Sequential Shrinkage and Swelling Underlie P2X7-Stimulated Lymphocyte Phosphatidylserine Exposure and Death J. Immunol., January 1, 2008; 180(1): 300 - 308. [Abstract] [Full Text] [PDF]

				M. C. Shepherd, S. M. Duffy, T. Harris, G. Cruse, M. Schuliga, C. E. Brightling, C. B. Neylon, P. Bradding, and A. G. Stewart KCa3.1 Ca2+Activated K+ Channels Regulate Human Airway Smooth Muscle Proliferation Am. J. Respir. Cell Mol. Biol., November 1, 2007; 37(5): 525 - 531. [Abstract] [Full Text] [PDF]

				L. Hu, M. Pennington, Q. Jiang, K. A. Whartenby, and P. A. Calabresi Characterization of the Functional Properties of the Voltage-Gated Potassium Channel Kv1.3 in Human CD4+ T Lymphocytes J. Immunol., October 1, 2007; 179(7): 4563 - 4570. [Abstract] [Full Text] [PDF]

				S. A. Nicolaou, P. Szigligeti, L. Neumeier, S. Molleran Lee, H. J. Duncan, S. K. Kant, A. B. Mongey, A. H. Filipovich, and L. Conforti Altered Dynamics of Kv1.3 Channel Compartmentalization in the Immunological Synapse in Systemic Lupus Erythematosus J. Immunol., July 1, 2007; 179(1): 346 - 356. [Abstract] [Full Text] [PDF]

				S. A. Nicolaou, L. Neumeier, Y. Peng, D. C. Devor, and L. Conforti The Ca2+-activated K+ channel KCa3.1 compartmentalizes in the immunological synapse of human T lymphocytes Am J Physiol Cell Physiol, April 1, 2007; 292(4): C1431 - C1439. [Abstract] [Full Text] [PDF]

				T. Ronni, K. J. Payne, S. Ho, M. N. Bradley, G. Dorsam, and S. Dovat Human Ikaros Function in Activated T Cells Is Regulated by Coordinated Expression of Its Largest Isoforms J. Biol. Chem., January 26, 2007; 282(4): 2538 - 2547. [Abstract] [Full Text] [PDF]

				V. Kaushal, P. D. Koeberle, Y. Wang, and L. C. Schlichter The Ca2+-Activated K+ Channel KCNN4/KCa3.1 Contributes to Microglia Activation and Nitric Oxide-Dependent Neurodegeneration J. Neurosci., January 3, 2007; 27(1): 234 - 244. [Abstract] [Full Text] [PDF]

				D. Yamazaki, M. Aoyama, S. Ohya, K. Muraki, K. Asai, and Y. Imaizumi Novel Functions of Small Conductance Ca2+-activated K+ Channel in Enhanced Cell Proliferation by ATP in Brain Endothelial Cells J. Biol. Chem., December 15, 2006; 281(50): 38430 - 38439. [Abstract] [Full Text] [PDF]

				D. L. Tharp, B. R. Wamhoff, J. R. Turk, and D. K. Bowles Upregulation of intermediate-conductance Ca2+-activated K+ channel (IKCa1) mediates phenotypic modulation of coronary smooth muscle Am J Physiol Heart Circ Physiol, November 1, 2006; 291(5): H2493 - H2503. [Abstract] [Full Text] [PDF]

				G Cruse, S M Duffy, C E Brightling, and P Bradding Functional KCa3.1 K+ channels are required for human lung mast cell migration Thorax, October 1, 2006; 61(10): 880 - 885. [Abstract] [Full Text] [PDF]

				S. Srivastava, K. Ko, P. Choudhury, Z. Li, A. K. Johnson, V. Nadkarni, D. Unutmaz, W. A. Coetzee, and E. Y. Skolnik Phosphatidylinositol-3 Phosphatase Myotubularin-Related Protein 6 Negatively Regulates CD4 T Cells Mol. Cell. Biol., August 1, 2006; 26(15): 5595 - 5602. [Abstract] [Full Text] [PDF]

				T. Pietrangelo, B. Fioretti, R. Mancinelli, L. Catacuzzeno, F. Franciolini, G. Fano, and S. Fulle Extracellular guanosine-5'-triphosphate modulates myogenesis via intermediate Ca2+-activated K+ currents in C2C12 mouse cells J. Physiol., May 1, 2006; 572(3): 721 - 733. [Abstract] [Full Text] [PDF]

				A. Gasser, G. Glassmeier, R. Fliegert, M. F. Langhorst, S. Meinke, D. Hein, S. Kruger, K. Weber, I. Heiner, N. Oppenheimer, et al. Activation of T Cell Calcium Influx by the Second Messenger ADP-ribose J. Biol. Chem., February 3, 2006; 281(5): 2489 - 2496. [Abstract] [Full Text] [PDF]

				S. Srivastava, P. Choudhury, Z. Li, G. Liu, V. Nadkarni, K. Ko, W. A. Coetzee, and E. Y. Skolnik Phosphatidylinositol 3-Phosphate Indirectly Activates KCa3.1 via 14 Amino Acids in the Carboxy Terminus of KCa3.1 Mol. Biol. Cell, January 1, 2006; 17(1): 146 - 154. [Abstract] [Full Text] [PDF]

				C. Beeton and K. G. Chandy Potassium Channels, Memory T Cells, and Multiple Sclerosis Neuroscientist, December 1, 2005; 11(6): 550 - 562. [Abstract] [PDF]

				D. Tuteja, D. Xu, V. Timofeyev, L. Lu, D. Sharma, Z. Zhang, Y. Xu, L. Nie, A. E Vazquez, J. N. Young, et al. Differential expression of small-conductance Ca2+-activated K+ channels SK1, SK2, and SK3 in mouse atrial and ventricular myocytes Am J Physiol Heart Circ Physiol, December 1, 2005; 289(6): H2714 - H2723. [Abstract] [Full Text] [PDF]

				H. Rus, C. A. Pardo, L. Hu, E. Darrah, C. Cudrici, T. Niculescu, F. Niculescu, K. M. Mullen, R. Allie, L. Guo, et al. The voltage-gated potassium channel Kv1.3 is highly expressed on inflammatory infiltrates in multiple sclerosis brain PNAS, August 2, 2005; 102(31): 11094 - 11099. [Abstract] [Full Text] [PDF]

				B. Fioretti, T. Pietrangelo, L. Catacuzzeno, and F. Franciolini Intermediate-conductance Ca2+-activated K+ channel is expressed in C2C12 myoblasts and is downregulated during myogenesis Am J Physiol Cell Physiol, July 1, 2005; 289(1): C89 - C96. [Abstract] [Full Text] [PDF]

				S. Srivastava, Z. Li, L. Lin, G. Liu, K. Ko, W. A. Coetzee, and E. Y. Skolnik The Phosphatidylinositol 3-Phosphate Phosphatase Myotubularin- Related Protein 6 (MTMR6) Is a Negative Regulator of the Ca2+-Activated K+ Channel KCa3.1 Mol. Cell. Biol., May 1, 2005; 25(9): 3630 - 3638. [Abstract] [Full Text] [PDF]

				I. Grgic, I. Eichler, P. Heinau, H. Si, S. Brakemeier, J. Hoyer, and R. Kohler Selective Blockade of the Intermediate-Conductance Ca2+-Activated K+ Channel Suppresses Proliferation of Microvascular and Macrovascular Endothelial Cells and Angiogenesis In Vivo Arterioscler. Thromb. Vasc. Biol., April 1, 2005; 25(4): 704 - 709. [Abstract] [Full Text] [PDF]

				C. Beeton, M. W. Pennington, H. Wulff, S. Singh, D. Nugent, G. Crossley, I. Khaytin, P. A. Calabresi, C.-Y. Chen, G. A. Gutman, et al. Targeting Effector Memory T Cells with a Selective Peptide Inhibitor of Kv1.3 Channels for Therapy of Autoimmune Diseases Mol. Pharmacol., April 1, 2005; 67(4): 1369 - 1381. [Abstract] [Full Text] [PDF]

				J. R Robbins, S. M. Lee, A. H Filipovich, P. Szigligeti, L. Neumeier, M. Petrovic, and L. Conforti Hypoxia modulates early events in T cell receptor-mediated activation in human T lymphocytes via Kv1.3 channels J. Physiol., April 1, 2005; 564(1): 131 - 143. [Abstract] [Full Text] [PDF]

				C. Poulopoulou, I. Markakis, P. Davaki, C. Nikolaou, A. Poulopoulos, E. Raptis, and D. Vassilopoulos Modulation of Voltage-Gated Potassium Channels in Human T Lymphocytes by Extracellular Glutamate Mol. Pharmacol., March 1, 2005; 67(3): 856 - 867. [Abstract] [Full Text] [PDF]

				T. Begenisich, T. Nakamoto, C. E. Ovitt, K. Nehrke, C. Brugnara, S. L. Alper, and J. E. Melvin Physiological Roles of the Intermediate Conductance, Ca2+-activated Potassium Channel Kcnn4 J. Biol. Chem., November 12, 2004; 279(46): 47681 - 47687. [Abstract] [Full Text] [PDF]

				V. Visan, Z. Fajloun, J.-M. Sabatier, and S. Grissmer Mapping of Maurotoxin Binding Sites on hKv1.2, hKv1.3, and hIKCa1 Channels Mol. Pharmacol., November 1, 2004; 66(5): 1103 - 1112. [Abstract] [Full Text] [PDF]

				H. Wulff, H.-G. Knaus, M. Pennington, and K. G. Chandy K+ Channel Expression during B Cell Differentiation: Implications for Immunomodulation and Autoimmunity J. Immunol., July 15, 2004; 173(2): 776 - 786. [Abstract] [Full Text] [PDF]

				H. Ouadid-Ahidouch, M. Roudbaraki, P. Delcourt, A. Ahidouch, N. Joury, and N. Prevarskaya Functional and molecular identification of intermediate-conductance Ca2+-activated K+ channels in breast cancer cells: association with cell cycle progression Am J Physiol Cell Physiol, July 1, 2004; 287(1): C125 - C134. [Abstract] [Full Text] [PDF]

				J. Vennekamp, H. Wulff, C. Beeton, P. A. Calabresi, S. Grissmer, W. Hansel, and K. G. Chandy Kv1.3-Blocking 5-Phenylalkoxypsoralens: A New Class of Immunomodulators Mol. Pharmacol., June 1, 2004; 65(6): 1364 - 1374. [Abstract] [Full Text] [PDF]

				J. H. Nam, J.-E. Woo, D.-Y. Uhm, and S. J. Kim Membrane-delimited Regulation of Novel Background K+ Channels by MgATP in Murine Immature B Cells J. Biol. Chem., May 14, 2004; 279(20): 20643 - 20654. [Abstract] [Full Text] [PDF]

				J. Xu, P. Wang, Y. Li, G. Li, L. K. Kaczmarek, Y. Wu, P. A. Koni, R. A. Flavell, and G. V. Desir The voltage-gated potassium channel Kv1.3 regulates peripheral insulin sensitivity PNAS, March 2, 2004; 101(9): 3112 - 3117. [Abstract] [Full Text] [PDF]

				H. Jager, T. Dreker, A. Buck, K. Giehl, T. Gress, and S. Grissmer Blockage of Intermediate-Conductance Ca2+-Activated K+ Channels Inhibit Human Pancreatic Cancer Cell Growth in Vitro Mol. Pharmacol., March 1, 2004; 65(3): 630 - 638. [Abstract] [Full Text] [PDF]

				A. Kolski-Andreaco, H. Tomita, V. G. Shakkottai, G. A. Gutman, M. D. Cahalan, J. J. Gargus, and K. G. Chandy SK3-1C, a Dominant-negative Suppressor of SKCa and IKCa Channels J. Biol. Chem., February 20, 2004; 279(8): 6893 - 6904. [Abstract] [Full Text] [PDF]

				S. Brakemeier, A. Kersten, I. Eichler, I. Grgic, A. Zakrzewicz, H. Hopp, R. Kohler, and J. Hoyer Shear stress-induced up-regulation of the intermediate-conductance Ca2+-activated K+ channel in human endothelium Cardiovasc Res, December 1, 2003; 60(3): 488 - 496. [Abstract] [Full Text] [PDF]

				R. Kohler, H. Wulff, I. Eichler, M. Kneifel, D. Neumann, A. Knorr, I. Grgic, D. Kampfe, H. Si, J. Wibawa, et al. Blockade of the Intermediate-Conductance Calcium-Activated Potassium Channel as a New Therapeutic Strategy for Restenosis Circulation, September 2, 2003; 108(9): 1119 - 1125. [Abstract] [Full Text] [PDF]

				N. M. Storey, M. Gomez-Angelats, C. D. Bortner, D. L. Armstrong, and J. A. Cidlowski Stimulation of Kv1.3 Potassium Channels by Death Receptors during Apoptosis in Jurkat T Lymphocytes J. Biol. Chem., August 29, 2003; 278(35): 33319 - 33326. [Abstract] [Full Text] [PDF]

				U. Kim, R. Siegel, X. Ren, C. S. Gunther, T. Gaasterland, and R. G. Roeder Identification of transcription coactivator OCA-B-dependent genes involved in antigen-dependent B cell differentiation by cDNA array analyses PNAS, July 22, 2003; 100(15): 8868 - 8873. [Abstract] [Full Text] [PDF]

				C. Beeton, H. Wulff, S. Singh, S. Botsko, G. Crossley, G. A. Gutman, M. D. Cahalan, M. Pennington, and K. G. Chandy A Novel Fluorescent Toxin to Detect and Investigate Kv1.3 Channel Up-regulation in Chronically Activated T Lymphocytes J. Biol. Chem., March 7, 2003; 278(11): 9928 - 9937. [Abstract] [Full Text] [PDF]

				J. Xu, P. A. Koni, P. Wang, G. Li, L. Kaczmarek, Y. Wu, Y. Li, R. A. Flavell, and G. V. Desir The voltage-gated potassium channel Kv1.3 regulates energy homeostasis and body weight Hum. Mol. Genet., March 1, 2003; 12(5): 551 - 559. [Abstract] [Full Text] [PDF]

				C. A. Syme, K. L. Hamilton, H. M. Jones, A. C. Gerlach, L. Giltinan, G. D. Papworth, S. C. Watkins, N. A. Bradbury, and D. C. Devor Trafficking of the Ca2+-activated K+ Channel, hIK1, Is Dependent upon a C-terminal Leucine Zipper J. Biol. Chem., February 28, 2003; 278(10): 8476 - 8486. [Abstract] [Full Text] [PDF]

				N. A. Castle, D. O. London, C. Creech, Z. Fajloun, J. W. Stocker, and J.-M. Sabatier Maurotoxin: A Potent Inhibitor of Intermediate Conductance Ca2+-Activated Potassium Channels Mol. Pharmacol., February 1, 2003; 63(2): 409 - 418. [Abstract] [Full Text] [PDF]

				H. Koegel, S. Kaesler, R. Burgstahler, S. Werner, and C. Alzheimer Unexpected Down-regulation of the hIK1 Ca2+-activated K+ Channel by Its Opener 1-Ethyl-2-benzimidazolinone in HaCaT Keratinocytes. INVERSE EFFECTS ON CELL GROWTH AND PROLIFERATION J. Biol. Chem., January 24, 2003; 278(5): 3323 - 3330. [Abstract] [Full Text] [PDF]

				L. Conforti, M. Petrovic, D. Mohammad, S. Lee, Q. Ma, S. Barone, and A. H. Filipovich Hypoxia Regulates Expression and Activity of Kv1.3 Channels in T Lymphocytes: A Possible Role in T Cell Proliferation J. Immunol., January 15, 2003; 170(2): 695 - 702. [Abstract] [Full Text] [PDF]

				T. Schilling, A. Gratopp, T. E DeCoursey, and C. Eder Voltage-activated proton currents in human lymphocytes J. Physiol., November 15, 2002; 545(1): 93 - 105. [Abstract] [Full Text] [PDF]

				M. Simoes, L. Garneau, H. Klein, U. Banderali, F. Hobeila, B. Roux, L. Parent, and R. Sauve Cysteine Mutagenesis and Computer Modeling of the S6 Region of an Intermediate Conductance IKCa Channel J. Gen. Physiol., June 24, 2002; 120(1): 99 - 116. [Abstract] [Full Text] [PDF]

				T. Ayabe, H. Wulff, D. Darmoul, M. D. Cahalan, K. G. Chandy, and A. J. Ouellette Modulation of Mouse Paneth Cell alpha -Defensin Secretion by mIKCa1, a Ca2+-activated, Intermediate Conductance Potassium Channel J. Biol. Chem., January 25, 2002; 277(5): 3793 - 3800. [Abstract] [Full Text] [PDF]

				C. Beeton, H. Wulff, J. Barbaria, O. Clot-Faybesse, M. Pennington, D. Bernard, M. D. Cahalan, K. G. Chandy, and E. Beraud Selective blockade of T lymphocyte K+ channels ameliorates experimental autoimmune encephalomyelitis, a model for multiple sclerosis PNAS, November 20, 2001; 98(24): 13942 - 13947. [Abstract] [Full Text] [PDF]

				B. S. Fischer, D. Qin, K. Kim, and T. V. McDonald Capsaicin Inhibits Jurkat T-Cell Activation by Blocking Calcium Entry Current ICRAC J. Pharmacol. Exp. Ther., October 1, 2001; 299(1): 238 - 246. [Abstract] [Full Text] [PDF]

				M. J. Miller, H. Rauer, H. Tomita, H. Rauer, J. J. Gargus, G. A. Gutman, M. D. Cahalan, and K. G. Chandy Nuclear Localization and Dominant-negative Suppression by a Mutant SKCa3 N-terminal Channel Fragment Identified in a Patient with Schizophrenia J. Biol. Chem., July 20, 2001; 276(30): 27753 - 27756. [Abstract] [Full Text] [PDF]

				R. Desai, A. Peretz, H. Idelson, P. Lazarovici, and B. Attali Ca2+-activated K+ Channels in Human Leukemic Jurkat T Cells. MOLECULAR CLONING, BIOCHEMICAL AND FUNCTIONAL CHARACTERIZATION J. Biol. Chem., December 15, 2000; 275(51): 39954 - 39963. [Abstract] [Full Text] [PDF]

				C. M. Fanger, H. Rauer, A. L. Neben, M. J. Miller, H. Rauer, H. Wulff, J. C. Rosa, C. R. Ganellin, K. G. Chandy, and M. D. Cahalan Calcium-activated Potassium Channels Sustain Calcium Signaling in T Lymphocytes. SELECTIVE BLOCKERS AND MANIPULATED CHANNEL EXPRESSION LEVELS J. Biol. Chem., April 6, 2001; 276(15): 12249 - 12256. [Abstract] [Full Text] [PDF]

				W. J. Joiner, R. Khanna, L. C. Schlichter, and L. K. Kaczmarek Calmodulin Regulates Assembly and Trafficking of SK4/IK1 Ca2+-activated K+ Channels J. Biol. Chem., October 5, 2001; 276(41): 37980 - 37985. [Abstract] [Full Text] [PDF]

				H. Wulff, G. A. Gutman, M. D. Cahalan, and K. G. Chandy Delineation of the Clotrimazole/TRAM-34 Binding Site on the Intermediate Conductance Calcium-activated Potassium Channel, IKCa1 J. Biol. Chem., August 17, 2001; 276(34): 32040 - 32045. [Abstract] [Full Text] [PDF]

				H. Danahay, H. Atherton, G. Jones, R. J. Bridges, and C. T. Poll Interleukin-13 induces a hypersecretory ion transport phenotype in human bronchial epithelial cells Am J Physiol Lung Cell Mol Physiol, February 1, 2002; 282(2): L226 - L236. [Abstract] [Full Text] [PDF]

				R. Kohler, S. Brakemeier, M. Kuhn, C. Behrens, R. Real, C. Degenhardt, H.-D. Orzechowski, A. R. Pries, M. Paul, and J. Hoyer Impaired Hyperpolarization in Regenerated Endothelium After Balloon Catheter Injury Circ. Res., July 20, 2001; 89(2): 174 - 179. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) All Versions of this Article: 275/47/37137    most recent M003941200v1 Submit a Letter to Editor Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Ghanshani, S. Articles by Chandy, K. G. Search for Related Content PubMed PubMed Citation Articles by Ghanshani, S. Articles by Chandy, K. G. Social Bookmarking                      What's this?