HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

J. Biol. Chem., Vol. 275, Issue 48, 37686-37691, December 1, 2000

This Article Abstract Full Text (PDF) All Versions of this Article: 275/48/37686    most recent M003963200v1 Submit a Letter to Editor Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Liu, L. Articles by Reed, G. L. Search for Related Content PubMed PubMed Citation Articles by Liu, L. Articles by Reed, G. L. Social Bookmarking                      What's this?

Leucine 42 in the Fibronectin Motif of Streptokinase Plays a Critical Role in Fibrin-independent Plasminogen Activation^*

Lin Liu, Irina Y. Sazonova, Ryan B. Turner, Shakeel A. Chowdhry, Judy Tsai, Aiilyan K. Houng, and Guy L. Reed^§

From the Harvard School of Public Health, Boston, Massachusetts 02115 and  Massachusetts General Hospital, Boston, Massachusetts 02114

Received for publication, May 9, 2000, and in revised form, August 24, 2000

	ABSTRACT

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

The NH₂ terminus (residues 1-59) of streptokinase (SK) is a molecular switch that permits fibrin-independent plasminogen activation. Targeted mutations were made in recombinant (r) SK1-59 to identify structural interactions required for this process. Mutagenesis established the functional roles of Phe-37and Glu-39, which were projected to interact with microplasmin in the activator complex. Mutation of Leu-42 (rSK1-59_L42A), a conserved residue in the SK fibronectin motif that lacks interactions with microplasmin, strongly reduced plasminogen activation (k_cat decreased 50-fold) but not amidolysis (k_cat decreased 1.5-fold). Otherwise rSK1-59_L42A and native rSK1-59 were indistinguishable in several parameters. Both displayed saturable and specific binding to Glu-plasminogen or the remaining SK fragment (rSK59). Similarly rSK1-59 and rSK1-59_L42A bound simultaneously to two different plasminogen molecules, indicating that both plasminogen binding sites were intact. However, when bound to SK59, rSK1-59_L42A was less effective than rSK1-59 in restructuring the native conformation of the SK A domain, as detected by conformation-dependent monoclonal antibodies. In the light of previous studies, these data provide evidence that SK1-59 contributes to fibrin-independent plasminogen activation through 1) intermolecular interactions with the plasmin in the activator complex, 2) binding interactions with the plasminogen substrate, and 3) intramolecular interactions that structure the A domain of SK for Pg substrate processing.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Plasminogen (Pg)¹ activators cleave the zymogen Pg to the enzyme plasmin (1). Because plasmin degrades fibrin to dissolve blood clots, Pg activators such as streptokinase (SK) are widely used in the medical treatment of heart attacks (2). SK indirectly activates Pg by forming an "activator complex" with Pg through high affinity binding interactions (3, 4). In this complex, SK non-proteolytically rearranges the latent activation domain of Pg to generate an active site (Pg*) in a manner similar to chymotrypsinogen activation, then SK acts as a cofactor that permits the binding and processing of substrate Pg molecules (5-7). The SK activator complex is the most efficient Pg activator in vitro and does not require fibrin as a cofactor (8). However, because of its fibrin independence, SK activity is not targeted or restricted to fibrin, which appears to make it less effective for dissolving blood clots in humans (2, 9, 10).

The NH₂-terminal peptide of SK, spanning residues 1-59 (particularly 24-59), gives the activator complex the capacity for fibrin-independent Pg activation through unknown mechanisms (11). When the NH₂-terminal peptide is removed, SK requires fibrin as a cofactor for efficient Pg activation (11). SK1-59 contains the first and second  strands of the A domain (1 and 2), which interact with a loop of microplasmin that spans residues 713 to 721 (12). Glu-39 of SK forms a salt bridge with Arg-719 of microplasmin, which in turn has a van der Waals contact with Val-19 (12). Phe-37 appears to stack on the aliphatic side chain of Arg-719 and to interact with Trp-761 of microplasmin. Residues 1-15 and 46-70 of the SK NH₂-terminal peptide are disordered, and residues 42-46 contain a fibronectin motif L⁴²TSRPA. Although this fibronectin motif has no contact interactions with microplasmin in the activator complex, fibronectin can bind plasmin and inhibit Pg activation by SK (13), which suggests that residues in this motif could play a key functional role. Finally, in modeling studies that dock the substrate Pg with the activator complex, there is a potential interaction between SK residues 45-50 and kringle 5 of substrate Pg (12). Indeed recent studies show that Pg substrate binding is kringle-dependent (14).

In addition to its potential interactions with Pg substrate, the NH₂-terminal peptide (or subdomain A1) also interacts with another fragment (subdomain A2) to reconstitute the structure of the SK A domain (residues 1-148) (15). The A domain has more extensive molecular contacts with microplasmin in a crystal structure of the activator complex than the other two domains of SK (B and C) (12). Still, the isolated A domain has been reported not to bind to Pg, although the NH₂-terminal peptide of SK (A1) markedly augments the binding affinity of the remaining SK molecule (A2, B, C) for Pg (16). The NH₂-terminal peptide may contribute to this binding because it binds with A2 to restructure the A domain (15) or because it contains an extra Pg binding site (16, 17).

These studies suggest several potential mechanisms through which residues in the NH₂-terminal peptide of SK may foster fibrin-independent Pg activation. First, by virtue of their interaction with the plasmin moiety in the activator complex, they may stabilize the catalytic function of the complex. Alternatively, they may directly dock Pg substrate to the activator complex, or indirectly, through intermolecular interactions they may structure the A domain to permit binding between this domain and Pg substrate. To examine these hypotheses, we studied the contribution of key residues in the NH₂-terminal peptide through mutagenesis. Mutations of residues that directly interact with the plasmin moiety in the activator complex reduced Pg activation, confirming their functional role in the activator complex. Mutation of a residue (Leu-42) in the fibronectin motif of the NH₂-terminal peptide caused a marked defect in fibrin-independent Pg activation. This mutation (L42A) did not alter the binding of the NH₂-terminal peptide (A1) to the remaining SK fragment (A2-B-C or residues 60-414). Nor did the L42A mutation affect the ability of the NH₂-terminal peptide to simultaneously bind two molecules of Pg, an interaction that may dock Pg substrate with the plasmin or Pg* moiety in the activator complex. Instead, the L42A mutation prevented the A1 fragment from restructuring the native conformation of the A domain, which appears necessary for the fibrin-independent processing of Pg substrate by the activator complex.

	EXPERIMENTAL PROCEDURES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Cloning, Expression, and Purification of Recombinant Proteins

The SK gene was cloned from Streptococcus equisimilis, expressed in bacteria via the pMALc vector (New England Biolabs, Beverly, MA) and purified as described in detail (3). The recombinant (r) deletion mutant lacking the first 59 (rSK59) amino acids has been described (11). Site-directed mutagenesis of the SK 1-59 sequence was performed by polymerase chain reaction with overlap extension using the following primers: SKT43A sense, atcgatctagcatcacg, and SKT43A antisense, cgtgatgctagatcgat; SKE39Q sense, tttcaaatcgatctaacatc, and SKE39Q antisense, gatgttagatcgatttgaaa; SKF37A sense gtccttaaagcttttgaaatc, and SKF37A antisense, gatttcaaaagctttaagac; SKL42A sense, atgcaagcatcacgacct, and SKL42A antisense, aggtcgtgatgttgcat. The polymerase chain reaction products were sequenced on both strands to confirm the target mutations and ligated into pMalc for expression in bacteria (18). The purity of the rSK proteins was assessed by SDS-polymerase chain reaction as described (3). Recombinant microPg that spanned residues 530-791 of human Pg was cloned into pET11d (Stratagene, La Jolla, CA), expressed in bacteria, and purified as described in detail (11).

Enzymatic Assays

Active Site Titration-- The molar quantity of active sites generated by the various rSK-Pg activator complexes was determined at 25 °C in a Hitachi 2500 fluorescence spectrophotometer by active site titration with the fluorogenic substrate 4-methylumbelliferyl p-guanidinobenzoate (Sigma) as described (3).

Kinetic Assays of the rSK-Pg Activator Complex, Amidolysis-- The amidase kinetic parameters of the activator complexes were measured with a p-nitroanilide substrate (S2251, H-D-valyl-L-leucyl-L-lysine-p-nitroanilide dihydrochloride, Chromogenix, Sweden) as described (3, 19, 20). The rSK (20 nM) and Glu-Pg (10 nM; 95% Glu-type, Pharmacia Hepar, Franklin, Ohio) were mixed together and incubated at 37 °C for 5 min to construct the SK-Pg activator complex. By immunoblotting studies (20), this batch of Glu-Pg had less than 1% plasmin or Lys-Pg. The mixture was then transferred to a thermostatically regulated (37 °C) quartz cuvette containing assay buffer (50 mM Tris, 100 mM NaCl, pH 7.4) and various concentrations of S2251 (100-800 µM) in a total volume of 300 µl. The change in absorbance was monitored at 405 nm for 5 min at 37 °C in a thermostatted Cary 100-Bio spectrophotometer. The data were plotted as velocity/[substrate] and analyzed by hyperbolic curve fitting with the use of the Sigma Plot program.

Pg Activation Assays-- The effects of NH₂-terminal mutations on Pg activation by rSK59 were also studied as described (3, 7, 11, 19). In these studies Glu-Pg and rSK59 were mixed together in stoichiometric ratios for various times (as indicated) to form an activator complex. In some cases native or mutant rSK1-59 was pre-incubated with SK59 overnight at 4 °C before formation of an activator complex. The activator complex was then added (10 nM) to a quartz cuvette containing assay buffer (50 mM Tris, 100 mM NaCl, pH 7.4), 500 µM S2251, and various concentrations of Glu-Pg (50-750 nM) in a total volume of 300 µl. The change in absorbance at 405 nm was monitored at 37 °C as described. Initial reaction rates were obtained from the first 300 s by plotting A₄₀₅/time², and the apparent Michaelis constants and catalytic rate constants were calculated by fitting the data to a hyperbolic curve as described (3, 7, 11, 19) using the Sigma Plot program. The effect of rSK1-59 (native or mutant) on the activation of bovine Pg (300 nM) by the stoichiometric complex of rSK59 and human plasmin was also studied in a similar fashion. Radioiodination was performed using the Iodogen reagent (Pierce) (21), and the specific activity was determined as described (3, 22).

Binding Assays

Competitive Binding of Native and Mutant rSK1-59 to Glu-Pg-- Wells of microtiter plates were coated with Glu-Pg (5 µg/ml). The wells were washed, and nonspecific protein binding sites were blocked with 1% bovine serum albumin. Radioiodinated rSK1-59 (200,000 cpm/25 µl) was added to the wells in the presence of various amounts of rSK1-59 proteins (0 to 200 µg/ml) added as competitors. The percent inhibition of binding of native rSK1-59 to Glu-Pg by various concentrations of mutant rSK1-59 was corrected for the nonspecific binding of ¹²⁵I-rSK1-59 to wells not coated with Pg (which was ~1% of total).

Binding between rSK59 and rSK1-59-- Wells were coated with rSK59 (20 µg/ml) or purified MBP (20 µg/ml) or no antigen. The wells were washed and blocked with 1% BSA. After that rSK1-59 (native or mutant, 50 µl, 0-100 µg/ml) was added. After a 1-h incubation and washing, the anti-SK NH₂-terminal monoclonal antibody (mAb) 9D10 (23, 24) was added for 1 h. After washing bound mAb was detected by ¹²⁵I goat anti-mouse Ab (50,000 cpm) followed by -counting.

Binding of rSK1-59 and rSK59 to Glu-Pg-- Microtiter plates were coated with 50 µl of Glu-Pg (5 µg/ml) or no protein (control). Nonspecific binding was blocked with 1% BSA. After washing, SK1-59 or rSK59 (50 µl) was added in different concentrations (0-100 µg/ml). After 1 h, wells were washed, and 50 µl of rabbit anti-MBP Ab was added for 1 h. After washing, bound Ab was detected by 50 µl of ¹²⁵I-protein A followed by -counting.

Simultaneous Binding of rSK1-59 to Two Pg Molecules Was Assessed in a "Sandwich" Binding Assay-- Microtiter plates were coated with or without Glu-Pg (5 µg/ml), and nonspecific binding sites were blocked with 1% BSA. After that rSK1-59 (native or L42A, 10 µg/ml) or MBP (10 µg/ml) was added for 1 h. After washing, ¹²⁵I-Glu-Pg was added for 1 h before wells were washed and -counted.

Binding of Conformation-dependent and -independent Antibodies to the rSK1-59 and rSK59 Complex-- Native or L42A mutant rSK1-59 (5 µg/ml) were mixed together with rSK59 (10 µg/ml) or kept separate for 1 h. Microtiter plates were coated with the mixed or separate proteins for 1 h. After blocking with 1% BSA (1 h) and washing, various conformation-dependent and -independent mAb hybridoma supernatants were added for 1 h. After washing, bound mAb was detected by ¹²⁵I goat anti-mouse Ab followed by -counting. The binding of these anti-SK mAbs to native rSK or the isolated rSK A, B, or C domains was assessed in a similar binding assay.

	RESULTS

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Mutation of Key Residues in the NH₂-terminal Peptide-- Previous studies show that recombinant NH₂-terminal peptide of SK (rSK1-59), when mixed stoichiometrically with the remaining SK molecule (rSK59), restored fibrin-independent Pg activation to the activator complex to levels comparable with full-length rSK (11). Because deletion of amino acids 24-59 profoundly reduced fibrin-independent Pg activation, we used mutagenesis to examine the functional role of residues in this region (11). We selected for mutation Glu-39 (which forms a salt bridge with microplasmin Arg-719), Phe-37 (which interacts with microplasmin Trp-761 and Arg-719), and two conserved residues (Thr-42, Leu-43) in the fibronectin motif (which have no apparent intermolecular interactions) (12, 25).

Functional Effects of Mutations in rSK1-59 on Pg Activation-- In the absence of the NH₂-terminal peptide (rSK1-59), rSK59 alone could not significantly activate Glu-Pg (Fig. 1A). The addition of rSK1-59 containing the native sequence or with a mutation of Thr-43 to Ala (T43A) markedly amplified Pg activation. By comparison with native rSK1-59, the activity of the F37A and Glu-39 mutants was modestly reduced, and the L42A mutant demonstrated virtually no activity. To determine whether the reduced function of these rSK1-59 mutants was due to an impaired kinetic ability to form a complex with rSK59, both mutants and rSK59 were pre-incubated together overnight at 4 °C and then tested in the same Pg activation assay. The rate of Pg activation improved after longer incubation for all of the mutants (Fig. 1, B versus A), which suggested that the rate of complex formation between the rSK1-59 and rSK59 fragments was rate-limiting. However, despite slight improvement with overnight incubation, the L42A mutant (rSK1-59_L42A) was still impaired in its ability to restore Pg activation to the rSK59 fragment. Even incubation of rSK1-59_L42A, rSK59, and Pg overnight at 4 °C did not restore normal activity to the activator complex (data not shown).

View larger version (17K): [in this window] [in a new window]   Fig. 1.   Indirect Pg activation by rSK59 and various rSK1-59 mutants. To a cuvette containing 300 nM Glu-Pg in 37 °C buffer (50 mM Tris-HCl, 100 mM NaCl, pH 7.4) with 0.5 mM S2251 was added rSK59 (0 or 10 nM) with or without rSK1-59 (10 nM, wild type or mutants). The absorption at 405 nm was recorded for 30 min in a spectrophotometer. A, Pg activation without preincubation of rSK fragments. B, Pg activation after preincubation of rSK fragments overnight at 4 °C.

Kinetics of Pg Activation by SK Mutants-- Kinetic studies were used to further characterize the functional defects in the rSK1-59_L42A. In parallel assays the activator complexes formed by native rSK1-59 or rSK1-59_L42A with Glu-Pg showed only minor differences (2-fold) in the kinetics of amidolysis for a small peptide substrate (Table IB). In contrast, rSK1-59_L42A had more marked effects on the kinetics of Pg activation. The activator complex formed with rSK1-59_L42A had a 50-fold lower k_cat for Glu-Pg substrate than the native rSK1-59 sequence (Table IA). The relatively selective defect in Pg activation versus amidolysis suggested that the Leu-42 was required for the processing of Pg substrate by the activator complex but was not required for the generation or stabilization of the active site per se. If this was true, the L42A mutation should also impair Pg activation when the activator complex contains plasmin, which already possesses a productively arranged active site. To distinguish the effects of the NH₂ terminus on the plasmin in the activator complex from its potential interactions with Pg substrate (see below), bovine Pg was used as a substrate because it does not form an activator complex with SK (26). When compared with the rSK59-plasmin activator complex containing wild-type rSK1-59, the activator complex containing rSK1-59_L42A showed a diminished ability to activate bovine Pg substrate (Fig. 2).

View this table: [in this window] [in a new window]   Table I Steady state Pg activation and amidolytic parameters A, plasminogen activation parameters. Activation experiments were performed at 37 °C in a total volume of 300 µl. The activator complex (10 nM) was formed by mixing stoichiometric amounts of rSK59 and rSK1-59 (or L42A mutant) overnight at 4 °C before mixing with Glu-plasminogen for 30 min on ice (see "Experimental Procedures"). The activator complex was then added to various concentrations (50-750 nM) of Glu-Pg in a cuvette at 37 °C. Kinetic parameters were determined as described ("Experimental Procedures"). The values represent the mean ± S.E. B, amidolytic parameters. Amidolytic experiments were performed at 37 °C in a total volume of 300 µl. The activator complexes (5.7-17.5 nM) were formed as described above. The activator complex was added to various concentrations (80-800 nM) of H-D-valyl-L-leucyl-L-lysine-p-nitroanilide dihydrochloride. The rate of product formation was determined by the change in absorbance at 405 nm. Kinetic parameters were determined as described under "Experimental Procedures." The values represent the mean ± S.E.

View larger version (29K): [in this window] [in a new window]   Fig. 2.   Influence of rSK1-59 (native or L42A mutant) on Pg activation by the rSK59-plasmin activator complex. An equimolar complex was formed (10 nM) between rSK59 (with or without rSK1-59) and human plasmin (h-plasmin) by incubation on ice for 3 min. The SK fragments were preincubated overnight at 4 °C to maximize complex formation as shown in Fig. 1. The activator complexes were added to cuvettes containing 0.3 µM bovine Pg. Plasminogen activation was detected by continuously monitoring the change in absorbance at 405 nM. Shown also for comparison are the effects on Pg activation of sham activator complexes of human plasmin with rSK1-59 (native or L42A mutant), plasmin alone, or no additive (control).

Complex Formation; Pg Binding Interactions-- If SK 1-59 plays a selective role in the processing of Pg substrate by the activator complex, it may directly interact with Pg or plasmin in the activator complex and/or Pg substrate. Experiments confirmed that rSK1-59, like rSK59, bound in a saturable and specific fashion to Glu-Pg (Fig. 3A). Comparative inhibition studies were performed to determine whether the L42A mutation altered the binding interactions of rSK1-59 with Glu-Pg. The binding of native ¹²⁵I-rSK1-59 to Glu-Pg was specifically inhibited by unlabeled native rSK1-59 with an IC₅₀ of 0.3 µM (Fig. 3B). A similar inhibition of ¹²⁵I-rSK1-59 binding was seen with rSK1-59_L42A, indicating that this mutation did not significantly affect these binding interactions. Thus the impaired function caused by the L42A mutation was not due to abnormal binding to Glu-Pg.

View larger version (18K): [in this window] [in a new window]   Fig. 3.   The binding of rSK1-59 to Glu-Pg. A, direct binding of rSK1-59 and rSK59 to Glu-Pg. Wells coated with Glu-Pg or no Pg were incubated with various amounts of rSK1-59 or rSK59. The amount of bound SK was detected by anti-MBP antibody, followed by 125I-protein A. B, inhibition of binding of 125I-rSK1-59 binding to Glu-Pg by the rSK1-59 L42A mutant. Wells of a microtiter plate were coated with Glu-Pg (50 µl, 5 µg/ml). After blocking nonspecific protein binding sites, 125I-rSK1-59 (25 µl, 19 nM final) and various amounts (0 to 4 µM) of rSK1-59 L42A (filled symbols) or native rSK1-59 (open symbols) were added for 1 h as competitors. After washing, the bound 125I-rSK1-59 was determined by -counting. The percent bound was determined by measuring the fractional binding in the presence of competitor to that in the absence of a competitor after correcting for nonspecific binding. C, simultaneous binding of Pg molecules to rSK1-59. Microtiter plates were coated with or without Glu-Pg (5 µg/ml) and nonspecific binding sites were blocked with 1% BSA. After that rSK1-59 (native or L42A, 10 µg/ml) or MBP (10 µg/ml) was added for 1 h. After washing, 125I-Glu-Pg was added. One h later, wells were washed and -counted. The background binding of 125I-Glu-Pg to wells not containing Pg or rSK1-59 was subtracted, and the mean ± S.E. is shown.

To give the activator complex the ability to efficiently activate Pg in the absence of fibrin, SK1-59 may contribute to binding interactions between the moiety Pg or plasmin in the activator complex and Pg substrate. Thus we examined whether SK1-59 could simultaneously bind two different Pg molecules. In the absence of rSK1-59, ¹²⁵I-Glu-Pg showed no significant binding to immobilized Glu-Pg substrate (Fig. 3C). However, the binding of rSK1-59 to wells coated with Glu-Pg enhanced the subsequent binding of ¹²⁵I-Glu-Pg, which indicated that rSK1-59 was capable of simultaneously binding or docking two Pg molecules (Fig. 3C). In the same assay, rSK1-59_L42A also showed a comparable ability to dock Pg molecules.

Structural Interactions between rSK1-59 and rSK59-- Because SK1-59 or subdomain A1 has been reported to bind to subdomain A2 () we investigated the interactions of rSK1-59 with rSK59. Both the wild-type rSK1-59 fragment and rSK1-59_L42A bound comparably with SK59 in solid phase binding studies (Fig. 4). In the crystal structure of the SK-microplasmin complex, the Leu-42 side chain is oriented inward and has potential hydrophobic interactions that may contribute to the structure of the A domain (Fig. 6). To detect whether the L42A mutation altered the structure of the A domain when it interacted with rSK59, we used a panel of well characterized mAbs that bind to conformation-dependent and -independent epitopes in native SK (23, 24). The mAbs that recognize the native conformation of the A domain of SK (1E10 and 2E8, Fig. 5A) bound to the complex formed by native rSK1-59 and rSK59 but only partially to the complex formed by rSK1-59_L42A and rSK59 (Fig. 5B). As expected, these mAbs bound minimally to rSK59 alone and not to rSK1-59. However, under the same conditions, the conformation-independent antibody directed to the A domain (9G12, Fig. 5A) bound comparably with rSK59 alone or in complex with rSK1-59 (Fig. 5B). Similarly, a mAb (8F5) directed against the B domain of SK (Fig. 5A) showed comparable binding to rSK59 alone or to the mixture of native or mutant rSK1-59 with rSK59 (Fig. 5B). This indicates that the complex formed by rSK59 with native rSK1-59 more closely recapitulates the native conformational structure of the A domain of SK than does the complex formed by rSK59 with rSK1-59_L42A.

View larger version (26K): [in this window] [in a new window]   Fig. 4.   Binding of native rSK1-59 and the Leu-42 mutant to rSK59. Wells were coated with rSK59 (20 µg/ml) or purified MBP (20 µg/ml) or no antigen. The wells were washed and blocked with 1% BSA before the addition of 50 µl of rSK1-59 (native or mutant, 0-100 µg/ml). After a 1-h incubation and washing, the anti-SK NH2-terminal mAb 9D10 (23, 24) was added for 1 h. After washing, bound mAb was detected by 125I goat anti-mouse Ab (50,000 cpm) followed by -counting.

View larger version (20K): [in this window] [in a new window]   Fig. 5.   Complex formation between rSK1-59 and rSK59 detected by conformation-dependent anti-SK antibodies. A, binding specificity of conformation-dependent (2E8 and 1E10) and -independent (9G12 and 8F5) anti-SK monoclonal antibodies for native SK and SK domains. Wells of a microtiter plate were coated with purified rSK domains (A, B, and C) or native rSK (50 µl, 5 µg/ml) or no SK (Ctl) and then blocked with 1% BSA. After washing, mAb hybridoma supernatants were added for 1 h. After additional washing, bound mAb was detected by 125I-goat anti-mouse Ab followed by -counting. B, binding of conformation-dependent and -independent antibodies to rSK1-59 and rSK59 alone and to the rSK1-59 and rSK59 complex. Native or L42A mutant rSK1-59 (5 µg/ml) were mixed together with rSK59 (10 µg/ml) or kept separate for 1 h. The microtiter plates were coated with the individual or complexed proteins for 1 h. After blocking with 1% BSA (1 h) and washing, various conformation-dependent and -independent mAb hybridoma supernatants were added for 1 h. Bound mAb was detected by -counting as described above.

	DISCUSSION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

The goal of these studies was to identify the potential mechanisms through which SK residues 24-59 play a critical role in fibrin-independent Pg activation (11). In a crystal structure of the activator complex, SK Glu-39 and Phe-37 were projected to interact with plasmin (12). Our mutagenesis experiments confirm that these residues play a functional role in Pg activation. After these residues is the fibronectin motif that begins at the end of 2 and continues into an unstructured loop (beginning at residue 46 through residue 70). These sequences do not have intermolecular contacts with microplasmin in the activator complex (12). Still, mutation of Leu-42 in the fibronectin motif appeared to cause a nearly selective defect in the ability of SK to serve as a cofactor for the binding and processing of Pg substrate because 1) it reduced the ability of the SK-plasmin complex to activate Pg and 2) it caused a significant (50-fold) decrease in the k_cat for Pg activation but only slightly affected the k_cat for amidolysis (~1.5-fold).

Investigation of the mechanism underlying the defect in the L42A mutant revealed the roles played by SK1-59 in fibrin-independent Pg activation. We found that both the native rSK1-59 and rSK1-59_L42A bound comparably in a saturable and specific fashion to Glu-Pg. In addition, both native rSK1-59 and rSK1-59_L42A simultaneously bound to immobilized Glu-Pg and ¹²⁵I-Glu-Pg in a sandwich assay, indicating that both molecules have at least two intact Pg binding sites. Native rSK1-59 and rSK1-59_L42A also bound indistinguishably in a saturable and specific fashion to the remainder of the SK molecule, rSK59. However, studies with conformation-dependent monoclonal antibodies showed that the binding interactions of native SK1-59 with rSK59 largely reconstituted the native structure of the A domain of SK, whereas the binding of rSK1-59_L42A to rSK59 did not. Thus the interactions of SK1-59 with rSK59 induced structural changes that restored the ability of SK to bind Pg substrate either through direct interactions with the structured A domain or indirectly through other sites. A direct effect on substrate binding by the A domain appears to be the best explanation for two reasons. This domain recapitulates in sequence and size the structure of staphylokinase, a Pg activator that acts as a cofactor for binding Pg substrate for processing by plasmin (27). In addition, in modeling studies with the activator complex, the A domain is projected to have the most extensive binding contacts with Pg substrate (12).

Unlike the other residues in the fibronectin motif, Leu-42 is one of the few residues conserved among different SKs isolated from humans, pigs, and horses (28). The crystal structure of the streptokinase-plasmin complex revealed that there was no interaction of Leu-42 with microplasmin. The side chain of Leu-42 was oriented inward and appeared to contribute to the packing of the hydrophobic core of the protein through hydrophobic side chain interactions with Leu-18, Leu-74, Leu-127, Phe-135, and Ile-40 (Fig. 6) (29). Mutation of a packed Leu residue to Ala significantly affects the thermal stability of the protein (30). Although not directly shown in this study, it is possible to infer from crystal structure data that Leu-18, Ile-40, and Leu-42 participate in the formation of a type of a non-classical leucine zipper (i.e. "non-zipper") interaction with Leu-74 and Leu-79 (31). This hydrophobic interaction may be responsible for maintaining the association of the A1 and A2 subdomains after proteolytic cleavage of the A domain during Pg activation. Without the Leu-42 interaction, the A domain may not structure properly to permit optimal positioning of residues involved in direct contact with Pg substrate.

View larger version (24K): [in this window] [in a new window]   Fig. 6.   Structural interactions of Leu-42 in the SK A domain (12). A, the side chain of Leu-42 is oriented inward and appears to contribute to the formation of a hydrophobic core through side-chain interactions with Leu-18, Leu-74, Leu-127, Phe-135, and Ile-40. B, Leu-42 may participate in the formation of a leucine non-zipper interaction (31) that pairs the A1 and A2 subdomains. In this structure Leu-87, Ile-83, and Leu-79 are on the same hydrophobic surface of the helix (3,4; see Ref. 12) in the A2 subdomain. Leu-74 also faces the same surface. In the A1 subdomain several residues (Leu-18, Val-22, Ile-33, Leu-35, Ile-40, Leu-42) form a complementary hydrophobic surface that pairs with the hydrophobic surface of the helix in the A2 subdomain. Phe-38 of the A1 subdomain also extends into the hydrophobic interface.

Other studies have suggested that the SK NH₂ terminus is involved in binding Pg substrate. For example, a monoclonal antibody against the NH₂ terminus of SK inhibited Pg activation but not amidolytic activity (23, 24). The fibronectin motif sequence L⁴²TSRPA⁴⁷ has been implicated in Pg binding because of its homology to a fragment of fibronectin that binds to plasmin (13). A docking interaction between kringle 5 of substrate Pg and residues 45-50 of SK (in the activator complex) has been projected in computer-assisted structural models (12). In support of this, Pg does bind to an immobilized peptide mimic of SK residues 37-51 (33). However, the fibronectin motif does not appear to be the binding site because replacement of the LTSRP sequence with alanines does not eliminate binding (33). Similarly, we have found that mutation of Leu-42 and Thr-43 does not alter Pg binding and that mutation of Arg-45 (not shown) does not reduce Pg activation. Thus the residues responsible for Pg substrate binding in the NH₂-terminal peptide remain unidentified.

The results of these experiments may help to resolve the apparent contradictions in the literature about the role of the NH₂ terminus in Pg activation (11, 15, 32-35). Because the A1 and A2 subdomains interact relatively slowly to restructure the A domain and to restore Pg activation, the effects of this interaction will be significantly influenced by experimental conditions such as time, temperature, and stoichiometry. Another explanation for previous experimental differences is the multiple roles played by the NH₂ terminus of SK in Pg activation. The NH₂-terminal Ile participates in the non-proteolytic activation of Pg through a chymotrypsinogen-like activation mechanism (7). The present experiments provide functional evidence that the NH₂-terminal peptide of SK influences fibrin-independent Pg activation through at least three other mechanisms, as follows: 1) SK residues Phe-37 and Glu-39 play an important role in interacting with Pg* or plasmin moiety in the activator complex (12), 2) SK1-59 contains two Pg binding sites and appears capable of binding both the plasmin or Pg moiety in the activator complex and another Pg molecule in a potential substrate-docking interaction, and 3) SK 1-59 interacts with the A2 subdomain to restore the native structure of the A domain, so as to permit additional interactions between the activator complex and Pg substrate, which have been projected by structural modeling (12).

	FOOTNOTES

^* This work was supported in part by National Institutes of Health Grant HL-57314 (to G. L. R.).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

^§ To whom correspondence should be addressed: Cardiovascular Biology Laboratory, HSPH II-127, 677 Huntington Ave., Boston, MA 02115. Tel.: 617-432-4992; Fax: 617-432-0031; E-mail: reed@cvlab.harvard.edu.

Published, JBC Papers in Press, August 28, 2000, DOI 10.1074/jbc.M003963200

	ABBREVIATIONS

The abbreviations used are: SK, streptokinase; Pg, plasminogen; r, recombinant; Ab, antibody; mAb, monoclonal Ab; MBP, maltose-binding protein; BSA, bovine serum albumin.

	REFERENCES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

CiteULike

Complore

Connotea

Del.icio.us

Digg

Reddit

Technorati

This article has been cited by other articles:

				A. C. Tharp, M. Laha, P. Panizzi, M. W. Thompson, P. Fuentes-Prior, and P. E. Bock Plasminogen Substrate Recognition by the Streptokinase-Plasminogen Catalytic Complex Is Facilitated by Arg253, Lys256, and Lys257 in the Streptokinase {beta}-Domain and Kringle 5 of the Substrate J. Biol. Chem., July 17, 2009; 284(29): 19511 - 19521. [Abstract] [Full Text] [PDF]

				R. R. Bean, I. M. Verhamme, and P. E. Bock Role of the Streptokinase {alpha}-Domain in the Interactions of Streptokinase with Plasminogen and Plasmin J. Biol. Chem., March 4, 2005; 280(9): 7504 - 7510. [Abstract] [Full Text] [PDF]

				I. Y. Sazonova, B. R. Robinson, I. P. Gladysheva, F. J. Castellino, and G. L. Reed {alpha} Domain Deletion Converts Streptokinase into a Fibrin-dependent Plasminogen Activator through Mechanisms Akin to Staphylokinase and Tissue Plasminogen Activator J. Biol. Chem., June 11, 2004; 279(24): 24994 - 25001. [Abstract] [Full Text] [PDF]

				L. V. Mundada, M. Prorok, M. E. DeFord, M. Figuera, F. J. Castellino, and W. P. Fay Structure-Function Analysis of the Streptokinase Amino Terminus (Residues 1-59) J. Biol. Chem., June 27, 2003; 278(27): 24421 - 24427. [Abstract] [Full Text] [PDF]

				V. Leksa, S. Godar, M. Cebecauer, I. Hilgert, J. Breuss, U. H. Weidle, V. Horejsi, B. R. Binder, and H. Stockinger The N Terminus of Mannose 6-Phosphate/Insulin-like Growth Factor 2 Receptor in Regulation of Fibrinolysis and Cell Migration J. Biol. Chem., October 18, 2002; 277(43): 40575 - 40582. [Abstract] [Full Text] [PDF]

				I. P. Gladysheva, I. Y. Sazonova, S. A. Chowdhry, L. Liu, R. B. Turner, and G. L. Reed Chimerism Reveals a Role for the Streptokinase beta -Domain in Nonproteolytic Active Site Formation, Substrate, and Inhibitor Interactions J. Biol. Chem., July 19, 2002; 277(30): 26846 - 26851. [Abstract] [Full Text] [PDF]

				I. Y. Sazonova, A. K. Houng, S. A. Chowdhry, B. R. Robinson, L. Hedstrom, and G. L. Reed The Mechanism of a Bacterial Plasminogen Activator Intermediate between Streptokinase and Staphylokinase J. Biol. Chem., April 13, 2001; 276(16): 12609 - 12613. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) All Versions of this Article: 275/48/37686    most recent M003963200v1 Submit a Letter to Editor Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Liu, L. Articles by Reed, G. L. Search for Related Content PubMed PubMed Citation Articles by Liu, L. Articles by Reed, G. L. Social Bookmarking                      What's this?