JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M005298200 on September 13, 2000

J. Biol. Chem., Vol. 275, Issue 49, 38384-38392, December 8, 2000
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
275/49/38384    most recent
M005298200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Goswami, P. C.
Right arrow Articles by Spitz, D. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Goswami, P. C.
Right arrow Articles by Spitz, D. R.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Cell Cycle-coupled Variation in Topoisomerase IIalpha mRNA Is Regulated by the 3'-Untranslated Region

POSSIBLE ROLE OF REDOX-SENSITIVE PROTEIN BINDING IN mRNA ACCUMULATION*

Prabhat C. GoswamiDagger §, Jamie SherenDagger , Lee D. AlbeeDagger , Azemat ParsianDagger , Julia E. SimDagger , Lisa A. RidnourDagger , Ryuji HigashikuboDagger , David GiusDagger , Clayton R. HuntDagger , and Douglas R. SpitzDagger §

From the Dagger  Radiation Oncology Center, MIR, Washington University Medical School, St. Louis, Missouri 63108 and the § Free Radical and Radiation Biology Program, University of Iowa, Iowa City, Iowa 52242

Received for publication, June 19, 2000, and in revised form, August 30, 2000



    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Mammalian topoisomerase IIalpha (Topo II) is a highly regulated enzyme essential for many cellular processes including the G2 cell cycle checkpoint. Because Topo II gene expression is regulated posttranscriptionally during the cell cycle, we investigated the possible role of the 3'-untranslated region (3'-UTR) in controlling Topo II mRNA accumulation. Reporter assays in stably transfected cells demonstrated that, similar to endogenous Topo II mRNA levels, the mRNA levels of reporter genes containing the Topo II 3'-UTR varied during the cell cycle and were maximal in S and G2/M relative to G1. Topo II 3'-UTR sequence analysis and RNA-protein binding assays identified a 177-nucleotide (base pairs 4772-4949) region containing an AUUUUUA motif sufficient for protein binding. Multiple proteins (84, 70, 44, and 37 kDa) bound this region, and the binding of 84- and 37-kDa (tentatively identified as the adenosine- or uridine-rich element-binding factor AUF1) proteins was enhanced in G1, correlating with decreased Topo II mRNA levels. The binding activity was enhanced in cellular extracts or cells treated with thiol-reducing agents, and increased binding correlated with decreased Topo II mRNA levels. These results support the hypothesis that cell cycle-coupled Topo II gene expression is regulated by interaction of the 3'-UTR with redox-sensitive protein complexes.



    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Mammalian topoisomerase IIalpha (Topo II)1 is a multifunctional protein involved in many cellular processes including replication, repair, transcription, recombination, chromosome condensation and segregation, and the G2 cell cycle checkpoint pathway (1-5). Topo II levels (mRNA, protein, and activity) increase in late S phase, peak in G2/M, and rapidly decrease following mitosis (4, 6-8). Consistent with these observations, inhibitors of Topo II have been shown to arrest mammalian cells before mitosis in the G2 phase of the cell cycle (6, 9-12), and deregulated expression of Topo II results in cell death (13). In HeLa cells synchronized by mitotic shake-off, Topo II mRNA levels increased 16-fold in late S to G2/M phases (14-18 h after plating) relative to G1 (6). This increase in Topo II mRNA level was associated with a significant increase in Topo II mRNA stability, but with only marginal changes in the transcription rate.

The regulation of mRNA stability has emerged as an important control mechanism of gene expression. Although the mechanisms that alter mRNA stability of different genes have unique features, in general, sequences located in the 3'-untranslated region (UTR) and their interactions with specific proteins regulate mRNA stability (14-17). The most common 3'-UTR stability determinants are adenosine- or uridine-rich elements (AREs), which include AUUUA, AUUUUA, and AUUUUUA motifs (18-22). Furthermore, a family of proteins, the AU-binding proteins, including AUF1 (23), Hel-N1 (24), AUH (25), HuR (26), and AUBF (27), have the capacity to bind with high affinity to mRNA containing ARE. Binding of AU-binding proteins (e.g. 15-, 18-, and 19-kDa AUBF and 37-, 40-, 42-, and 45-kDa AUF1) to AREs correlates with either mRNA stabilization (27, 28) or destabilization (23, 29, 30). These observations suggest that ARE elements can be both positive and negative regulators of mRNA stability, depending on the sequence context in which the sequence elements are located and the precise protein composition of the RNA-protein complex. In addition, posttranslational modifications involving oxidation/reduction as well as phosphorylation/dephosphorylation of AU-binding proteins have also been shown to affect ARE binding (23, 27, 31). Binding to cytokine and lymphokine mRNAs can be reversibly blocked by the thiol-oxidizing agent diamide but irreversibly inhibited by the thiol-alkylating agent N-ethylmaleimide (NEM) and enhanced by the thiol-reducing agent 2-mercaptoethanol (2-ME) (31, 32). Thus, it is possible that subtle changes in redox potential during cell growth or in response to environmental stimuli may influence ARE-AU-binding protein binding and alter the stability of ARE-containing mRNA. We showed earlier that the cell cycle-coupled accumulation of Topo II mRNA levels is regulated by changes in mRNA stability (6). The present study was designed to test the idea that Topo II gene expression during the cell cycle is regulated by 3'-UTR via interactions with redox-sensitive protein complexes.


    MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Cell Culture and Extract Preparation-- HeLa cell cultures, synchronization by selective detachment of mitotic cells, and flow cytometric analysis of cell cycle positions were performed following previously described procedures (6). Mouse NIH 3T3 fibroblast cells were grown in Dulbecco's modified Eagle's medium with 10% calf serum and antibiotics. Exponentially growing cells were synchronized by replacing the growth medium with medium containing 0.5% serum and serum-stimulated to reenter the cell cycle. Cytoplasmic extracts were prepared following the method described by Konarska and Sharp (33). In selected experiments, dithiothreitol (DTT) was omitted during the preparation of cytoplasmic extracts. For determining redox sensitivity in RNA-protein binding, protein extracts were treated with DTT, 2-ME, NEM, or diamide for 10 min at 25 °C prior to RNA-protein gel shift analysis.

Plasmid Construction and DNA Transfections-- Three reporter constructs, (a) HDelta Topo2, a truncated form of Topo II cDNA with the entire 3'-UTR (base pairs 1-3013 deleted), (b) Hbeta galSV40, beta -galactosidase reporter gene fused with the SV40 3'-UTR at its 3'-end, and (c) Hbeta galTopo, beta -galactosidase reporter fused with Topo II 3'-UTR at its 3'-end, were engineered. All three constructs were fused at the 5'-end with a 1.6-kb fragment containing 650 nucleotides (nt) of the Topo II promoter, first exon (21 nt), intron (860 nt), and the second exon (150 nt) (34). The 1.6-kb fragment was polymerase chain reaction-amplified from human genomic DNA (CLONTECH) using primer pairs 5'--562GGGGCGGGGTTGAGGCAGATGCCAGAATCT-532-3' and 5'-+150AGGTGTCTGGGCGGAGCAAAATATGTTCC+121-3' (34). The polymerase chain reaction-amplified fragment was cloned into TA-cloning vector (Invitrogen), digested with MfeI restriction enzyme, and ligated into SpeI-digested hTopo2 plasmid (plasmid DNA containing the entire human Topo II cDNA, a gift from Dr. J. C. Wang, Ref. 35) to generate plasmid HDelta Topo2. Plasmid HDelta Topo2 when expressed will represent approximately a 2.2-kb Topo II reporter mRNA containing Topo II 3'-UTR at its 3'-end. For the Hbeta galSV40 plasmid, the TA-cloning vector containing the 650-nt Topo II promoter, first exon, intron, and the second exon was digested with SpeI and XhoI restriction enzymes and directionally cloned into a SmaI- and XhoI-digested pNASSbeta reporter vector (CLONTECH). The plasmid DNA pNASSbeta lacks eukaryotic promoter and enhancer sequences and contains E. coli beta -galactosidase as the reporter. The resulting reporter construct when expressed will transcribe approximately a 3-kb beta -galactosidase reporter mRNA with the SV40 3'-UTR at its 3'-end. In the third reporter construct Hbeta galTopo, the SV40 3'-UTR in Hbeta galSV40 plasmid DNA was removed by SalI and BamHI restriction enzyme digestion and replaced with a XhoI- and BamHI-digested Topo II 3'-UTR from the HDelta Topo2 plasmid. The resulting reporter construct when expressed will represent approximately a 4-kb beta -galactosidase reporter mRNA with Topo II 3'-UTR at its 3'-end. Mouse NIH 3T3 fibroblast cells were stably transfected with plasmid DNAs pSVneo (CLONTECH) and HDelta Topo2, Hbeta galTopo, or Hbeta galSV40 using LipofectAMINE (Life Technologies, Inc.) following a manufacturer-supplied protocol. Geneticin-resistant colonies were pooled and cultured in G418-containing medium.

Construction of Riboprobe Templates and in Vitro Transcription-- cDNA sequences representing various regions of Topo II 3'-UTR were amplified by standard polymerase chain reaction techniques from a plasmid containing the entire Topo II 3'-UTR (pTopUTR). Polymerase chain reaction products representing the proximal (nt 4495-4948), middle (nt 4772-5298), distal (nt 5093-5595), and overlapping (nt 4772-4948) regions of Topo II 3'-UTR (Fig. 2) were purified by agarose gel electrophoresis and subcloned into pGEM-T plasmid DNA (Promega). The fos-ARE plasmid (pfosARE) containing both AU-rich domains I and II was constructed by subcloning the fos 3'-UTR from the pBBB plasmid (20) into pBS II SK(+). The plasmid containing the nonspecific beta -galactosidase competitor was constructed by subcloning the coding sequence within the HpaI and ClaI restriction sites in pCMV plasmid (CLONTECH) into pBS II SK(+). Orientation and sequence of inserts were verified by dideoxy sequencing of both strands of DNA in each plasmid construct.

Riboprobes representing the sense strand of RNA from each plasmid were transcribed in vitro following the protocol from Promega. Labeled riboprobes were transcribed by inclusion of [alpha -32P]-UTP (800 Ci/mmol; PerkinElmer Life Sciences) in the transcription reaction.

RNA-Protein Binding and Gel Mobility Shift Assay-- RNA-protein gel mobility shift assay was performed following previously published methods (36). Briefly, protein extracts (15 µg) were incubated with radiolabeled riboprobes (1 × 105 cpm; approximately 1 ng of RNA) in 12 mM Hepes, pH 7.9, 15 mM KCl, 5 mM MgCl2, 2 mM DTT (unless specified otherwise), 1 µg/µl tRNA, 1 µg/µl heparin, 1 unit/µl RNasin, and 10% glycerol in a total volume of 20 µl for 20 min at 25 °C. For competition experiments, the protein extract was first incubated for 10 min at 25 °C with unlabeled competitor RNA (specific or nonspecific) or RNA homopolymers (poly(A), poly(C), poly(G), and poly(U)) prior to the addition of the radiolabeled transcript. Control reactions without competitors were sham-treated under identical conditions. For immunodepletion of AUF1, protein extracts were incubated for 1 h at 4 °C with or without polyclonal antibody to AUF1 (23), and immune complexes were separated by protein A-Sepharose. An immunoblotting of the supernatants showed that, while AUF1 is present in the supernatant from the control reaction, it was absent in the immunodepleted supernatant (data not shown). Supernatants from control and immunodepleted extracts were used for RNA-protein gel mobility shift assay. RNA-protein binding reactions were treated with RNase T1 (5 units/reaction) and separated by electrophoresis on 4.5% native polyacrylamide gel in 45 mM Tris, 45 mM boric acid, and 1.2 mM EDTA buffer, pH 7.4. The RNA-protein complexes were analyzed by a PhosphorImager (STORM 840, Molecular Dynamics).

UV RNA-Protein Cross-linking-- RNA-protein binding reactions as described above were UV-irradiated (2500 µJ for 3 min) and incubated with RNase A (0.2 µg/µl) and RNase T1 (10 units) at 37 °C for 20 min. Protein samples were analyzed by electrophoresis on 10% SDS-polyacrylamide gel along with prestained protein molecular size markers (Life Technologies) and visualized by exposing the dried gel to a PhosphorImager screen.

Northern Blot Analysis-- Northern blot analysis was performed according to a previously published protocol (6). Radiolabeled probes, prepared by random priming, were the human Topo II cDNA (35), beta -galactosidase (CLONTECH), human p21 (37), human geminin (38), or glyceraldehyde 3-phosphate dehydrogenase (CLONTECH).

Measurement of Glutathione and N-Acetyl-L-cysteine Levels-- Intracellular reduced and oxidized glutathione as well as N-acetyl-L-cysteine (NAC) levels were assayed following previously published protocols (39, 40). Cell pellets were homogenized in 50 mM potassium phosphate buffer (pH 7.8) containing 1.34 mM diethylenetriaminepentaacetic acid. Total glutathione content was determined by the method of Anderson (41). Reduced (GSH) and oxidized (GSSG) glutathione were distinguished by the addition of 2 µl of a 1:1 mixture of 2-vinylpyridine and ethanol per 30 µl of sample. NAC levels in cells were measured following derivatization with N-(1-pyrenyl)maleimide using a 15-cm C18 Reliasil column (Column Engineering, Ontario, CA) coupled with high performance liquid chromatography with fluorescent detection (40). All biochemical determinations were normalized to the protein content of whole cell homogenates using the method of Lowry et al. (42).

Measurement of Intracellular Prooxidant Production during the Cell Cycle-- HeLa cells synchronized by mitotic shake-off were replated and harvested at representative times for measurement of prooxidant production (39). Cells were spun down, and the pellets were resuspended in 1 ml of phosphate-buffered saline supplemented with 5.5 mM glucose at 37 °C. Samples were labeled with 10 µl of 1 mg/ml C-400, an oxidation-sensitive fluorescent probe (Molecular Probes, Inc., Eugene, OR) and incubated for 15 min at 37 °C and then placed on ice immediately. Labeled samples were analyzed by flow cytometry (excitation at 488 nm, emission at 535 ± 10 nm); 20,000 cells from each sample were analyzed to obtain mean fluorescence intensity and corrected for autofluorescence obtained from samples of unlabeled cells. The variations in mean fluorescence intensity during the cell cycle were calculated relative to early G1 cells (2 h after mitotic shake-off).


    RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

A Regulatory Role for 3'-UTR in the Cell Cycle-coupled Accumulation of Topo II mRNA Levels-- To determine if the 3'-UTR of Topo II mRNA has a role in cell cycle-specific increase in Topo II mRNA levels, reporter assays in stably transfected 3T3 cells were performed. Stably transfected cells containing HDelta Topo2, Hbeta galTopo, or Hbeta galSV40 reporter constructs were synchronized by serum starvation and serum stimulation to reenter the cell cycle. Cells were harvested at various times for analysis of cell cycle position and reporter mRNA levels. Representative univariant flow cytometric analysis of cell cycle positions in HDelta Topo2 transfected cells are presented in Table I. Results presented in Table I indicate that the majority of the cells were in G1 (80%) at the time of serum stimulation (0 h), and 58% of cells were in S phase at 16 h after serum stimulation. The fraction of cells in S phase increased to 76% by 20 h, and approximately 20-30% of the cells entered G2/M at 24 h after serum stimulation. Similar results were obtained for Hbeta galTopo- or Hbeta galSV40-transfected cells and were comparable with untransfected control cells (data not shown), demonstrating that expression of the reporter constructs did not affect cell cycle transit. When the total cellular RNA from the HDelta Topo2-transfected cell populations was analyzed by Northern blotting, an mRNA band of approximately 2.2 kb, representing the HDelta Topo2 reporter construct, was detected with a radiolabeled probe specific for the human Topo II cDNA (Fig. 1A). HDelta Topo2 reporter mRNA levels were low in G1 (0-12 h poststimulation) and increased 12-16-fold at mid-S to G2 phases (16-24 h poststimulation). These results were comparable with our previously published results obtained with mitotically selected HeLa cells (6) and indicated that the truncated Topo II cDNA reporter construct contains sequence element(s) regulating Topo II mRNA levels. Since the Hbeta galTopo reporter mRNA levels (Fig. 1C) also showed similar cell cycle-coupled variations (as compared with HDelta Topo2), we concluded that sequences within the open reading frame of Topo II are not involved in the regulation of mRNA levels. Therefore, the increase in HDelta Topo2 and Hbeta galTopo reporter mRNA levels might be regulated either by changes in the Topo II promoter activity or by a combination of promoter activity and posttranscriptional regulation governed by the Topo II 3'-UTR. Results from the Hbeta galSV40 reporter construct (Fig. 1C), which contains the Topo II promoter but not the 3'-UTR, showed a 6-8-fold decrease in Hbeta galSV40 mRNA levels compared with Hbeta galTopo mRNA levels during 20-24 h poststimulation. The low level of Hbeta galSV40 mRNA during 20-24 h poststimulation can be attributed to the 2-fold increase in Topo II transcription that has been reported previously to occur during late S phase by us (6) and other investigators (34, 43). Results from a representative Northern blot measuring the variations in endogenous Topo II mRNA levels are shown in Fig. 1B. The kinetics of endogenous Topo II mRNA accumulation was comparable to reporter mRNA levels during the cell cycle. Overall, these results demonstrate that Topo II 3'-UTR has a regulatory role in accumulation of Topo II mRNA levels during the mammalian cell cycle.


                              
View this table:
[in this window]
[in a new window]
 
Table I
Cell cycle phase distribution in HDelta Topo2-transfected NIH 3T3 cells synchronized by serum starvation and serum-stimulated to reenter the cell cycle



View larger version (42K):
[in this window]
[in a new window]
  		Fig. 1.   Topo II 3'-UTR has a regulatory role in mRNA accumulation during the cell cycle. Northern blot analysis of reporter mRNA levels in stably transfected NIH 3T3 cells. Schematic diagrams of reporter constructs are shown at the top of each panel. hTop promoter consists of the 650-nt human Topo II promoter (thick line), exon 1, intron, and exon 2 (34). Delta -Topo cDNA represents a truncated form of human Topo II cDNA (base pairs 1-3013 deleted). hTop and SV40 3'-UTR represent 3'-untranslated regions of human Topo II and SV40 DNAs. Stably transfected 3T3 cells containing HDelta Topo2 (A), Hbeta galTopo (C), or Hbeta galSV40 reporter constructs were synchronized by serum starvation and serum-stimulated to reenter the cell cycle. Cells were harvested at the indicated times for RNA isolation and analyzed by Northern blotting. RNAs from Hbeta galTopo- or Hbeta galSV40-transfected cells were analyzed under identical conditions for comparison. B, Northern blot analysis of endogenous Topo II mRNA levels in Hbeta galTopo transfected 3T3 cells during the cell cycle. Ethidium bromide-stained 18 S ribosomal band and A260 measurements were used for loading control.

A complete sequence analysis of the Topo II 3'-UTR was performed to determine if sequences known to regulate mRNA levels are present in the 3'-UTR. The hTopo2 plasmid (35) was digested with NdeI and XhoI restriction enzymes and cloned into pBS II SK(+), and both strands were sequenced. Sequence analysis showed that the Topo II mRNA has a long (~1.1-kb) 3'-UTR with several ARE motifs (four AUUUA, one AUUUUA, and one AUUUUUA; Fig. 2) present throughout the 3'-UTR. These results suggest that AREs in Topo II 3'-UTR could participate in the regulation of Topo II mRNA levels during the cell cycle.



View larger version (77K):
[in this window]
[in a new window]
  		Fig. 2.   Several AU-rich elements are present in Topo II 3'-UTR. Sequence analysis of Topo II 3'-UTR cDNA. Boldface letters represent AU-rich elements. Translation termination and polyadenylation signals are in boldface type and underlined. Uppercase letters represent coding sequence, and lowercase letters represent 3'-untranslated region. The putative protein-binding region is double underlined.

Specific Sequences in Topo II 3'-UTR mRNA Bind to Proteins in Cellular Extracts-- Because protein binding to 3'-UTR has been shown to regulate mRNA levels (23, 27-29), an in vitro RNA-protein binding assay was performed to determine if cellular proteins bind to the Topo II 3'-UTR. A series of overlapping [32P]UTP-labeled riboprobes representing the proximal, middle, and distal regions of Topo II 3'-UTR mRNA were transcribed in vitro and incubated with cellular protein extracts prepared from asynchronously growing HeLa cells. RNA-protein complex formation was analyzed by gel mobility shift assay. Results presented in Fig. 3 show that the mobility of all three transcripts was retarded in their migration when compared with the control reaction that did not contain the protein extract (compare lane 1 with lane 2, lane 6 with lane 7, and lane 12 with lane 13). The retardation in mobility was due to an RNA-protein interaction because proteinase K treatment of cellular extracts prior to the binding assay abolished the retardation (lane 11). To analyze the specificity of the RNA-protein complex, competition experiments were performed. The RNA-protein binding assay was carried out in the presence of an unlabeled specific competitor or a nonspecific competitor RNA (beta -galactosidase). The addition of a 1-fold excess of specific unlabeled competitor RNA had a minimal effect on RNA-protein complex formation (lanes 3, 8, and 14). However, a 10-fold excess of specific unlabeled proximal and middle transcripts decreased the RNA-protein complex formation by more than 90% (lanes 4 and 9). In contrast, a similar 10-fold excess of the unlabeled distal transcript did not compete with the labeled distal transcript for complex formation. A 10-fold excess of the nonspecific competitor RNA (beta -galactosidase) caused no change in complex formation (lanes 5, 10, and 16). These results demonstrate that protein binding to both the proximal and middle portions of the Topo II 3'-UTR is specific in contrast to nonspecific binding to the distal region. Alternatively, the protein(s) bound to the distal region could be highly abundant and therefore might not be competed away under these conditions.



View larger version (17K):
[in this window]
[in a new window]
  		Fig. 3.   Cellular proteins bind to the Topo II 3'-UTR mRNA. RNA-protein gel shift assay of [32P]UTP riboprobes representing the proximal (lanes 1-5), middle (lanes 6-11), or distal (lanes 12-16) region of Topo II 3'-UTR mRNA. Radiolabeled riboprobes (1 × 105 cpm; approximately 1 ng of RNA) were incubated with 15 µg of protein extract prepared from asynchronously growing HeLa cells. Binding reactions were performed in a total volume of 20 µl and incubated for 20 min at 25 °C. For competition experiments, the protein extract was first incubated for 10 min at 25 °C with unlabeled competitor RNA (specific or nonspecific) prior to the addition of the radiolabeled transcript. Control reactions without competitors were sham treated under identical conditions. Binding mixtures were treated with RNase T1 prior to electrophoresis. C, RNA-protein complex; F, free probe; Comp., specific competitor RNA; NS, nonspecific beta -galactosidase competitor; Prot.K, proteinase K; 1×, 1 ng of RNA.

To further localize the sequence region involved in Topo II 3'-UTR RNA-protein complex formation, cross-competition assays were performed in the presence of unlabeled transcripts from the proximal or the middle region. Cellular proteins bound to labeled proximal transcript could be competed more than 90% with a 10-fold excess of unlabeled proximal competitor RNA (compare lanes 2 and 3, Fig. 4A). Interestingly, a 10-fold excess of unlabeled competitor RNA representing the middle region of Topo II 3'-UTR mRNA also competed (lane 4), while a nonspecific competitor RNA (beta -galactosidase, lane 5) did not. Alternatively, the RNA-protein complex formed from the middle region of Topo II 3'-UTR mRNA (Fig. 4B, lane 7) could be competed away with 10-fold excess of unlabeled middle competitor RNA (lane 8) or unlabeled RNA from the proximal region of Topo II 3'-UTR (lane 9). These results indicate that the overlapping sequence spanning the proximal and middle regions of Topo II 3'-UTR may contain the motifs necessary for specific RNA-protein complex formation.



View larger version (28K):
[in this window]
[in a new window]
  		Fig. 4.   Cross-competition between proximal and middle Topo II 3'-UTR riboprobes for protein binding. RNA-protein gel shift assay performed with proximal (A), middle (B), or the 177-nt riboprobe representing the overlapping region of the proximal and middle region (C) of Topo II 3'-UTR. Lanes 1, 6, and 11, binding reactions without the protein extract; lanes 2, 7, and 12, binding reactions with the protein extract prepared from asynchronously growing HeLa cells. Competition assays with a 10-fold (10 ng) excess of the specific unlabeled competitor (lanes 3 and 8), middle (lane 4) and proximal (lane 9) cross-competitor, and the nonspecific competitor beta -galactosidase (lanes 5 and 10) were performed following methods described in Fig. 3. Lanes 13-24 represent competition assays with increasing concentrations of poly(U) (lanes 13-15), poly(C) (lanes 16-18), poly(A) (lanes 19-21), or poly(G) (lanes 22-24) RNA homoploymers. Protein extracts were incubated with RNA homopolymers for 10 min at 25 °C prior to the addition of the radiolabeled transcript. M, middle; P, proximal Topo II 3'UTR RNA; NS, nonspecific competitor.

To more precisely define the binding site, a riboprobe representing the 177-nt (base pairs 4772-4948; Fig. 2) sequence overlapping the proximal and middle region of Topo II 3'-UTR was used in the RNA-protein binding assay. The 177-nt transcript, when incubated with cellular protein extract, formed an RNA-protein complex (Fig. 4C, compare lane 11 with lane 12). RNA-protein complex formation could be competed with unlabeled proximal and middle transcripts, indicating that this region of Topo II 3'-UTR mRNA is sufficient for RNA-protein complex formation (data not shown). To further examine RNA binding specificity, RNA homopolymers were tested for the ability to compete for binding to the 32P-labeled 177-nt Topo II 3'-UTR RNA substrate. Protein extract was incubated for 10 min at 25 °C with 1, 10, and 100 ng of poly(U) (lanes 13-15), poly(C) (lanes 16-18), poly(A) (lanes 19-21), or poly(G) (lanes 22-24) prior to the addition of the 32P-labeled 177-nt transcript. While poly(C) and poly(G) RNA homopolymers had no effect on Topo II 3'-UTR RNA-protein binding (lanes 16-18 and 22-24), both 10 and 100 ng of poly(U) inhibited more than 90% of the RNA-protein complex formation (lanes 14 and 15, Fig. 4C). Although competition assay with 1 and 10 ng poly(A) did not inhibit protein binding (lanes 19 and 20), 100 ng of poly(A) showed approximately 40% inhibition in complex formation (lane 21, Fig. 4C). The competition with poly(A) at higher concentration could be due to the formation of a double-stranded region with uridylate residues present within the 177-nt sequence. Furthermore, unlabeled c-fos ARE transcript containing the AUUUUUA motif also competed with 177-nt Topo II 3'-UTR for protein binding (data not shown). These results indicate that at least some of the proteins bound to the 177-nt overlapping transcript have poly(U) binding activity, suggesting a possible role for the AUUUUUA motif in complex formation.

Characterization of the Topo II 3'-UTR RNA-Protein Complex Formation-- If protein binding to the Topo II 3'-UTR influences Topo II mRNA levels, then it is reasonable to postulate that variations in Topo II mRNA levels during the cell cycle may be associated with changes in proteins binding to the UTR. Specific protein binding to the 177-nt Topo II 3'-UTR RNA was analyzed by a UV cross-linking assay. Protein extracts prepared from G1 (2 and 4 h after mitotic shake-off) and S (16 h after mitotic shake-off) phase cells were incubated with the 177-nt riboprobe and UV-irradiated, and unbound RNA was digested with RNases A and T1. Proteins were separated by SDS-gel electrophoresis and visualized by autoradiography. In the absence of UV irradiation, no cross-linking of labeled probe to protein was observed (Fig. 5, lane 1). In contrast, several polypeptide bands of apparent molecular masses of 84, 70, 44, and 37 kDa (Fig. 5, lanes 2-4) were detected in UV-irradiated reactions. Protein binding was specific and could be competed with 10 ng of poly(U) (lane 5). Furthermore, while the binding of the 70- and 44-kDa polypeptides was detected in extracts from both G1 and S phase cells, binding of the 84- and 37-kDa polypeptides was specific to the G1 phase. These results support the idea that differential binding of proteins to the Topo II 3'-UTR might regulate Topo II mRNA accumulation during the cell cycle.



View larger version (27K):
[in this window]
[in a new window]
  		Fig. 5.   Multiple proteins including AUF1 are present in Topo II 3'-UTR RNA-protein complex. A, autoradiograph of 177-nt Topo II 3'-UTR riboprobe cross-linked to cellular proteins. Radiolabeled transcript was incubated with HeLa cellular extracts prepared from G1 (2 and 4 h after mitotic shake-off, lanes 2 and 3) and late S (16 h after mitotic shake-off, lane 4) cells followed by UV cross-linking. Unbound RNAs were digested with RNases T1 and A, and the proteins were separated by SDS-gel electrophoresis. Duplicate reactions were carried out in the presence of 10 ng of poly(U) (lane 5) and extract from G1 cells (2 h after mitotic shake-off). A binding reaction without UV cross-linking is shown in lane 1. B, RNA-protein gel mobility shift assay using control (lane 1) or AUF1-immunodepleted (lane 2) protein extract and the 177-nt riboprobe. Protein extract prepared from asynchronously growing HeLa cells was incubated with or without the AUF1 polyclonal antibody for 1 h at 4 °C. Immune complexes were separated by protein A-Sepharose, and the supernatants were used in the RNA-protein binding assay. Lane 3 represents a negative control for the assay that was performed with 15 µg of bovine serum albumin. C, immunoblot analysis of AUF1 protein in RNA-protein complexes from the 177-nt Topo II 3'-UTR (lane 2) and c-fos ARE (lane 3) riboprobes. Lane 1 represents a control binding reaction that was carried out without the radiolabeled transcript under identical conditions. RNA-protein binding reactions were carried out with protein extract isolated from asynchronously growing HeLa cells and resolved by RNA-protein gel shift assay; excised and bound proteins were separated by SDS-gel electrophoresis. Proteins were transferred to Immobilon-P membrane and immunoblotted with a polyclonal antibody to AUF1. Immunoreactive bands were visualized by the chemiluminescence method following the supplier's protocol (Amersham Pharmacia Biotech).

Since the molecular mass of the 37-kDa polypeptide (Fig. 5A) is similar to that of the ARE-binding protein AUF1 (23), and the 177 nt of Topo II 3'-UTR contains an AUUUUUA motif, we determined whether AUF1 is present in the RNA-protein complex. Protein extract prepared from asynchronously growing HeLa cells was incubated with or without a polyclonal antibody to AUF1, and the immune complex was separated using protein A-Sepharose. Immunoblotting of the supernatants showed that, while AUF1 is present in the supernatant from the control reaction, it was not detected in the supernatant from the immunoprecipitation reaction performed with the AUF1 polyclonal antibody (data not shown). RNA-protein binding assays were then performed using the control or AUF1-immunodepleted supernatant. While the supernatant from the control reaction showed no change in complex formation, depletion of AUF1 from the protein extract inhibited complex formation by more than 90% (compare lanes 1 and 2, Fig. 5B). Binding reactions performed with bovine serum albumin alone (lane 3) showed no retardation in mobility of the transcript and served as a negative control for the assay. The presence of AUF1 in the Topo II 3'-UTR RNA-protein complex was further verified by comparing binding reactions with c-fos 3'-UTR transcript as a positive control. RNA-protein binding reactions with the 177-nt Topo II 3'-UTR transcript, c-fos 3'-UTR transcript, or a control reaction without any transcript were first resolved by RNA-protein gel shift assay and excised under autoradiographic guidance. In the control lane, an identical region of the gel compared with the radioactive band was also excised. Bound proteins in the excised bands were separated by SDS-gel electrophoresis, transferred to Immobilon-P membrane, and immunoblotted with a polyclonal antibody to AUF1. The control reaction without the transcript did not show any AUF1 immunoreactive polypeptide band (Fig. 5C, lane 1). In contrast, AUF1 was detected in both the 177-nt Topo II and c-fos 3'-UTR RNA-protein complexes (lanes 2 and 3). These results identify AUF1 as one of the proteins present in the Topo II 3'-UTR RNA-protein complex and suggest that the interaction of AUF1 with the AUUUUUA motif in Topo II 3'-UTR may have a regulatory role in determining Topo II mRNA levels during the cell cycle.

Oxidation/reduction Sensitivity of Protein Binding to the Topo II 3'-UTR-- Since proteins that bind AREs have been shown previously to demonstrate alterations in binding based on the oxidation/reduction (redox) state of the protein complexes (31, 32), redox sensitivity of protein binding to the 177-nt Topo II 3'-UTR was investigated (Fig. 6). Protein extract was prepared from asynchronously growing HeLa cells using extraction buffer that lacks a reducing agent. Binding reactions were then performed with increasing concentrations of the thiol-reducing agent DTT, or 2-ME, prior to the addition of the 177-nt riboprobe and analyzed by RNA gel shift assay (Fig. 6A, lanes 2-5). Binding of cellular proteins to the Topo II 3'-UTR increased 5-6-fold in protein extracts pretreated with the reducing agents DTT (lanes 3 and 4) or 2-ME (lane 5). The assay was then repeated in extracts supplemented with 2 mM DTT and increasing concentrations of a thiol-oxidizing agent (diamide) or a thiol-alkylating agent, NEM (Fig. 6B). A dose-dependent inhibition in protein binding was observed in extracts that were pretreated with the sulfhydryl-oxidizing agent, diamide (1, 5, 10, and 20 mM; lanes 6-9). While 1 and 5 mM of diamide caused 40 and 90% decreases in protein binding (lanes 6 and 7), both 10 and 20 mM of diamide completely abolished the complex formation (lanes 8 and 9). The inhibition in protein binding in 5 mM diamide-treated extract could be reversed by treatment with the thiol-reducing agent, 2-ME (compare lanes 7 and 10). Treatment with NEM also showed a dose-dependent inhibition in protein binding to Topo II 3'-UTR (1 and 10 mM, lanes 11 and 12). Because thiol alkylation is an irreversible reaction, inhibition in RNA-protein binding by NEM could not be reversed by the addition of DTT or 2-ME to the reaction mixture (data not shown). Taken together, these results indicate that reduced thiol residues in Topo II 3'-UTR binding proteins participate in the RNA-protein complex formation and that oxidation of these thiol residues to the disulfide form abolishes binding.



View larger version (18K):
[in this window]
[in a new window]
  		Fig. 6.   Protein binding to the 177-nt riboprobe is sensitive to oxidation and reduction reactions in vitro. RNA-protein gel shift assay is shown of the 177-nt Topo II 3'-UTR riboprobe and HeLa cellular protein extracts pretreated with thiol-reducing or -oxidizing agents. A, protein extracts from asynchronously growing HeLa cells were prepared using extraction buffer without any DTT. RNA-protein binding reactions were carried out with extracts that were pretreated with varying concentrations of DTT (0, 2, and 10 mM; lanes 2-4) or 2-ME (1%, lane 5). B, protein extracts from asynchronously growing HeLa cells were prepared with regular extraction buffer containing 2 mM DTT. RNA-protein binding reactions were carried out in the presence of increasing concentrations of diamide (1, 5, 10, and 20 mM; lanes 6-9) or NEM (1 and 10 mM; lanes 11 and 12). Lane 1 represents a probe without any extract, and lane 10 represents 2-ME treatment of a 5 mM diamide-treated extract.

If the above in vitro results are relevant to in vivo regulation, then it is reasonable to postulate that manipulations of intracellular redox status would influence Topo II 3'-UTR RNA-protein binding and mRNA levels. To address this question, asynchronously growing HeLa cells were treated with 20 mM NAC and assayed for NAC uptake, reduced and oxidized glutathione content, RNA-protein binding, and Topo II mRNA levels. By 2 h, intracellular NAC uptake was approximately 4 nmol/mg protein and increased to almost 6 nmol/mg protein by 6 h of treatment (Fig. 7A). Consistent with these results, the ratio of reduced to oxidized glutathione increased approximately 1.5- to 2.0-fold during this time frame, demonstrating that NAC treatment altered the intracellular redox state in favor of a more reducing environment. Topo II 3'-UTR mRNA-protein gel mobility shift assays performed with protein extracts from duplicate samples showed that protein binding increased 2-3-fold in NAC-treated cells compared with untreated controls (compare lanes 2-4, Fig. 7B). Results from Fig. 7B (inset) showed that the increase in protein binding was not due to changes in AUF1 protein levels following NAC treatment. Interestingly, Topo II mRNA levels under these conditions decreased dramatically to 10% of control at 2-6 h after NAC treatment (Fig. 7, C and D). These results provide in vivo evidence that a shift to a more reducing environment enhances protein binding to the 177-nt Topo II 3'-UTR, which correlates with a decrease in mRNA levels.



View larger version (32K):
[in this window]
[in a new window]
  		Fig. 7.   Manipulations of intracellular redox state affect RNA-protein binding and Topo II mRNA levels. Asynchronously growing HeLa cells were treated with 20 mM NAC (pH 7.0) and assayed for NAC uptake and reduced and oxidized glutathione content (A). Open circles and solid squares represent NAC uptake and the ratio of reduced to oxidized glutathione levels, respectively. Dashed and dotted lines represent control and NAC-treated cells, respectively. B, RNA-protein gel mobility shift assay with the 177-nt Topo II 3'-UTR transcript and protein extracts prepared from cells in duplicate dishes. Proteins were extracted with extraction buffer without DTT. Inset represents immunoblotting of AUF1 in protein extracts isolated from control and 6-h NAC-treated cells. C, Topo II mRNA levels in replicate dishes were analyzed by Northern blot analysis. The blot was rehybridized with a radiolabeled glyceraldehyde-3-phosphate dehydrogenase (GAPD) cDNA probe for quantitation. D, quantitation of mRNA levels was performed using the PhosphorImager and plotted as a function of time of treatment with NAC.

If these apparent redox-sensitive alterations in Topo II 3'-UTR mRNA-protein complex formation are a reflection of events occurring during the cell cycle, then a lower oxidation potential in G1 (relative to S, G2, and M) would favor Topo II 3'-UTR mRNA-protein binding, resulting in decreased mRNA levels. In contrast, a relatively more oxidizing environment in late S, G2, and M would inhibit complex formation, resulting in increased mRNA levels. To determine if variations in redox potential occur during the cell cycle, synchronized HeLa cells collected by mitotic shake-off were replated and harvested at representative times for analysis of prooxidant production. Cells were stained with an oxidation-sensitive fluorescent probe (C-400) and analyzed by flow cytometry. Oxidation of the probe 1) was greatest in cells immediately following mitotic shake-off (0 h postmitotic shake-off); 2) was minimal in G1 cells (2-7 h); and 3) increased 3-5-fold in late S/G2 cells (14-20 h) relative to G1 (Fig. 8A). An analysis of Topo II mRNA levels at representative time points during the cell cycle showed that the lower oxidation potential during the G1 phase (Fig. 8A) correlated with a decrease in Topo II mRNA levels (Fig. 8B). Similarly, an increase in oxidation potential during S/G2 phase correlated with an increase in Topo II mRNA levels. These observations are consistent with the results from Figs. 6 and 7, suggesting that a relatively reducing environment during G1 favors protein binding to the Topo II 3'-UTR and correlates with a decrease in Topo II mRNA levels. In contrast, a relatively greater oxidation potential during S/G2 phase would be expected to inhibit protein binding to Topo II 3'-UTR, resulting in increased Topo II mRNA levels.



View larger version (19K):
[in this window]
[in a new window]
  		Fig. 8.   A higher intracellular prooxidant production during S and G2 correlates with increased Topo II mRNA levels. Cells synchronized by mitotic shake-off were replated and harvested at various times for measurement of prooxidant production, cell cycle position, and mRNA levels. A, cells were stained with the C-400 fluorescent probe and analyzed by flow cytometry. Cells from replicate dishes were analyzed for cell cycle position by flow cytometric assay of DNA content in propidium iodide-stained cells. The left y axis represents the fraction of cells at various hours after mitotic shake-off, and the mean fluorescence intensity (MFI) of the C-400 probe after normalization to autofluorescence and relative to early G1 is plotted on the right y axis. B, Northern blot analysis of Topo II and glyceraldehyde-3-phosphate dehydrogenase (GAPD) mRNA levels harvested from replicate dishes under similar experimental conditions.

The idea that the 3'-UTR containing the ARE motifs participates in the regulation of mRNA levels during the cell cycle was further investigated by measuring mRNA levels of two other ARE-containing cell cycle genes, p21 (37) and geminin (38). Both mRNAs contain AREs including the AUUUUUA motif in their 3'-UTRs. HeLa cells synchronized by mitotic shake-off were replated, and total cellular RNA isolated at 4, 12, 18, and 24 h after plating. Cells from duplicate dishes were assayed for cell cycle position by flow cytometric determination of DNA content. Approximately 85% of the cells were in G1 at 4 h after plating, and by 12 h 76% of the cells were in S phase (Fig. 9A). At 18 h after plating, 42% of the cells entered G2, and by 24 h approximately 65% of the cells entered G1 of the next generation. Consistent with previous reports, Northern blot analysis showed that Topo II mRNA levels were low in G1 (lane 1) and increased 15-fold during late S and G2 (lanes 2 and 3, Fig. 9B). Following cell division, Topo II mRNA levels decreased to basal levels (lane 4) in G1 of the next generation. Interestingly, both geminin and p21 mRNA levels were low in G1 (lane 1) and increased approximately 2- (geminin) and 5-fold (p21) during late S and G2 (lanes 2 and 3). The mRNA levels of both geminin and p21 decreased during G1 of the subsequent generation (lane 4). These results support the idea that AREs including the AUUUUUA motif present in the 3'-UTRs of Topo II, geminin, and p21 could possibly contribute to the regulation of mRNA accumulation during the cell cycle.



View larger version (28K):
[in this window]
[in a new window]
  		Fig. 9.   Messenger RNA levels of ARE-containing cell cycle genes varied during the cell cycle. HeLa cells synchronized by mitotic shake-off were harvested at the indicated times for flow cytometric determination of DNA content (A) and Northern blot analysis (B). Cells were stained with propidium iodide and analyzed for DNA content following a previously published procedure (6). DNA contents of G1 and G2 are marked with arrows. For Northern blot analysis, blots were hybridized with random-labeled cDNA probes for human Topo II, geminin, and p21. Ethidium bromide staining of 28 S ribosomal RNA was used for loading control.



    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

We have shown previously that Topo II mRNA levels increase 15-16-fold during late S and G2 compared with the G1 phase of the HeLa cell cycle and that variations in Topo II mRNA levels are associated with significant changes in mRNA stability (6). The present study investigates whether Topo II 3'-UTR has a regulatory role in cell cycle-coupled accumulation of mRNA levels. Using a reporter assay in stably transfected 3T3 cells, we have shown that the Topo II 3'-UTR can confer cell cycle regulation in reporter mRNA levels. A sequence analysis showed that Topo II mRNA contains a 1.1-kb 3'-UTR with several known mRNA instability elements (AREs) present throughout the entire UTR. Furthermore, results from in vitro RNA-protein binding assays demonstrate that cellular proteins bind to specific sequences within the Topo II 3'-UTR, and protein binding to a 177-nt Topo II 3'-UTR transcript containing a AUUUUUA motif varies during the cell cycle. These results indicate that the AUUUUUA motif within the 177-nt Topo II 3'-UTR transcript may have a regulatory role in cell cycle control of Topo II mRNA accumulation. This idea is further supported by results from Fig. 9, demonstrating that mRNA accumulation of two other AUUUUUA-containing cell cycle genes (geminin and p21) also varied during the cell cycle, and similar to Topo II their mRNA levels were low in G1. This is intriguing because, in general, the pentameric AUUUA motif(s) have been shown to regulate mRNA levels (18, 27, 29, 30). Although the role of heptamer ARE motifs in the regulation of mRNA levels has not been reported previously, it is well known that the nonamer ARE motif (UUAUUUAUU) can act as a potent mRNA destabilizer (21). Our results suggest that the potential influence of ARE-mediated mRNA instability may extend beyond the control of cytokine and proto-oncogene gene expression and include other growth-regulatory genes. Future studies will determine if the AUUUUUA motif by itself or in combination with other AREs or non-AREs confers cell cycle regulation of Topo II, geminin, and p21 gene expression.

Cytokine and proto-oncogene mRNA decay are thought to involve an AU-rich binding protein AUF1, which complexes with heat shock proteins hsc70-hsp70, translation initiation factor eIF4G, and poly(A)-binding protein (44). Multiple proteins with apparent molecular masses of 84, 70, 44, and 37 kDa bind to Topo II 3'-UTR and identified AUF1 as one of the proteins present in the RNA-protein complex. Since the 37-kDa protein has a molecular mass similar to AUF1 and its binding was enhanced in G1 (Fig. 5A), the possibility that enhanced binding could be related to changes in absolute quantities of AUF1 during the cell cycle was investigated. An immunoblot analysis of AUF1 in whole HeLa cell extracts prepared from cells in G1 and S showed that the absolute quantities of immunoreactive AUF1 protein did not vary during the cell cycle (data not shown). Thus, the absolute amount of AUF1 protein does not appear to influence Topo II mRNA levels, but posttranslational modifications (e.g. phosphorylation and/or oxidation/reduction) might regulate AUF1 activity during the cell cycle. Since AUF1 consists of four protein isomers, our results do not eliminate the possibility that other isomers of AUF1 may be involved in the cell cycle regulation of Topo II mRNA levels. Nonetheless, these results indicate the potential role of AUF1 in ARE-mediated regulation of cell cycle gene expression.

Our results further indicated that the protein binding to Topo II 3'-UTR is sensitive to redox reactions both in vitro and in vivo. In vitro protein binding to the 177-nt Topo II 3'-UTR was found to be reversibly enhanced by thiol-reducing agents and inhibited by thiol-oxidizing agents. These results support earlier in vitro reports demonstrating redox sensitivity of protein binding to ARE-containing cytokine and lymphokine mRNAs (27). In vivo experiments in which cells were treated with a thiol-reducing agent showed that a shift to a more reducing intracellular environment resulted in increased RNA-protein binding as well as more than 90% reduction in Topo II mRNA levels (Fig. 7). Taken together, these results indicate that thiol residues (presumably cysteine residues) in ARE-binding proteins (e.g. AUF1) participate in the binding to the Topo II 3'-UTR mRNA and that reduction of these thiol residues is required for binding. Since AUF1 has three cysteine residues in its two RNA binding domains (23), it is possible that one or more of these cysteine residues are involved in redox sensitivity of RNA-protein binding during the cell cycle. Thus, subtle changes in redox states during cell growth or in response to environmental stimuli may influence Topo II 3'-UTR mRNA-protein interactions, thereby affecting mRNA levels. Consistent with this assumption, a lower oxidation potential during G1 in synchronized cells was associated with more protein binding to Topo II 3'-UTR, correlating with decreased mRNA levels. Likewise, a relatively more oxidizing environment during S and G2 was associated with less protein binding, correlating with increased Topo II mRNA levels. The variations in intracellular redox states (Fig. 8) are consistent with previous findings (45), suggesting that a relatively high intracellular oxidation potential is associated with progression toward mitosis. Furthermore, our results also support the idea that proteins regulating cell cycle progression are sensitive to the redox potential of the microenvironment (46, 47).

In summary, results from this study support the hypothesis that a posttranscriptional mechanism regulated by the interaction of 3'-UTR mRNA with redox-sensitive protein complexes containing AUF1 may regulate Topo II mRNA accumulation during the cell cycle.


    ACKNOWLEDGEMENTS

We thank Drs. J. C. Wang (Harvard University) for the human topoisomerase IIalpha cDNA, A. B. Shyu (University of Texas) for the c-fos 3'-UTR plasmid, and G. Brewer (UMDNJ-Robert Wood Johnson Medical School) for the antibody to the AUF1 protein.


    FOOTNOTES

* This work was supported by National Institutes of Health Grants R29CA69593 (to P. C. G.), RO1HL51469 (to D. R. S.), CA50950 (to C. R. H.), and K08CA72602 (to D. G.).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

To whom correspondence should be addressed: Free Radical & Radiation Biology Program, Dept. of Radiology, University of Iowa, B180 Medical Laboratories, Iowa City, Iowa 52242. Tel.: 319-335-8019; Fax: 319-335-8039; E-mail: goswamip@mail.medicine.uiowa.edu.

Published, JBC Papers in Press, September 13, 2000, DOI 10.1074/jbc.M005298200


    ABBREVIATIONS

The abbreviations used are: Topo II, topoisomerase IIalpha ; UTR, untranslated region; ARE, adenosine- or uridine-rich element; NEM, N-ethylmaleimide; 2-ME, 2-mercaptoethanol; DTT, dithiothreitol; nt, nucleotide; kb, kilobase pair(s).


    REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES


1. Wang, J. C. (1985) Annu. Rev. Biochem. 54, 665-697
2. Wang, J. C. (1996) Annu. Rev. Biochem. 65, 635-692
3. Earnshaw, W. C., and Heck, M. M. S. (1985) J. Cell Biol. 100, 1716-1715
4. Earnshaw, W. C., and Heck, M. M. S. (1988) in Cell Cycle Control in Eukaryotes (Beach, D. , Basilico, C. , and Newport, J., eds) , pp. 176-183, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
5. Downes, C. S., Clarke, D. J., Mullinger, A. M., Gimenez-Abian, J. F., Creighton, A. M., and Johnson, R. T. (1994) Nature 372, 467-470
6. Goswami, P. C., Roti Roti, J. L., and Hunt, C. R. (1996) Mol. Cell. Biol. 16, 1500-1508
7. Goswami, P. C., Hill, M., Higashikubo, R., Wright, W. D., and Roti Roti, J. L. (1992) Radiat. Res. 132, 162-167
8. Heck, M. M. S., Hittelman, W. N., and Earnshaw, W. C. (1988) Proc. Natl. Acad. Sci. U. S. A. 85, 1086-1090
9. DeToledo, S. M., Azzam, E. I., Gasmann, M. K., and Mitchel, R. E. J. (1995) Int. J. Radiat. Biol. 67, 135-143
10. Giaccone, G., Gazdar, A. F., Beck, H., Zunino, F., and Capranico, G. (1992) Cancer Res. 52, 1666-1674
11. Jarvinen, T. A., Kononen, J., Pelto-Huikko, M., and Isola, J. (1996) Am. J. Pathol. 148, 2073-2082
12. Kalwinsky, D. K., Look, A. T., Ducore, J., and Fridland, A. (1983) Cancer Res. 43, 1592-1597
13. McPherson, J. P., and Goldenberg, G. J. (1998) Cancer Res. 58, 4519-4524
14. Beelman, C. A., and Parker, R. (1995) Cell 81, 179-183
15. Duret, L., and Bucher, P. (1997) Curr. Opin. Struct. Biol. 7, 399-406
16. Ross, J. (1995) Microbiol. Rev. 59, 423-450
17. Sachs, A. B. (1993) Cell 74, 413-421
18. Chen, A. C. Y., and Shyu, A. B. (1995) Trends Biochem. Sci. 20, 465-470
19. Shaw, G., and Kamen, R. (1988) Cell 46, 659-667
20. Chen, C. Y. A., and Shyu, A. B. (1994) Mol. Cell. Biol. 14, 8471-8482
21. Lagnado, C. A., Brown, C. Y., and Goodall, G. J. (1994) Mol. Cell. Biol. 14, 7984-7995
22. Schuler, G. D., and Cole, M. D. (1988) Cell 55, 1115-1122
23. Zhang, W., Wagner, B. J., Ehrenman, K. A., Schaefer, W., DeMaria, C. T., Crater, D., DeHaven, K., Long, L., and Brewer, G. (1993) Mol. Cell. Biol. 13, 7652-7665
24. Levine, T. D., Gao, F., King, P. H., Andrews, L. G., and Keene, J. D. (1993) Mol. Cell. Biol. 13, 3494-3504
25. Nakagawa, J., Waldner, H., Meyer-Monard, S., Hofsteenge, J., Jeno, P., and Moroni, C. (1995) Proc. Natl. Acad. Sci. U. S. A. 92, 2051-2055
26. Ma, W. J., Cheng, S., Campbell, C., Wright, A., and Furmeaux, H. (1996) J. Biol. Chem. 271, 8144-8151
27. Gillis, P., and Malter, J. S. (1991) J. Biol. Chem. 266, 3172-3177
28. Rajagopalan, L. E., and Malter, J. S. (1994) J. Biol. Chem. 269, 23882-23888
29. Brewer, G. (1991) Mol. Cell. Biol. 11, 2460-2466
30. DeMaria, C. T., and Brewer, G. (1996) J. Biol. Chem. 271, 12179-12184
31. Malter, J. S., and Hong, Y. (1991) J. Biol. Chem. 266, 3167-3171
32. Hentz, M. W., Rouault, T. A., Hartford, J. B., and Klausner, R. D. (1989) Science 244, 357-359
33. Konarska, M. M., and Sharp, P. A. (1986) Cell 46, 845-855
34. Hochhauser, D., Stanway, C. A., Harris, A. L., and Hickson, I. D. (1992) J. Biol. Chem. 267, 18961-18965
35. Tsai-Pflugfelder, M., Liu, L. F., Liu, A. A., Tewey, K. M., Whang-Peng, J., Knutsen, T., Huebner, K., Croce, C. M., and Wang, J. C. (1988) Proc. Natl. Acad. Sci. U. S. A. 85, 7177-7181
36. Ross, J. (1994) in RNA-processing: A Practical Approach (Hames, B. D. , and Higgins, S. J., eds), Vol. 11 , pp. 107-133, IRL Press, London
37. El-Diery, W. S., Tokino, T., Velculesco, V. E., Levy, D. B., and Parsons, R. (1993) Cell 75, 817-825
38. McGary, T. J., and Kirschner, M. W. (1998) Cell 93, 1043-1053
39. Blackburn, R. V., Spitz, D. R., Liu, X., Galoforo, S. S., Sim, J. E., Ridnour, L. A., Chen, J. C., Davis, B. H., Corry, P. M., and Lee, Y. J. (1999) Free Radical Biol. Med. 26, 419-430
40. Ridnour, L. A., Winters, R. A., Ercal, N., and Spitz, D. R. (1999) Methods Enzymol. 299, 258-267
41. Anderson, M. E. (1985) in Handbook of Methods for Oxygen Radical Research (Greenwald, R. A., ed) , pp. 317-323, CRC Press, Boca Raton, FL
42. Lowry, O. H., Rosebrough, N. J., Farr, A. L., and Randall, R. J. (1951) J. Biol. Chem. 193, 265-275
43. Falck, J., Dagger, P., Jensen, B., and Sehested, M. (1999) J. Biol. Chem. 274, 18753-18758
44. Laroia, G., Cuesta, R., Brewer, G., and Schneider, R. J. (1999) Science 284, 499-502
45. Li, N., and Oberley, T. D. (1998) J. Cell. Physiol. 177, 148-160
46. Dunphy, W. G., and Kumagai, A. (1991) Cell 67, 189-196
47. Hoffmann, I., Draetta, G., and Karsenti, E. (1994) EMBO J. 13, 4302-4310

Copyright © 2000 by The American Society for Biochemistry and Molecular Biology, Inc.
Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page