JBC Ideal method for primary cell transfection

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M005159200 on September 11, 2000

J. Biol. Chem., Vol. 275, Issue 50, 39039-39047, December 15, 2000
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
275/50/39039    most recent
M005159200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Du, B.
Right arrow Articles by McCaffrey, T. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Du, B.
Right arrow Articles by McCaffrey, T. A.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Elevated Egr-1 in Human Atherosclerotic Cells Transcriptionally Represses the Transforming Growth Factor-beta Type II Receptor*

Baoheng DuDagger §, Chenzhong FuDagger §, K. Craig Kent, Harry Bush Jr., Andrew H. Schulick, Karl Kreiger||, Tucker Collins**, and Timothy A. McCaffreyDagger DaggerDagger

From the Dagger  Department of Medicine, Division of Hematology/Oncology,  Department of Surgery, and Division of Vascular Surgery, and || Department of Cardiothoracic Surgery, Weill Medical College of Cornell University New York, New York 10021 and ** Harvard Medical School, Department of Pathology, Brigham and Women's Hospital, Boston, Massachusetts 02115

Received for publication, June 14, 2000, and in revised form, September 5, 2000



    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Atherosclerotic lesions may progress due to a "failure to die" by vascular repair cells. Egr-1, a zinc finger transcription factor, is elevated more than 5-fold in human carotid lesions relative to the adjacent tunica media. Lesion cells in vitro also express 2-3-fold higher Egr-1 mRNA and protein levels but express much lower levels of the transforming growth factor-beta (TGF-beta ) Type II receptor (Tbeta R-2) and are functionally resistant to the antiproliferative effects of TGF-beta . Lesion cells fail to express a Tbeta R-2 promoter/chloramphenicol acetyltransferase (CAT) construct but overexpress an Egr-1-inducible platelet-derived growth factor-A promoter/CAT construct. Transfection of Egr-1 cDNA represses Tbeta R-2/CAT constructs but induces PDGF-A/CAT. Egr-1 transfection reduces the levels of Tbeta R-2 and confers resistance to the antiproliferative effect of TGF-beta 1. Egr-1 can interact directly with both the -143 Sp1 site and the positive regulatory element 2 (PRE2) (ERT/ets) region of the Tbeta R-2 promoter. Thus, although activating a family of stress-responsive genes, Egr-1 also transcriptionally represses one of the major inhibitory pathways that restrains vascular repair.



    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

It is thought that atherosclerotic changes in the vessel wall are initially due to injury from shear stress, hypertension, hypercholesterolemia, homocysteinemia, smoking, or viral/bacterial pathogens (1). However, it is evident that the major arteries tolerate these injuries for decades, successfully repairing the injury to maintain both vascular integrity and patency. After chronic injury, vascular repair cells, phenotypically similar to both smooth muscle cells and myofibroblasts (2), eventually accumulate in the vessel wall and occlude the vessel by progressive fibroproliferative remodeling. Atherosclerotic lesions commonly show a strong hyperplastic reaction to angioplasty or surgical endarterectomy, suggesting that their response to defined injuries is exaggerated. Vascular repair cells in the late lesion may suffer from a failure to die phenotype that allows the cell to respond to injury but disables its ability to undergo apoptosis as a natural part of wound regression (3). Cells cultured from human atherosclerotic lesions initially show a high rate of apoptosis as they encounter in vitro conditions (4), but then a substantial subset of cells emerge that are resistant to apoptosis induced by factors such as TGF-beta 1 (5) and glucocorticoids (6).

The resistance to the antiproliferative and apoptotic effects of TGF-beta is principally due to a selective age-related loss of the Type II receptor for TGF-beta (Tbeta R-2) (5, 7, 8). Tbeta R-2 is required for conveying the TGF-beta signal (9) to the SMAD family of transcription factors (10), thus leading to fibrotic, antiproliferative, and apoptotic responses in human lesion cells (11). Transfection of cDNA for Tbeta R-2 partially restores the antiproliferative response to TGF-beta in lesion cells (5, 7). Tbeta R-2 is expressed in early atherosclerotic lesions but is essentially undetectable in late lesions, except in discrete foci adjoining inflammatory regions (7, 12). A small subset of patients can be defined in which acquired mutations in the Tbeta R-2 contribute to the receptor loss, although the majority of cases cannot be explained by mutations in the receptor (13).

Using cDNA arrays to profile the mRNA transcripts of carotid artery lesions relative to the adjacent media, it was observed that the transcription factor Egr-1 was 5-fold higher in the human atherosclerotic lesion than in the adjacent media (14). Semi-quantitative reverse transcription-polymerase chain reaction confirmed that Egr-1 levels were 4-8-fold higher in individual lesions relative to the adjacent media. Control studies rejected the possibility that the differences in Egr-1 were induced ex vivo because 1) this should induce Egr-1 in both media and lesion equally, and 2) Egr-1 mRNA levels in lesion and media were stable ex vivo for an hour after surgery. The Egr-1 appeared to be transcriptionally active in the human lesion, because a high percentage of Egr-1-inducible genes were also elevated in the lesions relative to the adjacent media. Furthermore, in hypercholesterolemic mice, Egr-1 levels were found to parallel the development of the atherosclerotic lesion (14).

Egr-1 was identified by a number of different groups in widely divergent areas ranging from PDGF-induced mitogenesis to NGF-induced differentiation of neuronal cells. Egr-1 is potentially activated by a variety of cellular stressors: growth factors (15), oxidized lipoproteins (16), shear stress (17), sphingosine 1-phosphate (18), angiotensin II (19), endothelin, and hypoxia (20). In the vascular setting, both proliferation and migration after in vitro injury is Egr-1-dependent and blocked by antisense oligonucleotides (21). Egr-1 is rapidly induced upon injury to the rat carotid (22) or after partial stenosis of the rat carotid (17). Elevated Egr-1 in the latter model was associated with elevated tissue factor levels in the artery, suggesting that the Egr-1 had transcriptional effects. Inhibition of Egr-1 via DNA enzymes that degrade the mRNA blocks intimal hyperplasia in injured rat arteries (23).

Elevated Egr-1 activates the transcription of several important gene families that would influence vascular repair and cell survival. Egr-1 is a major activator of PDGF-A chain synthesis (24) and is directly involved in angiotensin II-dependent activation of PDGF and TGF-beta expression (19, 25). Egr-1 is considered a major transcription factor for other key repair systems: angiogenic factors, such as vascular endothelial growth factor; procoagulants, such as tissue factor (17); cytokines (interleukin-2 (26) and TNF-alpha (27)); receptors (Flt-1(28)), apoptotic factors (Fas (29), Fas ligand (30)); cell cycle factors (cyclin D1 (31), p15, p21, p53); metabolic factors (5-lipoxygenase (32), multidrug resistance factor 1 (33), thymidine kinase (34), superoxide dismutase (35), adhesion factors (intercellular adhesion molecule 1 (ICAM-1) (36), fibronectin (37)), and proteases (urokinase-type plasminogen activator, matrix metalloproteinase type 1).

The present studies examined whether the highly elevated Egr-1 observed in human lesions was retained by the cells that proliferated in vitro and whether Egr-1 contributed to their known resistance to TGF-beta . The results indicate that Egr-1 is a transcriptional repressor of Tbeta R-2, presumably by interacting directly with both an Sp1 site and an ets-like ERT site in the proximal promoter of the Tbeta R-2 gene. Thus, although activating a family of stress-responsive genes, Egr-1 also suppresses one of the major inhibitory pathways that restrains vascular repair.


    EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Tissue Specimens-- Vascular specimens were obtained during surgical revascularization procedures at The New York Presbyterian/Cornell Medical Center as waste surgical specimens under institutional review board-approved protocols. Surgical endarterectomy of carotid artery disease produces full diameter lesions of 2-5 cm in length that commonly contain lesion and tunica media without adventitia. The medial tissue can be cleanly dissected from the overlying lesion for cell culture or RNA purification. Internal mammary arteries and radial arteries were obtained as excess waste from coronary artery bypass (CABG) operations.

Cell Culture-- Human vascular specimens were typically received and processed within 30 min of surgical excision. Carotid lesions, mammary arteries, and radial arteries were opened longitudinally and gently scraped free of endothelium. Carotid lesions were dissected into the most lumenal regions of the fibrous cap and the striated tunica media, then cultured separately by explanting onto serum-coated flasks in M199 with 20% FBS and antibiotics (penicillin/streptomycin). Mammary and radial arteries were scraped extensively on the adventitial side to remove extravascular tissue and then cultured by explant as above. The phenotype and growth properties of these cells have been previously described (5, 7). Approximately 30% of patients produce cultures that can be sustained for 5-10 passages, with an approximate doubling time of 4 days. CCL-64 cells (Mv 1 Lu, NBL-7), a mink lung epithelial cell line (ATCC), was cultured in M199 with 10% FBS and antibiotics.

RNA Purification-- Total RNA was purified from lesion-derived or medial cells using RNAzol B with minor modifications of the manufacturer's method. RNA quantity and quality was assessed by both optical density and agarose gel electrophoresis and further quantitated with the RiboGreen RNA fluorescent stain (Molecular Probes).

Genomic Expression Arrays-- For genomic analysis, RNA was further purified by retention on glass fiber columns (HighPure, Roche Molecular Biochemicals), DNase digestion, ethanol precipitation, and a final gel filtration on a desalting column (Chroma-spin 200) to remove small oligonucleotides or contaminants. The paired RNAs (medial cells versus lesion cells) were reversed-transcribed with Superscript (Life Technologies, Inc.), an RNase H(-) Moloney murine leukemia virus mutant, [32P]dATP, and a mixture of 588 sequence-specific primers, as described by the manufacturer (CLONTECH). The labeled cDNAs were desalted to remove free isotope and then hybridized overnight to identical cDNA arrays under stringent conditions (68 °C). The array membranes were washed with 2× SSC (1× SSC = 0.15 M NaCl and 0.015 M sodium citrate) with 1% SDS for 30 min 4 times and 0.1× SSC with 0.5% SDS for 30 min 3 times, all at 68 °C. The paired membranes were exposed to storage phosphor plates (Eastman Kodak Co) for 1 to 5 days and quantified on a PhosphorImager (Storm, Molecular Dynamics).

Western Blot Analysis-- For comparison of Egr-1 protein levels in medial versus lesion cells, cells were plated in 35-mm wells (6 well) at 1 × 105 cells/well in M199 with antibiotics 24 h before use. For analysis of growth factor effects on Egr-1 protein levels, cells were plated in 6-well plates at 2 × 105 cells/well in M199 with 5% FBS and antibiotics. After an overnight plating period, the cells were washed with serum-free media and changed to serum-free M199 with antibiotics for 24 h before treatment with growth factors. FGF-2 (R&D Systems, human, 10 ng/ml) or NGF (Harlan Bioproducts, murine salivary gland, 100 ng/ml) were then added in fresh serum-free media for the specified times before harvest of all the wells as follows.

Cellular lysates were prepared by washing the cell monolayer twice with phosphate-buffered saline and then scraping the cells into ice-cold lysis buffer (40 mM Tris-HCl, 1% Triton X-100, 2 mM MgCl2, 200 µM phenylmethylsulfonyl fluoride, 1 µM leupeptin, 0.5 mM benzamidine, and 1 µM pepstatin) on ice and then centrifuging at 15,000 × g for 10 min to remove particulate. Protein content was determined by the BCA method (Pierce), and 20-30 µgs of protein was separated on a 10% polyacrylamide gel under reducing conditions. After electrophoretic transfer of the proteins to a nitrocellulose membrane, the blot was probed with specific antibodies that were detected by peroxidase-labeled second antibodies and chemiluminescent reporters (ECL or ECL+, Amersham Pharmacia Biotech). Antibody titers ranged from 1:100 for Egr-1 (Santa Cruz Biotechnology, sc-110), 1:200 for antibody to Tbeta R-2 (Santa Cruz, L21), to 1:2000 for beta -actin (Sigma, clone AC-15). Molecular weights were determined from pre-stained standards (Bio-Rad).

Nuclear Protein Preparation-- Nuclear proteins were prepared from lesion or medial cells by minor modifications of standard methods. Cells (1 × 106/75 cm2) were scraped into 4 ml of cold phosphate-buffered saline, pelleted at 450 × g, resuspended in 3 volumes of buffer A (10 mM HEPES, pH 7.9, 1.5 mM MgCl2, 10 mM KCl, 0.1 mM dithiothreitol, 0.5 mM phenylmethylsulfonyl fluoride, 1 µg/ml leupeptin, 1 µg/ml aprotinin, 1.5 µg/ml pepstatin A, 0.2 mM levamisole, 10 mM beta -glycerophosphate, 0.5 mM benzamidine, 0.5% Nonidet P-40), and chilled on ice for 10 min. The sample was centrifuged at 10,000 × g, and the supernatant, containing cytosolic proteins, was frozen at -70 °C for later analysis. The pellet was resuspended in 2 volumes of buffer A and 2 volumes of buffer B (1.5 mM MgCl2, 20 mM HEPES, 420 mM NaCl, 0.2 mM EDTA, and DTT, PMSF, leupeptin, aprotinin, pepstatin, levamisole, beta -glycero phosphate, and benzamidine as in buffer A). The pellet was vortexed and titrated 10 times through a sterile 25-gauge needle. The suspension was pelleted at 10,000 × g, and the supernatant, containing soluble nuclear protein, was mixed with an equal volume of buffer C (buffer A except: 100 mM KCl, no Nonidet P-40, 0.2 mM EDTA, and 20% glycerol). Aliquots were snap-frozen in an ethanol/dry ice slurry and stored at -70 °C.

Electrophoretic Mobility Shift Assays-- Probes for electrophoretic mobility shift assays were synthesized by commercial sources as complementary, single-stranded DNAs and then mixed in equimolar ratios, heated to 75 °C for 2 min, and then chilled on ice. Sp1 and Egr-1 consensus probes were purchased from Santa Cruz. DNA sequences used were (5' to 3'; +strand): PDGF, GGGGGGGGCGGGGGCGGGGGCGGGGGAGGG; Tbeta R-2-25, gAgAaggCTCTCgggCggAgAgAggTCCTg; Tbeta R-2-143, AgTggTgTgggAgggCggTgAggggCAgCT; PRE2, gCgAggAgTTTCCTgTTTCCCCCgCagCgCTgAgTTgAAg; Sp1 consensus, ATTCGATCGGGGCGGGGCGAGC; Egr-1 consensus, GGATCCAGCGGGGGCGAGCGGGGGCGA. The double-stranded probes were labeled with [32P]ATP via T4 polynucleotide kinase (Promega) and then purified on a G-25 spin column. Probe (100,000 cpm) and nuclear protein (6-8 µg/2 µl) were incubated in binding buffer (1 mM dithiothreitol, 12% glycerol, 1 mM EDTA, 5 mM MgCl2, 10 mM Tris-HCl, pH 7.5, 30 mM KCl, 333 µM ZnSO4, 50 µg/ml dI-dC). For antibody blockade or supershift, 1 µl of antibody (2 µg/µl, Santa Cruz) was added to binding buffer containing nuclear protein 10 min before the probe. The reaction was incubated 20 min at room temperature and then separated on a 4% acrylamide, 0.25× Tris-buffered EDTA gel, pH 7.6, for 2 h at 150 V and then dried and exposed to film and/or PhosphorImager.

Cloning of Human Egr-1-- Human Egr-1 was cloned from human lesion-derived mRNA by reverse transcription-polymerase chain reaction using primers directed against nucleotides 131-149 and 2115-2131 of human Egr-1 (GenBankTM accession number M62829 (38)). The polymerase chain reaction product was cloned into pCR2.1 (Invitrogen), and the orientation was established by restriction analysis. The insert was subcloned into pcDNA3.1/zeo at the HindIII and XbaI sites. The identity of the clone was confirmed by sequencing approximately 700 base pairs from each end. Coupled in vitro transcription/translation (TnT, Promega) indicated that the cDNA produced an 82-kDa protein.

Transfection of Transcription Factors and Promoter/Reporter Constructs-- For expression of promoter/reporter constructs in lesion or medial cells, cells were plated at 1 × 105 cells/ well at least 24 h before a brief wash with M199 and transfection with 4 µl of LipofectAMINE (Life Technologies, Inc.) and 1 µg of DNA/well. The Tbeta R-2 promoter/chloramphenicol acetyl transferase (CAT) constructs were kindly provided by Dr. Seong-Jin Kim (NIH/NCI) (39). The transfection was incubated for 4 h in M199, and then the cells were changed to normal growth media for 48 h before harvest for determination of CAT or luciferase levels. In some studies, the cells were transfected first with Egr-1 (human or murine), Sp1 (murine vectors kindly provided by Dr. John Schuetz, St. Jude's Children's Research Center, Memphis, TN), or the pcDNA3 vector alone, and then 48 h later, they were retransfected with a promoter/CAT reporter or SV40 promoter-luciferase reporter as a control for transfection efficiency. 48 h later, cells were harvested for determining CAT antigen levels by enzyme-linked immunosorbent assay (Roche Molecular Biochemicals) or luciferase levels in a luminometer. CAT and luciferase levels were normalized to protein levels as determined by the BCA method (Pierce).

Transcription/Translation of Egr-1 and Sp1-- To examine the ability of recombinant protein to bind specific regions of the Tbeta R-2 promoter, the proteins were produced in vitro by coupled transcription/translation from the T7 promoter of the pcDNA3 plasmid. Plasmid was reacted with the rabbit reticulocyte lysate in the presence of T7 primer according to the manufacturer's method (TnT, Promega). Egr-1 protein was further purified by binding to and elution from an anti-Egr-1 affinity column.


    RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Expression of Egr-1 in cells derived from human atherosclerotic lesions. Prior studies from this laboratory demonstrate that cells cultured from lesions or the adjacent media exhibit differences in their functional response to growth factors such as TGF-beta 1 (5, 7) and glucocorticoids such as dexamethasone (6). The lesions, from which these cells derive, exhibit a 5-fold increase in Egr-1 levels compared with the adjacent media (14). To determine whether the elevated Egr-1 expression of lesion cells was retained by the cells migrating from the lesion and proliferating in tissue culture, two lesions (E196, E197) were identified that produced productive cell cultures from both the lesion and from the adjacent media. RNA was prepared from these cultures at identical, early subpassages (P2) and analyzed individually by cDNA arrays.

Overall, the transcript profiles between medial and lesion cells were quite similar (r = 0.90, p < 0.001), with a relatively small set of genes that differed. Table I contains genes that were increased or decreased in lesion cells and might be relevant to a resistant phenotype. Among these genes is Egr-1, which was 1.9 times higher in lesion cells (L) than in autologous medial cells (M) in culture. In contrast, Sp1 mRNA levels in lesion cells were decreased to one-half the level in medial cells, so that the Egr-1/Sp1 mRNA ratio was effectively 4 times higher in lesion compared with medial cells.


                              
View this table:
[in this window]
[in a new window]
 
Table I
Selected transcripts detected by cDNA arrays

Levels of Egr-1 Protein in Medial and Lesion Cells

Whether these elevated Egr-1 mRNA levels translated to increased Egr-1 protein levels was examined by Western blot on eight lesion/media cultures, two of which had been tested in the cDNA arrays. In all eight lesion/media-matched cultures (E196, E197, E221, E243, E246, E278, E281, E291), the lesion cells (L) expressed markedly higher Egr-1 protein antigen than did the cells derived from the adjacent media (M) (Fig. 1, four patients shown). The same blots were reprobed with an antibody to beta -actin, and equal levels were observed between samples (Fig. 1). Quantitation of the Egr-1 band intensities by densitometric scanning of film or by Storm chemiluminescence yielded similar results, both indicating that the level of Egr-1 antigen level was 2.6 times higher in lesion cells compared with medial cells (L/M ratio = 2.6, p < 0.0002). Thus, the elevated Egr-1 levels observed in the atherosclerotic lesion are retained by the lesion cells in culture and lead to elevated Egr-1 protein levels.



View larger version (63K):
[in this window]
[in a new window]
  		Fig. 1.   Egr-1 protein levels in cells from lesion versus adjacent media. Cells were cultured by explant from the fibrous cap of human atherosclerotic plaques (L, lesion) or the adjacent tunica media of the carotid artery (M, media). Four patients (E197, etc.) are shown, representing a total of eight patients. Cells were plated in low passage (P2-P4) in 1% FBS for 24 h before harvest and then examined by Western blot analysis for Egr-1 or beta -actin.

Levels of Tbeta R-2 Protein and Antiproliferative Response to TGF-beta 1 in Medial and Lesion Cells

Although the lesion cells demonstrated elevated Egr-1 levels, levels of the Tbeta R-2 protein were significantly lower in lesion cells than in medial cells (L/M ratio = 0.38, p < .01). This is consistent with prior data indicating both reduced 125I-TGF-beta cross-linking to the Tbeta R-2 and reduced Tbeta R-2 mRNA by reverse transcription-polymerase chain reaction in lesion cells (5). Thus, there was a consistent pattern of elevated Egr-1 and reduced Tbeta R-2 in lesion-derived cells relative to their medial counterparts (Fig. 2A). Furthermore, the reduced levels of the Tbeta R-2 were associated with functional resistance to the antiproliferative effect of TGF-beta 1 in the lesion cells. The ability of TGF-beta 1 to inhibit DNA synthesis in two of the matched lesion/medial cell lines is shown in Fig. 2B. Although cells from the media are inhibited 50-60% by 1 ng/ml TGF-beta 1 in 24 h, cells derived from the adjacent lesion are stimulated 50-60% under identical conditions. The ability of TGF-beta to stimulate DNA synthesis is probably due to the induction of soluble mitogens such as PDGF (40) and connective tissue growth factor (41) by a subset of cells possessing Tbeta R-2. The mitogens can then diffuse in the culture flask to stimulate cells regardless of their Tbeta R-2 status.



View larger version (21K):
[in this window]
[in a new window]
  		Fig. 2.   Expression of Tbeta R-2, Egr-1, and antiproliferative responses to TGF-beta in lesion (L) and medial (M) cells. A, protein was harvested as in Fig. 1. Western blots were probed for Egr-1 and Tbeta R-2 using specific antibodies and chemiluminescent detection. Band intensity was semi-quantified by densitometric scanning of the film or by Storm imaging of the chemiluminescence. Four patients, representative of eight patients examined, are shown. B, antiproliferative response to TGF-beta in two of the autologous pairs used in panel A. Cells were plated at 1 × 104 cells/well for 24 h before treatment with the specified doses of TGF-beta 1. The rate of DNA synthesis was determined 20 h later by a 4-h incorporation of [3H]thymidine into DNA. Data points are mean ± S.E., n = 3.

Modulation of Egr-1 Levels by FGF-2 and NGF

Egr-1 expression is rapidly stimulated by growth factors such as PDGF, FGF, and NGF. To determine whether Egr-1 levels could be induced by growth factor in medial cells, which have low Egr-1 levels, medial cells were subjected to serum withdrawal for 24 h and then stimulated with FGF-2 (10 ng/ml) or NGF (100 ng/ml) for specified periods of time up to 4 h.

Both FGF-2 and NGF led to a rapid increase (30 min) in Egr-1 protein (82-85 kDa) to a level twice the base-line level in medial cells (Fig. 3, A and B). The effect was partially reversed at 1-2 h after growth factor treatment, remaining 50% above the unstimulated level. Based on parallel wells in which the media was changed, but without growth factor (4 h), the increase was not due to nonspecific stimulation of the cells. Although NGF was able to stimulate Egr-1 levels in medial cells (E196M is shown in Fig. 3), NGF had no mitogenic effect on this cell line, as determined by [3H]thymidine incorporation 24 h after stimulation. Lesion-derived cells, which had very high basal levels of Egr-1 protein (E197L), did not show any further stimulation by NGF (Fig. 3A). In lesion cells with lower base-line levels (E196L), stimulation of Egr-1 levels by FGF-2 was detectable.



View larger version (26K):
[in this window]
[in a new window]
  		Fig. 3.   Induction of Egr-1 by FGF-2 and NGF. Cells derived from carotid media (Medial) or atherosclerotic lesion (Lesion) were cultured under low serum conditions for 48 h and then stimulated with FGF-2 (10 ng/ml) or NGF (100 ng/ml) for the specified times. To control for nonspecific effects of adding media, parallel wells were treated identically, but no growth factor was added (4 h, panel A, and NO FGF and NO NGF in panel B). Cells were harvested, lysed, and analyzed by Western blot as described, and band intensity of Egr-1 in medial cells was semi-quantitated densitometrically (panel B).

Tbeta R-2 Promoter Activity in Lesion and Medial Cells

In light of the association of high Egr-1 levels with low Tbeta R-2 levels and resistance to TGF-beta , the expression of Tbeta R-2 promoter/reporter constructs was examined in lesion versus medial cells. As shown in Fig. 4 the CAT reporter plasmid is essentially inactive in the absence of a promoter (CAT null). The introduction of the Tbeta R-2 promoter from -274/+50 or -47/+50 causes an increase to 8-10-fold above base-line reporter activity in medial cells but not in lesion cells (n = 3 matched cell lines, mean ± S.E.). Conversely, the PDGF-A chain promoter, a prototype of Egr-1-inducible promoters (15), is about 2-fold more active in lesion cells than in medial cells, whereas the SV40-luciferase construct is more variable but unchanged.



View larger version (23K):
[in this window]
[in a new window]
  		Fig. 4.   Expression of Tbeta R-2 promoter/reporter constructs by medial and lesion cells. Autologous media/lesion cultures from 3 patients (E278, E281, E291) were transfected with one of five promoter/reporter constructs: CAT null (no promoter), Tbeta R-2-274/CAT (-274/+50), Tbeta R-2-47/CAT (-47/+50), PDGF-A chain promoter/CAT, or SV40 promoter upstream of luciferase reporter. Transfection was achieved with LipofectAMINE for 4 h in serum-free media, followed by 48 h recovery in 10% FBS. Lysed cells were assayed for CAT antigen by enzyme-linked immunosorbent assay, or luciferase by luminometer. Values are mean ± S.E., n = 3. Units for luciferase are luminescent units/mg of protein. prom., promoter.

Egr-1 Suppresses Transcription of Tbeta R-2

Transient Transfection-- Prior studies indicated that the Type II promoter is partially controlled by 2 Sp1 sites at -143 and -25 relative to the transcriptional start site (Fig. 5). Two other PREs were identified by deletion analysis, either 5' to the Sp1 sites or 3' to the predicted transcriptional start site (PRE2) (42). Conventionally, Egr-1 is thought to activate transcription at overlapping Egr-1/Sp1 sites (24). However, Egr-1 can interfere with Sp1 to block the activation of some genes such as the rat plasma membrane-glycoprotein/multidrug resistance gene 1B (33), murine adenosine deaminase (43), and the macrophage colony-stimulating factor gene (44). To determine the effect of elevated Egr-1 on transcription of Tbeta R-2, expression vectors containing Egr-1 or Sp1 under the control of the cytomegalovirus promoter (pcDNA3) were transfected into several cell types, and then 48 h later, other plasmids containing regions of the Tbeta R-2 promoter (-274/+50 or -47/+50) driving the CAT reporter gene were retransfected into the same cultures. Control studies transfecting either empty vector, human Egr-1, or murine Egr-1 into E12 cells and then harvesting the cells at specific time points for Western blot indicated that both human and murine Egr-1 expression vectors increased Egr-1 antigen to levels 3-5 times the control levels by 48 h and that these levels were sustained at 96 h post-transfection.



View larger version (27K):
[in this window]
[in a new window]
  		Fig. 5.   Structure of the proximal region of the Tbeta R-2 promoter. Prior deletional analysis has identified a positive regulatory element (PRE1) that interacts with AP1 like factors, followed by two functional Sp1 sites at -143 and -25 relative to the predicted transcriptional start site. Current analysis of the -143 Sp1 site indicates that it shares homology to known Egr-1 binding sequences, as shown in the expanded sequence. Consensus Sp1 and Egr-1 sites are shown above the Tbeta R-2 sequence and the PDGF-A chain sequence for comparison. This -143 site is flanked 3' by a known negative regulatory element (NRE) with an unknown ligand. Oligo-capping of the mRNA suggests transcription may begin from a -36 GAA alternate start site. A second PRE (PRE2) was identified at +12, which was later shown to bind a novel member of the ets family, ERT, recognizing tandem GGAA sites on the negative strand. The downstream ERT site appears to overlap a potential Egr-1 binding site on the negative strand. The regions contained in the -274 and -47 CAT constructs used for promoter analysis are shown by the arrows.

Egr-1 expression via transient transfection strongly suppressed the transcription from the -274/+50 region of the Tbeta R-2 promoter in 3 different cell types: CCL64 (mink lung epithelial), E12 (lesion-derived), and HCT116 (human colon cancer, Tbeta R-2 receptor mutant) (E12 shown in Fig. 6A, 97% reduction). Transcription of the -47/+50 Tbeta R-2/CAT construct was also suppressed in CCL64 and E12 cells (75% reduction), but it was essentially unaffected by Egr-1 in the HCT116 cells. Conversely, Sp1 transfection slightly increased the transcription of the Tbeta R-2-CAT constructs (30%), consistent with both constructs having functional Sp1 sites (Fig. 6A).



View larger version (32K):
[in this window]
[in a new window]
  		Fig. 6.   Effect of Egr-1 or Sp1 on Tbeta R-2 promoter/reporter constructs. A, a lesion-derived line (E12) was transiently transfected with empty pcDNA vector (WT) or with pcDNA3 containing Egr-1 or Sp1 and then 48 h later re-transfected with 1 of 4 promoter/reporter constructs: null/CAT, Tbeta R-2-74/CAT, Tbeta R-2-47/CAT, or SV40-luciferase. Reporter activity was measured 48 h later. B, HCT116 cells, a human colon carcinoma line, were stably transfected with pcDNA3, Egr-1, or Sp1 and then re-transfected transiently with 1 of the 4 constructs in panel A or PDGF-A chain promoter/CAT. After a 48-h expression period, CAT antigen was assayed by enzyme-linked immunosorbent assay, luciferase was assayed by luminometer, and each was normalized to protein content.

Stable Transfection-- These studies have been confirmed using stable transfections of Egr-1 or Sp1 into the HCT116 cells. After selection for stable expression, the cells were re-transfected transiently with Tbeta R-2-CAT constructs, PDGF-A promoter-CAT, or SV40-luciferase. As shown in Fig. 6B, plasmid expression of Egr-1 markedly suppressed the -274 Tbeta R-2-CAT construct (96% reduction) but had only a small effect on Tbeta R-2-47/CAT (27% reduction). Sp1 increased transcription of the Tbeta R-2-47 construct (71% increase). As previously reported, the PDGF-A promoter was strongly induced by Egr-1 (277% increase) (24). Thus, Egr-1 suppresses the Tbeta R-2 promoter but activates the PDGF-A promoter in the context of a chromatin environment.

Egr-1 Reduces the Cellular Levels of the Tbeta R-2 and Confers Resistance to TGF-beta

The prior promoter data suggest that the endogenous Tbeta R-2 gene would be suppressed by overexpression of Egr-1. Among the cell lines in which transfection studies are feasible, Tbeta R-2 is not expressed by HCT116 cells due to homozygous mutation or in the E12 cells, and consequently, both cells are resistant to TGF-beta . CCL64 cells are mink lung epithelial cells that express naturally high levels of Tbeta R-2, consistent with their high sensitivity to TGF-beta . CCL64 cells were transiently transfected with empty vector, human Egr-1, or murine Egr-1 48 h before examining their levels of the Tbeta R-2 and their antiproliferative response to TGF-beta . Both human Egr-1 cDNA (huEgr-1) and mouse Egr-1 (moEgr-1) increased Egr-1 antigen levels to 4 to 7 times the level in vector transfectants. Concurrently, Tbeta R-2 levels were decreased to 18-37% that of control levels (Fig. 7, panel A). Parallel cultures were treated with TGF-beta in increasing doses, and 24 h later, DNA synthesis was measured by [3H]thymidine incorporation. Vector-transfected cells were inhibited by 60% at 0.1 ng/ml TGF-beta or higher. Transient transfection of murine Egr-1 into CCL64 cells, which reduced Tbeta R-2 levels to 37% that of control, caused complete resistance to low doses of TGF-beta while having little or no effect as the dose was increased 5-10-fold (Fig. 7B). Transfection of human Egr-1, which reduced the receptor to 18% of control, conferred resistance to all doses of TGF-beta , and at lower doses (0.1-0.5 ng/ml), DNA synthesis was stimulated up to 60% above base line, an effect almost identical to the response of lesion-derived cells (Fig. 2B).



View larger version (34K):
[in this window]
[in a new window]
  		Fig. 7.   Effect of Egr-1 and Sp1 on Tbeta R-2 protein expression. A, CCL64, a TGF-beta -sensitive epithelial cell line, was transiently transfected with pcDNA3 vector (vector), human Egr-1 (huEgr-1), or mouse Egr-1 (moEgr-1), and then 48 h later the cells were harvested. Egr-1 and Tbeta R-2 levels were analyzed in parallel lanes by Western blot. Mean densitometric values are shown below the duplicate lanes as a percent of the level in the vector-only group. Tbeta R-2 commonly migrates as two bands corresponding to the glycosylated and unglycosylated receptor. B, CCL64 cells were transfected as above and 48 h later were treated with increasing doses of TGF-beta 1 for 20 h before a 4-h treatment with [3H]thymidine to determine the rate of DNA synthesis (mean ± S.E., n = 3 wells/point).

Parallel studies in smooth muscle cells isolated from a grossly normal human radial artery (RA-1) further indicated that transfection of Egr-1 could almost completely suppress the antiproliferative response to TGF-beta 1. RA-1 cells transfected with the pcDNA3 expression vector were inhibited 70% by 1 ng/ml of TGF-beta , whereas Egr-1-transfected cells were essentially unaffected by TGF-beta treatment. Western blot analysis confirmed the concurrent decrease in Tbeta R-2 levels. Combined with the prior data, this strongly suggests that Egr-1 decreases the Tbeta R-2 and confers functional resistance to the antiproliferative effect of TGF-beta . However, it is possible that Egr-1 has additional effects upon mitogen production that might also influence TGF-beta responses.

Egr-1 Interacts with the-143 Sp1 Site

At least two models of Egr-1 suppressive action in lesion cells can be proposed from prior studies. 1) Egr-1 interacts directly with the Tbeta R-2 promoter or induces a factor, such as Sp3, that directly binds to and represses the Tbeta R-2 promoter, or 2) Egr-1 does not interact with the Tbeta R-2 promoter but instead interacts with Sp1 or ERT/ets factors to sequester or "squelch" the factor and block the transactivation of the promoter. These models can be distinguished easily because the former "repression" model predicts increased binding to Tbeta R-2 promoter sites in lesion cells, whereas the latter, "sequestration" model predicts decreased binding to the promoter. Using nuclear proteins extracted from stably transfected HCT116 cells (used in Fig. 6B), the binding to radiolabeled, double-stranded oligo (30 base pairs) matching the -143 Sp1 site was examined by gel shift assay (Fig. 8). A series of studies using specific antibodies to Egr-1, Egr-2, Egr-3, Sp1, and Sp3 could readily identify the protein-probe complexes. The complexes migrate in 2 sets that probably correspond to dimeric complexes that migrate as the protein (Egr-1 = 82 kDa; Sp1 = 90 kDa; Sp3 = 103 kDa) plus the labeled probe (18 kDa) and then as a higher molecular weight set of multimers. These multimers could be homodimeric, i.e. Egr-1/Egr-1, heteromeric, i.e. Egr-1/Sp1, or involve a co-factor such as cAMP-response element-binding protein (CREB)-binding protein (CBP). The smallest band in each set is eliminated by a blocking antibody to Egr-1 (C19, Santa Cruz). One band in each set is supershifted by an antibody to Sp3, a known inhibitor of Sp1 activity, and the other band is shifted by anti-Sp1. Antibodies to Egr-2 and Egr-3 had no effect. After transfection with Egr-1, the Egr-1-probe complex is strongly up-regulated and blocked by antibody to Egr-1 (Fig. 8). Sp1 and Sp3 were slightly increased in the transfected cells. Thus, Egr-1 can interact directly with the -143 site in the Tbeta R-2 promoter.



View larger version (87K):
[in this window]
[in a new window]
  		Fig. 8.   Interaction of Egr-1 with the Tbeta R-2-143 Sp1 binding site. Left panel, HCT116 cells were transfected with Egr-1 and then selected with G418. Nuclear proteins from untransfected (C) or Egr-1-transfected cells (Egr-1 Tfect) were incubated with 32P-oligo probe homologous to the -143 Sp1 site in the Tbeta R-2 promoter. Protein-oligo complexes were separated by polyacrylamide gel electrophoresis, and the identity of the complexes was determined by a blocking antibody to Egr-1, antibody to Sp1, or antibody to Sp3. Right panel, HCT116 cells were incubated with the radiolabeled Tbeta R-2-143 probe (C) and then blocked with unlabeled probe (cold probe, +), or recombinant Egr-1 protein was added (Egr-1 prot.) to the nuclear lysate with labeled probe, followed by analysis with polyacrylamide gel electrophoresis. The known positions of specific protein-probe complexes is shown to the left of the autoradiograms. Molecular mass was determined by prestained markers, shown on the right.

This was further examined by using recombinant Egr-1 protein produced by in vitro transcription/translation. To examine the potential competition with Sp1-like factors, HCT116 cells stably transfected with Sp1 were used for nuclear protein preparation. Under these conditions, each of the Sp1, Sp3, and Egr-1 bands are apparent. The addition of an excess of cold -143 probe markedly reduced binding to all 3 protein complexes. The addition of Egr-1 protein strongly increased both of the Egr-1 bands and reduced the upper Sp1 and Sp3 bands to undetectable levels, suggesting that elevated Egr-1 competitively displaces Sp1 and Sp3 from the -143 site (Fig. 8). Neither the in vitro transcription/translation reaction buffer nor Sp1 protein produced by the same method had the effect of Egr-1 in the gel shift assay.

Tbeta R-2 Promoter Binding Activity in Medial and Lesion Cells

To determine whether a direct interaction of Egr-1 with the Tbeta R-2 promoter was observable in lesion cells, a series of three autologous media/lesion cultures were examined. The binding of the nuclear proteins to double-stranded, radiolabeled oligomers identical to the Tbeta R-2-143 Sp1/Egr-1 site was examined by electrophoretic mobility shift assays. The results, shown in Fig. 9 indicate that binding of Egr-1 to the -143 site was consistently stronger in the lesion than in medial cells (Fig. 9A). The binding of the same nuclear proteins to the PDGF-A chain Sp1/Egr-1 site (Fig. 9B) was generally similar to the Tbeta R-2-143 site, although cells from patient E281 media (M) showed greater binding than lesion (L) cells. In contrast, binding of the same nuclear proteins to a consensus Sp1 probe indicated relatively stable levels of Sp1 binding, with some patients (E292) showing slightly lower Sp1 binding in lesion cells versus medial cells (Fig. 9D), consistent with the Sp1/Sp3 binding observed using the -143 Tbeta R-2 probe (Fig. 9A). Cytoplasmic proteins isolated at the same time as the nuclear protein were analyzed by Western blot (Fig. 9C), and levels of Egr-1 protein paralleled the Egr-1-like binding to the Tbeta R-2 promoter.



View larger version (89K):
[in this window]
[in a new window]
  		Fig. 9.   Comparison of Tbeta R-2-143 promoter binding in nuclear proteins from medial- and lesion-derived cells. Nuclear proteins were purified from cells cultured from the media (M) or lesion (L) of three human atherosclerotic lesions (E291, E292, E281). Nuclear proteins were incubated with one of three 32P-oligo probes: Tbeta R-2-143 (panel A), PDGF-A (panel B), or Sp1 (panel D). The position of the protein-probe complexes is shown beside each autoradiogram. Cytoplasmic proteins from the same cells were analyzed by Western blot for Egr-1 (panel C).

Despite the elevated levels of Egr-1 protein (Fig. 9C) and elevated Egr-1 binding to the -143 region (Fig. 9A), there is no apparent decrease in the level of Sp1 binding to the -143 region (Fig. 9A). Thus, it is possible that Egr-1 and Sp1 bind to adjacent but non-competitive sites in the -143 region. However, the specific binding conditions created by different nuclear protein preparations may alter the stoichiometry between probe, Egr-1, and Sp1 to create competitive or non-competitive binding conditions. Further studies using purified proteins, and DNase footprinting will address this question.

Interaction with PRE2 Site

The Egr-1 and Tbeta R-2 promoter co-transfection studies indicated that typically both the -274/+50 and -47/+50 constructs were suppressed by Egr-1. Both the promoter sequence and gel shift studies suggested that Egr-1 did not interact with the -25 Sp1 site. Thus, to determine how the -47/+50 construct was repressed by Egr-1, the PRE2 site at +13 to +24 was examined by electrophoretic mobility shift assays using a probe spanning +2/+44. As shown in Fig. 10, using 3 matched lesion/media cultures, binding to the PRE2 site is 3-4-fold higher in lesion than medial cells, based on quantification of radioactivity in the band by phosphorimaging. Prior incubation with a blocking antibody to Egr-1 reduced binding in this band by 90% in medial cells and by 75% in lesion cells, whereas an antibody to Sp1 did not have a consistent effect, increasing binding slightly in medial cells but reducing binding in lesion cells. Thus, it appears that Egr-1 can interact directly with the PRE2 site of the Tbeta R-2 and that this activity is 3-4-fold higher in lesion cells than medial cells. The addition of recombinant Egr-1, produced by in vitro transcription/translation, readily formed a complex with the PRE2 probe that was blocked by antibody to Egr-1 but not by antibodies to Sp1 or Sp3.



View larger version (67K):
[in this window]
[in a new window]
  		Fig. 10.   Comparison of PRE2 promoter binding in nuclear proteins from medial-and lesion-derived cells. Nuclear proteins were prepared and co-incubated with 32P-probe as in Fig. 9, except the PRE2 region of the Tbeta R-2 was used. Medial (M) and lesion (L) cells were additionally incubated with blocking antibody to Egr-1 or supershift antibody to Sp1, as indicated by (+) below the lanes.



    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

The present data indicate that the elevated levels of Egr-1 that are observed in human atherosclerotic lesions in vivo are retained by the lesion-derived cells in vitro. Egr-1 is rapidly induced by mitogens such as PDGF, FGF, and EGF as well as by modified lipoproteins, shear/mechanical stresses, and free radicals. Thus, it is reasonable that Egr-1 would be elevated in atherosclerotic lesions, particularly in inflammatory areas (14). However, when the cells are removed from the lesion and cultured in vitro under identical conditions, it was expected that the levels of Egr-1 would equalize between medial and lesion cells. Likewise, Egr-1 levels could be expected to increase in both cell types due to activation and increased proliferative rates in vitro. Surprisingly, however, the overall mRNA levels, by array analysis, decreased as the cells were cultured, but the relative difference between medial and lesion cells were largely retained. This suggests that the elevated Egr-1 levels are at least partially due to an intrinsic dysregulation of the Egr-1 gene or that the stimulus for Egr-1 production is intrinsic to the cell. In medial cells, Egr-1 protein is transiently elevated within 1 h after FGF or NGF stimulation. Normally, Egr-1 is thought to exhibit negative feedback to its own promoter, thus ensuring its transient expression after stimulation (45).

Presently, the stimulus for the elevated Egr-1 levels in lesion cells is not known, but possibilities include: (a) genetic or methylation defects in the Egr-1 promoter, (b) increases in cellular free radicals that might induce Egr-1, (c) constitutive activation of protein kinase Cs or mitogen-activated protein kinases, (d) alterations in cellular sphingolipid balance, or (e) failure in the negative feedback pathway for Egr-1 transcription. Transcript profiling suggests reduced levels of extracellular signal-regulated kinase 1 (ERK1), extracellular signal-regulated kinase kinase 1 (MKK4/SEK1), and c-Jun NH2-terminal kinase 2 (JNK2) in lesion cells, kinases that might be involved in Egr-1 activation in lesion cells (Table I). Although further studies will be required to evaluate the role of kinases, transcript profiling does not indicate an obvious activation of these pathways.

The present data further indicates that elevated Egr-1 can suppress transcription of the Tbeta R-2. Previously Egr-1 was principally observed to activate gene expression by displacing Sp1, which commonly serves as a weaker transcription factor. Prior publications have identified two general mechanisms by which Egr-1 could suppress transcription: direct repression of the promoter via DNA binding (46) or squelching of transcription via interactions with Sp1, independent of DNA binding (44). Using both cells transfected with Egr-1 and medial/lesion cultures, which express different Egr-1 levels, it appears likely that the reduction in Tbeta R-2 transcription is associated with an increase in protein binding to both the -143 Sp1 site and the PRE2 region. The interaction of Egr-1 with the -143 Sp1 is consistent with known Egr-1/Sp1 hybrid sites, although it is possible that Egr-1 and Sp1 bind in an adjacent, non-competitive manner to this region (Fig. 5). The binding of Egr-1 to the PRE2 sites may define a new type of negative regulatory function at some ets-like sites. The PRE2 region contains two negative strand, ets-like ERT sites (42). The predicted Egr-1 site, also negative strand, would likely mask at least one of the ERT sites. It is also possible that Egr-1 induces other factors such as Sp3, which then have a repressor activity on the Tbeta R-2 promoter. However, the main factor in lesion cells appears to be Egr-1, and in general, Sp3 mRNA levels tend to be markedly lower in lesion that medial cells (Table I).

The present studies indicate that the elevated levels of Egr-1 in lesion cells is a potential explanation for the resistance of these cells to inhibition by TGF-beta . Although the TGF-beta 1 gene is potently transactivated by Egr-1 (47), the present data indicates that, paradoxically, the Type II receptor for TGF-beta is probably suppressed by high, sustained levels of Egr-1. It is interesting to speculate that a component of sustained cellular activation may be suppression of inhibitory pathways such as the TGF-beta pathway. In cases where production of TGF-beta is elevated, as in chronic repair/inflammation, it might be necessary to protect the TGF-beta -producing cell from the autocrine inhibitory effects of TGF-beta .

The current results may have some relevance to the progression of tumors as well. Almost all tumor cell lines examined have acquired resistance to the antiproliferative and apoptotic effects of TGF-beta (48). Only in relatively rare cases such as the RER+ phenotype of familial colon carcinomas, are acquired mutations in Tbeta R-2 a sufficient explanation for the resistance (49). In most other cases, the resistance to TGF-beta is associated with reduced levels of Tbeta R-2 but is not due to detectable mutations or promoter hypermethylation (50), and thus, transcriptional repression of Tbeta R-2 may be a significant cause of resistance to the TGF-beta tumor suppressor pathway (51). Notably, some oncogenic rearrangements, such as the EWS/Fli1 rearrangement, create repressors for Tbeta R-2 transcription (52).

Accumulating evidence indicates that atherosclerosis is associated with both reduced levels of TGF-beta (53) and with acquired resistance to the apoptotic effects of TGF-beta in lesion cells (5, 7). Based on the current data, it is reasonable to speculate that chronic expression of Egr-1 is a major contributing factor to acquired resistance to TGF-beta . Acquired resistance to inhibitors might then be a major factor determining the failure to die phenotype that describes the advanced atherosclerotic lesion. In vitro and in vivo data both suggest that blocking Egr-1 expression via antisense or DNAzymes inhibits smooth muscle cells proliferation and migration and blocks injury-induced intimal hyperplasia (21, 23). Combined, the evidence indicates that chronically elevated Egr-1 in lesions cells is 1) a marker of a highly activated phenotype, which includes functional resistance to inhibitory agents, 2) a direct repressor of the TGF-beta pathway, and 3) a potential target for intervention in cases of excessive vascular repair.


    FOOTNOTES

* This work was supported by National Institutes of Health (NIH) NHLBI Specialized Centers of Research (SCOR) Grants HL56985 and HL56987 (in molecular mechanisms of atherosclerosis) and by NIH NIA Grant AG12712 (to T. M.) and NHLBI R37-HL35716 (to T. C.).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Dagger Dagger To whom correspondence should be addressed: Weill Medical College of Cornell University, 1300 York Ave., C-608, New York, NY 10021. Tel.: 212-746-2089; Fax: 212-746-8866; E-mail: tamccaf@med.cornell.edu.

§ Contributed equally to the work.

Published, JBC Papers in Press, September 11, 2000, DOI 10.1074/jbc.M005159200


    ABBREVIATIONS

The abbreviations used are: TGF-beta , transforming growth factor-beta ; Tbeta R-2, TGF Type II receptor; PDGF, platelet-derived growth factor; NGF, nerve growth factor; FBS, fetal bovine serum; FGF, fibroblast growth factor; CAT, chloramphenicol acetyltransferase; PRE, positive regulatory element.


    REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES


1. Ross, R. (1993) Nature 362, 801-809
2. Schmitt-Graff, A., Desmouliere, A., and Gabbiani, G. (1994) Virchows Arch. 425, 3-24
3. Rembold, C. (1996) Perspect. Biol. Med. 39, 405-408
4. Bennett, M. R., Evan, G. I., and Schwartz, S. M. (1995) J. Clin. Invest. 95, 2266-2274
5. McCaffrey, T. A., Consigli, S., Du, B., Falcone, D. J., Sanborn, T. A., Spokojny, A. M., and Bush, H. (1995) J. Clin. Invest. 96, 2667-2675
6. Bray, P., Du, B., Mejia, V., Hao, S., Deutsch, E., Fu, C., Wilson, R., Hanauske-Abel, H., and McCaffrey, T. (1999) Arterioscler. Thromb. Vasc. Biol. 19, 1180-1189
7. McCaffrey, T., Du, B., Bray, P., Fu, C., Sanborn, T., Deutsch, E., Tarazona, N., Shaknovitch, A., Newman, G., Patterson, C., and Bush, H. (1999) J. Mol. Cell. Cardiol. 31, 1627-1642
8. McCaffrey, T. A., and Falcone, D. J. (1993) Mol. Biol. Cell 4, 315-322
9. Wrana, J. L., Attisano, L., Carcamo, J., Zentella, A., Doody, J., Laiho, M., Wang, X. F., and Massague, J. (1992) Cell 71, 1003-1014
10. Miyazono, K. (2000) Cytokine Growth Factor Rev. 11, 15-22
11. McCaffrey, T. (2000) Cytokine Growth Factor Rev. 11, 103-114
12. Bobik, A., Agrotis, A., Kanellakis, P., Dilley, R., Krushinsky, A., Smirnov, V., Tararak, E., Condron, M., and Kostolias, G. (1999) Circulation 99, 2883-2891
13. McCaffrey, T., Du, B., Consigli, S., Szabo, P., Bray, P., Hartner, L., Weksler, B., Sanborn, T., Bergman, G., and Bush, H. (1997) J. Clin. Invest. 100, 2182-2188
14. McCaffrey, T., Fu, C., Du, B., Eksinar, S., Kent, K., Bush, H., Kreiger, K., Rosengart, T., Cybulsky, M., Silverman, E., and Collins, T. (2000) J. Clin. Invest. 105, 653-662
15. Silverman, E. S., Khachigian, L. M., Lindner, V., Williams, A. J., and Collins, T. (1997) Am. J. Physiol. 273, H1415-H1426
16. Cui, M., Penn, M., and Chisolm, G. (1999) J. Biol. Chem. 274, 32795-32802
17. Houston, P., Dickson, M. C., Ludbrook, V., White, B., Schwachtgen, J. L., McVey, J. H., Mackman, N., Reese, J. M., Gorman, D. G., Campbell, C., and Braddock, M. (1999) Arterioscler. Thromb. Vasc. Biol. 19, 281-289
18. Sato, K., Ishikawa, K., Ui, M., and Okajima, F. (1999) Brain Res. 74, 182-189
19. Day, F. L., Rafty, L. A., Chesterman, C. N., and Khachigian, L. M. (1999) J. Biol. Chem. 274, 23726-23733
20. Yan, S. F., Lu, J., Zou, Y. S., Soh-Won, J., Cohen, D. M., Buttrick, P. M., Cooper, D. R., Steinberg, S. F., Mackman, N., Pinsky, D. J., and Stern, D. M. (1999) J. Biol. Chem. 274, 15030-15040
21. Santiago, F. S., Atkins, D. G., and Khachigian, L. M. (1999) Am. J. Pathol. 155, 897-905
22. Kim, S., Ohta, K., Hamaguchi, A., Omura, T., Yukimura, T., Miura, K., Inada, Y. I., Chatani, F., and Iwao, H. (1995) J. Pharmacol. Exp. Ther. 273, 509-515
23. Santiago, F., Lowe, H., Kavurma, M., Chesterman, C., Baker, A., Atkins, D., and Khachigian, L. (1999) Nat. Med. 5, 1264-1269
24. Khachigian, L., Williams, A., and Collins, T. (1995) J. Biol. Chem. 270, 27679-27686
25. McKay, S., de Jongste, J. C., Saxena, P. R., and Sharma, H. S. (1998) Am. J. Respir. Cell Mol. Biol. 18, 823-833
26. Skerka, C., Decker, E. L., and Zipfel, P. F. (1995) J. Biol. Chem. 270, 22500-22506
27. Yao, J., Mackman, N., Edgington, T. S., and Fan, S. T. (1997) J. Biol. Chem. 272, 17795-177801
28. Akuzawa, N., Kurabayashi, M., Ohyama, Y., Arai, M., and Nagai, R. (2000) Arterioscler. Thromb. Vasc. Biol. 20, 377-384
29. Dinkel, A., Aicher, W., Haas, C., Zipfel, P., Peter, H., and Eibel, H. (1997) J. Immunol. 159, 2678-2684
30. Li-Weber, M., Laur, O., and Krammer, P. H. (1999) Eur. J. Immunol. 29, 3017-3027
31. Yan, Y. X., Nakagawa, H., Lee, M. H., and Rustgi, A. K. (1997) J. Biol. Chem. 272, 33181-33190
32. Silverman, E., Du, J., De Sanctis, G., Radmark, O., Samuelsson, B., Drazen, J., and Collins, T. (1998) Am. J. Respir. Cell Mol. Biol. 19, 316-323
33. Thottassery, J. V., Sun, D., Zambetti, G. P., Troutman, A., Sukhatme, V. P., Schuetz, E. G., and Schuetz, J. D. (1999) J. Biol. Chem. 274, 3199-3206
34. Molnar, G., Crozat, A., and Pardee, A. (1994) Mol. Cell. Biol. 14, 5242-5248
35. Minc, E., de Coppet, P., Masson, P., Thiery, L., Dutertre, S., Amor-Gueret, M., and Jaulin, C. (1999) J. Biol. Chem. 274, 503-509
36. Maltzman, J. S., Carmen, J. A., and Monroe, J. G. (1996) J. Exp. Med. 183, 1747-1759
37. Liu, C., Yao, J., Mercola, D., and Adamson, E. (2000) J. Biol. Chem. 275, 20315-20323