JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M007983200 on September 21, 2000

J. Biol. Chem., Vol. 275, Issue 51, 40605-40613, December 22, 2000
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
275/51/40605    most recent
M007983200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Okuda, T.
Right arrow Articles by Habuchi, O.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Okuda, T.
Right arrow Articles by Habuchi, O.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Molecular Cloning and Characterization of GalNAc 4-Sulfotransferase Expressed in Human Pituitary Gland*

Tetsuya OkudaDagger , Satoka MitaDagger , Shinobu YamauchiDagger §, Masakazu FukutaDagger , Hirofumi Nakano, Toshihiko Sawada, and Osami HabuchiDagger ||

From the Dagger  Department of Life Science,  Department of Chemistry, Aichi University of Education, Kariya, Aichi 448-8542, Japan

Received for publication, August 31, 2000, and in revised form, September 20, 2000



    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

We have previously cloned chondroitin-4-sulfotransferase (C4ST) cDNA from mouse brain. In this paper, we report cloning and characterization of GalNAc 4-sulfotransferase (GalNAc4ST), which transfers sulfate to position 4 of the nonreducing terminal GalNAc residue. The obtained cDNA contains a single open reading frame that predicts a type II transmembrane protein composed of 424 amino acid residues. Identity of the amino acid sequence between GalNAc4ST and human C4ST was 30%. When the cDNA was transfected in COS-7 cells, sulfotransferase activity toward carbonic anhydrase VI was overexpressed but no sulfotransferase activity toward chondroitin or desulfated dermatan sulfate was increased over the control. Sulfation of carbonic anhydrase VI by the recombinant GalNAc4ST occurred at position 4 of the GalNAc residue of N-linked oligosaccharides. The recombinant GalNAc4ST transferred sulfate to position 4 of GalNAc residue of p-nitrophenyl GalNAc, indicating that this sulfotransferase transfers sulfate to position 4 at the nonreducing terminal GalNAc residue. Dot blot analysis showed that the message of GalNAc4ST was expressed strongly in the human pituitary, suggesting that the cloned GalNAc4ST may be involved in the synthesis of the nonreducing terminal GalNAc 4-sulfate residues found in the N-linked oligosaccharides of pituitary glycoprotein hormones.



    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Sulfated sugar chains are found not only in glycosaminoglycans but also in oligosaccharides of glycoproteins and glycolipids (1). Sulfate moieties attached to the sugar residues of glycosaminoglycans and oligosaccharides play key roles in various molecular and cellular interactions: binding of FGF2 to heparan sulfate (2, 3); interaction of L-selectin on the lymphocytes with L-selectin ligands on the endothelial cells of high endothelial venule (4-10); binding of HNK-1 epitope to the sulfoglucuronyl carbohydrate-binding protein (11); and rapid clearance of a pituitary glycoprotein hormone, lutropin, mediated by the interaction with a hepatic reticuloendothelial cell receptor (12, 13). Various sulfotransferases involved in the sulfation of glycosaminoglycans (14) and oligosaccharides (15-17) have been cloned. We have purified and cloned chondroitin-6-sulfotransferase (C6ST)1 (18, 19) and chondroitin-4-sulfotransferase (C4ST) (20, 21), which are involved in the sulfation of position 6 and position 4, respectively, of GalNAc residues of chondroitin. C6ST also transfers sulfate to position 6 of Gal residue of keratan sulfate and sialyl N-acetyllactosamine oligosaccharides (22, 23). We have cloned keratan sulfate Gal-6-sulfotransferase using the homology with C6ST. Keratan sulfate Gal6ST transfers sulfate to position 6 of the Gal residue of keratan sulfate and sialyl N-acetyllactosamine oligosaccharides but not to GalNAc residue of chondroitin (24, 25). Several GlcNAc-6-sulfotransferases, which are involved in the synthesis of 6-sulfo-sialyl Lewis x, have been cloned from the family genes including C6ST and keratan sulfate Gal6ST (9, 10, 26). On the other hand, C4ST showed significant homology with HNK-1 sulfotransferase (21, 27), which transfers sulfate to position 3 of nonreducing terminal GlcA residue and is responsible for the synthesis of the HNK-1 epitope (16, 17). These observations suggest that, in some cases, sulfotransferases involved in the sulfation of glycosaminoglycans and sulfotransferases involved in the sulfation of oligosaccharides of glycoproteins may be included in a common gene family.

Nonreducing terminal GalNAc 4-sulfate residue is present in oligosaccharides attached to pituitary glycoprotein hormones (lutropin, follitropin, and thyrotropin) (28-30), pro-opiomelanocortin (31), and carbonic anhydrase VI of submaxillary gland (32), and was shown to play an important role in a pulsatile appearance of lutropin in the blood through the binding to the hapatic receptor for the sulfated GalNAc residue (12, 33). GalNAc 4-sulfotransferase (GalNAc4ST) that transfers sulfate to the nonreducing terminal GalNAc residue attached to the N-linked oligosaccharides of lutropin was found in the pituitary (34) and submaxillary gland (32), and was purified from the bovine submaxillary gland (35). Since both GalNAc4ST and C4ST transfer sulfate to position 4 of GalNAc residue, it is possible that GalNAc4ST and C4ST may belong to the same gene family as discussed above. On the basis of these considerations, we tried to find GalNAc4ST cDNA among expressed sequence-tagged cDNA clones showing homology with C4ST. One of these clones, which was expressed strongly in the pituitary, was found to encode a sulfotransferase capable of sulfating oligosaccharides of carbonic anhydrase VI. Product analysis showed that this sulfotransferase transferred sulfate to position 4 of the nonreducing terminal GalNAc residue.


    EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Materials-- The following commercial materials were used: H235SO4 was from PerkinElmer Life Sciences; chondroitinase ACII, chondroitinase ABC, dermatan sulfate (pig skin), Delta Di-0S, Delta Di-6S, Delta Di-4S, Delta Di-diSD, and Delta Di-diSE were from Seikagaku Corp., Tokyo; Partisil SAX-10 was from Whatman; GalNAc 4-sulfate, GalNAc 6-sulfate, GalNAc 4,6-bissulfate, GlcNAc 6-sulfate, and GlcNAc 3-sulfate were from Sigma; recombinant N-glycosidase F was from Roche Molecular Biochemicals; Hiload Superdex 30 HR 16/60, Fast Desalting Column HR 10/10 were from Amersham Pharmacia Biotech.

[35S]PAPS was prepared as described (36). GalNAc 3-sulfate was prepared by treatment of benzyl 2-acetamide-4,6-O-benzylidene-2-deoxy-beta -D-galactopyranoside (37) with sulfur trioxide pyridine complex, followed by catalytic hydrogenolysis (5% Pd-C) in ethanol. The structure of GalNAc 3-sulfate was confirmed by 1H NMR, 13C NMR, and two-dimensional NMR spectra (COSY, HMQC, and HMBC). Chondroitin was prepared from the squid skin as described previously (38). Partially desulfated dermatan sulfate was prepared from pig skin dermatan sulfate according to Nagasawa et al. (39). Solvolysis with dimethyl sulfoxide was carried out at 100 °C for 60 min. The degree of the desulfation was calculated as 83% from the proportion of Delta Di-0S to the total unsaturated disaccharides formed after chondroitinase ABC digestion.

Preparation of Carbonic Anhydrase VI from Bovine Submaxillary Gland-- Carbonic anhydrase VI was purified from bovine submaxillary gland as described previously (32). All operations were carried out at 4 °C. 200 g of the freshly excised glands, which were obtained from a local slaughterhouse under the help of a veterinary, Dr. A. Mabuchi, were put through a meat grinder and homogenized by a Polytron homogenizer in 1 liter of 50 mM sodium phosphate buffer, pH 7.4, 1 mM EDTA. The homogenate was centrifuged at 10,000 × g, and the supernatant was filtered through two layers of cotton cloth and then precipitated with an equal volume of a saturated ammonium sulfate solution for 1 h. The solution was centrifuged at 10,000 × g, and the precipitate was resuspended with 60 ml of 0.1 M NH4HCO3 and dialyzed against 4 changes of 1.5 liter of 0.1 M NH4HCO3. After centrifuging the dialysate at 100,000 × g for 60 min, one-half of the solution (50 ml) was passed over 5 ml of p-aminomethylbenzene sulfonamide-agarose (Sigma) followed by washing with 150 ml each of 0.1 M NH4HCO3 and 0.2 M NaI in 0.1 M NH4HCO3. The column was eluted in 40 ml of 0.4 M NaN3 in 0.1 M NH4HCO3, and the fractions containing protein and carbonic anhydrase activity were pooled and dialyzed against 300 ml of 25 mM Tris-HCl, pH 7.4. This affinity chromatography was repeated once. The dialysate was bound to a 15-ml DEAE-Sephacel column equilibrated with 25 mM Tris-HCl, pH 7.4, followed by washing in 200 ml of 50 mM NaCl in 25 mM Tris-HCl, pH 7.4, and elution in 100 ml of 200 mM NaCl in 25 mM Tris-HCl, pH 7.4. The fractions containing protein and carbonic anhydrase activity were pooled and dialyzed against 25 mM Tris-HCl, pH 7.4. Carbonic anhydrase activity was determined by the method using phenol red (40). Through the purification, 20 mg of carbonic anhydrase was obtained. On SDS-PAGE, the purified carbonic anhydrase VI showed a single protein band of 41 kDa before N-glycosidase F digestion and 35 kDa after N-glycosidase F digestion (Fig. 4).

Polymerase Chain Reaction and Preparation of a Probe for Screening-- When the sequence of mouse C4ST was used for the homology search, we found a human expressed sequence-tagged cDNA clone (accession number AC005615). Examination of the sequence of the cDNA indicated the presence of the nucleotide sequences corresponding to putative PAPS binding motifs (5'-PSB and 3'-PB) found in every sulfotransferases; therefore, we predicted that this cDNA might encode a novel sulfotransferase with the substrate specificity similar to that of C4ST. We designed oligonucleotide primers for PCR from the sequence of the clone to amplify a DNA fragment, which was used as a probe for screening cDNA library. The 5' and 3' primers were GACCGCCAGGGTATCTTGCA and GAGTGCCGGTCCTTGAACCG, respectively. The PCR reaction was carried out in a final volume of 50 µl containing 50 pmol each of the oligonucleotide primers, 1 µl of human brain cDNA solution (OriGene Technologies), 0.2 mM each of four deoxynucleoside triphosphates, 1.5 unit of AmpliTaq polymerase (PerkinElmer Life Sciences). Amplification was carried out by 40 cycles of 94 °C for 45 s, 44 °C for 1.5 min, and 72 °C for 1 min. Reaction products were subjected to electrophoresis and the amplified DNA band (416 base pairs) was recovered from the gel. The radioactive probe for screening of the cDNA library was prepared from the PCR product by the random oligonucleotide-primed labeling method (41) using [alpha -32P]dCTP (Amersham Pharmacia Biotech) and a DNA random labeling kit (Takara Shuzo).

Screening of lambda gt 11 Library-- Approximately 4 × 105 plaques from the human fetal brain cDNA library (CLONTECH) were screened. Hybond N+ nylon membrane (Amersham Pharmacia Biotech) replicas of the plaques from the lambda gt 11 cDNA library were fixed by the alkali fixation method recommended by the manufacturer, prehybridized in a solution containing 50% formamide, 5 × SSPE, 5 × Denhardt's solution, 0.5% SDS, 0.04 mg/ml denatured salmon sperm DNA for 3.5 h at 42 °C. Hybridization was carried out in the same buffer containing 32P-labeled probe for 16 h at 42 °C. The filters were washed at 55 °C in 1 × SSPE, 0.1% SDS, and subsequently in 0.1 × SSPE, 0.1% SDS, and positive clones were detected by autoradiography.

DNA Sequence Analysis-- DNA from lambda gt 11 positive clones were isolated and cut with EcoRI, which excised the cDNA insert. The fragments were inserted into pBluescript II vector (Stratagene). The complete nucleotide sequence was determined by the dideoxy chain termination method using a DNA sequencer (Applied Biosystem Model 373A). DNA sequences were compiled and analyzed using the MacVector computer programs (Oxford Molecular Group PLC).

Construction of pFLAGGalNAc4ST and Transient Expression of GalNAc4ST cDNA in COS-7 Cells-- A DNA fragment which codes for full open reading frame was amplified by PCR using human GalNAc4ST cDNA as a template. The 5' and 3' primers were CGCAAGCTTATGACCCTGCGACCTGGAACAATG and CAGGAATTCTCAGAGCCCTGTTGCTCCCAGGAT, respectively. The PCR reaction was carried out by 40 cycles of 94 °C for 45 s, 57 °C for 1.5 min, and 72 °C for 1 min. The PCR product was digested with EcoRI and HindIII, and subcloned into these sites of pFLAG-CMV-2 plasmid (Kodak, New Haven, CT). COS-7 cells (obtained from Riken Cell Bank, Tsukuba, Japan) were plated in 100-mm culture dishes at a density of 8 × 105 cells/dish. Volume of the medium was 10 ml. The medium used was Dulbecco's modified Eagle's medium containing penicillin (100 units/ml), streptomycin (50 µg/ml), and 10% fetal bovine serum (Life Technologies, Inc.), and cells were grown at 37 °C in 5% CO2, 95% air. When the cell density reached 3 × 106 cells/dish (48 h after plating), COS-7 cells were transfected with pFLAGGalNAc4ST, a recombinant plasmid containing the GalNAc4ST cDNA in pFLAG-CMV-2, or pFLAG-CMV-2. The transfection was performed using the DEAE-dextran method (42). 5 ml of the prewarmed Dulbecco's modified Eagle's medium containing 10% Nu-serum (Collaborative Biomedical Products) was mixed with 0.2 ml of phosphate-buffered saline containing 10 mg/ml DEAE-dextran plus 2.5 mM chloroquine solution. 15 µg of the recombinant plasmid was mixed with the solution, and the mixture was added to the cells. The cells were incubated for 4 h in a CO2 incubator. The medium was then replaced with 5 ml of 10% dimethyl sulfoxide in phosphate-buffered saline. After the cells were left at room temperature for 2 min, the dimethyl sulfoxide solution was aspirated and 25 ml of Dulbecco's modified Eagle's medium containing penicillin (100 units/ml), streptomycin (50 µg/ml), and 10% fetal bovine serum was added. After incubation for 60-65 h, the cells were washed with Dulbecco's modified Eagle's medium alone, and the recombinant protein produced was extracted from the cells with a buffer containing 10 mM Tris-HCl, pH 7.2, 0.15 M NaCl, 10 mM MgCl2, 2 mM CaCl2, 0.5% Triton X-100, 20% glycerol by gentle shaking on a rotatory shaker for 30 min at 4 °C. The extracts were centrifuged at 10,000 × g for 10 min. The supernatant fraction was used for the experiments on the recombinant GalNAc4ST.

Assay of C4ST Activity-- C4ST activity was assayed by the method described previously (20). The standard reaction mixture contained 50 mM imidazole-HCl, pH 6.8, 0.0025% protamine chloride, 2 mM dithiothreitol, 25 nmol (as glucuronic acid) chondroitin, 50 pmol of [35S]PAPS (about 5.0 × 105 cpm), and enzyme in a final volume of 50 µl. For determining the activity toward desulfated dermatan sulfate, chondroitin was replaced with 25 nmol (as galactosamine) of desulfated dermatan sulfate and the amount of protamine chloride was increased to 0.02%. The reaction mixtures were incubated at 37 °C for 20 min and the reaction was stopped by immersing the reaction tubes in a boiling water bath for 1 min. After the reaction was stopped, 35S-labeled glycosaminoglycans were isolated by the precipitation with ethanol followed by gel chromatography with a Fast Desalting Column as described previously and radioactivity was determined. For determining the incorporation into position 4 and position 6 of GalNAc residues, 35S-labeled chondroitin and 35S-labeled desulfated dermatan sulfate were digested with chondroitinase ACII and chondroitinase ABC, respectively. The resulting unsaturated disaccharides (Delta Di-4S and Delta Di-6S) were separated with paper chromatography, and their radioactivities were measured.

Assay of GalNAc4ST Activity-- GalNAc4ST activity was assayed using carbonic anhydrase VI as an acceptor by the method described previously (34) with slight modification. The standard reaction mixture contained 15 mM imidazole-HCl, pH 7.2, 6 mM Mg(CH3COO)2, 40 mM 2-mercaptoethanol, 1% Triton X-100, 10 mM NaF, 0.1 mM 5'-AMP, 13% glycerol, 10 µg of the purified carbonic anhydrase VI, 50 pmol of [35S]PAPS (about 5.0 × 105 cpm), and enzyme in a final volume of 50 µl. The reaction mixtures were incubated at 28 °C for 2 h. After the reaction was over, the reaction mixtures were placed on an ice bath and injected into a Fast Desalting column as described previously and radioactivity of the void fraction was determined. Under the assay conditions, the incorporation of 35SO4 into carbonic anhydrase VI proceeded linearly up to 2 h. To determine the sulfation of pNP-GalNAc, carbonic anhydrase VI was replaced with 25 nmol of pNP-GalNAc. The reaction was stopped by adding 30 µl of 0.1 M HCl and the mixtures were incubated at 37 °C for 60 min to degrade excess amounts of [35S]PAPS. After the mixtures were spotted on Toyo No. 51A filter paper, the filter paper was developed with a solvent described below until the solvent front reached the edge of the paper. The dried paper strips were cut into 1.25-cm segments, which were analyzed for radioactivity by liquid scintillation counting.

Dot blot hybridization-- Human Multiple Tissue Expression Array was prehybridized in ExpresHyb solution (CLONTECH) at 68 °C. Hybridization was carried out in the same solution containing 32P-labeled probe for 1 h at 68 °C. The radioactive probe was prepared from the cDNA fragment excised from the pBluescript II plasmid with EcoRI by the random oligonucleotide-primed labeling method using [alpha -32P]dCTP and a DNA random labeling kit (Takara Shuzo). The filters were washed at room temperature in 2 × SSC, 0.05% SDS, and subsequently in 0.1 × SSC, 0.1% SDS at 50 °C. The membrane was exposed to x-ray film at -80 °C with an intensifying screen.

SDS-Polyacrylamide Gel Electrophoresis-- Polyacrylamide gel electrophoresis of proteins in SDS was carried out on 10% polyacrylamide gels as described (43). Protein bands were detected by Coomasie Brilliant Blue. 35S radioactivity was detected by autoradiography after the gel was dried.

Assay of Protein-- Protein was determined by the method of Bradford using bovine serum albumin as a standard (44). Protein assay reagent was obtained from Bio-Rad.

Digestion of the Carbonic Anhydrase VI with N-Glycosidase F-- The 35S-labeled carbonic anhydrase VI was precipitated with 10% trichloroacetic acid. The precipitates were washed with acetone and digested with recombinant N-glycosidase F (Roche Molecular Biochemicals) by the methods recommended by the manufacturer. After digestion, the protein was precipitated with 10% trichloroacetic acid and analyzed by SDS-PAGE. Oligosacharides released by N-glycosidase F digestion were recovered from the supernatant of 10% trichloroacetic acid.

Superdex 30 Chromatography, Paper Electrophoresis, Paper Chromatography, and HPLC-- A Superdex 30 16/60 column was equilibrated with 0.2 M NH4HCO3 and run at a flow rate of 1 ml/min. One-ml fractions were collected. Paper electrophoresis was carried out on Whatman No. 3 paper (2.5 cm × 57 cm) in pyridine/acetic acid/water (1:10:400, by volume, pH 4) at 30 V/cm for 40 min. Paper chromatography was performed on Toyo No. 51A paper (20 × 50 cm) using a solvent system, 1-butanol, acetic acid, 1 M NH3 (2:3:1, by volume). The dried paper strips after paper electrophoresis or paper chromatography were cut into 1.25-cm segments, which were analyzed for radioactivity by liquid scintillation counting. Separation of GalNAc(4SO4) was carried out by HPLC using a Whatman Partisil 10-SAX column (4.6 mm × 25 cm) equilibrated with 10 mM KH2PO4. The column was developed with 10 mM KH2PO4 for 10 min followed by a linear gradient from 10 to 450 mM KH2PO4 as indicted in Fig. 5. Fractions (0.5 ml) were collected at a flow rate of 1 ml/min and a column temperature of 40 °C.


    RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

cDNA and Predicted Protein Sequence of the GalNAc4ST-- When approximately 4 × 105 plaques of a human fetal brain cDNA library were screened using a probe, which was prepared by PCR using human brain cDNA as a template and primer oligonucleotides designed from the sequence of a human expressed sequence-tagged cDNA clone (accession number AC005615), two cDNA clones (2.2 and 1.3 kilobase pairs) were isolated. One of these clones (2.2 kilobase pairs) was found to contain whole open reading frame. The nucleotide sequence of the GalNAc4ST cDNA and the predicted amino acid sequence are shown in Fig. 1A. A single open reading frame predicts a protein of 424 amino acid residues with four potential N-linked glycosylation sites. Putative PAPS-binding domains (5'-PSB and 3'-PB) were present. The presumptive polyadenylation signal was found before the poly(A) sequence. To determine the location of any transmembrane domain, a hydropathy plot was generated from the translated sequence. Analysis of the plot revealed one prominent hydrophobic segment in the amino-terminal region, 22 residues in length, that extends from amino acid residues 10 to 31 (Fig. 1B).



View larger version (61K):
[in this window]
[in a new window]
  		Fig. 1.   Nucleotide sequence of the GalNAc4ST cDNA, and the predicted amino acid sequence and hydropathy plot of the protein. A, the predicted amino acid sequence is shown below the nucleotide sequence. Four potential N-linked glycosylation sites are indicated by dots. The putative transmembrane hydrophobic domain is boxed. The putative PAPS-binding domains, 5'-PSB and 3'-PB, are indicated by double underline and broken underline, respectively. The presumptive polyadenylation signal is underlined. B, the hydropathy plot was calculated by the method of Kyte and Doolittle (51) with a window of 11 amino acids.

Comparison of the coding sequence of human GalNAc4ST with that of human C4ST (45) has revealed that there are 30% identity on the amino acid level (Fig. 2). Homology in the amino acid sequence between the two proteins was observed in the carboxyl-terminal side of the molecules. Especially, amino acid sequences of 5'-PSB and 3'-PB were well conserved. Homology of the N-terminal region was rather poor.



View larger version (62K):
[in this window]
[in a new window]
  		Fig. 2.   Sequence comparison of human GalNAc4ST and human hC4ST. The predicted amino acid sequences were aligned using MacVector computer program. White letters in black boxes and boxed letters indicate identical and similar amino acid residues, respectively, between the two sequences.

Expression of GalNAc4ST cDNA in COS-7 Cells-- COS-7 cells were transfected with the pFLAGGalNAc4ST, a recombinant plasmid containing the isolated cDNA in the mammalian expression vector pFLAG-CMV-2. The transfected cells were extracted with a buffer containing 0.5% Triton X-100 and centrifuged. Activities of sulfotransferase was determined using chondroitin, desulfated dermatan sulfate, or carbonic anhydrase VI as acceptors. Control experiments with vector alone were also done. As shown in Fig. 3, more than 10-fold overexpression of the sulfotransferase activity was observed when carbonic anhydrase VI was used as the acceptor. In contrast, no sulfotransferase activity was overexpressed when chondroitin or desulfated dermatan sulfate was used as the acceptor. Sulfotransferase activity toward carbonic anhydrase VI was not overexpressed when COS-7 cells were transfected with human C4ST cDNA (data not shown).



View larger version (29K):
[in this window]
[in a new window]
  		Fig. 3.   Overexpression of GalNAc 4-sulfotransferase in COS-7 cells. COS-7 cells were transfected as described under "Experimental Procedures" with a plasmid containing the GalNAc4ST cDNA (G4) or plasmid alone (M). Sulfotransferase activity was determined as described under "Experimental Procedures" using carbonic anhydrase VI (closed bar), chondroitin (open bar), or desulfated dermatan sulfate (hatched bar) as acceptors. When chondroitin or desulfated dermatan sulfate was used as acceptor, incorporation of 35SO4 into Delta Di-6S (6S) and Delta Di-4S (4S) after digestion with chondroitinase ACII (for chondroitin) or chondroitinase ABC (for desulfated dermatan sulfate) were determined. Bars represent averages of triplicate cultures with S.D.

Analysis of Sulfated Carbonic Anhydrase VI-- When 35S-labeled carbonic anhydrase VI was separated with SDS-PAGE, the radioactivity was coincided with the protein band visualized with Coomasie Blue (Fig. 4, lane 1 and 3) The radioactivity, however, was completely removed after N-glycosidase F digestion (Fig. 4, lane 2 and 4), indicating that 35SO4 was transferred to N-linked oligosaccharides of carbonic anhydrase VI. The 35S-labeled N-linked oligosaccharides released from the 35S-labeled carbonic anhydrase VI with N-glycosidase F digestion were isolated by Superdex 30 chromatography (Fig. 5A). The 35S-labeled oligosaccharide fractions were hardly obtained when carbonic anhydrase VI was incubated with the extracts from COS-7 cells transfected with vector alone (control extract) (open circle in Fig. 5A). The 35S-labeled oligosaccharides were subjected to mild acid hydrolysis (40 mM HCl, 100 °C, 120 min) and separated with the Superdex 30 column again (Fig. 5B). The 35S radioactivity was detected in the position of GalNAc(4SO4), inorganic sulfate and larger molecules, which were thought to be partially degraded oligosaccharides. The fractions corresponding to GalNAc(4SO4) and inorganic sulfate (indicated by a horizontal bar in Fig. 5B) were combined. After removal of inorganic sulfate by paper electrophoresis, the materials which behaved together with GalNAc(4SO4) in both Superdex 30 chromatography and paper electrophoresis were separated with SAX-HPLC (Fig. 5C). The 35S radioactivity was exclusively eluted at the position of GalNAc(4SO4), and was clearly separated from GalNAc(6SO4), GalNAc(3SO4), GlcNAc(6SO4), and GlcNAc(3SO4). These observations clearly indicate that sulfate was transferred to position 4 of GalNAc residue of the N-linked oligosaccharides attached to carbonic anhydrase VI.



View larger version (52K):
[in this window]
[in a new window]
  		Fig. 4.   Incorporation of 35SO4 into N-linked oligosaccharides of carbonic anhydrase VI. Carbonic anhydrase VI was incubated with the recombinant GalNAc4ST and [35S]PAPS as described under "Experimental Procedures." The sulfated products were precipitated with 10% trichloroacetic acid and applied to SDS-PAGE before (lanes 1 and 3) or after (lanes 2 and 4) digestion with N-glycosidase F. Protein bands were visualized with Coomasie Brilliant Blue staining (lanes 1 and 2), and the radioactivity was detected by autoradiography (lanes 3 and 4). Molecular size standards were the following: bovine serum albumin (66 kDa), egg albumin (45 kDa), rabbit muscle glyceraldehyde-3-phosphate dehydrogenase (36 kDa), and bovine erythrocyte carbonic anhydrase (29 kDa).



View larger version (20K):
[in this window]
[in a new window]
  		Fig. 5.   Identification of [35S]GalNAc(4SO4) in the mild acid hydrolysate of 35S-labeled N-linked oligosaccharides released from 35S-labeled carbonic anhydrase VI by N-glycosidase F digestion. A, carbonic anhydrase VI was incubated with the recombinant GalNAc4ST (closed circle) or the control extracts (open circle) together with [35S]PAPS as described under "Experimental Procedures." 35S-Labeled carbonic anhydrase VI isolated by the gel chromatography on Fast desalting column was digested with N-glycosidase F as described under "Experimental Procedures" and precipitated with 10% trichloroacetic acid. The supernatant fraction was neutralized with sodium hydroxide and applied to the Superdex 30 column. The arrows indicate the elution position of oligosaccharides derived from chondroitin. The number above each arrow indicates the number of sugar residues of chondroitin oligosaccharides. Vo, blue dextran. B, the oligosaccharide fractions derived from 35S-labeled carbonic anhydrase VI formed after incubation with the recombinant GalNAc4ST (indicated by a horizontal bar in A) were combined and subjected to mild acid hydrolysis (40 mM HCl, 100 °C, 120 min). The hydrolysate was separated with the Superdex 30 column. The arrows indicate the elution position of: 1, GalNAc(4SO4); and 2, inorganic sulfate. C, the fractions indicated by a horizontal bar in B was separated with SAX-HPLC after removal of inorganic sulfate by paper electrophoresis. The arrows indicate the elution position of: 1, Delta Di-0S; 2, GlcNAc(3SO4) and GalNAc(3SO4); 3, GalNAc(6SO4); 4, GlcNAc(6SO4); 5, GalNAc(4SO4); 6, Delta Di-6S; 7, Delta Di-4S; 8, GalNAc(4, 6-bisSO4); 9, Delta Di-diSD; and 10, Delta Di-diSE.

Analysis of Sulfated p-Nitrophenyl GalNAc-- It was reported that N-linked oligosaccharides attached to carbonic anhydrase VI contained GalNAcbeta 1-4GlcNAc sequence at the nonreducing terminal (32); therefore, it is most likely that 35SO4 was transferred to GalNAc residue at the nonreducing terminal. To demonstrate that the recombinant GalNAc4ST could transfer sulfate to nonreducing terminal GalNAc residue, we tested the possibility that p-nitrophenyl-beta -D-GalNAc (pNP-GalNAc) could serve as acceptor for GalNAc4ST, since pNP-GalNAc was reported to inhibit GalNAc4ST activity (34). After pNP-GalNAc was incubated with the recombinant GalNAc4ST together with [35S]PAPS, the reaction products were separated with paper chromatography. A radioactive peak migrating near the solvent front was observed (peak 2 in Fig. 6A). This peak was also observed when pNP-GalNAc was incubated with the control extract. The radioactive materials contained in peak 2 (indicated by a horizontal bar in Fig. 6A) were eluted from the paper and separated with paper electrophoresis (Fig. 6B). Two peaks (peaks 3 and 4 in Fig. 6B) were observed when pNP-GalNAc was incubated with the recombinant GalNAc4ST. The slower migrating peak (peak 3) was not observed when pNP-GalNAc was incubated with the control extract. When peak 3 in Fig. 6B (indicated by a horizontal bar) was eluted, subjected to mild acid hydrolysis (40 mM HCl, 100 °C, 60 min) (46), and separated again with paper electrophoresis, a radioactive peak (peak 5 in Fig. 6C), which migrated slowly than inorganic sulfate (peak 6 in Fig. 6C), was observed when pNP-GalNAc was incubated with the recombinant GalNAc4ST. A small peak was observed slightly ahead of peak 5, but this peak was not examined further. Peak 5 was not detected at all when pNP-GalNAc was incubated with the control extract. The mild acid hydrolysis of peak 4 in Fig. 6B resulted in complete release of inorganic sulfate even when pNP-GalNAc was incubated with the recombinant GalNAc4ST (data not shown). When peak 5 was recovered and separated with paper chromatography, the 35S radioactivity was detected in two peaks (Fig. 6D). One of the two peaks (peak 7 in Fig. 6D) migrated to the position of GalNAc(4SO4) and was clearly separated from GalNAc(6SO4) and GalNAc(3SO4). The faster migrating peak (peak 8 in Fig. 6D) seemed to contain sulfated pNP-GalNAc which remained intact during the mild acid hydrolysis. These observations clearly indicate that GalNAc4ST transfers sulfate to position 4 of nonreducing terminal GalNAc residue. Both the recombinant GalNAc4ST and the control extracts catalyzed the formation of 35S-labeled material that was degraded completely by the mild acid hydrolysis (peak 4 in Fig. 6B). Since this acid-labile 35S-labeled material was formed when p-nitrophenol was used as acceptor, and was migrated together with p-nitrophenyl sulfate in paper chromatography and paper electrophoresis (data not shown), this material appears to be p-nitrophenyl sulfate. p-Nitrophenyl sulfate might be formed by the sulfation of contaminating p-nitrophenol in pNP-GalNAc with endogenous cytosol sulfotransferase. Unlike pNP-GalNAc, no sulfated GlcNAc was obtained when pNP-GlcNAc was used as acceptor, although acid-labile 35S-labeled material was formed (Fig. 7). These results suggest that GalNAc4ST may not transfer sulfate to nonreducing terminal GlcNAc residue.



View larger version (18K):
[in this window]
[in a new window]
  		Fig. 6.   Identification of [35S]GalNAc(4SO4) in the mild acid hydrolysate of 35S-labeled pNP-GalNAc. pNP-GalNAc was incubated with the recombinant GalNAc4ST (closed circle) or the control extracts (open circle) together with [35S]PAPS as described under "Experimental Procedures." A, the reaction mixtures were spotted on paper and developed until solvent front reached the paper edge (about 12 h). Peak 1 represents inorganic sulfate released from [35S]PAPS after incubation with HCl. Peak 2 (indicated by a horizontal bar) was eluted from the paper and used for further analysis. B, peak 2 fraction from A was separated by paper electrophoresis. Peak 3 (indicated by a horizontal bar) was eluted from the paper and subjected to mild acid hydrolysis (40 mM HCl, 100 °C, 60 min). C, after the mild acid hydrolysis, peak 3 from B was separated by paper electrophoresis. Peak 6 represents inorganic sulfate. Peak 5 (indicated by a horizontal bar), which was observed only when pNP-GalNAc was incubated with recombinant GalNAc4ST, was pooled and used for further analysis. D, peak 5 fraction from C was separated by paper chromatography for 20 h. The arrows indicate the position of standard sugars detected by silver nitrate staining: a, Delta Di-diSE; b, GalNAc(4, 6-bisSO4); c, Delta Di-6S; d, Delta Di-4S; e, GalNAc(6SO4); f, GalNAc(3SO4); and g, GalNAc(4SO4).



View larger version (19K):
[in this window]
[in a new window]
  		Fig. 7.   Characterization of 35S-labeled products after incubation of pNP-GlcNAc with the recombinant GalNAc4ST and [35S]PAPS. pNP-GlcNAc was incubated with the recombinant GalNAc4ST (closed circle) or the control extracts (open circle) together with [35S]PAPS as described under "Experimental Procedures." 35S-Labeled products were analyzed as described in the legend for Fig. 6. A, the reaction mixtures were spotted on paper and developed until solvent front reached the paper edge (about 12 h). Peak 1 in A (indicated by a horizontal bar) was eluted from the paper and used for further analysis. B, peak 1 from A was separated by paper electrophoresis. Only one peak (peak 2) was obtained even when pNP-GlcNAc was incubated with the recombinant GalNAc4ST (closed circle). Peak 2 (indicated by a horizontal bar in B) was subjected to mild acid hydrolysis (40 mM HCl, 100 °C, 60 min). C, after the mild acid hydrolysis, peak 2 from B was separated with paper electrophoresis. All the radioactivity migrated to the position of inorganic sulfate (peak 3).

Properties of GalNAc4ST-- The pH optimum for the recombinant GalNAc4ST was around 7.2 (Fig. 8A). The recombinant GalNAc4ST was stimulated with 2-mercaptoethanol (Fig. 8B) and protamine chloride (Fig. 8C). These properties were similar to those of the GalNAc4ST preparation from the bovine pituitary (34). The Km for carbonic anhydrase VI was 10 µM on the assumption that molecular weight of the purified carbonic anhydrase VI is 41,000 (Fig. 9). This value is similar to the Km for GalNAcbeta 1-4GlcNAcbeta 1-2Manalpha -O-(CH2)8-COOCH3 of the pituitary GalNAc4ST (34).



View larger version (18K):
[in this window]
[in a new window]
  		Fig. 8.   Effect of pH (A), 2-mercaptoethanol (B), and protamine chloride (C) on the sulfation of carbonic anhydrase VI with the recombinant GalNAc4ST. A, the GalNAc4ST activity was determined as described under "Experimental Procedures" except that 50 mM imidazole-HCl contained in the standard reaction mixture was replaced with 50 mM buffers with various pH values; sodium acetate (closed square), MES-NaOH (open square), imidazole-HCl (closed circle), and Tris-HCl (open circle). B, the GalNAc4ST activity was determined as described under "Experimental Procedures" except that the concentration of 2-mercaptoethanol was varied. C, the GalNAc4ST activity was determined as described under "Experimental Procedures" except that various amounts of protamine chloride were added to the reaction mixtures.



View larger version (14K):
[in this window]
[in a new window]
  		Fig. 9.   Effect of the concentration of carbonic anhydrase VI on the activity of the recombinant GalNAc4ST. The GalNAc4ST activity was determined as described under "Experimental Procedures" except that the concentration of carbonic anhydrase VI was varied. The inset represents the double reciprocal plot, in which the concentration of carbonic anhydrase VI was calculated on the assumption that molecular weight of carbonic anhydrase VI is 41,000.

Dot Blot Analysis-- Dot blot analysis using Human Multiple Tissue Expression Array (CLONTECH) showed that GalNAc4ST was expressed in various brain tissues and placenta; the strongest expression was observed in the pituitary gland (Fig. 10).



View larger version (61K):
[in this window]
[in a new window]
  		Fig. 10.   Dot blot analysis of GalNAc4ST messages in various human tissues. A, a Human Multiple Tissue Expression Array was hybridized with 32P-labeled DNA probe for human GalNAc4ST cDNA as described under "Experimental Procedures." B, the sources of the poly(A)+ RNA were indicated.



    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

We have cloned GalNAc4ST from a fetal brain library as a protein showing sequence homology with C4ST. GalNAc4ST shared several properties with C4ST: 1) both sulfotransferases were type II transmembrane proteins having four potential N-glycosylation sites. 2) Amino acid sequences of the putative PAPS-binding domains, especially 3'-PB, of these sulfotransferases were highly conserved. 3) 2-Mercaptoethanol and protamine chloride activated both sulfotransferases. 4) Both sulfotransferases transferred sulfate to position 4 of GalNAc residue. However, expression pattern in various human tissues were quite different; human C4ST was expressed strongly in peripheral blood leukocytes (27, 45) and colorectal adenocarcinoma (45), whereas expression of GalNAc4ST was detected in the various brain-related tissues and placenta. The strongest expression of GalNAc4ST was observed in the pituitary gland, suggesting that the cloned GalNAc4ST might participate in the biosynthesis of nonreducing terminal GalNAc(4SO4) residue found in N-linked oligosaccharides of pituitary hormones. As observed in C4ST, GalNAc4ST also contains Cys in the 5'-PSB domain, and was activated with 2-mercaptoethanol, suggesting that the Cys residue in 5'-PSB may be relevant to the stimulation of GalNAc4ST and C4ST by 2-mercaptoethanol.

Although both C4ST and GalNAc4ST transfer sulfate to position 4 of GalNAc residue, a clear difference in the recognition of the neighboring sugar residue was observed between these sulfotransferases. GalNAc residues in the repeating disaccharide units of chondroitin, GalNAcbeta 1-4GlcA, acted as acceptor for C4ST, but did not serve as acceptor for GalNAc4ST. On the other hand, GalNAc residues in the nonreducing terminal GalNAcbeta 1-4GlcNAc sequence present in N-linked oligosaccharides of carbonic anhydrase VI did not serve as acceptor for C4ST. It has been reported that isoforms of a glycosaminoglycan sulfotransferase transferred sulfate to the same position of the same sugar residue, but showed difference in the recognition of the structure of the neighboring sugar residue. Both 3O-ST-1 and 3O-ST-2 transferred sulfate to position 3 of GlcN(SO4), but 3O-ST-1 required GlcA at the nonreducing side, whereas 3O-ST-2 required IdoA(2SO4) or GlcA(2SO4) (47, 48). HS6ST-1, -2, and -3 transferred sulfate to position 6 of GlcN(SO4) of heparan sulfate, but each isoform showed the different specificity toward the isomeric hexuronic acid adjacent to the targeted N-sulfoglucosamine; HS6ST-1 appeared to prefer iduronosyl N-sulfoglucosamine unit, while HS6ST-2 had the different substrate preference depending upon the concentration of substrate and HS6ST-3 acted on either substrate (49). To understand the substrate specificity, it will be required to establish the three-dimensional interaction between each sulfotransferase and acceptor substrates.

Nonreducing terminal GalNAc(4SO4)beta 1-4GlcNAc sequence found in pituitary hormones has been implicated in the pulsatile characteristic of the circulating hormone levels through binding to the receptor for sulfated GalNAcbeta 1-4GlcNAc termini expressed by hepatic endothelial cells and Kupffer cells (12, 33). A pituitary sulfotransferase responsible for the 4-O-sulfation of terminal GalNAc residue was characterized using GalNAcbeta 1-4GlcNAcbeta 1-2Manalpha -O-(CH2)8-COOCH3 (GGnM-MCO) as an acceptor (34), and the sulfotransferase with the same substrate specificity as that of the pituitary sulfotransferase was purified from bovine submaxillary gland (35). The recombinant GalNAc4ST expressed in COS-7 cells from the cDNA shared several properties with the purified GalNAc4ST. The pH optimum of both the recombinant GalNAc4ST and the purified GalNAc4ST fell between 7.0 and 7.5, and both the sulfotransferases were activated with 2-mercaptoethanol and protamine chloride. In contrast, molecular size of the purified GalNAc4ST was quite different from that of the recombinant GalNAc4ST; molecular size of the purified GalNAc4ST was 128 kDa on SDS-PAGE (35), whereas molecular mass of the recombinant GalNAc4ST calculated from the cDNA was 48,831. Such a discrepancy in molecular size may be explained by a hypothesis that the purified GalNAc4ST might be present as a dimer. The protein deduced from the GalNAc4ST cDNA potentially bears four N-linked oligosaccharide chains (Fig. 1A). C4ST also contains four potential glycosylation sites (21), and the contents of N-linked oligosaccharide of the purified C4ST was estimated as 35% as judged from the decrease in molecular size after digestion with N-glycosidase F (20). If the content of N-linked oligosaccharides of the GalNAc4ST is nearly equal to that of C4ST, molecular size of the glycosylated form of the recombinant GalNAc4ST could be estimated as about 64 kDa. This value is just a half of the molecular size reported for the purified GalNAc4ST. Alternatively, GalNAc4ST expressed in the pituitary and GalNAc4ST present in the submaxillary gland may be quite distinct from each other.

Molecular size of the purified carbonic anhydrase VI was 41 kDa as judged from the mobility on SDS-PAGE (Fig. 4). This value seems to be slightly smaller than the molecular size previously reported (50). After digestion with N-glycosidase F, molecular size was decreased to 35 kDa, which is nearly the same as that previously reported; therefore, the difference in the molecular size of the intact carbonic anhydrase VI might be attributable to the heterogeneity in the glycosylation.

We found pNP-GalNAc served as an acceptor for the recombinant GalNAc4ST. pNP-GalNAc was reported to inhibit pituitary GalNAc4ST (34), but it has not been examined whether this material could serve as acceptor for the pituitary or submaxillary GalNAc4ST. Comparison of the hydropathy plot between GalNAc4ST and C4ST revealed that GalNAc4ST, but not C4ST, had a cluster of hydrophobic amino acid residues (Val208-Ala216) near the 5'-PSB (Fig. 1). The presence of the hydrophobic region might contribute to the recognition of hydrophobic aglycon bound to the targeted GalNAc residue such as the p-nitrophenyl group or GlcNAc residue. We found that the recombinant GalNAc4ST failed to transfer sulfate to a undecasaccharide prepared from chondroitin by the digestion with hyaluronidase and beta -glucuronidase (data not shown). The penultimating hydrophilic GlcA residue contained in the undecasaccharide might inhibit the recognition of nonreducing terminal GalNAc residue by GalNAc4ST. We previously found that C6ST-containing microsomal fraction of chick embryo chondrocytes catalyzed sulfation of position 6 of the GalNAc residue of pNP-GalNAc (46), but unlike the sulfation with GalNAc4ST, 6-sulfation by the microsomal fraction was markedly inhibited by the addition of detergent.

By BLAST search, we obtained human genomic clones located to chromosome 19q13.1 that contained identical sequence with the cDNA of GalNAc4ST. Genomic organization constructed from these genomic clones showed that there were at least four exons; start ATG codon and terminal TGA codon were found in the second exon and the fourth exon, respectively (Fig. 11). Nucleotide sequences of the exon-intron junctions fitted the consensus sequence except for 5'-terminal of the first exon, suggesting that the GalNAc4ST cDNA did not contain the sequence of 5'-terminal region of the first exon. PAPS-binding domains (5'-PSB and 3'-PB) were both present in the fourth exons.



View larger version (16K):
[in this window]
[in a new window]
  		Fig. 11.   Putative genomic organization of GalNAc4ST gene. Human genomic clones (accession numbers AC010510, AC007205, and AC005615) located on chromosome 19q13.1 were found to contain nucleotide sequences identical to the sequence of GalNAc4ST cDNA. From these genomic clones, GalNAc4ST gene was found to be composed of at least four exons. A, exons are indicated by boxes and introns are indicated by lines. Closed boxes represent the coding sequence and open boxes indicate 5'- and 3'-untranslated sequence. The lateral lengths of boxes and lines are roughly proportional to the number of nucleotides. ATG, TGA, and poly(A) indicate initiation codon, termination codon, and the presumptive polyadenylation signal, respectively. B, nucleotide sequences of the exon-intron junctions. Nucleotide sequences of exon and intron were indicated by uppercase and lowercase, respectively. Numbers under the sequences represent the nucleotide number indicated in Fig. 1A.



    FOOTNOTES

* This work was supported by grants-in-aid for Scientific Research on Priority Areas No. 10178102 and grants-in-aid for Scientific Research No. 12680610 from the Ministry of Education, Science, Sports and Culture of Japan, grants-in-Aid of Mizutani Foundation for Glycoscience, and by a special research fund from Seikagaku Corporation.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EMBL Data Bank with accession number(s) AB047801.

§ Present address: Dept. of Perinatology and Neuroglycoscience, Institute for Developmental Research, Kasugai, Aichi 480-0392, Japan

|| To whom correspondence should be addressed: Dept. of Life Science, Aichi University of Education, Kariya, Aichi 448-8542, Japan. Fax: 81-566-26-2649; E-mail: ohabuchi@auecc.aichi-edu.ac.jp.

Published, JBC Papers in Press, September 21, 2000, DOI 10.1074/jbc.M007983200


    ABBREVIATIONS

The abbreviations used are: C6ST, chondroitin-6-sulfotransferase; C4ST, chondroitin-4-sulfotransferase; GalNAc4ST, GalNAc 4-sulfotransferase; PAPS, 3'-phosphoadenosine 5'-phosphosulfate; GlcA, D-glucuronic acid; IdoA, L-iduronic acid; Delta Di-0S, 2-acetamide-2-deoxy-3-O-(beta -D-gluco-4-enepyranosyluronic acid)-D-galactose; Delta Di-4S, 2-acetamide-2-deoxy-3-O-(beta -D-gluco-4-enepyranosyluronic acid)-4-O-sulfo-D-galactose; Delta Di-6S, 2-acetamide-2-deoxy-3-O-(beta -D-gluco-4-enepyranosyluronic acid)-6-O-sulfo-D-galactose; Delta Di-diSD, 2-acetamide-2-deoxy-3-O-(2-O-sulfo-beta -D-gluco-4-enepyranosyluronic acid)-6-O-sulfo-D-galactose; Delta Di-diSE, 2-acetamide-2-deoxy-3-O-(beta -D-gluco-4-enepyranosyluronic acid)-4,6-bis-O-sulfo-D-galactose; pNP-GalNAc, p-nitrophenyl-beta -D-GalNAc; pNP-GlcNAc, p-nitrophenyl-beta -D-GlcNAc; HPLC, high performance liquid chromatography; SSPE, sodium chloride/sodium phosphate/EDTA buffer; 5'-PSB, 5'-phosphosulfate-binding domain; 3'-PB, 3'-phosphate-binding domain; PCR, polymerase chain reaction; PAGE, polyacrylamide gel electrophoresis; MES, 2-(N-morpholino)ethanesulfonic acid.


    REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES


1. Brockhausen, D., and Kuhns, W. (1997) Trends Glycosci. Glycotech. 9, 379-398
2. Habuchi, H., Suzuki, S., Saito, T., Tamura, T., Harada, T., Yoshida, K., and Kimata, K. (1992) Biochem. J. 285, 805-813
3. Turnbull, J. E., Fernig, D. G., Ke, Y., Wilkinson, M. C., and Gallagher, J. T. (1992) J. Biol. Chem. 267, 10337-10341
4. Imai, Y., Lasky, L. A., and Rosen, S. D. (1993) Nature 361, 555-557
5. Tsuboi, S., Isogai, Y., Hada, N., King, J. K., Hindsgaul, O., and Fukuda, M. (1996) J. Biol. Chem. 271, 27213-27216
6. Galustian, C., Lawson, A. M., Komba, S., Ishida, H., Kiso, M., and Feizi, T. (1997) Biochem. Cell Biol. Commun. 240, 748-751
7. Mitsuoka, C., Sawada-Kasugai, M., Ando-Furui, K., Izawa, M., Nakanishi, H., Nakamura, S., Ishida, H., Kiso, M., and Kannagi, R. (1998) J. Biol. Chem. 273, 11225-11233
8. Kimura, N., Mitsuoka, C., Kanamori, A., Hiraiwa, N., Uchimura, K., Muramatsu, T., Tamatani, T., Kansas, G. S., and Kannagi, R. (1999) Proc. Natl. Acad. Sci. U. S. A. 96, 4530-4535
9. Bistrup, A., Bhakta, S., Lee, J. K., Belov, Y. Y., Gunn, M. D., Zuo, F-R., Huang, C-C., Kannagi, R., Rosen, S. D., and Hemmerich, S. (1999) J. Cell Biol. 145, 899-910
10. Hiraoka, N., Petryniak, B., Nakayama, J., Tsuboi, S., Suzuki, M., Yeh, J. C., Izawa, D., Tanaka, T., Miyasaka, M., Lowe, J. B., and Fukuda, M. (1999) Immunity 11, 79-89
11. Nair, S. M., and Jungalwala, F. B. (1997) J. Neurochem. 68, 1286-1297
12. Fiete, D., Srivastava, V., Hindsgaul, O., and Baenziger, J. U. (1991) Cell 67, 1103-1110
13. Fiete, D., and Baenziger, J. U. (1997) J. Biol. Chem. 272, 14629-14637
14. Habuchi, O. (2000) Biochim. Biophys. Acta 1474, 115-127
15. Honke, K., Tsuda, M., Hirahara, Y., Ishii, A., Makita, A., and Wada, Y. (1997) J. Biol. Chem. 272, 4864-4868
16. Bakker, H., Friedmann, I., Oka, A., Kawasaki, T., Nifant'ev, N., Schachner, M., and Mantei, N. (1997) J. Biol. Chem. 272, 29942-29946
17. Ong, E., Yeh, J-C., Ding, Y., Hindsgaul, O., and Fukuda, M. (1998) J. Biol. Chem. 273, 5190-5195
18. Habuchi, O., Matsui, Y., Kotoya, Y., Aoyama, Y., Yasuda, Y., and Noda, M. (1993) J. Biol. Chem. 268, 21968-21974
19. Fukuta, M., Uchimura, K., Nakashima, K., Kato, M., Kimata, K., Shinomura, T., and Habuchi, O. (1995) J. Biol. Chem. 270, 18575-18580
20. Yamauchi, S., Hirahara, Y., Usui, H., Takeda, Y., Hoshino, M., Fukuta, M., Kimura, J. H., and Habuchi, O. (1999) J. Biol. Chem. 274, 2456-2463
21. Yamauchi, S., Mita, S., Matsubara, T., Fukuta, M., Habuchi, H., Kimata, K., and Habuchi, O. (2000) J. Biol. Chem. 275, 8975-8981
22. Habuchi, O., Hirahara, Y., Uchimura, K., and Fukuta, M. (1996) Glycobiology 6, 51-57
23. Habuchi, O., Suzuki, Y., and Fukuta, M. (1997) Glycobiology 7, 405-412
24. Fukuta, M., Inazawa, J., Torii, T., Tsuzuki, K., Shimada, E., and Habuchi, O. (1997) J. Biol. Chem. 272, 32321-32328
25. Torii, T., Fukuta, M., and Habuchi, O. (2000) Glycobiology 101, 203-211
26. Uchimura, K., Muramatsu, H., Kadomatsu, K., Fan, Q-W., Kurosawa, N., Mitsuoka, C., Kannagi, R., Habuchi, O., and Muramatsu, T. (1998) J. Biol. Chem. 273, 22577-22583
27. Hiraoka, N., Nakagawa, H., Ong, E., Akama, T., Fukuda, M. N., and Fukuda, M. (2000) J. Biol. Chem. 275, 20188-20196
28. Green, E. D., van Halbeek, H., Boime, I., and Baenziger, J. U. (1985) J. Biol. Chem. 260, 15623-15630
29. Green, E. D., and Baenziger, J. U. (1988) J. Biol. Chem. 263, 25-35
30. Green, E. D., and Baenziger, J. U. (1988) J. Biol. Chem. 263, 36-44
31. Skelton, T. P., Kumar, S., Smith, P. L., Beranek, M. C., and Baenziger, J. U. (1992) J. Biol. Chem. 267, 12998-13006
32. Hooper, L. V., Beranek, M. C., Manzella, S. M., and Baenziger, J. U. (1995) J. Biol. Chem. 270, 5985-5993
33. Baenziger, J. U., Kumar, S., Brodbeck, R. M., Smith, P. L., and Beranek, M. C. (1992) Proc. Natl. Acad. Sci. U. S. A. 89, 334-338
34. Skelton, T. P., Hooper, L. V., Srivastava, V., Hindsgaul, O., and Baenziger, J. U. (1991) J. Biol. Chem. 266, 17142-17150
35. Hooper, L. V., Hindsgaul, O., and Baenziger, J. U. (1995) J. Biol. Chem. 270, 16327-16332
36. Delfert, D. M., and Conrad, H. E. (1985) Anal. Biochem. 148, 303-310
37. Malet, C., and Hindsgaul, O. (1997) Carbohydr. Res. 303, 51-65
38. Habuchi, O., and Miyata, K. (1980) Biochim. Biophys. Acta 616, 208-217
39. Nagasawa, K., Inoue, Y., and Tokuyasu, T. (1995) J. Biochem. 86, 1323-1329
40. Sundaram, V., Rumbolo, P., Grubb, J., Strisciuglio, P., and Sly, W. S. (1986) Am. J. Hum. Genet. 38, 125-136
41. Feinberg, A. P., and Vogelstein, B. (1983) Anal. Biochem. 132, 6-13
42. Aruffo, A. (1991) in Current Protocols in Molecular Biology (Ausubel, F. M. , Brent, R. , Kingston, R. E. , Moore, D. D. , Seidman, J. A. , Smith, J. A. , and Struhl, K., eds), Vol. pp , pp. 16.13.1-16.13.7, John Wiley & Sons, New York
43. Laemmli, U. K. (1970) Nature 227, 680-685
44. Bradford, M. (1976) Anal. Biochem. 72, 248-254
45. Okuda, T., Mita, S., Yamauchi, S., Matsubara, T., Yagi, F., Yamamori, D., Fukuta, M., Kuroiwa, A., Matsuda, Y., and Habuchi, O. (2000) J. Biochem. 128, 763-770
46. Habuchi, O., and Conrad, H. E. (1995) J. Biol. Chem. 260, 13102-13108
47. Shworak, N. W., Liu, J., Fritze, L. M. S., Schwartz, J. J., Zhang, L., Logeart, D., and Rosenberg, R. D. (1997) J. Biol. Chem. 272, 28008-28019
48. Liu, J., Shworak, N. W., Sinay, P., Schwartz, J. J., Zhang, L., Fritze, L. M. S., and Rosenberg, R. D. (1999) J. Biol. Chem. 274, 5185-5192
49. Habuchi, H., M., Tanaka, M., Habuchi, O., Yoshida, K., Suzuki, H., Ban, K., and Kimata, K. (2000) J. Biol. Chem. 275, 2859-2868
50. Fernley, R. T., Coghlan, J. P., and Wright, R. D. (1988) Biochem. J. 249, 201-207
51. Kyte, J., and Doolittle, R. F. (1982) J. Mol. Biol. 157, 105-132

Copyright © 2000 by The American Society for Biochemistry and Molecular Biology, Inc.
Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
 J. Biol. Chem.Home page
Y. Kizuka, T. Matsui, H. Takematsu, Y. Kozutsumi, T. Kawasaki, and S. Oka
Physical and Functional Association of Glucuronyltransferases and Sulfotransferase Involved in HNK-1 Biosynthesis
J. Biol. Chem., May 12, 2006; 281(19): 13644 - 13651.
[Abstract] [Full Text] [PDF]