| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
J. Biol. Chem., Vol. 275, Issue 52, 40897-40903, December 29, 2000
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
,¶
From the University Medical Center of
Utrecht, Department of Physiological Chemistry and Centre for
Biomedical Genetics, Utrecht 3584 CG, The Netherlands and
§ European Molecular Biology Laboratory, c/o DESY,
Notkestraße 85, D22603 Hamburg, Germany
Received for publication, June 30, 2000, and in revised form, September 14, 2000
 |
ABSTRACT |
|---|
 TOP
 ABSTRACT
 INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
|
|---|
The adenovirus DNA-binding protein (DBP) binds
cooperatively to single-stranded DNA (ssDNA) and stimulates both
initiation and elongation of DNA replication. DBP consists of a
globular core domain and a C-terminal arm that hooks onto a neighboring DBP molecule to form a stable protein chain with the DNA bound to the
internal surface of the chain. This multimerization is the driving
force for ATP-independent DNA unwinding by DBP during elongation. As
shown by x-ray diffraction of different crystal forms of the C-terminal
domain, the C-terminal arm can adopt different conformations, leading
to flexibility in the protein chain. This flexibility is a function of
the hinge region, the part of the protein joining the C-terminal arm to
the protein core. To investigate the function of the
flexibility, proline residues were introduced in the hinge region, and
the proteins were purified to homogeneity after baculovirus expression.
The mutant proteins were still able to bind ss- and double-stranded DNA
with approximately the same affinity as wild type, and the binding to
ssDNA was found to be cooperative. All mutant proteins were able to
stimulate the initiation of DNA replication to near wild type levels.
However, the proline mutants could not support elongation of DNA
replication efficiently. Even the elongation up to 26 nucleotides was
severely impaired. This defect was also seen when DNA unwinding was
studied. Binding studies of DBP to homo-oligonucleotides showed an
inability of the proline mutants to bind to
poly(dA)40, indicating an inability to adapt to
specific DNA conformations. Our data suggest that the flexibility of
the protein chain formed by DBP is important in binding and unwinding
of DNA during adenovirus DNA replication. A model explaining the need
for flexibility of the C-terminal arm is proposed.
Adenovirus DNA replication can be reconstituted in
vitro, using three viral proteins, adenovirus DNA polymerase
(pol),1 precursor terminal
protein (pTP), and the DNA-binding protein (DBP). Optimal replication
efficiency is obtained when two cellular transcription factors are
added, nuclear factor I (NFI) and Oct 1 (for reviews see Refs.
1-3).
The adenoviral dsDNA genome contains two terminal proteins (TP)
covalently linked to the 5' ends. The inverted terminal repeats contain
the origins of replication. pTP and pol are tightly associated in
solution. During initiation of replication pTP functions as a primer to
which the first nucleotide, dCTP, is covalently coupled. Both NFI and
Oct 1 stimulate the initiation by recruiting the pTP-pol complex to the
origin of replication (4-7). Initiation starts opposite position 4 of
the template strand. After formation of a pTP-trinucleotide (pTP-CAT)
(8), the complex jumps back and CAT becomes paired with template
residues 1-3. Shortly after jumping back, the polymerase dissociates
from pTP and elongation proceeds via strand displacement (9).
DBP has several functions during the adenovirus life cycle. Besides DNA
replication, the protein is involved in transcriptional control and
mRNA stability (10, 11), transformation (12), virion assembly (13),
and determination of the host range (14, 15).
DBP performs several functions in DNA replication. During initiation,
it stimulates directly the formation of a pTP-CAT intermediate by
lowering the Km value of the reaction (16), possibly via a direct interaction with the pTP-pol complex. Indirectly, DBP
stimulates initiation by increasing the binding of NFI to the origin
(17-19). The stimulation of initiation by DBP is most pronounced at
low pTP-pol concentrations, suggesting a role of DBP in recruitment of
the pTP-pol complex to the origin. Furthermore, DBP plays an essential
role during the elongation phase of DNA replication, where it helps to
unwind the parental strand (20) and enhances the processivity of the
polymerase (17). This is achieved by cooperative binding to the
displaced strand during replication, thereby protecting it from
nuclease digestion and facilitating strand displacement. Strand
displacement is ATP-independent and requires only the helix DNA
unwinding activity of DBP, unlike helicase activity, which does require
ATP (21-23). Finally, DBP enhances the renaturation of complementary
displaced strands (20).
The crystal structure of the C-terminal domain of DBP (amino acids
174-529,
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
N-DBP) has been solved (24). This region contains the DNA
binding domain and is functional in in vitro assays
(25-27). The protein is mainly globular except for the last 17 amino
acids, which form a protruding arm. This C-terminal arm binds to a
hydrophobic cleft of another DBP molecule, allowing protein chain
formation which is essential for the function of DBP in elongation and
cooperative binding on ssDNA as shown by deletion studies (28) (Fig.
1B). A second crystal
structure of N-DBP has been described, which superimposes except for
the C-terminal arm (Fig. 1) (29). Comparison of the structure of the
last 17 amino acids of the crystal forms 1 and 2 demonstrates a
difference in the arrangement of residues Asn512-Leu515, called the hinge region.
Further investigations have revealed amino acids Asn512 and
Ser514 to be responsible mainly for the conformational
changes. The ability of the C-terminal arm to adopt several
orientations suggests that the DBP protein chain is flexible and can
adopt different arrangements. This effect could explain different
estimations of the length of the binding sites found for different
homopolynucleotides (29, 30).
View larger version (32K):
[in a new window]
Fig. 1.
Structure of DBP. A, crystal
structures I and II of the C-terminal fragment of DBP (aa 174-529,
N-DBP) are shown with different orientations of their C-terminal arm
(29). The difference lies in the arrangement of residues
Asn512-Leu515 (N512
L515,
encircled), called the hinge region. B, DBP
monomers form a multimer. The C-terminal arm of one monomer hooks into
the hydrophobic cleft of the second monomer and so on leading to a
protein chain. Only the dimer is shown (29).
Here we have studied the role of the flexibility of the C-terminal arm
in ssDNA binding and DNA replication using DBP with mutations in the
hinge region that are expected to lead to reduced flexibility. We find
that the proline mutations severely impair the capability of DBP to
sustain elongation and to unwind DNA, although protein chain formation
is still possible. This indicates that flexibility of the protein chain
is essential for its function, possibly by enabling adaptation to
different DNA conformations.
| |
EXPERIMENTAL PROCEDURES |
|---|
|
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
|
|---|
Construction of Mutants--
The hinge mutants were prepared by
PCR in two steps from the adenovirus 5 N-DBP (amino acids 174-529)
gene (31) in the pVL1392 baculovirus vector. In the first step
the 5' primer was TTTAGATCTTCATGAGTGTGCCGATCGTGTCTGC and the 3' primers
were CGCGCATCGCTATGCGCCACTGGCAGGGACACGGGGCGATACT, CGCGCATCGCTATGCGCCACTGGCAGGGACAGGTTGCGATA, and
CGCGCATCGCTATGCGCCACTGGCAGGGGAGGTGGGCGATACT for the
N512P, V513L, and NVS512-514PPP
mutants (changes in bold), respectively. In the second PCR step the
generated PCR product was, in each case, annealed with the 3' end of a
common 3' primer GGCACGAATTCTCAAAAATCAAAGGGGTTCTGCCGCGCATCGCTATGCGCCAC, and the DNA was amplified using the same 5' primer as above.
In each case the constructs were prepared by isolating, purifying, and
annealing three DNA fragments as follows: (a) the
pVL1392-N-DBP vector processed with EagI (cleavage site
at position 128) and opened 3' with EcoRI; (b)
this fragment further cut with BanI (cleavage site at
position 897) to yield the EagI-BanI piece; and
(c) the second PCR product digested with BanI and
EcoRI. The third fragment (containing the mutations) was
sequenced to check the correctness of the construct.
C-DBP (aa 174-511) was constructed and purified as described by
Dekker et al. (28).
Purification of N-DBP and Mutant DBP from Baculovirus-infected
Cells--
Monolayers of SF9 cells were infected with recombinant
baculoviruses at 28 °C for 72 h. The titer giving optimal
protein expression levels was determined beforehand in pilot
experiments. The purification of wild type and mutant DBP was as
follows. Cells were harvested, washed twice with PBS, and resuspended
in 50 mM Tris-Cl (pH 8.0), 5 mM KCl, 1 mM DTT, 1 mM PMSF, 500 mM NaCl, and
0.5 mM MgCl2 followed by homogenizing using a
Dounce homogenizer. The solution was clarified by centrifugation at
60,000 × g for 30 min at 4 °C. The supernatant was
diluted in DEAE buffer, 25 mM Tris-Cl (pH 8.0), 1 mM DTT, 0.1 mM PMSF, 1 mM EDTA,
20% glycerol, to lower the salt concentration to 100 mM.
The diluted supernatant was loaded on a DEAE-FF-Sepharose column
equilibrated in DEAE buffer containing 200 mM NaCl. The flow-through was applied to an ssDNA-cellulose column equilibrated in
10 mM Tris-Cl (pH 8.0), 1 mM DTT, 0.1 mM PMSF, 20% glycerol, and 50 mM NaCl (ssDNA
buffer). The column was washed in buffer containing 500 mM
NaCl, and the protein was eluted with buffer containing 2 M
NaCl. The protein was dialyzed to 100 mM against 25 mM Hepes-KOH (pH 8.0), 100 mM NaCl. To
concentrate the protein, the solution was loaded on a MonoS1 FPLC
column equilibrated with 25 mM Hepes-KOH (pH 8.0), 20%
glycerol, and 80 mM NaCl and developed with a linear
gradient of 80-600 mM NaCl. The proteins eluted around 200 mM and were shown to be at least 95% homogeneous as judged
by SDS-polyacrylamide gel electrophoresis and Coomassie staining.
DNA Binding Assays--
For the ssDNA electrophoretic mobility
shift assay, a 114-bp EcoRI/XbaI fragment from
pHRI was Klenow end-labeled in the presence of
[
-32P]dCTP and denatured by boiling. The dsDNA assays
were performed with a 50-nt dsDNA oligonucleotide (TD50), containing
the first 50 base pairs of the Ad5 origin.
Binding assays were performed in a final volume of 20 µl of buffer
containing 20 mM Hepes-KOH (pH 8.0), 100 mM
NaCl, 4 mM MgCl2, 0.4 mM DTT, 4%
Ficoll, 1 µg of bovine serum albumin, 0.05 ng of denatured DNA or
dsDNA, and the indicated amounts of N-DBP or mutants. Bound and free
DNAs were separated on a 10% polyacrylamide gel at room temperature.
The running buffer contained 0.5 TBE and 0.01% Nonidet P-40.
Gels were dried and quantified using a PhosphorImager Storm 820 from
Molecular Dynamics with ImageQuaNT 4.2a, Build 13 software. The
concentration at which 50% of the ssDNA is complexed with DBP is used
as a measure of the ssDNA binding affinity. A more accurate calculation
as described by Verrijzer et al. (32) was not possible since
binding of DBP to ssDNA is cooperative and does not fit a normal
Scatchard plot.
DNA Unwinding-- DNA unwinding assays were performed using a partially double-stranded oligonucleotide consisting of the last 50 bases of the template strand of the adenoviral origin of replication, hybridized with an oligonucleotide containing the complementary bases 15-50 from the displaced strand, thereby creating a dsDNA oligonucleotide with a 3' (template) 15-base pair single-stranded overhang. Both strands were 5'-labeled prior to hybridization. DNA (0.5 ng) and indicated amounts of DBP or mutant forms of DBP were incubated for 1 h at 30 °C in a total volume of 25 µl in a buffer containing 25 mM Hepes-KOH (pH 8.0), 1 mM DTT, 0.1 mM PMSF, 20% glycerol, 0.02% Nonidet P-40, 0.5 mM EDTA, 1 µg of bovine serum albumin, and 100 mM NaCl. Reactions were stopped by addition of 5 µl of 40% sucrose, 1.2% SDS, and 0.1% bromphenol blue and 0.1% xylene cyanol. Products were analyzed on a 12.5% SDS-polyacrylamide gel using a running buffer containing 1 TBE and 0.2% SDS. Gels were dried and quantified using a PhosphorImager.
DNA Replication on TP-DNA--
The pTP-pol complex was purified
as described (8). Terminal protein containing Ad5 DNA (TP-DNA) was
obtained as described (33). Adenovirus DNA replication was performed in
a final reaction volume of 25 µl in the presence of 25 mM
Hepes-KOH (pH 7.5), 50 mM NaCl, 1.5 mM NaCl,
1.5 mM MgCl2, 1 mM DTT, 500 nM [-32P]dCTP, and 40 µM
dATP, dTTP, and dGTP, and 30 ng of TP-DNA cut with XhoI. 140 ng of pTP-pol was added to the reaction. The amounts of N-DBP and
mutants are indicated in the legends. After incubation for 45 min at
37 °C reactions were stopped by addition of 2.8 µl of stop mix
(40% sucrose, 1% SDS, 0.1% bromphenol blue, 0.1% xylene cyanol).
Replication products were analyzed on a 1% agarose gel. Gels were
dried followed by autoradiography. Replication products were quantified
by densitometric analysis using a PhosphorImager.
Initiation and Partial Elongation of DNA
Replication--
Initiation of replication on TP-DNA was performed in
a final reaction volume of 25 µl in the presence of 25 mM
HEPES-KOH (pH 7.5), 50 mM NaCl, 1.5 mM
MgCl2, 1 mM DTT, 50 nM
[-32P]dCTP, 90 ng of Ad5 TP-DNA, and 50 ng of pTP-pol.
When partial elongation was performed extra 1 µM dCTP, 1 µM dATP, 1 µM dTTP, and 5 µM
ddGTP together with 100 ng of pTP-pol and 26 nM
[-32P]dCTP were added. The amounts of N-DBP and
mutants are indicated in the legends. Reactions were performed at
37 °C for TP-DNA and at 30 °C when a synthetic oligonucleotide
was used. After 45 min the reactions were stopped by addition of 80 mM EDTA. The samples were precipitated with 20%
trichloroacetic acid for 30 min on ice. Precipitates were washed with
5% trichloroacetic acid, resolved in sample buffer, and analyzed on an
SDS-7.5% polyacrylamide gel and autoradiographed. Initiation products
were quantified by densitometric analysis using a PhosphorImager.
| |
RESULTS |
|---|
|
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
|
|---|
The Hinge Mutants Bind ss- and dsDNA with Approximately Wild
Type-like Affinity--
N-DBP (wild type) and the mutants N512P
(P-DBP), V513L (L-DBP), and NVS512-514PPP (PPP-DBP) were purified and
assayed for their ability to bind to ss- and dsDNA as shown in Fig.
2. All proteins bound cooperatively to
ssDNA resulting in fully saturated protein-DNA complexes without
intermediate complexes (Fig. 2A). Multiple intermediate
complexes can be seen when C-DBP was used in this assay (Fig.
2B). C-DBP lacks the C-terminal arm and is therefore not
able to form multimers on ssDNA, resulting in the loss of cooperative
binding (28). To estimate the binding affinity, the concentration
required to shift 50% of the probe was determined after quantification
(Table I). All proteins bound to ssDNA
with approximately wild type affinity. The slight differences in
binding affinity for the different mutants are not significant in view of the scattering of the data around the 50% shift point.
|
|
The binding of the mutants to a 50-base pair dsDNA probe is shown in Fig. 2C. All three mutants were able to bind to dsDNA with wild type affinity. Binding to dsDNA is not cooperative for DBP, and therefore intermediate complexes can be found in this assay. We assume that the band with the slowest migration is fully saturated, whereas the fastest migrating band contains only 1 monomer. However, we have not studied the stoichiometry of the bands in detail. The lack of cooperativity also leads to a lower binding affinity that is reflected by the higher concentration of proteins needed to obtain a shifted complex (35).
The Hinge Mutants, in Particular PPP-DBP, Are Defective in
Stimulating DNA Replication--
We tested the hinge mutants for their
activity to support DNA replication in an in vitro assay,
see Fig. 3A. Ad5 DNA isolated from virus particles and containing the terminal protein was digested with XhoI and used as template. The reaction was carried out
in the presence of pTP-pol, NFI, Oct 1, radiolabeled dNTPs, and
increasing amounts of wild type or mutant DBP. Analysis of the products
on agarose gels shows specific labeling of two restriction fragments, B
and C, containing the origin of replication. In addition two labeled
fragments migrating with higher mobility are observed which contain
ssDNA. These originate from second rounds and further of displacement
synthesis, indicative of effective template usage (Fig. 3B).
Quantitation of the total DNA replication activity, the 1st as well as
further rounds together, was performed and compared for the 500 (lanes 3, 7, 11, and 14) and 1000 ng (4, 8, 12, and 15) lanes. P-DBP had a slightly lowered
replication activity (4.2- to 1.1-fold), whereas PPP-DBP had a 100- to
50-fold decrease in activity and could hardly support any replication. L-DBP behaved wild type-like with a slight decrease in activity (1.4-fold) at 500 ng. The differences in activity are most prominent at
low protein concentrations.
|
To test whether the loss of activity for PPP-DBP is due to the presence
of inhibitors in the protein solution, a control was performed by
mixing in PPP-DBP in a N-DBP replication (lane 18). Inhibition of DNA replication was not detected. Lane 17, the
negative control (no DBP), contains some background bands, caused by
aspecific labeling of all XhoI TP-DNA fragments not related
to protein-primed replication.
The Hinge Mutants Stimulate Initiation but Are Defective in Early Elongation-- To test whether the observed decrease in replication efficiency is due to reduced initiation levels, an initiation assay was performed. The first step in initiation is the covalent coupling of dCTP to the pTP of the pTP-pol complex. This reaction is enhanced considerably by DBP when the pTP-pol concentration is low (28)
A low amount of pTP-pol (50 ng) was incubated together with TP-DNA and
dCTP. The stimulation of pTP-C formation was determined for two DBP
concentrations (250 and 500 ng) (Fig.
4A). Without DBP only a low
level of initiation was observed (1%). L-DBP and P-DBP stimulated the
initiation like wild type with activities ranging from 86 to 116%. For
a quantitation see Fig. 4A. The stimulation by PPP-DBP was
slightly lower (25-36%) but was still considerable.
|
To distinguish between defects during the initiation and elongation
phase, we performed a partial elongation. This leads to the formation
of a pTP-CAT initiation intermediates (8) as well as a pTP-26
nucleotide product indicative of early elongation (Fig. 4B).
The elongation to initiation ratio was calculated after quantitation
(Fig. 4B). This ratio is indicative of the ability to
stimulate the elongation by DBP. Whereas N-DBP as well as L-DBP and
P-DBP were all able to stimulate elongation efficiently, PPP-DBP was
deficient indicating that stimulation of elongation is already
inhibited at an early stage of elongation.
The pTP-CAT formation is slightly stimulated by all mutant DBPs, but the absolute rate of stimulation is lower that in Fig. 4A, due to the higher pTP-pol (100 ng) concentration, and for PPP-DBP the increase is minimal as this mutant is already less efficient stimulating initiation (Fig. 4A).
For N-DBP the pTP-CAT formation decreases at the highest amount of
protein (1000 ng), due to efficient elongation of this intermediate.
For L- and P-DBP, however, no decrease in pTP-CAT formation was
observed, presumably since higher protein concentrations are required
for optimal stimulation of elongation by these mutants.
A small band below the pTP-C and pTP-26n products was also observed, presumably due to degradation of pTP.
Unwinding of DNA Correlates with the Reduction in DNA Replication
Activity--
During elongation, DBP destabilizes dsDNA and
facilitates elongation of the DNA polymerase. The unwinding of dsDNA is
ATP-independent and only DBP is required, cooperative binding of the
DBP monomers to the displaced strand being the driving force (21-23).
Defects in unwinding will therefore result in diminished, or loss of, replication activity. An unwinding assay was performed with a partial
duplex DNA (TD15) to investigate the unwinding activity of DBP and the
hinge mutants (Fig. 5A). The
percentages of unwinding were calculated and presented in Fig.
5B. All proteins were able to unwind TD15, but the activity
of the hinge mutants was diminished as higher protein concentrations
were required. The differences in unwinding activity were calculated
from the slope of the curves. Most prominent was the decrease of
unwinding activity for PPP-DBP (125-fold), whereas the reductions for
L- and P-DBP were 1.25- and 23-fold, respectively (Fig.
5B). The decrease in unwinding activity for PPP-DBP can
account for the large decrease found in the DNA replication activity
during the elongation phase.
|
Binding to Poly(dA)40 Is Diminished for P- and
PPP-DBP--
Both the unwinding and replication assays show large
differences in activity for the hinge mutants, with L-DBP behaving like wild type, P-DBP having an intermediate effect, and PPP-DBP being most
severely impaired. An explanation for these results could be that the
flexibility of the C-terminal arm is gradually reduced. This could lead
to a change in the multiprotein chain making adaptation to rigid or
irregularly shaped DNA more difficult. To investigate this, we tested
the proteins for binding to homo-oligonucleotides containing either 40 A, T, C, or G residues. Binding to poly(dT)40, (dC)40, and (dG)40 showed only small
differences and are not shown. In contrast, P- and PPP-DBP are unable
to bind to poly(dA)40 efficiently (Fig.
6). The highest concentration used in
Fig. 6 was 40 ng for P- and PPP-DBP. No binding of P- and PPP-DBP could
be found up to 1000 ng (data not shown). This suggests that reduction
of the flexibility of the C-terminal arm can result in loss of the
ability to bind particular sequences, possibly caused by the presence of aberrant secondary or tertiary structures in these homopolymers.
|
| |
DISCUSSION |
|---|
|
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
|
|---|
Reduction of the Flexibility of the C-terminal Arm Does Not Result
in Loss of ss- and dsDNA Binding--
The ss- and dsDNA binding
capabilities of the hinge mutants were not significantly reduced. This
is in contrast with deletion of the C-terminal arm (C-DBP), which
leads to a 100-fold reduction in ssDNA binding, whereas no change in
dsDNA binding is detectable (28, 34). This has been explained by the
lack of cooperativity in C-DBP. Since the cooperative binding is not
lost in the hinge mutants, this strongly suggests that the hinge
mutants are still able to form multimers on DNA. Direct assays to test
this (electron microscopy with negative staining and dynamic light
scattering) were inconclusive perhaps due to aggregation problems.
A small decrease in ssDNA binding was found for P- and PPP-DBP. A low resolution crystal structure of DBP complexed with ssDNA shows that although Asn512 approaches the DNA, it is unlikely to make any interaction with the phosphate backbone (31). Rather than a loss of direct contacts, the slight decrease in binding affinity for ssDNA could be due to the reduced flexibility of the C-terminal arm. Possibly, the mutant protein chain is not able to adapt to certain secondary structures or conformations in the ssDNA strand as indicated by the inability to bind poly(dA) efficiently.
Elongation of Replication Is Dependent on the Flexibility of the
C-terminal Arm--
P-DBP and, in particular, PPP-DBP have a reduced
replication activity. No strong differences in stimulation of
initiation were detected, and direct assays show that the main defect
lies in elongation. This is in agreement with the reduced unwinding. A
similar effect was observed upon deletion of the C-terminal arm (28).
Like PPP-DBP, the C-DBP mutant was still able to stimulate
initiation with a slight reduction in efficiency while being unable to
support replication or DNA unwinding. From this we have concluded
earlier that oligomerization of DBP is the driving force of
ATP-independent DNA unwinding during the elongation phase. Although
this may be true, multimerization apparently is not the only
requirement for DBP to function effectively in elongation. Previously
we showed the need for an intact flexible loop located between aa
Lys296 and aa Ser332 that ensures high affinity
binding to ssDNA (34). Here we suggest yet another requirement,
i.e. the need for flexibility in the protein chain even in
the presence of an intact flexible loop and multimerization
Model--
What could be the function of the flexibility of the
C-terminal arm during elongation and replication fork destabilization? We propose (Fig. 7) that reduction of the
flexibility of the C-terminal arm leads to an inability to hook into a
neighboring DBP molecule when bound to the replication fork. In
particular we assume that a conformational change is required to
accommodate the transition of DBP bound to the double-stranded parental
strands to that when bound to the displaced single strand, which is
situated at the ssDNA part of the replication fork. The high off rate
of DBP on dsDNA coupled to an impairment of the transition will prevent unwinding at the replication fork. Why is multimerization possible when
bound on single-stranded DNA and not in the replication fork? Presumably less mobility exists in the replication fork, compared with
single-stranded DNA.
|
As an addition to the model, binding of a less flexible DBP protein to the displaced strand could also lead to difficulties when AT tracts, hairpins, or other secondary DNA structures are encountered. This might be reflected by the problems in binding poly(dA) which has an aberrant structure and a different binding site for DBP (30, 35).
The model might explain the lack of unwinding by hinge region mutants
during elongation. This situation might also apply to the early stages
of elongation. For stimulation of initiation DBP monomers suffice (28),
but even early in elongation multimerization is required. Although the
conformation of the preinitiation complex and the changes occurring
during transition of initiation to early elongation are unknown, we
assume that the same flexibility of DBP is needed at this stage.
Alternatively, we could envisage the dsDNA breathing and the
irreversible steps that occur when DBP binds cooperatively to the part
unwound by breathing to be slowed down with the mutants. However, we
consider this to be less likely because this effect would mainly
influence unwinding of long stretches of DNA, and we observe already a
block in unwinding with a 35-bp probe.
| |
ACKNOWLEDGEMENTS |
|---|
We thank R. N. de Jong, K. D. Augustijn, and A. B. Brenkman for critical reading of the manuscript.
| |
FOOTNOTES |
|---|
* This work was supported in part by the Netherlands Organization for Scientific Research (NWO) and by European Union Contract FMRX-CT97-0125.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
¶ To whom correspondence should be addressed: Universiteitsweg 100, 3584 CG Utrecht. Tel.: 31 30 2538989; Fax: 31 30 2539035; E-mail: p.c.vandervliet@med.uu.nl.
Published, JBC Papers in Press, October 2, 2000, DOI 10.1074/jbc.M005745200
| |
ABBREVIATIONS |
|---|
The abbreviations used are: pol, polymerase; pTP, precursor terminal protein; TP, terminal proteins; DBP, DNA-binding protein; NFI, nuclear factor I; ssDNA, single-stranded DNA; dsDNA, double-stranded DNA; PCR, polymerase chain reaction; DTT, dithiothreitol; PMSF, phenylmethylsulfonyl fluoride; nt, nucleotide; bp, base pair; aa, amino acids.
| |
REFERENCES |
|---|
|
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
|
|---|
| 1. | Hay, R. T., Freeman, A., Leith, I., Monaghan, A., and Webster, A. (1995) Curr. Top. Microbiol. Immunol. 199, 31-48 |
| 2. | van der Vliet, P. C. (1995) Curr. Top. Microbiol. Immunol. 199, 1-30 |
| 3. | de Jong, R. N., and van der Vliet, P. C. (1999) Gene (Amst.) 236, 1-12 |
| 4. | Bosher, J., Robinson, E. C., and Hay, R. T. (1990) New Biol. 2, 1083-1090 |
| 5. | Chen, M., Mermod, N., and Horwitz, M. S. (1990) J. Biol. Chem. 265, 18634-18642 |
| 6. | Coenjaerts, F. E., and van der Vliet, P. C. (1994) Nucleic Acids Res. 22, 5235-5240 |
| 7. | Dekker, J., van Oosterhout, J. A., and van der Vliet, P. C. (1996) Mol. Cell. Biol. 16, 4073-4080 |
| 8. | King, A. J., and van der Vliet, P. C. (1994) EMBO J. 13, 5786-5792 |
| 9. | King, A. J., Teertstra, W. R., and van der Vliet, P. C. (1997) J. Biol. Chem. 272, 24617-24623 |
| 10. | Zijderveld, D. C., d'Adda, d. F., Giacca, M., Timmers, H. T., and van der Vliet, P. C. (1994) J. Virol. 68, 8288-8295 |
| 11. | Cleghon, V., Voelkerding, K., Morin, N., Delsert, C., and Klessig, D. F. (1989) J. Virol. 63, 2289-2299 |
| 12. | Rubenstein, F. E., and Ginsberg, H. S. (1974) Intervirology 3, 170-174 |
| 13. | Nicolas, J. C., Sarnow, P., Girard, M., and Levine, A. J. (1983) Virology 126, 228-239 |
| 14. | Anderson, C. W., Hardy, M. M., Dunn, J. J., and Klessig, D. F. (1983) J. Virol. 48, 31-39 |
| 15. | Harfst, E., and Leppard, K. N. (1999) Virus Genes 18, 97-106 |
| 16. | Mul, Y. M., and van der Vliet, P. C. (1993) Nucleic Acids Res. 21, 641-647 |
| 17. | Lindenbaum, J. O., Field, J., and Hurwitz, J. (1986) J. Biol. Chem. 261, 10218-10227 |
| 18. | Cleat, P. H., and Hay, R. T. (1989) EMBO J. 8, 1841-1848 |
| 19. | Stuiver, M. H., and van der Vliet, P. C. (1990) J. Virol. 64, 379-386 |
| 20. | Zijderveld, D. C., Stuiver, M. H., and van der Vliet, P. C. (1993) Nucleic Acids Res. 21, 2591-2598 |
| 21. | Pronk, R., Van Driel, W., and van der Vliet, P. C. (1994) FEBS Lett. 337, 33-38 |
| 22. | Monaghan, A., Webster, A., and Hay, R. T. (1994) Nucleic Acids Res. 22, 742-748 |
| 23. | Zijderveld, D. C., and van der Vliet, P. C. (1994) J. Virol. 68, 1158-1164 |
| 24. | Tucker, P. A., Tsernoglou, D., Tucker, A. D., Coenjaerts, F. E., Leenders, H., and van der Vliet, P. C. (1994) EMBO J. 13, 2994-3002 |
| 25. | Ariga, H., Klein, H., Levine, A. J., and Horwitz, M. S. (1980) Virology 101, 307-310 |
| 26. | Friefeld, B. R., Krevolin, M. D., and Horwitz, M. S. (1983) Virology 124, 380-389 |
| 27. | Tsernoglou, D., Tsugita, A., Tucker, A. D., and van der Vliet, P. C. (1985) FEBS Lett. 188, 248-252 |
| 28. | Dekker, J., Kanellopoulos, P. N., Loonstra, A. K., van Oosterhout, J. A., Leonard, K., Tucker, P. A., and van der Vliet, P. C. (1997) EMBO J. 16, 1455-1463 |
| 29. | Kanellopoulos, P. N., Tsernoglou, D., van der Vliet, P. C., and Tucker, P. A. (1996) J. Mol. Biol. 257, 1-8 |
| 30. | van Amerongen, H., van Grondelle, R., and van der Vliet, P. C. (1987) Biochemistry 26, 4646-4652 |
| 31. | Kanellopoulos, P. N., van der Zandt, H., Tsernoglou, D., van der Vliet, P.C., and Tucker, P. A. (1995) J. Struct. Biol. 115, 113-116 |
| 32. | Verrijzer, C. P., Kal, A. J., and van der Vliet, P. C. (1990) Genes Dev. 4, 1964-1974 |
| 33. | Dekker, J., Coenjaerts, F. E., and van der Vliet, P. C. (1996) in Viral Genome Methods (Adoph, K. W., ed) , pp. 269-282, CRC Press, Boca Raton, FL |
| 34. | Dekker, J., Kanellopoulos, P. N., van Oosterhout, J. A., Stier, G., Tucker, P. A., and van der Vliet, P. C. (1998) J. Mol. Biol. 277, 825-838 |
| 35. | Kuil, M. E., van Amerongen, H., van der Vliet, P. C., and van Grondelle, R. (1989) Biochemistry 28, 9795-9800 |
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati What's this?
This article has been cited by other articles:
|
|
 |
|
  M. E. Mysiak, C. Wyman, P. E. Holthuizen, and P. C. van der Vliet NFI and Oct-1 bend the Ad5 origin in the same direction leading to optimal DNA replication Nucleic Acids Res., December 1, 2004; 32(21): 6218 - 6225. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. E. Mysiak, M. H. Bleijenberg, C. Wyman, P. E. Holthuizen, and P. C. van der Vliet Bending of Adenovirus Origin DNA by Nuclear Factor I as Shown by Scanning Force Microscopy Is Required for Optimal DNA Replication J. Virol., February 15, 2004; 78(4): 1928 - 1935. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. H. Stracker, G. D. Cassell, P. Ward, Y.-M. Loo, B. van Breukelen, S. D. Carrington-Lawrence, R. K. Hamatake, P. C. van der Vliet, S. K. Weller, T. Melendy, et al. The Rep Protein of Adeno-Associated Virus Type 2 Interacts with Single-Stranded DNA-Binding Proteins That Enhance Viral Replication J. Virol., January 1, 2004; 78(1): 441 - 453. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. van Breukelen, A. B. Brenkman, P. E. Holthuizen, and P. C. van der Vliet Adenovirus Type 5 DNA Binding Protein Stimulates Binding of DNA Polymerase to the Replication Origin J. Virol., December 20, 2002; 77(2): 915 - 922. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| All ASBMB Journals | Molecular and Cellular Proteomics |
| Journal of Lipid Research | ASBMB Today |
lane was used to determine 0% of unwinding
and the boiled lane was used to determine the 100%
unwinding value.
