JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M006111200 on October 3, 2000

J. Biol. Chem., Vol. 275, Issue 52, 41018-41027, December 29, 2000
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
275/52/41018    most recent
M006111200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Shen, Q.
Right arrow Articles by Subauste, J. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Shen, Q.
Right arrow Articles by Subauste, J. S.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Dimerization Interfaces of v-ErbA Homodimers and Heterodimers with Retinoid X Receptor alpha *

Qing Shen and Jose S. SubausteDagger

From the Division of Endocrinology and Metabolism, University of Mississippi Medical Center and G. V. Montgomery Veterans Administration Medical Center, Jackson, Mississippi 39216

Received for publication, July 11, 2000, and in revised form, September 12, 2000

    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

The oncoprotein v-ErbA, a member of the zinc finger transcription factor superfamily, is a mutated version of thyroid hormone receptor alpha 1 that is virtually incapable of binding T3. v-ErbA and other members of this family can bind as homodimers and heterodimers with retinoid X receptors to specific DNA sequences arranged as direct, inverted, or everted repeats. At least two regions in the C-terminal domain, the I box (10 and 11 helices in v-ErbA and thyroid hormone receptors) and the 20-amino acid region are involved in dimerization. However, it has not been entirely understood how these receptors dimerize on differently oriented core motifs and whether the domain(s) responsible for homodimerization and heterodimerization are identical. Therefore, deletions of the entire 20-amino acid region, the 10 helix, the 11 helix, and point mutations within these regions of v-ErbA were made by site-directed mutagenesis. The mutant proteins were tested for their ability to form v-ErbA homodimers and heterodimers with retinoid X receptor alpha  on differently oriented core motifs by electrophoretic mobility shift assay. Transient transfections were performed to determine the dominant negative activity of the v-ErbA mutants. The data indicate that different dimerization interfaces are used for v-ErbA homodimerization and heterodimerization with retinoid X receptor alpha , and different dimerization interfaces are used on differently oriented core motifs. The data are of general interest because the information improves our understanding of the role of these dimerization interfaces in the mechanism of action not only of v-ErbA but also of other members of the superfamily.

    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

The avian erythroblastosis virus (strain ES4) induces erythroleukemia and fibrosarcomas in birds (1, 2). This retrovirus possesses two oncogenes, v-ErbA and v-ErbB (1, 2). The retroviral oncoprotein v-ErbA, a member of the zinc finger transcription factor superfamily, is a mutated form of thyroid hormone receptor alpha 1 (TRalpha 1)1 that is virtually incapable of binding T3 (3). v-ErbA is a dominant negative repressor in avian and mammalian cells; however, its mechanisms of action and molecular targets remain unknown (4, 5).

v-ErbA and TR belong to the ErbA superfamily of nuclear receptors. Other members of this family include glucocorticoid receptor, retinoic acid receptors, retinoid X receptors (RXRs), and the vitamin D receptor (6). These receptors interact with specific DNA sequences, called response elements, in the promoter region of target genes and thereby regulate diverse aspects of cellular development and homeostasis (6).

TR and v-ErbA can bind as homodimers or heterodimers to response elements arranged as everted, direct, and inverted repeats (7). The heterodimerization with RXR enhances the DNA binding of these receptors to their respective response elements (8-10). We recently described the DNA binding affinity of v-ErbA homodimers and v-ErbA-RXR heterodimers to differently oriented core motifs (11). We found that v-ErbA homodimers bind with the highest affinity to an imperfect everted repeat with a 5- or 6-bp spacer. Also, v-ErbA homodimers and v-ErbA-RXR heterodimers bind to direct repeats with different spacers (11).

At least two regions within the nuclear receptors are involved in the heterodimerization with RXR. One region is located within the DNA-binding domain (DBD). This region confers a weak dimerization interface; however, it dictates the spacing preference of direct repeat response elements (12-16).

In contrast to this weak dimerization interface of the DBD, a second region located in the C-terminal domain confers a strong dimerization interface (Fig. 1). This region, named the I box, encompasses helices 10 and 11 in TR and v-ErbA (17). Unlike the dimerization interface that forms between DBDs, the C-terminal region is capable of mediating dimerization in solution that would account for the high degree of cooperativity between dimeric partners on response elements. The highly conserved ninth heptad located within helix 11 has been shown to play a critical role in TR heterodimerization with RXR (18, 19). Another region located toward the N-terminal side of the ligand-binding domain is involved in dimerization. It consists of 20 amino acids that are highly conserved among the majority of nuclear receptors (20). Mutations in this region of TRbeta 1, vitamin D receptor, and retinoic acid receptor impair heterodimerization with RXR on direct and inverted repeat response elements (20, 21). However, little is known about the role of this region in homodimerization on direct and inverted repeats or in heterodimerization or homodimerization on everted repeats.


View larger version (18K):
[in this window]
[in a new window]
  		Fig. 1.   Schematic diagram of v-ErbA. The sequence of the 20-amino acid region and the I box (helices 10 and 11) are shown. The sequences of helices 10 and 11 are in bold type, and that of the ninth heptad within helix 11 is underlined. Numbers indicate the amino acid positions in v-ErbA.

The crystal structures of the dimerization interfaces for several nuclear receptors have been published (22-25). However, in two of them, the studies were done with truncated DBDs in the presence of DNA (22, 23), whereas in others, the experiments were performed with the C-terminal region of the receptors in the absence of DNA (24, 25). Therefore, crystal structures of the full-length nuclear receptors in the presence of differently oriented core motifs are not available at this time.

Although it has not been entirely understood how these receptors dimerize on these different elements, it is believed that the presence of a flexible hinge located between the DBD and the ligand-binding domain allows the DBD to rotate with respect to a common C-terminal interface (7, 17, 26). However, recent data on the role of the ninth heptad repeat in the dominant negative activity of TR variant alpha 2 suggest that there are different dimerization interfaces as the half-site orientation changes (27, 28). Furthermore, it was unknown whether the domain(s) responsible for homodimerization and heterodimerization are identical.

To obtain a better understanding of the dimerization interfaces involved, we studied, by mutational analysis, the role of the I box and the 20-amino acid region of v-ErbA in the formation of v-ErbA homodimers and v-ErbA-RXR heterodimers on everted, direct, and inverted repeats.

The data described below indicate that different dimerization interfaces in the C-terminal domain are used in v-ErbA homodimers and v-ErbA-RXR heterodimers as well as within dimers on differently oriented core motifs.

    EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Site-directed Mutagenesis-- The Promega Altered Sites kit was used to create point mutations in v-ErbA. For deletions, the polymerase chain reaction-based splice overlap extension technique was employed (29). Mutant products were sequenced to confirm the mutations and to exclude errors.

Production and Purification of Proteins-- Wild type and mutant v-ErbAs (lacking gag sequences), and the mouse RXRalpha cDNAs (11, 30) were transcribed from pBluescript plasmids and then translated using the rabbit reticulocyte lysate system (Promega) in the presence of [3H]leucine or [35S]methionine (31). Trichloroacetic acid precipitable-protein counts per minute were determined. SDS-polyacrylamide gel electrophoresis and fluorography were performed to demonstrate that all proteins were of the appropriate size.

Electrophoretic Mobility Shift Assays-- Protein-DNA binding reactions were performed in 35 µl of 20 mM HEPES, pH 7.8, 20% glycerol, 1.4 µg of poly(dI·dC), 1 mM dithiothreitol, 50 mM KCl, 0.1% Nonidet P-40, 32P-labeled DNA, and the protein(s) of interest. The double-stranded DNAs were end-labeled with [gamma -32P]ATP using T4 polynucleotide kinase. An EMSA was performed with 40,000 cpm of 32P-labeled DNA/sample. The amounts of [3H]leucine v-ErbA proteins used were between 2,500 and 10,000 cpm for homodimer binding and between 1,250 and 5,000 cpm for heterodimer binding. On each core motif, the amounts of in vitro translated v-ErbA proteins used were equal as assessed by [3H]leucine incorporation, taking into consideration the number of leucines in the specific proteins. For experiments involving heterodimerization, 2,500 cpm of RXRalpha were employed. Reactions were incubated at room temperature for 45 min prior to electrophoresis. Electrophoresis was carried out on 0.25× TBE (22 mM Tris base, 22 mM boric acid, 0.5 mM EDTA) 6% polyacrylamide gels (29:1 acrylamide:bisacrylamide) at room temperature. Gels were fixed in 30% methanol, 10% acetic acid, dried, and exposed to film with an intensifying screen for 6-24 h at -70 °C.

The DNA-protein complexes were quantified using a Molecular Dynamics PhosphorImager. Experiments were performed at least twice using two different batches of rabbit reticulocyte lysates.

The sequences of the oligonucleotides used in EMSA are shown below (the hexameric half-sites are underlined): M1, GATCCGGGCGATGAAATAATTGAGGTCACGGATC; ER5, GATCCGGGCGATGACCTAATTGAGGTCACGGATC; ER6, GATCCGGGCGATGACCTAACTTGAGGTCACGGATC; DR4, GATCCGGGCGATGGGGTCATATGAGGTCACGGATC; IR0, GATCCTAAGGTCATGACCTTAGGATC; IR6, GATCCTAAGGTCAATCTACTGACCTTAGGATC; and IR9, GATCCTAAGGTCAATCTACGGTTGACCTTAGGATC.

v-ErbA Homodimerization and v-ErbA-RXR Heterodimerization in the Absence of DNA-- Wild type v-ErbA and mouse RXRalpha were produced in Escherichia coli using the vector pMAL (New England Biolabs) as described previously (32, 33). This vector produces a fusion protein of maltose binding protein followed by a cleavage site for factor Xa and the receptor of interest. The MBP-RXRalpha and MBP-v-ErbA fusion proteins were adsorbed onto a series of 1-ml amylose resin columns. MBP was similarly adsorbed as a control. The columns were washed with 60 ml of EMSA buffer, and then 1,200,000 cpm of [35S]methionine-labeled v-ErbAs were loaded onto the columns (taking into consideration the number of methionines in the specific proteins). After incubation for 30 min at 4 °C, the columns were washed with 20 ml of EMSA buffer. Radiolabeled v-ErbAs that remained bound were eluted with 10 mM maltose and quantified by scintillation counting. SDS-polyacrylamide gel electrophoresis of aliquots confirmed that the eluted v-ErbAs were of appropriate sizes.

Transient Transfections-- JEG-3 cells were grown in 90% Eagle's minimum essential medium plus 10% fetal bovine serum and were transfected using standard calcium phosphate precipitation (34). The oligonucleotides described above were used as potential v-ErbA response elements. These oligonucleotides were ligated as single inserts into pUTKAT3 at a BamHI site 5' to the basal herpes simplex virus thymidine kinase promoter driving expression of CAT (35). Reporter plasmids were transfected at a dose of 4 µg/60-mm Petri dish. Mouse TRalpha 1 and rat RXRbeta , were expressed from the vector pCDM (34); wild type and mutant v-ErbAs were expressed from the vector pRSV (36). The RSV-v-ErbA plasmid was modified from the original construct by deleting the gag sequences. Transfections included 100 ng of pCDMTRalpha 1, which represents a nonsaturating dose of this expression plasmid; 1 µg of pCDMRXRbeta , and different amounts of pRSV-v-ErbAs (or vector). The amount of pRSV-v-ErbA used was 300 ng in experiments containing the everted repeat ER5; 600 ng and 1.5 µg, in experiments containing the direct repeat DR4; 1 and 3 µg in experiments involving the inverted repeat IR0. Vector pRSV was added to achieve a total of 3 µg of pRSV-based plasmid per transfection. Expression of v-ErbA mutants was confirmed by Western blot of nuclear cell extracts (Amersham Pharmacia Biotech ECL kit) with v-ErbA antibody (gift from M. Privalsky).

Cotransfections included 1 µg of a human growth hormone (GH) expressing vector (pTKGH)/60-mm Petri dish to control for transfection efficiency. Cells were transfected in the presence of 10% charcoal stripped fetal bovine serum and 100 nM dexamethasone. Cells were cultured ± 10 nM T3 for 2 days prior to harvest. CAT and hGH assays were performed as described previously (34). v-ErbA suppression of CAT reporter gene expression was calculated as CAT/hGH for cells cultured with v-ErbA divided by CAT/hGH for cells cultured without v-ErbA in the presence or absence of ligand. Results are presented as the means ± S.E. for four to six independent transfections per assay condition.

    RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Expression of v-ErbA Mutants-- v-ErbA mutants were made by deleting the entire 20-amino acid region (Delta 20AA, amino acids 218-237), helix 10 (Delta H10, amino acids 322-342), helix 11 proximal to the ninth heptad (Delta H11A, amino acids 346-352), the ninth heptad (Delta 9 heptad, amino acids 353-360), and the helix 11 distal to the ninth heptad (Delta H11B, amino acids 361-366). Also, a mutant containing a stop codon prior to the ninth heptad was created (stop codon 352). In addition, point mutations were made within these regions in amino acids that are highly conserved throughout the superfamily of nuclear receptors. Most of these mutations were chosen to result in substantial alterations of charge or polarity. Mutations were also made outside the dimerization regions as controls (D254A, E258A, and L372R). These proteins were translated using the rabbit reticulocyte lysate system in the presence of [3H]leucine as shown in Fig. 2.


View larger version (47K):
[in this window]
[in a new window]
  		Fig. 2.   Expression of wild type and mutant v-ErbA proteins. Wild type and mutant v-ErbA proteins were translated using the rabbit reticulocyte lysate system in the presence of [3H]leucine and analyzed by SDS-polyacrylamide gel electrophoresis. Unprogrammed reticulocyte lysate was used as a control (mock). Molecular mass (MW) markers (in daltons) are shown.

The 20-Amino Acid Region and Helices 10 and 11 Are All Involved in v-ErbA Homodimerization and Heterodimerization with RXR alpha  on Everted Repeats-- Recently, we demonstrated that v-ErbA homodimers bind with the highest affinity to an imperfect everted repeat with a 5-bp spacer (ER5) (11). To determine the dimerization interfaces involved in this process, the ability of the v-ErbA mutants to dimerize on this core motif was tested by EMSA. In experiments involving v-ErbA-RXR heterodimers, we intentionally used a dose of v-ErbA that gives weak homodimer binding.

As shown in Fig. 3A and Table I, deletion of the 20-amino acid region significantly decreased homodimer and heterodimer formation with RXR. Among the point mutations tested, the v-ErbA mutants D232A and A219D significantly interfered with v-ErbA homodimerization and heterodimerization with RXR. The mutant P229R modestly decreased v-ErbA homodimerization and heterodimerization with RXR. The control mutants outside this region (D254A and E258A) did not affect v-ErbA dimerization. Deletion of helix 10 and mutant Y338L within this region significantly decreased the formation of v-ErbA homodimers and v-ErbA-RXR heterodimers on this core motif (Fig. 3B and Table I).


View larger version (26K):
[in this window]
[in a new window]
  		Fig. 3.   EMSA analysis of DNA binding of wild type and mutant v-ErbA proteins to the DNA element ER5 in the absence and in the presence of RXRalpha . A, in vitro translated wild type 3H-labeled v-ErbA, v-ErbA proteins containing mutations within the 20 AA region, the control mutant outside the 20-amino acid region (D254A), or unprogrammed reticulocyte lysate (mock) were incubated with a 32P-labeled DNA probe ER5 in the absence or in the presence of in vitro translated wild type 3H-labeled RXRalpha . The protein-DNA complexes were resolved by nondenaturing polyacrylamide gel electrophoresis. B, experiments were performed with wild type or mutant v-ErbA proteins containing mutations within helix 10 in the absence or in the presence of RXRalpha . C, experiments were performed with wild type, mutant v-ErbA proteins containing mutations within helix 11, or the control mutant outside the I box (L372R) in the absence or in the presence of RXRalpha . VM, VD, and VR indicate v-ErbA monomer, v-ErbA homodimer, and v-ErbA-RXR heterodimer-DNA complexes, respectively. The asterisk indicates a faint band seen with RXR alone. The amount of in vitro translated v-ErbA used was 2,500 or 1,250 cpm for homodimer or heterodimer formation with RXR, respectively. Equal amounts of mutant v-ErbAs were used, as assessed by [3H]leucine incorporation, taking into account the number of leucines in the specific proteins. For experiments involving heterodimerization, 2,500 cpm of RXRalpha were employed.

                              
View this table:
[in this window]
[in a new window]
 
Table I
Relative binding of v-ErbA mutants as homodimers and heterodimers with RXRalpha to everted repeats (ER5)

Deletions within the helix 11 of v-ErbA (Delta H11A, Delta H11B, and Delta 9 heptad) and the point mutations within the ninth heptad (L353R and L360R) significantly decreased and disrupted homodimerization and heterodimerization with RXR, respectively. The control mutant outside this region, L372R, did not affect dimerization (Fig. 3C and Table I).

In summary, the 20-amino acid region and helices 10 and 11 are all involved in v-ErbA homodimerization and v-ErbA-RXR heterodimerization on the everted repeat with a 5-bp spacer. Similar results were obtained when the studies were performed on the everted repeat with a 6-bp spacer (ER6) (data not shown).

Helix 10 Is Not Involved in v-ErbA Homodimerization, Whereas Sequences within Helix 11 Distal to the Ninth Heptad Are Not Involved in the Formation of v-ErbA-RXR Heterodimers on DR4-- EMSA analysis of the v-ErbA mutants on the direct repeat with a 4-bp spacer was next tested. In experiments involving v-ErbA-RXR heterodimers, we intentionally used a dose of v-ErbA that gives minimal homodimer binding. As shown in Fig. 4A and Table II, deletion of the entire 20-amino acid region significantly decreased and disrupted v-ErbA homodimer and v-ErbA-RXR heterodimer formation, respectively, on this site. Among the point mutations tested within this region, P229R and D232A significantly interfered with homodimer formation. The mutant D232A but not P229R also decreased v-ErbA-RXR heterodimer formation on this core motif. The control mutants D254A and E258A did not affect dimerization.


View larger version (32K):
[in this window]
[in a new window]
  		Fig. 4.   EMSA analysis of DNA binding of wild type and mutant v-ErbA proteins to the DNA element DR4 in the absence and in the presence of RXRalpha . A, in vitro translated wild type 3H-labeled v-ErbA, v-ErbA proteins containing mutations within the 20 AA region, the control mutants outside the 20-amino acid region (D254A and E258A), or unprogrammed reticulocyte lysate (mock) were incubated with a 32P-labeled DNA probe DR4 in the absence or in the presence of in vitro translated wild type 3H-labeled RXRalpha . The protein-DNA complexes were resolved by nondenaturing polyacrylamide gel electrophoresis. B, experiments were performed with wild type or mutant v-ErbA proteins containing mutations within helix 10 in the absence or in the presence of RXRalpha . C, experiments were performed with wild type, mutant v-ErbA proteins containing mutations within helix 11, or the control mutant outside the I box (L372R) in the absence or in the presence of RXRalpha . VM, VD, and VR indicate v-ErbA monomer, v-ErbA homodimer, and v-ErbA-RXR heterodimer-DNA complexes, respectively. The amount of in vitro translated v-ErbA used was 3,750 or 1,250 cpm for homodimer or heterodimer formation with RXR, respectively. Equal amounts of mutant v-ErbAs were used as assessed by [3H]leucine incorporation, taking into account the number of leucines in the specific proteins. For experiments involving heterodimerization, 2,500 cpm of RXRalpha were employed.

                              
View this table:
[in this window]
[in a new window]
 
Table II
Relative binding of v-ErbA mutants as homodimers and heterodimers with RXRalpha to direct repeats (DR4)

Interestingly, the deletion of helix 10 did not affect v-ErbA homodimer formation. However, the same mutant disrupted heterodimer formation with RXR (Fig. 4B and Table II).

Deletions within helix 11, especially a deletion of the ninth heptad, affected homodimerization. Point mutations within the ninth heptad (L353R and L360R) significantly affected homodimerization as well. Heterodimerization with RXR was disrupted with deletions of the proximal portion of helix 11 (Delta H11 A) and of the ninth heptad. However, a deletion within the I box distal to the ninth heptad (Delta  H 11 B) did not significantly affect heterodimerization on this site. The control mutant L372R outside the I box did not affect homodimerization or heterodimerization (Fig. 4C and Table II).

Neither the 20-Amino Acid Region nor Helices 10 and 11 Are Involved in v-ErbA Homodimerization on IR0-- Higher amounts of v-ErbA were required on IR0 than on ER5. This is in agreement with our previous data, which indicated that v-ErbA homodimers bind with lower affinity to IR0 than to ER5 (11).

As shown in Fig. 5 and Table III, deletions and point mutations within the 20-amino acid region and helices 10 and 11 did not affect the homodimer formation of v-ErbA on the inverted repeat IR0. In fact, deletions of helices 10 and 11, and the mutant carrying a stop codon prior to the ninth heptad (stop codon 352) significantly increased homodimer formation on this core motif.


View larger version (33K):
[in this window]
[in a new window]
  		Fig. 5.   EMSA analysis of DNA binding of wild type and mutant v-ErbA proteins to the DNA element IR0 in the absence and in the presence of RXRalpha . A, in vitro translated wild type 3H-labeled v-ErbA, v-ErbA proteins containing mutations within the 20 AA region, the control mutant outside the 20-amion acid region (D254A), or unprogrammed reticulocyte lysate (mock) were incubated with a 32P-labeled DNA probe IR0 in the absence or in the presence of in vitro translated wild type 3H-labeled RXRalpha . The protein-DNA complexes were resolved by nondenaturing polyacrylamide gel electrophoresis. B, experiments were performed with wild type or mutant v-ErbA proteins containing mutations within helix 10 in the absence or in the presence of RXRalpha . C, experiments were performed with wild type, mutant v-ErbA proteins containing mutations within helix 11, or the control mutant outside the I box (L372R) in the absence or in the presence of RXRalpha . VM, VD, and VR indicate v-ErbA monomer, v-ErbA homodimer, and v-ErbA-RXR heterodimer-DNA complexes, respectively. The asterisk indicates a nonspecific band seen with reticulocyte lysate alone (mock). The amount of in vitro translated v-ErbA used was 15,000 or 5,000 cpm for homodimer or heterodimer formation with RXR, respectively. Equal amounts of mutant v-ErbAs were used as assessed by [3H]leucine incorporation, taking into account the number of leucines in the specific proteins. For experiments involving heterodimerization, 2,500 cpm of RXRalpha were employed.

                              
View this table:
[in this window]
[in a new window]
 
Table III
Relative binding of v-ErbA mutants as homodimers and heterodimers with RXRalpha to inverted repeats (IR0)

In contrast, the heterodimerization of v-ErbA with RXR was disrupted with deletions of either the 20-amino acid region, helix 10, or helix 11. Also, point mutations within these regions, particularly D232A, Y338L, L353R, and L360R, significantly decreased the formation of heterodimers. The control mutants, D254A, E258A, and L372R, did not affect homodimerization or heterodimerization with RXR on IR0.

It was important to consider the independent occupancy of two half-sites by two protein molecules rather than protein-protein interactions on DNA because none of the v-ErbA mutants tested affect the formation of v-ErbA homodimers on the inverted repeat IR0. However, this possibility was very unlikely, because in dose-response curves, homodimer is the predominant complex observed bound to DNA (there is minimal evidence of a monomeric intermediate). Nevertheless, "spacing" mutants of the inverted repeat with a 6-bp spacer (IR6) and with a 9-bp spacer (IR9) were created. As seen in Fig. 6, v-ErbA binding was not observed on IR6 or IR9, confirming that the v-ErbA-DNA complex seen with IR0 was due to homodimer formation rather than to the independent occupancy of two half-sites by two molecules.


View larger version (52K):
[in this window]
[in a new window]
  		Fig. 6.   EMSA analysis of v-ErbA binding to variably spaced inverted repeats. 32P-Labeled inverted repeats with no spacer (IR0), 6-bp spacer (IR6), or 9-bp spacer (IR9) between half-sites were incubated with in vitro translated wild type 3H-labeled v-ErbA and analyzed by EMSA. VD indicates v-ErbA homodimer-DNA complexes.

v-ErbA Dimerization in the Absence of DNA-- Because the ability of v-ErbA mutants to homodimerize and heterodimerize with RXR differed on the differently oriented core motifs, we wished to determine whether such homodimers and heterodimers can form in the absence of DNA. To accomplish this, MBP-RXRalpha and MBP-v-ErbA fusion proteins were produced in E. coli and absorbed to amylose affinity columns (MBP was adsorbed as a control). After extensive washing, reticulocyte lysate-translated, 35S-radiolabeled wild type v-ErbA, Delta 20AA, Delta H10, Delta H11A, Delta H11B, or the Delta 9 heptad was applied to the columns. After further washing, the bound radiolabeled proteins were eluted, and the radioactivity was determined. As shown in Fig. 7, v-ErbA-RXR heterodimers were easily detected under these conditions (48% of input cpm). Proteins harboring deletions of either the 20-amino acid region, helix 10, or within helix 11, heterodimerize with RXR very poorly. Interestingly, in contrast to its inability to heterodimerize with RXR in solution, Delta H11B was able to heterodimerize with RXR on the direct repeat DR4 (Fig. 4C).


View larger version (19K):
[in this window]
[in a new window]
  		Fig. 7.   Dimerization of v-ErbAs in the absence of DNA. A, MBP-RXR fusion protein was produced in E. coli and adsorbed onto amylose columns. 35S-Labeled v-ErbAs were produced in reticulocyte lysate and loaded onto amylose columns. After washing, the bound v-ErbAs were eluted and quantified. MBP was adsorbed to amylose as a control for nonspecific binding, which was subtracted to yield the specifically bound radioactivity. Bars represent mean specific binding of two experiments. Results are normalized to the binding of wild type v-ErbA, which was 48% of input cpm. B, similar to A, except that MBP-v-ErbA was adsorbed onto amylose columns. Results are normalized to the binding of wild type v-ErbA, which was 31% of input cpm.

Also, v-ErbA homodimers were clearly detected under these conditions (31% of input cpm). The v-ErbA mutants described above dimerized with MBP-v-ErbA poorly, with Delta H11A the least affected (31% of the level seen for the wild type). Thus, homodimerization in the absence of DNA most closely resembles that seen on the everted repeats.

Dominant Negative Activity of v-ErbA Mutants on ER5-- The functional consequences of the mutations in the C-terminal region of v-ErbA was investigated. We determined the ability of the mutant proteins to direct v-ErbA repression of T3-dependent CAT expression mediated by TRalpha 1 in JEG-3 cells. As depicted in Table IV, wild type v-ErbA supports potent suppression of T3 induction on the response element ER5. The control mutants, D254A and L372R, are able to suppress T3 mediated CAT activity similar to the wild type. However, the difference in the effect on dimerization between the wild type v-ErbA and the mutants was dramatic. Specifically, suppression of T3-mediated CAT activity was about 5-6-fold greater for the wild type v-ErbA than for the mutants that significantly affect homodimerization and heterodimerization with RXR (A219D, D232A, Delta 20AA, Delta H10, L353R, L360R, Delta H11B, and Delta 9 heptad). v-ErbA proteins containing the point mutations P229R, and Y338L have a less deleterious effect, suppressing T3-mediated CAT activity to 38 ± 1.7 and to 55 ± 2.3%, respectively, of that observed in the absence of v-ErbA. Within helix 11, the mutant Delta H11A suppressed T3-mediated CAT activity to 49 ± 4.1% of that observed in the absence of v-ErbA. This indicates that the proximal region of helix 11 has a less important role in the dominant negative activity of v-ErbA than the ninth heptad or the distal portion of this helix. In addition, mutations within the 20-amino acid region, helices 10 or 11 affect the repressor activity of v-ErbA in the absence of T3 on this response element (Table IV).

                              
View this table:
[in this window]
[in a new window]
 
Table IV
Dominant negative effect of v-ErbA mutants on TRalpha 1 action on ER5

v-ErbA Homodimers and v-ErbA-RXR Heterodimers Are Both Involved in the Dominant Negative Activity of v-ErbA on DR4; However, RXR Is Required to Achieve Maximal Repressor Activity on This Response Element-- We have recently shown that cotransfected RXR enhances the dominant negative activity of v-ErbA on the response element arranged as a direct repeat with a 4-bp spacer (DR4) (11). This effect was not observed when RXR was cotransfected with v-ErbA on a response element arranged as an everted repeat (ER5) or inverted repeat (IR0) (11).

Experiments were conducted to test the role of the 20-amino acid region, helix 10, and helix 11 in the dominant negative activity of v-ErbA on DR4 in the absence and presence of cotransfected RXR. Because some v-ErbA mutants selectively affect heterodimerization (Delta  H 10) and others do not (Delta  H 11 B), these studies may provide a better understanding of the role of v-ErbA homodimers and v-ErbA-RXR heterodimers in the repressor activity of v-ErbA on this core motif.

As shown in Fig. 8, the cotransfection of wild type v-ErbA expressing vector at 600 ng and 1.5 µg suppressed T3-mediated CAT activity to 37 ± 3.7 and 22 ± 1.2% of that observed in the absence of v-ErbA, respectively. When 600 ng of mutant v-ErbA expression vector was cotransfected, the v-ErbA mutants elicit a nil to modest repression of T3 induction on DR4. Specifically, the CAT activities were: Delta 20AA, 100 ± 7%; Delta H10, 93 ± 5%; Delta H11 A, 110 ± 3%; Delta H11B, 99 ± 1.6%; and Delta 9 heptad, 80 ± 7.8%, of that observed in the absence of v-ErbA. At 1.5 µg, their repressor activities were enhanced, but remained weaker than that of the wild type. Specifically, the CAT activities on this response element were: Delta 20AA, 59 ± 6%; Delta H10, 66 ± 4%; Delta H11A, 65 ± 10%; Delta H11B, 59 ± 6%; and Delta 9 heptad, 46 ± 8%, of that observed in the absence of v-ErbA. Interestingly, Delta H10, a v-ErbA mutant able to homodimerize but not to heterodimerize with RXR, suppressed T3 induction modestly. This finding suggests that v-ErbA homodimers can, albeit weakly, repress transcription on direct repeats.


View larger version (23K):
[in this window]
[in a new window]
  		Fig. 8.   Dominant negative effect of v-ErbA mutants on TRalpha 1 action in the absence and in the presence of cotransfected RXRbeta on a direct repeat core motif. JEG-3 cells were transfected with the reporter plasmid pUTKAT3 containing a single copy of the direct repeat with a 4-bp spacer (DR4), along with the internal control plasmid pTKGH. All cells also received expression vectors for TRalpha 1 ± wild type or mutant v-ErbAs (or empty vector) and 0 or 1 µg of the expression vector for RXRbeta . Cells were cultured for 2 days in the presence of 10 nM T3, and then cell lysates were analyzed for CAT activity and media for hGH. Results are the means ± S.E. for six independent transfections. In some cases, the S.E. is too small for the error bar to be seen. AA, amino acids.

When RXRbeta was cotransfected with 600 ng of wild type v-ErbA, a maximal suppression of T3 induction was observed (6 ± 0.6% of that observed in the absence of v-ErbA). In contrast, with the exception of Delta H11B, RXRbeta did not enhance significantly the repressor activity of the v-ErbA mutants. Specifically, the cotransfection of RXRbeta with 600 ng of the v-ErbA mutants Delta 20AA, Delta H10, Delta H11A, and Delta 9 heptad, suppressed T3-mediated CAT activity to 91 ± 3.7, 79 ± 2.8, 108 ± 5.9, and 81 ± 3.7% of that observed in the absence of v-ErbA, respectively. However, the mutant Delta H11B was not only able to heterodimerize with RXR on DR4 by EMSA (Fig. 4C), but also its repressor activity was significantly enhanced when RXRbeta was cotransfected. Specifically, Delta H11B was without effect (99 ± 2%) in the absence of cotransfected RXRbeta and suppressed T3-mediated CAT activity to 39 ± 7% in the presence of cotransfected RXRbeta . In the absence of wild type or mutant v-ErbAs, cotransfected RXRbeta did not have a significant effect on T3-mediated CAT activity (92 ± 5% of that observed in the absence of RXRbeta ).

Taken together, the above data indicate that v-ErbA-RXR heterodimers rather than v-ErbA homodimers are critical for the dominant negative activity of v-ErbA on direct repeats. Moreover, the results obtained by EMSA and transfection assays with Delta H11B suggest that sequences within helix 11 distal to the ninth heptad of v-ErbA do not play an important role in the interaction with RXR on direct repeats with a 4-bp spacer.

The Repressor Activity of v-ErbA on IR0 Is Most Likely Mediated by v-ErbA Homodimers-- Experiments were conducted to examine the role of the 20-amino acid region, helix 10, and helix 11 in the dominant negative activity of v-ErbA on the inverted repeat IR0. For this purpose, 1 µg of wild type or mutant v-ErbAs was transfected. As shown in Fig. 9, wild type v-ErbA suppressed T3-mediated CAT activity to 72 ± 5% of that observed in the absence of v-ErbA, confirming that v-ErbA is a weak repressor on this response element.


View larger version (16K):
[in this window]
[in a new window]
  		Fig. 9.   Dominant negative effect of v-ErbA on TRalpha 1 action on an inverted repeat core motif. JEG-3 cells were transfected with the reporter plasmid pUTKAT3 containing a single copy of an inverted repeat (IR0), along with the internal control plasmid pTKGH. All cells also received expression vectors for TRalpha 1 ± wild type or mutant v-ErbAs (or empty vector). Cells were cultured for 2 days in the presence of 10 nM T3, and then cell lysates were analyzed for CAT activity and media for hGH. Results are the means ± S.E. for four independent transfections.

v-ErbA mutants containing deletions of either the 20-amino acid region, helix 10, helix 11A, helix 11B, or the ninth heptad suppressed T3-mediated CAT activity to 61 ± 6, 64 ± 7, 77 ± 2, 99 ± 4, and 76 ± 3%, respectively. In addition, the mutant harboring a stop codon at position 352 suppressed T3-mediated CAT activity to 57 ± 1.4% of that observed in the absence of the v-ErbA mutant. Thus, except for Delta H11B, the mutants were as potent or greater repressors as the wild type v-ErbA on this response element.

Experiments were also conducted with 3 µg of wild type or mutant v-ErbAs. Using this amount, wild type and v-ErbA mutants suppressed T3 induction to ~30% of that observed in their absence. However, an accurate result could not be obtained because some suppression in the expression of the internal control TKGH was observed.

Overall, the above data suggest that the repressor activity of v-ErbA on IR0 is most likely mediated by v-ErbA homodimers rather than heterodimers with RXR. This is likely because our data show that the mutants were not able to heterodimerize with RXR but that their ability to homodimerize remained unaffected.

    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

The C-terminal domain (ligand-binding domain) of the nuclear receptors contains a strong dimerization interface named the I box (helices 10 and 11 in TR and v-ErbA) (17). In addition, there is evidence that the 20-amino acid region located toward the N-terminal end of the ligand-binding domain is also involved in dimerization (20, 21).

Previous studies have suggested that there is a common C-terminal dimerization interface used on all classes of binding sites. Specifically, these studies have indicated that whereas the C-terminal domain is physically constrained as a consequence of dimerization, the DBD in contrast retains spatial flexibility (7, 17, 26). This flexibility would allow the DBD to rotate to bind to everted, direct, and inverted repeats. Although these important studies have improved our understanding of dimerization, the question of whether or not a common C-terminal domain interface exists has not been answered for the following reasons: 1) the data were obtained from DNA binding assays in which large deletions and chimeras within the C-terminal domain were created and 2) the crystal structures of the C-terminal domain of nuclear receptors were done in solution and not in the presence of the DBD bound to differently oriented core motifs (24, 25).

Therefore, we performed a detailed mutational analysis within the 20-amino acid region and helices 10 and 11 of v-ErbA to determine whether different dimerization interfaces in the C-terminal region are used for v-ErbA homodimerization and heterodimerization with RXR and whether different dimerization interfaces are used on core motifs with different orientations. Furthermore, the creation of v-ErbA mutants that disrupt heterodimerization with RXR without affecting homodimerization and vice versa helped clarify the role of RXR in the dominant negative activity of v-ErbA.

Our results indicate that different dimerization interfaces are used for v-ErbA homodimers and for v-ErbA-RXRalpha heterodimers and also that different dimerization interfaces are used on core motifs with different orientations. Specifically, for v-ErbA homodimers, helices 10 and 11 and the 20-amino acid region are all important when bound to everted repeats. For v-ErbA homodimers bound to direct repeats, helix 11 and the 20-amino acid region are involved in this process, whereas helix 10 does not play an important role. When bound to inverted repeats, neither the 20-amino acid region, helix 10, nor helix 11 are involved in v-ErbA homodimerization. Furthermore v-ErbA mutants containing deletions of helices 10 and 11 or a stop codon prior to the ninth heptad display an enhanced binding to inverted repeats as compared with the wild type v-ErbA. These results indicate that sequences within the C-terminal domain of v-ErbA interfere with v-ErbA homodimerization on inverted repeats, probably by a steric mechanism. In contrast, chicken ovalbumin upstream promotor transcription factor (COUP-TF) homodimers require the I box for binding to a core motif arranged as an inverted repeat (17).

The above data indicate that steric interactions between two v-ErbA molecules are not identical on everted, direct, or inverted repeats. We have found that everted repeats with a 5- or 6-bp spacer display a higher affinity binding for v-ErbA homodimers than direct or inverted repeats (11). The differences in affinity of these homodimers for the corresponding response elements may be explained by differences in the dimerization interfaces of v-ErbA homodimers. Two possibilities may be considered in the process of DNA binding by v-ErbA homodimers. In the first model, v-ErbA homodimers are formed in solution and subsequently bind to the response element with high affinity. In the second model, a v-ErbA monomer binds first to DNA, and then a second v-ErbA molecule binds, and the overall complex is stabilized by protein-protein as well as protein-DNA interactions.

Our data support the first model in that v-ErbA can indeed homodimerize in solution. The pattern of homodimerization in solution by the v-ErbA mutants resembles more closely that seen on the high affinity binding sites, the everted repeats. However, the dimerization interfaces involved in solution differed from those involved when bound to direct or inverted repeats, probably imposed by the orientation of these core motifs. This in turn could explain the lower affinity for v-ErbA homodimer binding for these sites as compared with everted repeats. In addition, the inhibitory effect of the C-terminal region of v-ErbA would explain the weak binding of v-ErbA homodimers to inverted repeats.

It is unknown which region(s) are involved in v-ErbA homodimerization on inverted repeats. It is likely that this is mediated by the dimerization interface of the DNA-binding domain or by specific sequences in the C-terminal domain. In addition, v-ErbA dimerization could be regulated by sequences in the N-terminal domain as described with TRalpha (37).

Regarding v-ErbA-RXR heterodimers, the 20-amino acid region and helices 10 and 11 of v-ErbA are all involved in the dimerization with RXR. However, sequences within helix 11 distal to the ninth heptad of v-ErbA are critical for heterodimerization with RXR in solution and when bound on response elements arranged as inverted and everted repeats but not on direct repeats, as shown with the mutant Delta H11B. This mutant is not only able to heterodimerize with RXR on DR4, but its repressor activity is also enhanced when RXR is cotransfected in a system containing a direct repeat as a response element. Thus, these data indicate that the nature of DNA-binding sites play an active role in the formation of dimerization interfaces of v-ErbA with RXR.

Overall, there is a good correlation between the DNA binding affinity of v-ErbA mutants assessed by EMSA and the transfection data, although some discrepancies are noted. For example, the mutant A219D has similar binding characteristics as the mutant Delta H11A for homodimer and heterodimer formation with RXR on everted repeats. However, the latter is a more potent repressor in transfection assays. A likely explanation could involve the nuclear corepressors. Recently, it has been shown that helices 5 and 6 in v-ErbA (named SSD-2 subdomain) are involved directly in protein-protein interactions with nuclear corepressors (NCoR and SMRT), thus playing an important role in the silencing activity of v-ErbA (38). Therefore, because the 20-amino acid region is included in this subdomain, it is probable that some mutations within this region could affect the interaction with the corepressors.

Although RXRs can enhance the DNA binding of v-ErbA, the significance of RXR in the dominant negative activity of v-ErbA remains to be elucidated. Based on the data obtained with the v-ErbA mutants, it is difficult to precisely determine the role of RXR in v-ErbA action on everted repeats, because the mutants that affect dimerization interfere with both homodimerization and heterodimerization. Nevertheless, important information can be obtained from these data. Specifically, Delta H11A, a v-ErbA mutant that partially retains its ability to homodimerize but is unable to heterodimerize with RXR, is capable of repressing T3-mediated action. Furthermore, we have shown that cotransfected RXR did not enhance the dominant negative activity of wild type v-ErbA on everted repeats (11). Thus, our data suggest that v-ErbA homodimers rather than v-ErbA-RXR heterodimers play an important role in v-ErbA action on response elements arranged as everted repeats. However, we cannot rule out the possibility that heterodimer formation between v-ErbA and endogenous RXR(s) accounts for some of the repressor activity on this core motif.

On direct repeats, the transfection data with the v-ErbA mutants show that v-ErbA homodimers and v-ErbA-RXR heterodimers are both involved in the dominant negative activity of v-ErbA. However, heterodimerization with RXR is required to achieve maximal repressor activity on this response element.

The v-ErbA mutants were as potent as the wild type in directing repression of T3-mediated action on inverted repeats. These mutants were capable of binding as homodimers but not as heterodimers with RXR on this response element. Furthermore, we have shown previously that cotransfected RXR does not affect the dominant negative activity of v-ErbA on this response element (11). Taken together, these results would indicate that the repressor activity of v-ErbA on inverted repeats is most likely mediated by v-ErbA homodimers rather than heterodimers with RXR. In conclusion, the data indicate that different dimerization interfaces are used for v-ErbA homodimerization and heterodimerization with RXRalpha , and different dimerization interfaces are used on differently oriented core motifs.

Data obtained from knock-out mice devoid of all known thyroid hormone receptors have shown a mild overall phenotype obtained with the TRalpha -/TRbeta - mice compared with those with hypothyroidism (39). The difference in phenotype could be explained by the ability of TRs to bind T3 response elements and repress transcription in the absence of T3. This would suggest physiological consequences for such T3-independent action of TR. Thus, a better understanding of the dimerization and repressor action of v-ErbA may provide insight into the fundamental mechanism underlying physiologic hormone regulation of TR as well as into that of other members of the nuclear receptor superfamily.

Also, investigation of v-ErbA may lead to important findings that can be applied to other clinical situations involving dominant negative transcription factors, such as the thyroid hormone resistance syndrome. This syndrome is an autosomal dominant condition with a variety of phenotypes caused by mutations in TRbeta . The mutant receptor appears to function as a dominant negative form inducing the disease by interfering with the action of the normal receptor counterpart. These mutations disrupt ligand (T3) binding, affect interaction with corepressors, or disrupt dimerization (40-42). Because v-ErbA and TR are highly related, the data described above could predict the effect of mutations in the carboxy teminal dimerization interface of TR on homodimerization or heterodimerization with RXR on differently oriented core motifs and therefore could help explain differences in phenotype in this syndrome.

    ACKNOWLEDGEMENTS

We thank Mary Coleman and Joseph Maher for critically reviewing the manuscript and Errol Crook for the preparation of the figures. We thank C. Glass and M. G. Rosenfeld for the rat RXRbeta cDNA, P. Chambon for the mouse RXRalpha , R. Evans for the v-ErbA cDNA and the Rous sarcoma virus expression vector, and M. Privalsky for the v-ErbA antiserum.

    FOOTNOTES

* This work was supported by a Veterans' Administration merit award grant.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Dagger To whom correspondence should be addressed: G. V. Montgomery Veterans' Administration Medical Center, R & E Bldg., Rm. 422, 1500 E. Woodrow Wilson Blvd., Jackson, MS 39216. E-mail: jsubauste@email.msn.com.

Published, JBC Papers in Press, October 3, 2000, DOI 10.1074/jbc.M006111200

    ABBREVIATIONS

The abbreviations used are: TR, thyroid hormone receptor; -bp, base pair; CAT, chloramphenicol acetyltransferase; DBD, DNA-binding domain; DR, direct repeat; EMSA, electromobility shift assay; ER, everted repeat; GH, growth hormone; hGH, human GH; IR, inverted repeat; MBP, maltose binding protein; RXR, retinoid X receptor; T3, thyroid hormone (3,5,3'-triiodothyronine).

    REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

1. Graf, T., and Beug, H. (1983) Cell 34, 7-9
2. Debuire, B., Henry, C., Benaissa, M., Bisert, G., Saule, S., Martin, P., and Stehelin, D. (1984) Science 224, 1456-1459
3. Sap, J., Munoz, A., Damm, K., Goldberg, Y., Ghysdael, J., Leutz, A., Beug, H., and Vennstrom, B. (1986) Nature 324, 635-640
4. Sharif, M., and Privalsky, M. L. (1991) Cell 66, 885-893
5. Damm, K., Thompson, C. C., and Evans, R. M. (1989) Nature 339, 593-597
6. Evans, R. M. (1988) Science 240, 889-895
7. Glass, C. K. (1994) Endocr. Rev. 15, 391-407
8. Yen, P. M., Ikeda, M., Brubaker, J. H., Forgione, M., Sugawara, A., and Chin, W. W. (1994) J. Biol. Chem. 269, 903-909
9. Kliewer, S., Umesono, K., Mangelsdorf, D. J., and Evans, R. M. (1992) Nature 355, 446-449
10. Chen, H., and Privalsky, M. L. (1993) Mol. Cell. Biol. 13, 5970-5980
11. Subauste, J. S., and Koenig, R. J. (1998) Mol. Endocrinol. 12, 1380-1392
12. Zechel, C., Shen, X., Chambon, P., and Gronemeyer, H. (1994) EMBO J. 13, 1414-1424
13. Mader, S., Chen, J., Chen, Z., White, J., Chambon, P., and Gronemeyer, H. (1993) EMBO J. 12, 5029-5041
14. Umesono, K., Murakami, K. K., Thompson, C. C., and Evans, R. M. (1991) Cell 65, 1255-1266
15. Mangelsdorf, D. J., Umesono, K., Kliewer, S. A., Borgmeyer, U., Ong, E. S., and Evans, R. M. (1991) Cell 66, 555-561
16. Mangelsdorf, D. J., and Evans, R. M. (1995) Cell 83, 841-850
17. Perlmann, T., Umesono, K., Rangarajan, P., Forman, B. M., and Evans, R. M. (1996) Mol. Endocrinol. 10, 958-966
18. Au-Fliegner, M., Helmer, E., Casanova, J., Raaka, B. M., and Samuels, H. H. (1993) Mol. Cell. Biol. 13, 5725-5737
19. Nagaya, T., and Jameson, J. L. (1993) J. Biol. Chem. 268, 15766-15771
20. O'Donnell, A. L., and Koenig, R. J. (1990) Mol. Endocrinol. 4, 715-720
21. Rosen, E. D., Beninghof, E., and Koenig, R. J. (1993) J. Biol. Chem. 268, 11534-11541
22. Rastinejad, F., Perlmann, T., Evans, R. M., and Sigler, P. B. (1995) Nature 375, 203-211
23. Zhao, Q., Chasse, S. A., Devarakonda, S., Sierk, M. L., Ahvazi, B., and Rastinejad, F. (2000) J. Mol. Biol. 18, 509-520
24. Bourguet, W., Ruff, M., Chambon, P., Gronemeyer, H., and Moras, D. (1995) Nature 375, 377-382
25. Nolte, R. T., Wisely, G. B., Westin, S., Cobb, J. E., Lambert, M. H., Kurokawa, R., Rosenfeld, M. G., Willson, T. M., Glass, C. K., and Milburn, M. V. (1998) Nature 395, 137-143
26. Kurokawa, R., Yu, V. C., Naar, A., Kyakumoto, S., Han, Z., Silverman, S., Rosenfeld, M. G., and Glass, C. K. (1993) Genes Dev. 7, 1423-1435
27. Yang, Y-Z., Burgos-Trinidad, M., Wu, Y., and Koenig, R. J. (1996) J. Bio. Chem. 271, 28235-28242
28. Reginato, M. J., Zhang, J. S., and Lazar, M. A. (1996) J. Biol. Chem. 271, 28199-28205
29. Cai, Z., Horton, R. M., Ho, S. N., and Pease, L. R. (1990) BioTechniques 8, 528-535
30. Leid, M., Kastner, P., Lyons, R., Nakshatri, H., Saunders, M., Zacharewski, T., Chen, J. Y., Staub, A., Garnier, J. M., Mader, S., and Chambon, P. (1992) Cell 68, 377-395
31. Prost, E., Koenig, R. J., Moore, D.D., Larsen, P. R., and Whalen, R. G. (1988) Nucleic Acids Res. 16, 6248
32. Subauste, J. S., and Koenig, R. J. (1995) J. Biol. Chem. 270, 7957-7962
33. Subauste, J. S., Katz, R. W., and Koenig, R. J. (1994) J. Biol. Chem. 269, 30232-30237
34. Koenig, R. J., Warne, R. L., Brent, G. A., Harney, J. W., Larsen, P. R., and Moore, D. D. (1988) Proc. Natl. Acad. Sci. U. S. A. 85, 5031-5035
35. Prost, E., and Moore, D. D. (1986) Gene (Amst.) 45, 107-111
36. Thompson, C. C., and Evans, R. M. (1989) Proc. Natl. Acad. Sci. U. S. A. 86, 3494-3498
37. Hadzic, E., Habeos, I., Raaka, B. M., and Samuels, H. H. (1998) J. Biol. Chem. 273, 10270-10278
38. Busch, K., Martin, B., Baniahmad, A., Martial, J. A., Renkawitz, R., and Muller, M. (2000) Mol. Endocrinol. 14, 201-211
39. Gothe, S., Wang, Z., Ng, L., Kindblom, J. M., Campos Barros, A., Ohlsson, C., Vennstrom, B., and Forres, D. (1999) Genes Dev. 13, 1329-1341
40. Nagaya, T., Madison, L. D., and Jameson, J. L. (1992) J. Biol. Chem. 267, 13014-13019
41. Piedrafita, F. J., Bendik, I., Ortiz, M. A., and Pfahl, M. (1995) Mol. Endocrinol. 9, 563-578
42. Safer, J. D., Cohen, R. N., Hollenberg, A. N., and Wondisford, F. E. (1998) J. Biol. Chem. 273, 30175-30182

Copyright © 2000 by The American Society for Biochemistry and Molecular Biology, Inc.
Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
 Mol. Endocrinol.Home page
A. M. Qazi, C.-H. Tsai-Morris, and M. L. Dufau
Ligand-Independent Homo- and Heterodimerization of Human Prolactin Receptor Variants: Inhibitory Action of the Short Forms by Heterodimerization
Mol. Endocrinol., August 1, 2006; 20(8): 1912 - 1923.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Endocrinol.Home page
G. M. C. Bonamy, A. Guiochon-Mantel, and L. A. Allison
Cancer Promoted by the Oncoprotein v-ErbA May Be Due to Subcellular Mislocalization of Nuclear Receptors
Mol. Endocrinol., May 1, 2005; 19(5): 1213 - 1230.
[Abstract] [Full Text] [PDF]