|
Originally published In Press as doi:10.1074/jbc.M005857200 on October 6, 2000
J. Biol. Chem., Vol. 275, Issue 52, 41175-41183, December 29, 2000
Latrophilin, Neurexin, and Their Signaling-deficient Mutants
Facilitate -Latrotoxin Insertion into Membranes but Are Not Involved
in Pore Formation*
Kirill E.
Volynski ,
Frédéric A.
Meunier §,
Vera
G.
Lelianova ,
Ekaterina E.
Dudina¶,
Tatyana M.
Volkova¶,
M. Atiqur
Rahman ,
Catherine
Manser ,
Eugene V.
Grishin¶,
J. Oliver
Dolly ,
Richard H.
Ashley , and
Yuri A.
Ushkaryov **
From the Biochemistry Department, Imperial College,
London, SW7 2AY, United Kingdom, Department of Biomedical
Sciences, University of Edinburgh, Edinburgh, EH8 9XD, United Kingdom,
and ¶ Shemyakin and Ovchinnikov Institute of Bioorganic Chemistry,
Russian Academy of Sciences, Moscow, 117871, Russia
Received for publication, July 5, 2000, and in revised form, September 11, 2000
 |
ABSTRACT |
Pure -latrotoxin is very inefficient at
forming channels/pores in artificial lipid bilayers or in the plasma
membrane of non-secretory cells. However, the toxin induces pores
efficiently in COS-7 cells transfected with the heptahelical receptor
latrophilin or the monotopic receptor neurexin. Signaling-deficient
(truncated) mutants of latrophilin and latrophilin-neurexin hybrids
also facilitate pore induction, which correlates with toxin binding
irrespective of receptor structure. This rules out the involvement of
signaling in pore formation. With any receptor, the -latrotoxin
pores are permeable to Ca2+ and small molecules
including fluorescein isothiocyanate and norepinephrine. Bound
-latrotoxin remains on the cell surface without penetrating
completely into the cytosol. Higher temperatures facilitate insertion
of the toxin into the plasma membrane, where it co-localizes with
latrophilin (under all conditions) and with neurexin (in the presence
of Ca2+). Interestingly, on subsequent removal of
Ca2+, -latrotoxin dissociates from neurexin but remains
in the membrane and continues to form pores. These receptor-independent
pores are inhibited by anti- -latrotoxin antibodies. Our results
indicate that (i) -latrotoxin is a pore-forming toxin, (ii)
receptors that bind -latrotoxin facilitate its insertion into the
membrane, (iii) the receptors are not physically involved in the pore
structure, (iv) -latrotoxin pores may be independent of the
receptors, and (v) pore formation does not require -latrotoxin
interaction with other neuronal proteins.
 |
INTRODUCTION |
-Latrotoxin (LTX)1
stimulates sustained release of various neurotransmitters and some
peptides from nerve terminals and endocrine cells but has a complex
mechanism of action (1-6). Importantly, before exerting any of its
effects, the toxin binds to presynaptic receptors (7): neurexin I
(NRX) (8) and latrophilin (LPH), also called CIRL (9, 10). NRX, a
single-pass transmembrane neuronal protein, resembles cell-contact
molecules and interacts with LTX only in the presence of
Ca2+ (8, 11, 12). LPH binds LTX strongly under all
conditions tested and, as a neuron-specific G protein-coupled receptor,
is likely to mediate intracellular signaling (13, 14).
One of the major effects of LTX binding to its receptors is the
induction of cation-permeable channels, or pores, in the cell membrane
(2, 6, 15). The pores play a profound role in the action of the toxin;
(i) influx of Ca2+ or other cations through such pores can
cause neurotransmitter release (12, 16-18), and (ii) cytoplasmic
neurotransmitters, including ATP, can leak out directly through these
pores (1, 12, 19, 20). However, the mechanism by which LTX induces the
pores and the role of the receptors in this action remain largely
unknown. The receptors could (i) mediate intracellular signaling
leading to the opening of endogenous channels, (ii) participate in the
pore structure or (iii) simply tether LTX to the cell surface, thus
allowing its insertion into the membrane to form pores. In addition,
other (non-receptor) proteins of the exocytotic apparatus could
participate in pore induction upon direct stimulation by the toxin. On
the other hand, LTX preparations can permeabilize artificial lipid
bilayers (21-23) and form pore-like tetrameric structures in liposomes
(24), suggesting that, under some conditions, the toxin is able to make
pores even in the absence of any receptors. It is unclear, however,
whether LTX acts in the same way upon binding to LPH or NRX and whether
these receptors are physically involved in the structure of the LTX pore.
The objective of this work was to analyze the roles that LPH and NRX
play in pore formation by LTX. We found that, in contrast to the crude
venom, highly purified LTX in physiological concentrations is very
inefficient in forming pores in lipid bilayers or receptor-less cells.
When expressed in non-secretory cells, the receptors, including signaling-deficient mutants, tether LTX to the plasma membrane with
subsequent formation of large pores permeable to ions and small
molecules. These pores remain open in the membrane even after LTX
dissociation from the receptor(s) and can be blocked by anti-LTX
antibody (Ab). Our findings suggest that LTX is the sole component of
the pores but only inserts efficiently into the plasma membrane if
recruited by any of its receptors.
 |
EXPERIMENTAL PROCEDURES |
Materials--
Bilayer lipids were purchased from Avanti; other
reagents were from Sigma. LTX was purified from the venom of
Latrodectus lugubris as described (25). Briefly, lyophilized
venom was dissolved in buffer B (50 mM Tris-HCl, pH 8.3, 0.15 M NaCl) containing 20 mM EDTA, applied on
to a high performance gel filtration column KW-803 (Waters) and eluted
with buffer A. Fractions containing LTX were subjected to ion exchange
chromatography on a Protein-Pak Q AP-1 column (Waters) eluted with a
gradient of NaCl. The LTX fraction (corresponding to conventional toxin
preparations (34)) was further purified by preparative native
electrophoresis using a 3.5-cm-long 6% polyacrylamide gel cast in a
model 491 Prep Cell (Bio-Rad). The electrophoresis buffer contained 25 mM Tris-HCl, 192 mM glycine, pH 8.3. Electrophoresis was carried out overnight at 200 V, with continuous
elution of proteins (monitored at 280 nm). LTX was pooled and
concentrated to 2-7 µM using a Centriprep 30 unit
(Amicon). Proteins obtained after each stage of purification were
carefully tested by SDS-polyacrylamide gel electrophoresis and
immunoblotting and assayed for toxicity, receptor binding, and
transmitter release (25).
Channel Formation in Lipid Bilayers--
Planar bilayers were
formed from pure lipids suspended at a total concentration of 30 mg/ml
in n-decane (Aldrich). Membranes containing POPE, equimolar
POPE/POPS, or an equimolar mixture of POPE, POPS, POPC, and cholesterol
were cast across a 0.3-mm-diameter hole in a polystyrene partition
separating two solution-filled chambers as described elsewhere (48,
49). Unless otherwise stated, the bilayers were exposed to symmetric
100 mM KCl buffered with 10 mM Tris-HCl, pH
7.4. The membranes were voltage-clamped using a Biologic RK-300 patch
clamp amplifier (Intracel, UK), and transmembrane currents were low
pass-filtered at 1-10 kHz ( 3-db point, 8-pole Bessel-type response)
and recorded.
Experiments were only carried out with membranes that thinned
spontaneously to give a capacitance of at least 250 picofarads and a
conductance of <10 picosiemens; junction potentials were routinely
nulled to within ± 1 mV. The cis side of the bilayer (the side to which LTX was added) was voltage-clamped relative to the
trans side, which was grounded, and we followed the standard electrophysiological current convention (i.e. positive
currents flowing cis to trans are shown as
positive, up-going currents). The contents of the chambers were changed
by perfusion ( 10 volumes) as required. Data were post-filtered and
digitally sampled at 5 times the filter corner frequency for analysis
using pClamp 6 (Axon) and other programs. Relative ion permeabilities
were calculated from reversal potentials measured under bi-ionic
conditions using appropriate forms of the Goldman-Hodgkin-Katz and
Fatt-Ginsborg equations.
Recombinant Receptors--
Rat latrophilin cDNA in
pBlueScript (13) was cleaved with HindIII and
EcoRI restrictases and subcloned into the same sites of the
pcDNA3.1 vector (Invitrogen). To produce LPH-FS lacking the
5'-untranslated region, the fragment between the HindIII and BamHI sites of the initial construct was replaced with a
shorter fragment, which was polymerase chain reaction (PCR)-amplified between primers CGTGCCCGCCCCAAGCTTTCGCCA (N77) and
GGGTCCGCAGGTCATATTTG. Latrophilin deletion mutants LPH-7TM and LPH-5TM
were prepared by PCR between N77 and oligonucleotides
GCACTTGCTGTACTTCTAGAGCACCTTTTT or ATGAGCTTCGGATCATCTAGAGCAGGGTC,
respectively, using latrophilin cDNA as a template. These fragments
were then digested with HindIII and XbaI and
ligated into the respective sites of pcDNA3.1. For LPH-1TM, LPH-FS
was cleaved with HpaI and NotI, and the deleted piece was replaced with a fragment obtained by PCR between primers GGAGAATGCCACAGTGAAGCTGGCAGGTGAG and AGGAAGCGGCCGCTGCACAGTTACTTGTGGATG (cut with the same enzymes). To make the LPH-NRX hybrid, an
intermediate construct was prepared by replacing the
XhoI/XbaI segment of the LPH-FS with a
PCR-amplified fragment between primers AAGGGAACTCGAGGAATTGCCTCG and
GGCCTCTAGAGAAGCAGAAGGTGG. Another fragment, obtained by PCR (between
CTTCTCTATGCTAGCTACAAGTACAG and TAAAAACAGTCTAGACTTCCTGATTGCA) on the NRX
template and cut with NheI and XbaI, was then
introduced into the XbaI site of the intermediate construct.
The full-size neurexin construct was prepared by directly subcloning a
KpnI-BglII fragment of the bovine cDNA for
neurexin I into pcDNA3.1. All mutations introduced were verified
by sequencing. DNA for transfection of mammalian cells was prepared
using Qiagen kits. Transfection of COS-7 cells maintained in
Dulbecco's modified Eagle's medium (Life Technologies, Inc.) was
carried out using the SuperFect transfection reagent (Qiagen) according
to the manufacturer's protocol.
Antibody Preparation--
Rabbit polyclonal Ab recognizing the
N-terminal domain of LPH was obtained by injecting rabbits with bovine
brain LPH purified by LTX affinity chromatography and
SDS-electrophoresis (9). The C terminus-specific Ab was obtained by
immunizing rabbits with a fusion protein consisting of glutathione
S-transferase and the LPH C terminus (cDNA fragment
3976-4856). LPH fusion proteins were constructed to affinity purify
these Abs; the N-terminal domain (nucleotides 630-2957) was subcloned
into the pGEX-4X vector in-frame with glutathione
S-transferase, whereas the C-terminal domain (nucleotides
3976-4856) was cloned into the pQE40 vector (Qiagen) in-frame with
dihidrofolate reductase. The fusion proteins were expressed in
Escherichia coli, purified by glutathione or Ni2+ affinity chromatography, and spot-blotted onto
pieces of Immobilon membrane (Millipore). These were used to purify the
LPH-specific Ab from respective sera as described (50). Anti-NRX Ab was
elicited in rabbits injected with keyhole limpet hemocyanin conjugated with the NRX C-terminal peptide (CSANKNKKNKDKEYYV) and
affinity-purified using this peptide immobilized on thiol-Sepharose
(Amersham Pharmacia Biotech).
Immunostaining Procedures--
COS-7 cells were grown on
multi-well chamber slides (Nunc) and transfected as described above.
One day after transfection, the cells were washed with PBS, fixed with
4% paraformaldehyde in PBS for 30 min at room temperature, and washed
again. Nonspecific binding sites were blocked by a 20-min incubation
with 3% (w/v) goat serum (Life Technologies, Inc.). In some
experiments, the cells were permeabilized with 0.05% Triton X-100. The
specimens were then incubated for 1 h with the respective primary
Ab, washed, incubated with a fluorescein-conjugated anti-rabbit IgG
(Sigma), washed, mounted using Vectashield mounting medium (Vector
Laboratories), and analyzed by confocal laser-scanning microscopy. In
some experiments, a fluorescent derivative of LTX was used, which was
obtained using the FluoroLink mAb labeling kit (Amersham Pharmacia
Biotech) according to the manufacturer's protocol. In
immunocytochemical experiments, the distribution pattern of the
fluorescently labeled LTX was identical to that of immunostained toxin.
For immunoblotting, COS-7 cells were detached from plates in ice-cold
PBS and pelleted by centrifugation. The pellets were then dissolved in
electrophoresis sample buffer containing 2% SDS, 100 mM
dithiothreitol, and 8 M urea (105 cells/50 µl
of buffer) for 30 min at 37 °C and separated in 6% SDS-polyacrylamide gels not containing urea. After electrophoresis, the
proteins were transferred onto Immobilon membrane (Millipore) and
visualized using primary Ab, goat anti-rabbit peroxidase-conjugated IgG, and chemiluminescent substrate (Pierce) followed by exposure onto
x-ray film.
Confocal Microscopy--
Specimens were imaged with a LSM 510 system (Zeiss) mounted on an upright microscope (Axioplan-2, Zeiss)
using dual excitation at 488 and 633 nm. Light emitted by doubly
stained preparations was analyzed using a combination of an FITC-type
narrow band-pass filter block (505-530 nm) and a long-pass filter
block ( 650 nm). Images were collected using oil immersion objective
(Plan-Neofluar, 40×/1.3, Zeiss) for fixed samples or a water immersion
objective (Achroplan, 40× W/0.8, Zeiss) for submerged unfixed samples.
To quantify the degree of co-localization, scatter diagrams for doubly stained samples were produced using the LSM 510 software (Zeiss). In
such diagrams, the brightness of each pixel in the red channel (Cy5-LTX) is interpreted as X coordinate, and that in the green channel
(immunostained NRX) is interpreted as Y coordinate; coordinates of
pixels that have similar intensity in both channels (co-localization) appear near the diagonal running from bottom left to top right of the graph.
Binding Experiments--
LTX was iodinated as described earlier
(34). When binding experiments were performed on culture plates, the
cells were incubated with 1 nM iodinated LTX in buffer A
(145 mM NaCl, 5 mM KCl, 1.2 mM
NaH2PO4, 2 mM MgCl2, 10 mM glucose, 20 mM HEPES, pH 7.4) in the
presence or absence of 2 mM CaCl2, then washed
with this buffer. Bound toxin was eluted from plates with 1% Triton
X-100. Alternatively, cells were scraped off the plates into PBS,
counted, then incubated with increasing concentrations of
[125I]LTX and filtered through GF/F glass fiber filters
(Whatman). Nonspecific binding was determined in the presence of a
100-fold excess of unlabeled toxin. The radioactivity of the Triton
eluate from plates and of the filters was measured in a
-spectrometer.
LTX-induced Influx into COS-7 Cells--
For influx experiments,
cells were plated at 50% confluence on 6-well tissue culture plates,
transfected with control or receptor plasmids, and 24 h later,
used in measurements of LTX-stimulated influx of
45Ca2+, [3H]NE, or FITC.
For 45Ca2+ influx, the cells were washed twice
with buffer A and incubated at room temperature for 5 min in the same
buffer supplemented with 2 mM CaCl2 and 2-4
µCi/ml 45Ca2+. One to five min after the
addition of 1-2 nM LTX, the cells were quickly washed
twice with buffer A. Alternatively, the toxin pores were pre-formed in
cells before the addition of 45Ca2+. For this
purpose, the cells were incubated with 1 nM LTX, washed with 0.2 mM EGTA, and kept in buffer A without
Ca2+ for a further 10-30 min at room temperature (anti-LTX
serum or purified IgG fraction was included in some experiments at this stage); influx was initiated by the addition of
Ca2+/45Ca2+. In all cases, after
the final wash, the cells were lysed in 0.5 ml of 10 mM
EDTA and 1% Triton X-100. The lysate was mixed with 10 ml of
UltimaGold scintillation mixture (Packard), and its radioactivity was
determined in a -spectrometer.
[3H]NE influx was measured in receptor- or
vector-transfected cells either by simultaneously adding LTX and
0.5-2.5 µCi of [3H]NE or by pre-forming LTX pores as
above, with subsequent addition of the label. Influx was determined
after 5 min by washing and lysing the cells.
To measure FITC influx, the cells were briefly washed with buffer A
(plus/minus 2 mM Ca2+) before the addition of 5 µM FITC with or without 4 nM LTX. After a
10-min incubation, the cells were extensively washed with buffer A and
immediately examined by confocal microscopy using a water immersion objective.
 |
RESULTS |
LTX Pores in Lipid Bilayers and Cells--
Recently, we introduced
a new improved LTX purification procedure (25) that uses an additional
step (preparative native electrophoresis) to remove several proteins
usually contaminating conventional LTX preparations (26). The resulting
highly purified LTX is fully active in biochemical and physiological
tests (25). Here, we compared the ability of this pure LTX and the
crude spider venom to form channels in artificial planar lipid bilayers
(21) containing different lipids and in the presence or absence of Ca2+. The addition of small amounts of the crude venom
(containing as little as 10 pM pure LTX) always gave rise
to channel activity within 2 min (Fig.
1A). Larger doses of the venom
(equivalent to 10 nM LTX) typically gave rise to
macroscopic conductances of >500 nanosiemens. The channels were
permeable to both Ca2+ and K+ and had
conductances ranging from 20 to 200 picosiemens, suggesting that the
venom contains several different channel-forming components. Relative
Ca2+/K+ selectivities (measured in
bi-ionic conditions in palmitoyloleoylphosphatidylethanolamine (POPE) bilayers) ranged from 0.45 ± 0.2 (mean ± S.D.,
n = 6) for 60-picosiemens channels to 1.6 ± 0.7 (mean ± S.D., n = 6) for 150-200-picosiemens
channels. Partially purified toxin (corresponding to conventional LTX
preparations) was much less active than the crude venom, typically
producing only 1-2 channels despite prolonged exposure (Fig.
1B).

View larger version (17K):
[in this window]
[in a new window]
|
Fig. 1.
LTX only forms pores in membranes containing
LTX receptors. A, examples of channels formed by crude
venom. An aliquot of black widow spider venom containing 10 pM LTX was added to an equimolar POPE/POPS bilayer cast in
100 mM KCl voltage-clamped at 100 mV (cis
minus trans). K+ currents flowing
trans to cis appear as downwards deflexions. The
closed (zero current) level is indicated by the upper horizontal
line. Data were filtered at 100 Hz. B, example
of channel formation by conventional (incompletely purified) LTX. Shown
is a 15-s recording from a POPE bilayer in symmetric 100 mM
KCl voltage-clamped at 100 mV and exposed to the ion exchange
fraction (25, 34) (containing the equivalent of 1 nM pure
LTX) added 2 min earlier to the cis chamber. Data were
filtered at 50 Hz. C, effect of adding Ca2+ and
venom to a bilayer exposed to pure LTX. Continuous recording from a
bilayer containing equimolar POPE/POPS/POPC/cholesterol in symmetric
100 mM KCl voltage-clamped at +40 mV and exposed to 10 nM pure LTX (added by stirring in for 1 min before starting
the recording). 2 mM CaCl2 and venom
(containing 10 pM LTX) were added as indicated. Note the
rapid increase in bilayer currents (upward deflections indicate net
positive currents flowing cis to trans) on adding
the venom. D, channel recordings from a very high
concentration of pure LTX. 15 s recording from a bilayer
containing equimolar POPE/POPS/POPC/cholesterol in symmetric 250 mM KCl voltage-clamped at 40 mV and exposed to >100
nM pure LTX, added as a bolus of 2 µM LTX
stock solution to the cis chamber. Channel openings give
rise to downwards deflections, and the upper horizontal line
indicates the main closed level. At least two channels appear to be
present. E, COS-7 cells (106 cells/plate) were
transfected with an empty expression vector or an LPH construct and
incubated with 45Ca2+ in the presence or
absence of 2 or 100 nM LTX. LTX-stimulated influx of
Ca2+ into the cells was measured as described under
"Experimental Procedures." Values are the mean ± S.E. At
physiological concentrations, LTX stimulates Ca2+
accumulation only in cells expressing LPH but not in control cells;
however, very high toxin concentrations can permeabilize the
receptor-deficient cells as well.
|
|
In contrast, 10 nM pure LTX (i.e. 1000-fold more
concentrated than in the venom) did not give rise to any channel
activity after periods of 20-60 min when added to more than 20 bilayers containing POPE and palmitoyloleoylphosphatidylserine (POPS), POPE alone, or a POPE/POPS/palmitoyloleoylphosphatidylcholine (POPC)/cholesterol mixture, irrespective of the presence of 2 mM Ca2+. The result was the same if membranes
were broken and reformed in the continued presence of LTX. To
illustrate these findings, Fig. 1C shows an experiment using
POPE/POPS/POPC/cholesterol bilayer. 10 nM LTX had no effect
over a prolonged period (note a different time scale), but there was
near-immediate channel activity on stirring in the venom equivalent to
10 pM LTX (confirming that the bilayer remained intact and
fusion-competent). These findings suggest that many pore-forming
constituents of the venom are gradually removed from LTX by the
purification procedure, resulting in a pure toxin that is unable to
form pores in pure lipid membranes at physiological concentrations. In
one experiment, we added a bolus of 2 µM LTX to produce a
final concentration of more than 100 nM (Fig.
1D). This did result in immediate channel activity, suggesting that pure LTX can induce membrane pores provided it is
present at extremely high concentrations. Unfortunately, the need for
these very large amounts of pure toxin precluded further, more detailed
experiments on planar bilayers.
On the other hand, nanomolar LTX is known to induce pores readily in
the membranes of neurons and endocrine cells or even non-secretory
cells expressing the toxin receptors (e.g. see Refs. 17 and
27-29). To investigate this phenomenon, we applied LTX to COS-7 cells
in the presence of extracellular 45Ca2+.
Consistent with its poor ability to permeabilize pure lipid bilayers, 2 nM LTX was unable to induce influx of Ca2+ into
vector-transfected cells (Fig. 1E). Only when the toxin concentration was elevated to more than 100 nM, did some
Ca2+ influx occur in control cells (Fig. 1E).
However, 2 nM LTX from the same toxin batch induced a large
accumulation of Ca2+ (Fig. 1E) by cells that had
been transfected with an LPH expression construct (13); this action
required millimolar extracellular [Mg2+] (12, 25). These
results indicated that the receptor was required for the induction of
LTX pores by a mechanism to be determined.
Generation and Features of LTX Receptor Constructs--
To study
the possibility that LPH-mediated signal transduction is involved in
the LTX pore formation, we produced a series of LPH deletion mutants
(Fig. 2A). Heptahelical
receptors require their cytoplasmic loops and the cytoplasmic tail in
order to interact functionally with G proteins (30-33), so these
domains were progressively removed in the receptor mutants. As a
result, functional coupling to G proteins was abolished2
in the mutants LPH-N5TM, LPH-N3TM and LPH-N1TM, which contain five, three, and one transmembrane domain (TM), respectively. To
independently test whether the receptor itself makes part of the pore,
a structurally different LTX receptor, NRX I , was also expressed
(Fig. 2A). In addition, a LPH-NRX hybrid was obtained by
fusing the cytoplasmic domain of NRX to the C terminus of LPH-N1TM.

View larger version (42K):
[in this window]
[in a new window]
|
Fig. 2.
LTX receptors and their mutants used in
this work. A, the structures, putative membrane
topographies, and nomenclature of the recombinant receptors.
B, SDS-gel analysis of the receptors and mutants expressed
in COS-7 cells. Cells were transfected with respective constructs and
solubilized as described under "Experimental Procedures." Proteins
were separated by electrophoresis (105
cells/lane) in 6% gels, transferred onto Immobilon
membrane, and stained with the primary Ab (as indicated),
peroxidase-conjugated secondary Ab, followed by chemiluminescent
visualization. The upper bands represent dimers of some
mutant proteins. Note that the C-terminal Ab recognizes LPH-FS whose
proteolytic cleavage (51) is undetectable in this experiment.
|
|
When expressed in COS-7 cells, the recombinant LPH mutants had
molecular masses consistent with the addition of approximately 15 kDa
due to glycosylation (Fig. 2B). All these constructs could be purified from solubilized cells by LTX affinity chromatography (not
shown), indicating that expression in non-neuronal cells and the
mutagenesis did not abolish the affinities of the receptors for
LTX.
Immunostaining of non-permeabilized cells transfected with the LPH
mutants revealed that most of these proteins were transported to the
plasma membrane (Fig. 3A).
However, cells that abundantly expressed LPH-N1TM (which could be
isolated from solubilized cells on an LTX column) did not display this
mutant on their surface and did not bind LTX (see Fig.
4A), probably because the
mutant protein lacked plasma membrane delivery signals. All the other LPH mutants were surface-expressed and bound LTX independently of
Ca2+, although with different affinities. Thus, LPH-N7TM
that lacks only the cytoplasmic tail was indistinguishable from the
full-size LPH (LPH-FS, Kd ~ 4 nM),
whereas other constructs containing fewer transmembrane domains
(including the LPH-NRX hybrid, not shown) had lower affinities for the
toxin and reduced numbers of receptors on the cell surface (Fig.
3B). COS-7 cells transfected with NRX also bound the toxin
but in a strictly Ca2+-dependent manner
(Kd ~ 7.5 nM) (Fig. 3B); in
addition, fewer receptor sites were present on the surface of
NRX-expressing cells than in the case of LPH-FS.

View larger version (33K):
[in this window]
[in a new window]
|
Fig. 3.
Surface expression of the recombinant
receptors and LTX binding. A, immunolocalization of
expressed LPH mutants in COS-7 cells. To demonstrate the synthesis of
mutant proteins, transfected cells were permeabilized and
stained with the LPH N-terminal Ab or NRX C-terminal Ab
(left). Surface delivery of the expressed proteins was
assessed using the same Abs on non-permeabilized cells
(right). Note the lack of surface exposure of LPH-1TM
despite its abundant production by the cells (NRX cannot be detected in
non-permeabilized cells because the Ab only recognizes its cytoplasmic
domain). B, Scatchard plot analysis of LTX binding to some
receptors. Cells were dislodged from plates 24 h after
transfection (2 × 105 cells/point), and their binding
of [125I]LTX was measured as explained under
"Experimental Procedures." Note that LPH-7TM has the same binding
capacity and affinity as LPH-FS, whereas LTX binding to NRX,
LPH-5TM, and LPH-N3TM is 2-, 4.5-, and 3-fold weaker, respectively.
LPH-1TM lacking all but the first transmembrane domain does not bind
LTX due to the lack of surface delivery.
|
|

View larger version (25K):
[in this window]
[in a new window]
|
Fig. 4.
LTX pores in receptor-expressing COS cells
are permeable to Ca2+. A, specific binding
of [125I]LTX to and influx of Ca2+ into cells
transfected with different receptor constructs. The binding to the
cells in situ was measured 24 h after transfection
(3 × 105 cells/well). In parallel, the cells were
incubated with 45Ca2+ in the presence of 1 nM LTX. The cells accumulated the radioactive tracer in
accordance with their binding of the toxin. In some experiments, before
the addition of 45Ca2+, LTX had been added to
the cells in the absence of this cation (0.2 mM EGTA) and
then washed away (Binding in EGTA); subsequently,
Ca2+ was taken up only by the LPH, but not the NRX, cells.
Data (±S.E.) are from a representative experiment done in triplicate.
B, rate of Ca2+ influx. Cells expressing LPH-FS
or NRX were incubated with 45Ca2+ as above;
upon the addition of 1 nM LTX, the cells were harvested
after specified periods of time. Data (±S.E.) are from two independent
experiments. C, time course of specific (spec.) LTX binding.
The LPH and NRX cells were incubated with 1 nM
[125I]LTX, and the amount of bound toxin was determined
after the same time periods as in B. Data are from
representative experiments carried out in duplicate. Note that the rate
of Ca2+ influx is slower in NRX-expressing cells, probably
due to a lower amount of bound toxin.
|
|
LTX-induced Pores Are Permeable to Ca2+ and Small
Molecules--
As shown in Fig. 1E, LTX
stimulates 45Ca2+ influx into LPH-expressing
COS cells. Similarly, NRX-transfected cells also accumulated 45Ca2+ in the presence of LTX (Fig.
4A). Most importantly, even LPH mutants unable to activate G
proteins (e.g. LPH-N3TM and LPH-NRX) stimulated pore
formation. After a 5-min exposure to LTX (Fig. 4A), the
total amount of 45Ca2+ uptake by the
receptor-transfected cells correlated with the binding capability of
the expressed receptor, i.e. the more toxin was bound to the
cells, the more tracer was accumulated irrespective of receptor
structure. This was also reflected in a slower initial rate of Ca2+ uptake by the NRX cells compared with the LPH
cells (Fig. 4B). This was not due to slower LTX
association with NRX; in fact, toxin binding to NRX reached a maximum
even faster but remained lower than in the case of LPH (Fig.
4C). Our experiments also directly showed that to induce the
pore, LTX must physically bind to the cell surface receptor rather than
just contact the cell. Indeed, when NRX cells were treated with 10 nM LTX in the absence of Ca2+, they did not
accumulate 45Ca2+ added after toxin removal
(Fig. 4A).
Previously, we demonstrated that the toxin pores in neuronal plasma
membrane are permeable not only to cations but also to small molecules
such as norepinephrine (NE), D-aspartate, and fluorescein
isothiocyanate (FITC) (12). This approach was also used here to study
the channels induced by the toxin in non-neuronal cells. When COS-7
cells, transfected with LPH, NRX, or vector DNA, were incubated with
FITC without added toxin, they did not accumulate the dye (not shown).
However, when FITC was added in the presence of LTX,
receptor-expressing, but not control, cells became fluorescent (Fig.
5A). Upon washout, the dye
quickly dissipated from the cytosol, suggesting that the toxin pore
allowed FITC diffusion into and out of the cytoplasm. Importantly, the
nuclei of these cells also accumulated and retained the dye (Fig.
5A). Diffusion of FITC from the cytoplasm into the nucleus
(probably via the nuclear pores) strongly suggests that the dye was not simply present in vesicles taken up by endocytosis.

View larger version (35K):
[in this window]
[in a new window]
|
Fig. 5.
LTX pores are permeable to small molecules.
A, LPH-, NRX-, or vector-transfected COS cells were treated
with 4 nM LTX for 10 min in the absence or presence of 2 mM Ca2+ (as indicated), washed and incubated
with 5 µM FITC, and quickly washed and imaged by confocal
microscopy. N, nucleus. Note that only receptor-expressing
cells are permeable to FITC and only upon the addition of LTX.
Scale bars, 20 µm. B, influx of
[3H]NE into LPH- or vector-transfected cells (details
under "Experimental Procedures"). Values (normalized for
transfected cells) are the mean ± S.E. from a representative
experiment.
|
|
Neurotransmitters are known to leak out of the neuronal cytoplasm via
the LTX pore (12, 19); therefore, we tested the permeability of the
toxin pore in non-secretory cells to [3H]NE. COS-7 cells
expressing the receptors took up this neurotransmitter but only on the
addition of LTX (Fig. 5B); again, uptake correlated with the
toxin binding (not shown). Overall, the results of the influx
experiments suggest that (i) when exogenous receptors are expressed on
the surface of cells not normally responsive to LTX, the toxin
permeabilizes the membrane of such cells to cations and small
molecules, (ii) the toxin pores are similar to those made by LTX in
neurons containing native receptors, and (iii) receptor-mediated
intracellular signaling is unlikely to be involved in the induction of
the pore.
LTX Inserts into the Cell Membrane--
To further characterize
the interaction of LTX with the surface of receptor-expressing COS-7
cells, we used confocal immunofluorescent microscopy. Upon binding of
LTX covalently labeled with a fluorophore (Cy5), the cells were fixed
and then permeabilized to immunostain the C-terminal domains of LPH or
NRX with appropriate fluorescently labeled Abs. We found that the toxin
bound only to the cells expressing recombinant receptors and, as
demonstrated in Fig. 6, A and
B, remained on the cell surface where it co-localized with
the receptors in a patchy pattern (arrows). In the LPH
cells, toxin fluorescence coincided with the staining for LPH at all
times (Fig. 6A). However, in the case of NRX, some of the
toxin fluorescence appeared separate from the receptor staining (Fig.
6B, arrowhead), suggesting that, upon binding,
LTX can remain on the cell surface even in the absence of direct
contact with the receptor protein.

View larger version (33K):
[in this window]
[in a new window]
|
Fig. 6.
Co-localization of LTX with receptors in cell
membrane. A and B, LPH- and NRX-expressing
cells were incubated with Cy5-labeled LTX in buffer A containing 2 mM CaCl2 for 10 min, washed, fixed, and stained
with respective anti-receptor Ab, and visualized by confocal
fluorescent microscopy. Scale bars, 20 µm. Note the
complete co-localization of LTX with the LPH C-terminal staining
(arrows) and partial co-localization of LTX and NRX (free
toxin is shown by an arrowhead). C, LTX remains
membrane-bound after dissociating from receptor in NRX-expressing
cells. The NRX cells were first incubated for 10 min with LTX in the
presence of 2 mM Ca2+, washed with 0.2 mM EGTA, incubated in an EGTA-containing buffer for a
further 10-30 min, then fixed and immunostained with anti-NRX Ab as
above. D, scatter diagrams (see "Experimental
Procedures") showing analysis of co-localization of Cy5-labeled LTX
with immunostained NRX after incubation of cells in the continued
presence of Ca2+ (left, n = 6)
or after subsequent removal of cation (right,
n = 9). Spots along the diagonal line correspond to LTX
co-localizing with NRX; spots along the x axis
(arrowheads) correspond to free toxin.
|
|
The nature of this toxin interaction with the cell surface was further
studied in NRX-expressing cells because LTX-NRX interaction is strictly
Ca2+-dependent (11, 12), and the removal of
this cation provides a convenient way to dissociate the toxin from the
receptor. Furthermore, even solubilized NRX does not interact with the
toxin in the absence of Ca2+ (12), suggesting that not only
surface-bound but also membrane-inserted LTX should lose its contact
with NRX upon the addition of EGTA. Here, we first allowed the
fluorescent LTX derivative to bind to the NRX cells in a
Ca2+-containing buffer and then washed the cells with EGTA.
After incubation in the absence of Ca2+, the cells were
fixed and immunostained for NRX. As predicted, the co-localization of
the toxin and the receptor largely disappeared, although LTX remained
on the cell surface (Fig. 6C, arrowheads). Statistical analysis (Fig. 6D) demonstrates that, in the
presence of Ca2+ (left panel), there was no free
toxin on the cells (absence of pixels along the red axis) as
it all co-localized with NRX (spots concentrating along the diagonal).
However, upon Ca2+ removal (right panel), almost
all cell-bound toxin appeared separate from NRX
(arrowheads). This could be due to lateral diffusion of
membrane-inserted LTX.
To confirm that LTX did indeed insert into the membrane, we applied
toxin to broken membranes from NRX-expressing cells at low or high
temperatures in the presence of Ca2+. When the LTX-NRX
interaction was subsequently disrupted by the addition of EGTA, the
bound toxin dissociated from the cells much faster if the binding had
been induced at 4 °C (Fig.
7A); conversely, when the
binding had been done at 28 °C, a large proportion of LTX remained
bound (Fig. 7A; see also Fig. 6D). Notably, only the initial rate of dissociation was greatly different, whereas the
later, very slow dissociation phase followed the same pattern in both
cases. This suggests that the residual LTX binding at both temperatures
had the same nature and was much stronger. Since endocytotic uptake by
broken cell membranes was not possible, the very strong interaction of
LTX with the cell surface was most likely due to membrane insertion of
the toxin, which was facilitated by elevated temperatures. Likewise,
temperature strongly affected the interaction of the toxin with rat
brain nerve terminal membranes, where LTX displays a lower dissociation
constant at 37 °C (Kd ~ 1.5 nM)
than at 0 °C (Kd > 6 nM) (Fig.
7B, left). At intermediate temperatures, both
dissociation constants are regularly observed (Fig. 7B,
right) (e.g. Refs. 34 and 35). Importantly, LTX
shows similar two dissociation constants even when only one receptor
(LPH) is expressed in the nerve terminals of NRX knockout mice (35),
indicating that the complex binding pattern is not associated with the
presence of two distinct receptor proteins. Taken together, these
findings are consistent with the idea that LTX binding to receptors is
followed by its insertion into the lipid bilayer, which is facilitated
by permissive temperatures, although some incorporation can occur even
at low temperature.

View larger version (19K):
[in this window]
[in a new window]
|
Fig. 7.
LTX interaction with the membrane of
receptor-expressing cells is temperature-dependent.
A, membranes from NRX-transfected COS cells (corresponding
to 2 × 105 cells/point) were incubated with
[125I]LTX in suspension in the presence of 2 mM Ca2+ at 0-4 or 28 °C (as indicated) and
quickly washed with an ice-cold buffer containing 5 mM
EGTA. Toxin remaining bound to these membranes was measured by
filtration. Note that the initial rate of LTX dissociation is much
slower if the binding was carried out at high temperature. Values are
mean ± S.E. B, Scatchard plots of
[125I]LTX interaction with rat brain synaptosomes (1 mg
of protein/ml). The binding was measured at 0 or 37 °C
(left, as indicated) or at 20 °C (right). The
respective Kd values are 1.6 nM
(37 °C) and >6 nM (0 °C). At 20 °C, the two
constituting types of binding are shown by dotted lines.
B, bound [125I]LTX; F, free
[125I]LTX concentration.
|
|
LTX Continues to Form Pores after Dissociating from
Receptor--
Our interesting observation that LTX stays inserted into
the membrane but can dissociate physically from NRX suggested a method for testing whether this receptor was forming a part of the
toxin-induced pore (Fig. 8A).
We therefore studied the permeability of the cell membrane after LTX
had been allowed to dissociate from NRX. As shown in Fig.
8B, Ca2+ (added to NRX-expressing cells after
pre-treatment with LTX and a 10-30-min incubation in the absence of
this cation) very quickly entered the cells through the LTX pore.
However, the re-introduced Ca2+ could potentially stimulate
some re-association of the membrane-inserted LTX with NRX. To avoid
this uncertainty, we looked at the influx of NE through the pre-formed
toxin pores detached from NRX; this allowed us to monitor the pore in
the continued absence of Ca2+. Under these conditions, NE
still accumulated in NRX cells (Fig. 8C). Moreover, the
pre-formed LTX pores were also permeable to FITC (Fig. 8D).
The influx of both compounds was even stronger in the absence of
Ca2+ than in its presence. Thus, the persistence of the
pore was most likely due to the ability of the toxin to form pores in
the membrane even in the absence of its direct interaction with
NRX.

View larger version (24K):
[in this window]
[in a new window]
|
Fig. 8.
LTX pores are still active even after
dissociating from receptor. A, scheme of the
experiment. LTX was bound to NRX-transfected cells (3 × 105 cells/well) for 10 min in 0.1 mM
Ca2+, and the cells were washed with 0.2 mM
EGTA. After a 10-30-min incubation at room temperature in a
Ca2+-free buffer, 45Ca2+,
[3H]NE, or FITC was added, and the accumulation of each
substance by the cells was measured using an appropriate method.
B-D, the cells prepared as in A were incubated
for 5 min with 2 mM
Ca2+/45Ca2+ or for 5 min with
0.5-2.5 µCi of [3H]NE or 5 µM FITC in an
EGTA-containing buffer. Scale bar, 20 µm. E, LTX pores can
be blocked by anti-LTX Ab. LTX pores were pre-formed in NRX-expressing
cells as in A, and the pre-immune or anti-LTX serum was
included during the 30-min incubation (1:20 dilution). 2 mM
Ca2+/45Ca2+ was then added, and the
influx of 45Ca2+ was measured after 5 min as
described under "Experimental Procedures." Values are mean ± S.E. from representative experiments repeated several times in
duplicate.
|
|
The LTX Pore Can Be Blocked by Anti-LTX Antibodies--
Our
experiments (Figs. 4, 5, and 8) strongly implied that intracellular
signaling was not involved in the pore induction but could not rule out
the possibility that LTX, by directly interacting with receptors or
some endogenous cellular proteins, induced pore formation by these
proteins themselves. To provide an unambiguous demonstration that LTX
itself is involved in the pore structure, we applied anti-LTX Ab to NRX
cells containing pre-formed LTX pores dissociated from the receptor.
The immune serum inhibited Ca2+ influx through such pores,
whereas the pre-immune serum was ineffective (Fig. 8E). This
result strongly suggests that LTX alone forms the pore.
 |
DISCUSSION |
Channel formation by LTX has been puzzling: it was unclear why
this toxin forms pores in lipid bilayers but not in cells that do not
express LTX receptors. Unfortunately, previous work did not compare the
same toxin preparations on both lipid bilayers and receptor-deficient
cells. Such comparison made in our work proves unequivocally that LTX
alone is a very inefficient pore former; experiments with lipid
bilayers and control COS-7 cells (Fig. 1) demonstrate that pure LTX at
concentrations up to 10 nM is unable to form pores in
membranes (artificial or biological) in the absence of LTX receptors.
Moreover, the strong pore-forming activity of the venom gradually
disappears with LTX purification. Therefore, previous observations of
pores in artificial lipid membranes made at low nanomolar LTX
concentrations (21-23) must be attributed to residual contamination by
other venom components. Indeed, LTX used in bilayer experiments was
routinely purified by one-step ion-exchange chromatography
(e.g. Refs. 22 and 23), although even the original paper
describing toxin purification pointed out the incomplete homogeneity of
LTX even after a two-step procedure (26). The large variety of channels
obtained with the crude venom (Fig. 1A) and with different
toxin preparations (e.g. Refs. 17, 23, 28, 36, and 37) also
suggests that other venom components either form channels themselves or
help LTX to insert into the membrane. In fact, at concentrations above 100 nM, the pure toxin can insert into liposomes (24),
planar bilayers (Fig. 1D), and biological membranes (Fig.
1E). However, receptors present on the cell surface
facilitate LTX pore formation by more than 100-fold (Fig.
1E).
What is the role of the receptors in membrane pore formation by LTX?
When the toxin pores are studied in native secretory cells
(neuroblastoma (17), chromaffin cells (6), gonadotropes (38)) or in
secretory cells transfected with exogenous receptors (39, 40), one
cannot totally exclude the involvement of intracellular signaling in
pore induction because such cells possess endogenous NRX and LPH as
well as receptor-linked pathways and non-receptor exocytotic proteins.
Similarly, injection of non-secretory cells (Xenopus
oocytes) with heterogeneous neuronal mRNA cannot demonstrate which
receptor(s) or other neuronal proteins are involved in LTX pore
formation (28). A more analytical approach was used in recent work (37,
41) based on electrophysiological characterization of LTX pores induced
in non-secretory (HEK293 and BHK, respectively) cells transfected only
with LPH, NRX, or mutant receptors. The results demonstrated that LTX
makes pores on binding to any of its receptors.
In our present work too, introduction of LTX-binding proteins,
including various receptor mutants, into non-secretory cells rendered
them susceptible to the pore-forming activity of the toxin (Figs. 1, 4,
5, and 8). COS-7 cells are not capable of regulated exocytosis and lack
most of the components of the exocytotic machinery present in endocrine
or neuronal cells. Thus, specific neuronal proteins cannot be involved
in the formation of the toxin pore in these cells. In addition, pore
formation depends on the amount of bound LTX rather than on the type of
receptor expressed (Fig. 4). Moreover, even receptor mutants that
cannot mediate signaling (LPH-5TM, LPH-3TM, and LPH-NRX) allow the
toxin to form pores, indicating that signal transduction is not
involved in the induction of the pore.
Do LPH or NRX contribute to the structure of the pore or just recruit
the toxin to the membrane? LPH and NRX have very different membrane
domain structures; therefore, if the receptors indeed formed the pore
together with LTX, such pores would have had different characteristics.
However, the pores induced by LTX in HEK293 or BHK cells transfected
with LPH, NRX, or their mutants have very similar electrophysiological
parameters (37, 41). In our experiments too, the features of the toxin
pores do not depend on the receptor structure (Figs. 4, 5, and 8).
Furthermore, at least in the case of NRX, the toxin can dissociate from
the receptor and remain in the membrane (Figs. 6 and 7), continuing to
form pores with the same macro characteristics (Fig. 8). Although such
dissociation apparently cannot be achieved for LPH, this receptor is
also unlikely to be physically involved in the pore because its mutants
with different numbers of transmembrane domains support the induction of similar LTX pores (Fig. 4 and data not shown).
Thus, our results suggest that the toxin itself forms pores, but how
does this hydrophilic toxin insert into the membrane? Using
cryo-electron microscopy, we recently visualized the toxin pores in the
membrane of liposomes and revealed the likely mechanism of pore
formation (24). LTX in solution exists as a homodimer (24, 25), but
when its local concentration increases (e.g. upon receptor
binding) and, especially in the presence of divalent cations (25), the
dimers assemble into tetramers; this rearrangement renders one side of
the tetramer hydrophobic. The tetramers can then incorporate into a
lipid bilayer. In the center, the tetramer has a channel of 10-25 Å in diameter that spans the membrane. Strikingly, a very similar
diameter (~19 Å) was estimated for LTX water pores in lipid bilayers
(23). Our tetramer/pore model (24, 25) is consistent with the
permeability of the toxin pore to different cations, amino acids, NE,
and FITC (largest dimension, 12 Å) but not to small dextrans or
cytoplasmic proteins (12, 14). Based on this model, the receptors may
act both by increasing the near-membrane toxin concentration (thus,
aiding LTX tetramerization) and by orientating the tetramers with their hydrophobic side toward the membrane. Receptors serving as specific anchors for inefficient pore-forming toxins can also explain the phylum
specificity of the members of latrotoxin family, which have very
similar mechanisms of action but only interact with receptors in their
target animals (26, 42).
Can pore formation by LTX explain all of its dramatic effects on a
secretory cell? We showed that most of LTX-induced secretion correlates
directly with formation of tetramers and pores (25). Massive influx of
Ca2+ and other cations through these pores can stimulate
exocytosis directly (6, 17, 40, 43) or indirectly by mobilizing intracellular Ca2+ (12, 17, 38, 44); in addition, leakage
of cytosolic constituents (12, 19, 20) can further destabilize and
stimulate the cell. But do the receptors mediate at least some of LTX
action? To answer this question properly, one should use a LTX
derivative that is unable to form pores; otherwise, the robust effects
of the membrane pore always mask the subtle receptor-mediated
mechanisms. Indeed, even signaling-deficient receptor mutants, by
binding LTX, support toxin pore formation and Ca2+ influx.
Ironically, an increased sensitivity of endocrine cells to LTX (in the
presence of Ca2+) upon super-transfection with receptor
mutants was used to suggest that the receptors do not transmit
exocytotic signals (40, 45, 46). However, neither these results nor the
data presented in this paper exclude the possibility that
receptor-mediated signaling may be involved in some aspects of
secretion stimulated by LTX, especially at low extracellular
Ca2+, as has been suggested by many authors (12, 14, 39,
44, 47). Thus, although the pore formation is very important for the
action of the toxin, the natural role of LTX receptors remains uncertain. Future work will be needed to address the functions of both
LTX receptors.
 |
ACKNOWLEDGEMENTS |
We thank A. C. Ashton for helpful discussions.
 |
FOOTNOTES |
*
This work was supported by the Wellcome Trust (a Senior
European Research Fellowship (to Y. A. U.), 058894 (to E. V. G.), and Project Grant 055498 (to R. H. A.)) and European Commission Biotechnology Program Grant B104CT965119 (to F. A. M.).The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
§
Present address: Imperial Cancer Research Fund, London, WC2A 3PX, UK.
**
To whom correspondence should be addressed. Tel.:
44-(0)20-7594-5237; Fax: 44-(0)20-7594-5207; E-mail:
y.ushkaryov@ic.ac.uk.
Published, JBC Papers in Press, October 6, 2000, DOI 10.1074/jbc.M005857200
2
Y. A. Ushkaryov, unpublished data.
 |
ABBREVIATIONS |
The abbreviations used are:
LTX, -latrotoxin;
Ab, antibody;
FITC, fluorescein isothiocyanate;
LPH, latrophilin;
LPH-FS, full-size LPH;
NE, norepinephrine;
NRX, neurexin I ;
PCR, polymerase chain reaction;
POPC, palmitoyloleoylphosphatidylcholine;
POPE, palmitoyloleoylphosphatidylethanolamine;
POPS, palmitoyloleoylphosphatidylserine;
TM, transmembrane domain.
 |
REFERENCES |
| 1.
|
Gorio, A.,
Hurlbut, W. P.,
and Ceccarelli, B.
(1978)
J. Cell Biol.
78,
716-733
|
| 2.
|
Grasso, A.,
Alema, S.,
Rufini, S.,
and Senni, M. I.
(1980)
Nature
283,
774-776
|
| 3.
|
Kobayashi, H.,
Izumi, F.,
and Meldolesi, J.
(1986)
Neurosci. Lett.
65,
114-118
|
| 4.
|
Rosenthal, L.,
and Meldolesi, J.
(1989)
Pharmacol. Ther.
42,
115-134
|
| 5.
|
De Potter, W. P.,
Partoens, P.,
Schoups, A.,
Llona, I.,
and Coen, E. P.
(1997)
Synapse
25,
44-55
|
| 6.
|
Liu, J.,
and Misler, S.
(1998)
J. Neurosci.
18,
6113-6125
|
| 7.
|
Meldolesi, J.
(1982)
J. Neurochem.
38,
1559-1569
|
| 8.
|
Ushkaryov, Y. A.,
Petrenko, A. G.,
Geppert, M.,
and Sudhof, T. C.
(1992)
Science
257,
50-56
|
| 9.
|
Davletov, B. A.,
Shamotienko, O. G.,
Lelianova, V. G.,
Grishin, E. V.,
and Ushkaryov, Y. A.
(1996)
J. Biol. Chem.
271,
23239-23245
|
| 10.
|
Krasnoperov, V. G.,
Beavis, R.,
Chepurny, O. G.,
Little, A. R.,
Plotnikov, A. N.,
and Petrenko, A. G.
(1996)
Biochem. Biophys. Res. Commun.
227,
868-875
|
| 11.
|
Davletov, B. A.,
Krasnoperov, V.,
Hata, Y.,
Petrenko, A. G.,
and Sudhof, T. C.
(1995)
J. Biol. Chem.
270,
23903-23905
|
| 12.
|
Davletov, B. A.,
Meunier, F. A.,
Ashton, A. C.,
Matsushita, H.,
Hirst, W. D.,
Lelianova, V. G.,
Wilkin, G. P.,
Dolly, J. O.,
and Ushkaryov, Y. A.
(1998)
EMBO J.
17,
3909-3920
|
| 13.
|
Lelianova, V. G.,
Davletov, B. A.,
Sterling, A.,
Rahman, M. A.,
Grishin, E. V.,
Totty, N. F.,
and Ushkaryov, Y. A.
(1997)
J. Biol. Chem.
272,
21504-21508
|
| 14.
|
Rahman, M. A.,
Ashton, A. C.,
Meunier, F. A.,
Davletov, B. A.,
Dolly, J. O.,
and Ushkaryov, Y. A.
(1999)
Philos. Trans. R. Soc. Lond-Biol. Sci.
354,
379-386
|
| 15.
|
Nicholls, D. G.,
Rugolo, M.,
Scott, I. G.,
and Meldolesi, J.
(1982)
Proc. Natl. Acad. Sci. U. S. A.
79,
7924-7928
|
| 16.
|
Rosenthal, L.,
Zacchetti, D.,
Madeddu, L.,
and Meldolesi, J.
(1990)
Mol. Pharmacol.
38,
917-923
|
| 17.
|
Hurlbut, W. P.,
Chieregatti, E.,
Valtorta, F.,
and Haimann, C.
(1994)
J. Membr. Biol.
138,
91-102
|
| 18.
|
Barnett, D. W.,
Liu, J.,
and Misler, S.
(1996)
Pfluegers Arch. Eur. J. Physiol.
432,
1039-1046
|
| 19.
|
McMahon, H. T.,
Rosenthal, L.,
Meldolesi, J.,
and Nicholls, D. G.
(1990)
J. Neurochem.
55,
2039-2047
|
| 20.
|
Deri, Z.,
Bors, P.,
and Adam-Vizi, V.
(1993)
J. Neurochem.
60,
1065-1072
|
| 21.
|
Finkelstein, A.,
Rubin, L. L.,
and Tzeng, M. C.
(1976)
Science
193,
1009-1011
|
| 22.
|
Mironov, S. L.,
Sokolov, Yu. V.,
Chanturiya, A. N.,
and Lishko, V. K.
(1986)
Biochim. Biophys. Acta
862,
185-198
|
| 23.
|
Krasilnikov, O. V.,
and Sabirov, R. Z.
(1992)
Biochim. Biophys. Acta
1112,
124-128
|
| 24.
|
Orlova, E. V.,
Rahman, M. A.,
Gowen, B.,
Volynski, K. E.,
Ashton, A. C.,
Manser, C.,
van Heel, M.,
and Ushkaryov, Y. A.
(2000)
Nat. Struct. Biol.
7,
48-53
|
| 25.
|
Ashton, A. C.,
Rahman, M. A.,
Volynski, K. E.,
Manser, C.,
Orlova, E. V.,
Matsushita, H.,
Davletov, B. A.,
van Heel, M.,
Grishin, E. V.,
and Ushkaryov, Y. A.
(2000)
Biochimie (Paris)
82,
453-468
|
| 26.
|
Frontali, N.,
Ceccarelli, B.,
Gorio, A.,
Mauro, A.,
Siekevitz, P.,
Tzeng, M. C.,
and Hurlbut, W. P.
(1976)
J. Cell Biol.
68,
462-479
|
| 27.
|
Meldolesi, J.,
Huttner, W. B.,
Tsien, R. Y.,
and Pozzan, T.
(1984)
Proc. Natl. Acad. Sci. U. S. A.
81,
620-624
|
| 28.
|
Filippov, A. K.,
Tertishnikova, S. M.,
Alekseev, A. E.,
Tsurupa, G. P.,
Pashkov, V. N.,
and Grishin, E. V.
(1994)
Neuroscience
61,
179-189
|
| 29.
|
Liu, J.,
and Misler, S.
(1998)
Brain Res.
799,
55-63
|
| 30.
|
Liu, J.,
Conklin, B. R.,
Blin, N.,
Yun, J.,
and Wess, J.
(1995)
Proc. Natl. Acad. Sci. U. S. A.
92,
11642-11646
|
| 31.
|
Wess, J.,
Blin, N.,
Mutschler, E.,
and Bluml, K.
(1995)
Life Sci.
56,
915-922
|
| 32.
|
Mathi, S. K.,
Chan, Y.,
Li, X.,
and Wheeler, M. B.
(1997)
Mol. Endocrinol.
11,
424-432
|
| 33.
|
Okamoto, Y.,
Ninomiya, H.,
Tanioka, M.,
Sakamoto, A.,
Miwa, S.,
and Masaki, T.
(1997)
J. Biol. Chem.
272,
21589-21596
|
| 34.
|
Ushkarev, I. A.,
and Grishin, E. V.
(1986)
Bioorg. Khim.
12,
71-80
|
| 35.
|
Geppert, M.,
Khvotchev, M.,
Krasnoperov, V.,
Goda, Y.,
Missler, M.,
Hammer, R. E.,
Ichtchenko, K.,
Petrenko, A. G.,
and Sudhof, T. C.
(1998)
J. Biol. Chem.
273,
1705-1710
|
| 36.
|
Wanke, E.,
Ferroni, A.,
Gattanini, P.,
and Meldolesi, J.
(1986)
Biochem. Biophys. Res. Commun.
134,
320-325
|
| 37.
|
Hlubek, M. D.,
Stuenkel, E. L.,
Krasnoperov, V. G.,
Petrenko, A. G.,
and Holz, R. W.
(2000)
Mol. Pharmacol.
57,
519-528
|
| 38.
|
Tse, F. W.,
and Tse, A.
(1999)
Endocrinology
140,
3025-3033
|
| 39.
|
Bittner, M. A.,
Krasnoperov, V. G.,
Stuenkel, E. L.,
Petrenko, A. G.,
and Holz, R. W.
(1998)
J. Neurosci.
18,
2914-2922
|
| 40.
|
Sugita, S.,
Ichtchenko, K.,
Khvotchev, M.,
and Südhof, T. C.
(1998)
J. Biol. Chem.
273,
32715-32724
|
| 41.
|
Van Renterghem, C.,
Iborra, C.,
Martin-Moutot, N.,
Lelianova, V. G.,
Ushkaryov, Y.,
and Seagar, M. J.
(2000)
Eur. J. Neurosci.
12,
3953-3962
|
| 42.
|
Magazanik, L. G.,
Fedorova, I. M.,
Kovalevskaya, G. I.,
Pashkov, V. N.,
Bulgakov, O. V.,
and Grishin, E. V.
(1992)
Neuroscience
46,
181-188
|
| 43.
|
Meunier, F. A.,
Colasante, C.,
and Molgo, J.
(1997)
Neuroscience
78,
883-893
|
| 44.
|
Vicentini, L. M.,
and Meldolesi, J.
(1984)
Biochem. Biophys. Res. Commun.
121,
538-544
|
| 45.
|
Ichtchenko, K.,
Khvotchev, M.,
Kiyatkin, N.,
Simpson, L.,
Sugita, S.,
and Sudhof, T. C.
(1998)
EMBO J.
17,
6188-6199
|
| 46.
|
Krasnoperov, V.,
Bittner, M. A.,
Holz, R. W.,
Chepurny, O.,
and Petrenko, A. G.
(1999)
J. Biol. Chem.
274,
3590-3596
|
| 47.
|
Gorio, A.,
Rubin, L. L.,
and Mauro, A.
(1978)
J. Neurocytol.
7,
193-202
|
| 48.
|
Ashley, R. H.
(1995)
Essays Biochem.
30,
97-117
|
| 49.
|
Williams, A. J.
(1995)
in
Ion Channels, a Practical Approach
(Ashley, R. H., ed)
, pp. 43-67, IRL Press at Oxford University Press, Oxford
|
| 50.
|
Rucklidge, G. J.,
Milne, G.,
Chaudhry, S. M.,
and Robins, S. P.
(1996)
Anal. Biochem.
243,
158-164
|
| 51.
|
Krasnoperov, V. G.,
Bittner, M. A.,
Beavis, R.,
Kuang, Y.,
Salnikow, K. V.,
Chepurny, O. G.,
Little, A. R.,
Plotnikov, A. N.,
Wu, D.,
Holz, R. W.,
and Petrenko, A. G.
(1997)
Neuron
18,
925-937
|
Copyright © 2000 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
J.-P. Silva, V. Lelianova, C. Hopkins, K. E. Volynski, and Y. Ushkaryov
Functional Cross-interaction of the Fragments Produced by the Cleavage of Distinct Adhesion G-protein-coupled Receptors
J. Biol. Chem.,
March 6, 2009;
284(10):
6495 - 6506.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Lajus, P. Vacher, D. Huber, M. Dubois, M.-N. Benassy, Y. Ushkaryov, and J. Lang
{alpha}-Latrotoxin Induces Exocytosis by Inhibition of Voltage-dependent K+ Channels and by Stimulation of L-type Ca2+ Channels via Latrophilin in beta-Cells
J. Biol. Chem.,
March 3, 2006;
281(9):
5522 - 5531.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. Li, D. Lee, L. Wang, M. Khvotchev, S. K. Chiew, L. Arunachalam, T. Collins, Z.-P. Feng, and S. Sugita
N-Terminal Insertion and C-Terminal Ankyrin-Like Repeats of {alpha}-Latrotoxin Are Critical for Ca2+-Dependent Exocytosis
J. Neurosci.,
November 2, 2005;
25(44):
10188 - 10197.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. M. O'Hanlon, P. D. Humphreys, R. S. Goldman, S. K. Halstead, R. W. M. Bullens, J. J. Plomp, Y. Ushkaryov, and H. J. Willison
Calpain inhibitors protect against axonal degeneration in a model of anti-ganglioside antibody-mediated motor nerve terminal injury
Brain,
November 1, 2003;
126(11):
2497 - 2509.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. E. Volynski, M. Capogna, A. C. Ashton, D. Thomson, E. V. Orlova, C. F. Manser, R. R. Ribchester, and Y. A. Ushkaryov
Mutant {alpha}-Latrotoxin (LTXN4C) Does Not Form Pores and Causes Secretion by Receptor Stimulation: THIS ACTION DOES NOT REQUIRE NEUREXINS
J. Biol. Chem.,
August 15, 2003;
278(33):
31058 - 31066.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Capogna, K. E. Volynski, N. J. Emptage, and Y. A. Ushkaryov
The {alpha}-Latrotoxin Mutant LTXN4C Enhances Spontaneous and Evoked Transmitter Release in CA3 Pyramidal Neurons
J. Neurosci.,
May 15, 2003;
23(10):
4044 - 4053.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. Ouanounou, M. Malo, J. Stinnakre, A. S. Kreger, and J. Molgo
Trachynilysin, a Neurosecretory Protein Isolated from Stonefish (Synanceia trachynis) Venom, Forms Nonselective Pores in the Membrane of NG108-15 Cells
J. Biol. Chem.,
October 11, 2002;
277(42):
39119 - 39127.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. C. Ashton, K. E. Volynski, V. G. Lelianova, E. V. Orlova, C. Van Renterghem, M. Canepari, M. Seagar, and Y. A. Ushkaryov
alpha -Latrotoxin, Acting via Two Ca2+-dependent Pathways, Triggers Exocytosis of Two Pools of Synaptic Vesicles
J. Biol. Chem.,
November 21, 2001;
276(48):
44695 - 44703.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 2000 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|