HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

J. Biol. Chem., Vol. 275, Issue 52, 41512-41520, December 29, 2000

This Article Abstract Full Text (PDF) All Versions of this Article: 275/52/41512    most recent M006757200v1 Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Lutz, L. B. Articles by Hammes, S. R. Search for Related Content PubMed PubMed Citation Articles by Lutz, L. B. Articles by Hammes, S. R. Social Bookmarking                      What's this?

G Protein Subunits Inhibit Nongenomic Progesterone-induced Signaling and Maturation in Xenopus laevis Oocytes

EVIDENCE FOR A RELEASE OF INHIBITION MECHANISM FOR CELL CYCLE PROGRESSION^*

Lindsey B. Lutz, Bonnie Kim, David Jahani, and Stephen R. Hammes

From the Department of Internal Medicine, University of Texas Southwestern Medical School, Dallas, Texas 75390-8857

Received for publication, July 27, 2000, and in revised form, September 12, 2000

	ABSTRACT

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Progesterone-induced maturation of Xenopus oocytes is a well known example of nongenomic signaling by steroids; however, little is known about the early signaling events involved in this process. Previous work has suggested that G proteins and G protein-coupled receptors may be involved in progesterone-mediated oocyte maturation as well as in other nongenomic steroid-induced signaling events. To investigate the role of G proteins in nongenomic signaling by progesterone, the effects of modulating G and G levels in Xenopus oocytes on progesterone-induced signaling and maturation were examined. Our results demonstrate that G subunits, rather than G, are the principal mediators of progesterone action in this system. We show that overexpression of G inhibits both progesterone-induced maturation and activation of the MAPK pathway, whereas sequestration of endogenous G subunits enhances progesterone-mediated signaling and maturation. These data are consistent with a model whereby endogenous free Xenopus G subunits constitutively inhibit oocyte maturation. Progesterone may induce maturation by antagonizing this inhibition and therefore allowing cell cycle progression to occur. These studies offer new insight into the early signaling events mediated by progesterone and may be useful in characterizing and identifying the membrane progesterone receptor in oocytes.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Steroid hormones are traditionally known to mediate their signaling and subsequent biological activities via nuclear receptors (1). Interestingly, many steroid-induced signaling events appear to be triggered independently from the classic nuclear receptor pathways. In fact, these processes likely involve steroid signaling via membrane receptors (2). Examples of rapid, nongenomic signaling by steroids are myriad, including aldosterone-induced increases in intracellular calcium in vascular smooth muscle cells (3-8), estrogen-mediated induction of nitric-oxide synthase in vascular endothelial cells (9-12), vitamin D-induced increases in intracellular calcium in osteosarcoma cells (13-15), and progesterone-mediated maturation of amphibian and fish oocytes (16-18).

The phenomenon of progesterone-induced maturation of Xenopus oocytes serves as a useful experimental model for studying nongenomic steroid signaling (16, 19-21). The maturation of an oocyte refers to the meiotic stage at which an oocyte rests. "Immature" oocytes are arrested in prophase of meiosis I. Before ovulation, oocytes are induced to re-enter the cell cycle, finally resting in metaphase II. These "mature" oocytes are then competent for ovulation and subsequent fertilization, after which the final stages of meiosis are completed (16).

Evidence suggests that progesterone-induced maturation of Xenopus oocytes is mediated by cell surface rather than nuclear receptors. First, maturation is unaffected by the transcriptional inhibitor actinomycin D (21). Second, progesterone covalently attached to either polymers or bovine serum albumin and therefore unable to diffuse through the oocyte membrane still mediates maturation (16, 22). Third, progesterone injection directly into oocytes does not induce maturation (16, 21, 23). Finally, progesterone appears to bind specifically and with relatively high affinity to oocyte membranes (24, 25). At this point, however, no progesterone binding proteins have been identified in Xenopus oocyte membranes.

Progesterone signaling may be coupled to G proteins. Progesterone treatment of oocytes results in a rapid decrease in intracellular cAMP, perhaps through attenuation of adenylyl cyclase activity (26-29). This suggests that G_i, and therefore a G_i-coupled receptor, may be involved in progesterone-mediated signaling. In addition, progesterone activates the mitogen-activated protein kinase (MAPK)¹ cascade in oocytes (30-34), which could be mediated by G subunits. Finally, 1-methyladenine induces maturation of starfish oocytes in a pertussis toxin-sensitive fashion, suggesting that G_i mediates oocyte maturation in a comparable system (35-37). Interestingly, progesterone binds to the G protein-coupled oxytocin receptor, thereby partially blocking oxytocin binding and oxytocin-mediated signaling (38). One hypothesis is that the high amounts of progesterone present during pregnancy bind to the oxytocin receptor and prevent the induction of labor. When progesterone levels decrease at the end of pregnancy, this "release of inhibition" may allow oxytocin-mediated contractions, and therefore labor, to begin. Again, these data are consistent with progesterone modulation of G protein-coupled receptor signaling.

The role of G proteins in progesterone-mediated Xenopus oocyte maturation was examined by systematically depleting or overexpressing G protein subunits in Xenopus oocytes. Our data suggest that, in fact, G_i is not important for this process. Rather, G subunits appear to be the principal mediators of progesterone action in Xenopus oocytes, acting as inhibitors of oocyte maturation. Progesterone may therefore induce maturation by antagonizing constitutive G-mediated inhibition of cell cycle progression.

	EXPERIMENTAL PROCEDURES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Oocyte Preparation-- Oocytes were harvested from female Xenopus laevis (Nasco) and treated as described previously (39, 40). Briefly, follicular cells were removed by incubation of the oocytes for 3-4 h at room temperature with 1 mg/ml collagenase A (Roche Molecular Biochemicals) in modified Barth's solution (MSBH) without Ca²⁺. Oocytes were then washed extensively and incubated overnight at 16 °C in MSBH II (MSBH with 1 mg/ml bovine serum albumin, 1 mg/ml Ficoll, 100 units/ml penicillin, and 100 µg/ml streptomycin). Stage V-VI oocytes were selected, and maturation assays were performed on each preparation to determine its sensitivity to progesterone-induced maturation.

Progesterone Maturation Assay-- Injected or uninjected stage V-VI ooctyes were washed extensively with MSBH to remove the bovine serum albumin from the storage buffer. They were then incubated with various doses of progesterone (Sigma) for the times indicated in the figure legends. The ethanol concentration was always kept constant at 0.1% regardless of the progesterone concentration. Maturation was detected by visualizing germinal vesicle breakdown, which manifests itself as a white spot on the dark animal pole of the oocyte (16).

Oocyte Membrane Preparation-- Oocyte membranes were prepared from Stage V-VI or Stage I-IIII oocytes as described (25). In summary, oocytes were homogenized with a Dounce homogenizer (Kontes, pestle A, 15 strokes) in membrane buffer (83 mM NaCl, 1 mM MgCl₂, 1 mM phenylmethylsulfonyl fluoride, 10 mM Hepes, pH 7.6) at 4 °C. The homogenate was centrifuged at 800 × g for 10 min, and the supernatant was removed and centrifuged again at 800 × g. After a third centrifugation at 800 × g, the supernatant was centrifuged at 20,000 × g for 25 min, and the membrane pellet was resuspended in membrane buffer, taking caution to avoid disturbing the black melanin component of the pellet. Membranes were centrifuged two more times at 20,000 × g and finally resuspended in MSBH at a protein concentration of 5 mg/ml. Samples were then frozen at 80 °C until needed.

Binding Assay-- 1,2,6,7-³H(N)]-progesterone (PerkinElmer Life Sciences) was diluted in ethanol on ice to 100× the final concentrations indicated in the figure legends. 5 µl of each of the 100× solutions was added to individual 1.5-ml polypropylene microcentrifuge tubes with either 1 µl of unlabeled progesterone stock in ethanol (concentration indicated in the figure legends) or 1 µl of ethanol alone. Each condition (i.e. concentration of radiolabeled progesterone) was tested in triplicate for every experiment. Membranes were diluted to the concentrations indicated in the figure legends in MSBH at 4 °C, and 500 µl of this mixture was added to each tube containing radiolabeled steroid. The tubes were then rocked at 4 °C for 1 h. 25 µl was collected from each tube, diluted in scintillation fluid, and counted to determine the concentration of free progesterone at the end of the assay. Glass microfiber filters (Millipore) that had been preincubated in MSBH at 4 °C were placed on a prechilled vacuum filter holder (Millipore), and 400 µl of each sample was applied to individual filters. The filters were washed with 20 ml of cold MSBH, removed, and placed in 5 ml of scintillation fluid (Budget-Solve, Research Products International Corp.) for counting on a Beckman LS1801 scintillation counter.

Oligonucleotide Design, Plasmid Construction, cRNA Synthesis, and cRNA Injection-- Sense and antisense oligonucleotides directed against sequences near the start codons of Xenopus G_i1 (accession number AF086606), G_i2 (accession number X56089), and G_i3 (accession number X56090) (41) were synthesized by Life Technologies, Inc. These sequences were as follows: ATCGCTGCCATGGGCTGCACCTCGAGCGCC (G_i1), GCTGAACGGAGAACCGTCGCCATGGGATGTACT (G_i2), and CGGGAGGCGCCGAGCGAAGTAAAATGATC (G_i3). 50.6 nl of 2 mg/ml solutions of oligonucleotides in 10 mM Hepes were injected into each oocyte as indicated in the figure legend.

The Xenopus G_i1, G_i2, and G_i3 cDNAs were cloned by polymerase chain reaction from a Xenopus oocyte cDNA library created from purified Xenopus oocyte mRNA (Fast-Track, Invitrogen) using standard techniques. The modified G_i2 cDNA (G_i2-Mod) contains the following 5' sequence: CCAGCCATGGGTTGCACA. The G_i2-Mod cDNA will match with only 12 of 33 nucleotides of the G_i2 antisense oligonucleotide. The rat G_i-WT and G_i-Q203L cDNAs were a gift from A. Gilman (UTSW). All of these cDNAs were cloned into the Xenopus oocyte expression vector pGEM HE (a gift from L. Jan, University of California at San Francisco) and were sequenced using the dideoxy method. The bovine G₁ cDNA in pGEM HE and bovine G₂ cDNA in pFROG were gifts from L. Jan (University of California at San Francisco). The bovine transducin G cDNA in pFROG was a gift from S. Coughlin (University of California at San Francisco), and the GRK-minigene in pGEM HE was a gift from E. Reuveny (Tel Aviv). All constructs were linearized and transcribed in vitro with either T7 or SP6 (Promega transcription kit). Stage V-VI oocytes were injected with 50.6 nl of cRNA at a concentration of approximately 200 ng/µl using a Drummond automatic injector, and injected oocytes were then incubated 30-48 h in MSBH II before the maturation or MAPK assays were performed.

MAPK Assay-- Injected oocytes were washed with MSBH and incubated with 50 nM progesterone as described in the experimental procedures under "Progesterone Maturation Assay." Oocytes were lysed at the indicated times with lysis buffer (150 mM NaCl, 2 mM EDTA, 0.5 mM sodium vanadate, 2 mM NaF, 1% Tx-100, 20 mM Tris, pH 7.6) at 4 °C. 20 µl of lysis buffer was used per oocyte. Lysates were microcentrifuged at full speed for 10 min, and the supernatant was removed and diluted in 2× Laemmli sample buffer. Samples were resolved by electrophoresis on 10% polyacrylamide gels, and proteins were transferred to Immobilon membranes (Millipore). Membranes were blocked with 5% nonfat dry milk in TBST (100 mM NaCl, 0.1% Tween-20, 50 mM Tris, pH 7.4) for 1 h, incubated overnight at 4 °C with a rabbit anti-phospho-p44/42 MAPK antibody (New England Biolabs), washed four times with TBST, incubated for 1 h at room temperature with horseradish peroxidase-conjugated goat anti-rabbit antibody (1:4000, Bio-Rad), and washed another four times with TBST. Blots were then treated with ECL-Plus (Amersham Pharmacia Biotech) to visualize the proteins. Next, blots were stripped in 100 mM 2-mercaptoethanol, 2% SDS, 62.5 mM Tris, pH 6.7 at 55 °C for 30 min, washed four times with TBST, and reblotted as above using a rabbit anti-p44/42 MAPK polyclonal antibody (New England Biolabs) that will bind all p44/p42 regardless of its phosphorylation status.

	RESULTS

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

The EC₅₀ of Progesterone-induced Maturation Correlated with Specific High Affinity Binding of Progesterone to Maturation-competent Oocyte Membranes-- Maturation experiments using increasing concentrations of progesterone revealed an EC₅₀ for maturation in the range of 75-150 nM, depending upon the oocyte preparation (Fig. 1A). The sensitivity of the in vitro maturation response to low concentrations of progesterone suggests that it could be relevant in vivo, where physiologic concentrations of progesterone in the ovary could easily be in the 100 nM range (38). The maturation response was also relatively specific to progesterone, because much higher concentrations of pregnenolone (EC₅₀ = ~1 µM), 17-OH progesterone, corticosterone, and aldosterone (all with EC₅₀ values of ~0.5-1 µM) were needed to induce maturation (data not shown).

View larger version (15K): [in this window] [in a new window]   Fig. 1.   Progesterone-mediated oocyte maturation and progesterone binding to oocyte membranes. A, the EC50 for progesterone-mediated maturation was determined by treating oocytes with the indicated concentrations of progesterone (x axis) for 18 h. Maturation, which was detected by looking for germinal vesicle breakdown, is displayed on the y axis as a percentage of the total number of oocytes/concentration of progesterone (n = 20). This experiment was performed over 10 times with a range of EC50 from 50 to 150 nM. B, binding studies on stage V-VI oocyte membranes using a wide range of radiolabeled progesterone concentrations was performed. 300 µg of membranes were used for each sample. Data represent the means of three samples at each concentration of progesterone and are expressed as a Scatchard plot. This experiment was performed three times with three different membrane preparations with nearly identical results. C, binding assays were performed on membranes from stage I-III and stage V-VI oocytes. 50 µg of membranes were incubated with 10 nM radiolabeled progesterone ± 100 nM unlabeled progesterone for each sample. Data represent the means ± S.D. (n = 3) of the total counts after subtracting background, with background defined as the number of counts in samples incubated with labeled plus excess unlabeled progesterone. The total counts bound in Stage V-VI membranes was approximately 2-fold above background. D, binding studies on stage V-VI oocyte membranes (300 µg/point) were done using the indicated radiolabeled progesterone concentrations. Experiments were performed as described in the experimental procedures only the MSBH contained 5 mM MgCl2, and half of the membranes were preincubated with 200 µM GTPS in MSBH for 30 min at 4 °C (open squares) before being added to the radiolabeled progesterone. Data represent the means of three samples at each concentration. This experiment was performed three times with nearly identical results.

Progesterone binding studies were performed on Xenopus oocyte membranes to compare the affinity of progesterone binding to the EC₅₀ for progesterone-induced maturation. Scatchard analysis revealed two different sets of progesterone binding sites on the oocyte membranes: a set of lower affinity sites (K_d = 140 nM), which most likely represented nonspecific binding, and a set of high affinity sites (K_d = 3 nM), which likely represented the specific progesterone binding sites (Fig. 1B). The density of high affinity binding sites in this experiment was approximately 1 × 10¹³ mol/mg (~3 × 10⁸ molecules/oocyte).

The EC₅₀ for progesterone-induced maturation correlated with the equilibrium constants calculated for both sets of binding sites, suggesting that progesterone binding to either set of receptors could be mediating the maturation response. To confirm that the high affinity sites were mainly responsible for progesterone-mediated effects, membranes from maturation-competent (Stage V-VI) and incompetent (Stage I-III) oocytes were tested for progesterone binding. A radiolabeled progesterone concentration of 10 nM was used to favor detection of the high affinity binding sites. Although stage V-VI oocytes contained specific high affinity binding sites for [³H]progesterone, the earlier stage oocytes (Stages I-III) did not (Fig. 1C). The presence of the high affinity progesterone binding sites almost exclusively on maturation-competent oocytes suggests that the specific binding of progesterone to the high affinity sites may indeed be linked to the maturation process. Competition studies with other steroids revealed that progesterone binding to the stage V-VI oocyte membranes was specific, because over 100-fold more corticosterone, testosterone, and aldosterone were needed to compete for the high affinity progesterone binding sites (data not shown).

Progesterone Binding to Its Membrane Receptor Was Unaffected by the State of G Activation-- The affinity of a GPCR agonist for its receptor is generally decreased when associated G subunits are in the GTP-bound, activated state (42). For example, agonist affinity for the -adrenergic receptor is markedly decreased in the presence of GTP (43). If progesterone is acting as a GPCR agonist to mediate oocyte maturation, then, accordingly, its affinity for this receptor might be expected to be lower when G subunits are in the activated state. Xenopus oocyte membranes were incubated both with and without the nonhydroyzable GTP analogue GTPS. As demonstrated in Fig. 1D, incubation with GTPS had no effect on progesterone binding to the oocyte membranes, suggesting that progesterone is not binding to its receptor in a fashion typical for a GPCR agonist.

Progesterone-induced Maturation of Xenopus Oocytes Was Affected by Changes in G_i Expression-- The role of G_i in progesterone-induced maturation was examined by modulating its expression in oocytes. Depletion of endogenous G_i was attained by injection of antisense oligonucleotides directed against mRNAs encoding three known Xenopus G_i proteins into oocytes. Antisense experiments work well in oocytes because the oligonucleotides can be injected directly into the cell, thus avoiding the usual problems of degradation and inconsistent uptake seen with cultured cells (44). Note that progesterone concentrations used in this and subsequent experiments were just below the EC₅₀ calculated from Fig. 1A. This allowed more subtle changes in progesterone sensitivity to be detected. Given the slight variability in EC₅₀ between oocyte preparations, however, all experiments were performed multiple times to confirm the results. Injection of antisense oligonucleotides against mRNA encoding each individual G_i subunit (G_i1, G_i2, and G_i3) had minimal effect on progesterone-induced maturation when compared with injection of matching sense oligonucleotides (Fig. 2A). In contrast, simultaneous injection of antisense oligonucleotides against mRNAs encoding all three G_i subunits significantly attenuated progesterone-mediated maturation when compared with oocytes injected with matching sense oligonucleotides (Fig. 2A).

View larger version (13K): [in this window] [in a new window]   Fig. 2.   Modulation of Gi levels in Xenopus oocytes. A, sense and antisense oligonucleotides directed against three Xenopus oocyte Gi subunits were injected into oocytes as indicated on the x axis at a total concentration of 2 mg/ml. After 30 h oocytes were washed with MSBH and treated with 100 nM progesterone for 15 h. The y axis represents the percent inhibition of maturation by the antisense oligonucleotides compared with matching sense oligonucleotides (100  (percentage of maturation of antisense injected)/(percentage of maturation of sense injected)). Approximately 70 oocytes were used for each condition, and this experiment was performed three times using two different preparations of oligonucleotides with nearly identical results. B, oocytes were injected with 10 mM Hepes (mock), nonspecific cRNA encoding the thrombin receptor (PAR1), or an equal amount of cRNA encoding the Xenopus Gi2 protein (Xe-Gi2). Spontaneous maturation was measured after 30 h of incubation in MSBH. 80 oocytes were used for each condition, and the y axis represents the percentage of mature oocytes per condition. This experiment was performed several times using multiple cRNA preparations with similar results. C, oocytes were co-injected with cRNA encoding either the wild-type (Gi2-WT) or modified (Gi2-Mod) Xe-Gi2 plus either the sense or antisense oligonucleotide directed against Xe-Gi2 (concentration, 2 mg/ml). Spontaneous maturation was measured after 30 h of incubation in MSBH, and the y axis represents the percentage of inhibition of maturation by the antisense oligonucleotides compared with matching sense oligonucleotides. 30 oocytes were used for each condition, and this experiment was performed twice using different cRNA preparations with similar results.

The results from these antisense experiments are difficult to interpret, because antibodies against Xenopus G_i proteins are not available to confirm that the antisense oligonucleotides are indeed reducing G_i expression. To further examine the effects of G_i on maturation, cRNA encoding the Xenopus G_i2 protein was injected into oocytes. Injection of this cRNA resulted in marked spontaneous maturation when compared with oocytes injected with 10 mM Hepes (mock) or nonspecific cRNA (PAR1) (Fig. 2B). Interestingly, this spontaneous maturation was inhibited by nearly 80% with co-injection of the antisense oligonucleotide directed against G_i2 (Fig. 2C, G_i2-WT). In contrast, co-injection of the G_i2 antisense oligonucleotide with a modified cRNA encoding the wild-type G_i2 protein but containing 21 of 33 mismatches in the region corresponding to antisense oligonucleotide binding had less of an inhibitory effect on maturation (Fig. 2C, G_i2-Mod). This suggests that at least the G_i2 antisense oligonucleotide can inhibit G_i activity via binding to its complementary RNA sequence. Together, these results indicate that the amount of G_i expressed in oocytes directly correlates with the maturation response to progesterone.

G Inhibited Progesterone-induced Maturation of Xenopus Oocytes-- Two interpretations can explain the observation that decreased G_i attenuated, whereas excess G_i enhanced, progesterone-induced maturation. First, G_i itself may be signaling to induce maturation. Second, G that is released by activation of G_i may be affecting the maturation response. To differentiate between these two possibilities, oocytes were injected with cRNAs encoding bovine G₁ or G₂ subunits. These cRNAs encode functional proteins, because they have been injected together into Xenopus oocytes and markedly enhanced G-dependent G protein inward rectifying potassium channel activity (45).² Individual expression of either G₁ or G₂ had no effect on progesterone-induced maturation when a progesterone concentration just below the EC₅₀ was used (50 nM). In contrast, simultaneous expression of both subunits in oocytes significantly attenuated progesterone-induced maturation (Fig. 3A). Incubation with higher concentrations of progesterone overcame this inhibition by G (Fig. 3B), indicating that the processes of G-mediated inhibition and progesterone-mediated induction of maturation can compete with each other. In addition, these data demonstrate that injected G subunits are not simply damaging their host oocytes in a nonspecific fashion.

View larger version (18K): [in this window] [in a new window]   Fig. 3.   G effects on progesterone-induced maturation of oocytes. A, oocytes were injected with 10 mM Hepes (Mock) or approximately 10 ng of cRNA encoding either G, G, or both G + G. After 30 h, injected oocytes were washed extensively with MSBH and incubated in MSBH containing either 0.1% ethanol (gray) or 50 nM progesterone (final ethanol concentration, 0.1%; black) for 18 h. B, oocytes were injected as indicated and treated as above, only increasing amounts of progesterone were added, keeping the final ethanol concentration constant at 0.1% (x axis). C and D, oocytes were injected with either Hepes (Mock) or cRNA encoding the indicated proteins and treated as above. For each of A-D, 20 oocytes were used for each condition, and the y axis indicates the percentage of mature oocytes for each condition. Similar experiments were performed at least three times for each study using different cRNA preparations with similar results.

The effect of lowering endogenous Xenopus G was examined by injecting oocytes with cRNA encoding the bovine retinal transducin G subunit. Transducin G itself has no apparent activity in oocytes but has been used as a G "sink" to inhibit G-mediated signaling (46). Oocytes injected with transducin G exhibited enhancement of progesterone-induced maturation (Figs. 3C and 2B). In addition, injection of a GRK minigene encoding the carboxyl portion of the GRK1 protein, which has been shown to inhibit G function in a very specific fashion (47, 48), markedly enhanced progesterone-mediated maturation at a concentration of progesterone just below the EC₅₀ (50 nM) (Fig. 3D). The observation that sequestration of endogenous G enhances, while overexpression of exogenous G attenuates, progesterone-induced maturation suggests that increased G_i activity is not activating maturation; instead, endogenous G is inhibiting maturation.

GTPS Inhibited Progesterone-induced Maturation-- One way to formally prove that G, and not G, is important for progesterone-induced maturation would be to examine the effect of injected GTPS on progesterone-induced maturation. GTPS would be expected to bind irreversibly to G subunits, thus activating all GTP binding proteins within the oocytes. In addition, the activated G subunits would no longer interact with G subunits; thus, free G activity would be expected to increase as well. Indeed, injection of GTPS has been shown to enhance signaling by G-activated G protein inward rectifying potassium channels (49, 50). Injection of GTPS significantly blocked oocyte maturation in response to all concentrations of progesterone tested when compared with Mock-injected cells (Fig. 4A), providing further evidence that intrinsic G activity is not stimulating oocyte maturation; rather, G subunits are inhibiting maturation.

View larger version (9K): [in this window] [in a new window]   Fig. 4.   The effect of activated G proteins on progesterone-induced maturation. A, oocytes were injected with 50.6 nl of either 10 mM Hepes (Mock, dark) or 100 µM GTPS (gray) and incubated in MSBH II for 6 h. Oocytes were then washed extensively with MSBH and incubated with progesterone at the indicated concentrations (final ethanol concentration, 0.1%) for 18 h. B, oocytes were injected with 10 mM Hepes (Mock) or cRNA encoding either wild-type rat Gi (Gi-WT) or a constitutively active isoform (Gi-Q204L). Injected oocytes were incubated for 30 h in MSBH II, washed extensively with MSBH, and incubated with either 0.1% ethanol or 100 nM progesterone (final ethanol concentration, 0.1%) for 18 h. 20 ooyctes were used for each condition, and the y axis indicates the percentage of mature oocytes/point. Similar experiments were performed using multiple cRNA and GTPS preparations with nearly identical results.

Constitutively Activated G_i Had Minimal Effect on Progesterone-induced Oocyte Maturation-- Injection of GTPS inhibited maturation in the presence of relatively high concentrations of progesterone (1 µM; Fig. 4A). GTPS may therefore be inhibiting maturation simply by disabling the oocyte in a nonspecific fashion. A more elegant way to delineate the role of G_i and G subunits in oocyte maturation would be to compare the effects of a constitutively active rat G_i protein to its matched wild-type isoform. If G suppression is indeed the more important signaling event, then wild-type rat G_i should behave similarly to the Xenopus G_i, whereas the constitutively active G_i protein, which cannot bind to and sequester G, should have little effect on progesterone-induced maturation. As expected, wild-type rat G_i markedly enhanced progesterone-induced maturation at progesterone concentrations just below the EC₅₀ (50 nM). In contrast, constitutively active rat G_i containing a mutation that decreased the intrinsic GTPase activity of the protein (Q204L) had minimal effect on maturation (Fig. 4B). The lack of any substantial change in progesterone sensitivity in oocytes overexpressing the activated G_i clearly implies that G_i activity is not important in the progesterone-mediated maturation response. Note that expression of these two G_i proteins was equal as measured by Western blot analysis of extracts from injected oocytes (see Fig. 7C).

G Effects Are Taking Place Upstream of Activation of Extracellular Signal-regulated Kinase Phosphorylation-- One of the early signaling events triggered by progesterone is activation of the MAPK cascade. This process can be measured by immunoblotting for phosphorylated MAPK p42 (ERK1). Of note, Xenopus oocytes contain only the p42 isoform of ERK (51, 52). Ooctyes were injected with cRNAs encoding the aforementioned G proteins to determine whether their effects were occurring proximal to this point. Overexpression of G resulted in decreased phosphorylation of ERK1 in response to sub-optimal concentration of progesterone (50 nM) over the course of 4 h (Fig. 5A), which correlated with the decrease in maturation observed over an 18-h time period (Fig. 3). In contrast, injection of the GRK minigene markedly enhanced both the rate and amount of progesterone-induced ERK phosphorylation, consistent with the GRK protein's ability to enhance progesterone-mediated maturation (Fig. 6A). Overexpression of transducin had a similar effect on ERK phosphorylation in response to progesterone (data not shown). Finally, injection of wild-type rat G_i enhanced both the rate and amount of progesterone-induced ERK phosphorylation, whereas expression of the constitutively active G_i (Q204L) had minimal overall effect on MAPK activation (Fig. 7A). Although phosphorylated ERK was detected at the 2-h time point in G_i-Q204L-injected oocytes, the amount of phosphorylation at 4 h remained similar to mock injected cells. This contrasted with the markedly increased phosphorylation of ERK1 after 4 h detected in G_i-WT expressing cells. Of note, Western blot analysis of these samples using an antibody against rat G_i protein revealed that both G_i subunits were equally expressed in the injected oocytes (Fig. 7C). In addition, equal amounts of sample were present in each lane, as confirmed by blotting for total ERK (Figs. 5B, 6B, and 7B). Together, these data indicate that G effects are occurring early in the progesterone-mediated signaling pathway, upstream of MAPK activation.

View larger version (69K): [in this window] [in a new window]   Fig. 5.   Progesterone-induced phosphorylation of p42 MAPK in the presence of excess G proteins. Oocytes were injected with either 10 mM Hepes (Mock) or cRNAs encoding both both G and G (G) and incubated for 48 h in MSBH. Oocytes were then extensively washed with MSBH and incubated with 50 nM progesterone for the indicated times. Extracts from each of these samples were first probed with antiserum against phosphorylated p42 (A) and stripped and then blotted for all p42 protein (B). 15 oocytes were used for each sample and this experiment was performed three times using multiple cRNA preparations with similar results.

View larger version (54K): [in this window] [in a new window]   Fig. 6.   The effect of G sequestration on progesterone-induced phosphorylation of p42 MAPK. Oocytes were injected with either 10 mM Hepes (Mock) or cRNA encoding the GRK minigene and treated as described in Fig. 5. 15 oocytes were used for each sample, and these experiments were performed three times using multiple cRNA preparations.

View larger version (53K): [in this window] [in a new window]   Fig. 7.   The effects of Gi proteins on progesterone-induced phosphorylation of p42 MAPK. A and B, oocytes were injected with either 10 mM Hepes (Mock) or the indicated cRNAs and treated as described in Fig. 5. C, extracts from the t = 0 samples of A were resolved by SDS-polyacrylamide gel electrophoresis and blotted with an anti-Gi polyclonal antibody (A. Gilman, University of Texas Southwestern Medical Center). 15 oocytes were used for each sample, and these experiments were performed three times using multiple cRNA preparations with similar results.

	DISCUSSION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Progesterone induces maturation of Xenopus oocytes via a nongenomic pathway. Very little is currently understood about the early progesterone-induced signaling events, including the identity of the putative membrane progesterone binding protein. Previous work reported the presence of specific high affinity progesterone binding sites on Xenopus membranes (24, 25). Our results confirm these reports, demonstrating high affinity progesterone binding sites (K_d = 3 nM) on Stage V-VI oocyte membranes but not on Stage I-III oocyte membranes (Fig. 1). The presence of high affinity sites almost exclusively on maturation-competent oocytes, combined with the similarities between the K_d for high affinity progesterone binding and the EC₅₀ for progesterone-induced maturation (~100 nM; Fig. 1A), suggest that the specific binding of progesterone to these sites is linked to the maturation process. An active role for the lower affinity sites cannot be completely ruled out, however, given that their equilibrium constant (140 nM) is also close to the EC₅₀ value.

Earlier work has implicated G_i as a possible mediator of progesterone signaling in Xenopus oocytes (16, 26-29). The inability of constitutively active rat G_i to significantly alter progesterone-mediated maturation and MAPK signaling, whereas wild-type rat G_i enhanced both maturation and MAPK activation (Figs. 4B and 7A), argues against this hypothesis. Instead, these data suggest that intrinsic G_i activity (for example, its ability to inhibit adenylyl cyclase) is unimportant for progesterone-induced maturation. We propose that the changes in progesterone sensitivity observed by modulating G_i levels in oocytes are in fact due to changes in free G levels. If so, G must be acting as an inhibitor of maturation: the more free G, the less sensitivity to progesterone-induced maturation. Accordingly, reduction of endogenous G_i, which would increase intracellular free G, inhibited progesterone-induced maturation (Fig. 2A). Overexpression of G_i, which would deplete free G, enhanced progesterone-induced maturation as well as MAPK activation (Figs. 2B, 4B, and 7A). Finally, constitutively active G_i, which cannot bind to G and therefore would not alter endogenous G levels, minimally affected both progesterone-mediated signaling and maturation (Figs. 4B and 7A).

In further support of the inhbitory role of G in maturation, overexpression of bovine G in oocytes markedly reduced the sensitivity of the maturation response to progesterone. More importantly, sequestration of endogenous G by overexpression of either transducin or the more specific G-binding mini-GRK protein enhanced responses to progesterone. This suggests that endogenous G plays a real role in attenuating Xenopus oocyte maturation in response to progesterone and perhaps in resting oocytes as well.

It is still possible that progesterone-induced maturation is mediated by a G subunit other than G_i. An argument against this possibility is that injection of GTPS, which activates all G subunits, still inhibited maturation (Fig. 5A). In addition, progesterone-mediated activation of G_s would be unlikely given the observed decrease in cAMP after progesterone treatment (26-29). Formal exclusion of this possibility is difficult, however, and will involve examining the effects of overexpression of all of the known classes of G subunits, and perhaps of their respective constitutively active forms, on progesterone-induced maturation. To date, in addition to the G subunits presented in these studies, G_i2, as well as multiple mammalian and Xenopus G_i subunits, enhance maturation when overexpressed in oocytes (data not shown).

Our results are strikingly different than earlier data reported using starfish oocytes. Injection of G_i subunits into starfish oocytes inhibits, whereas injection of G enhances, maturation (35, 37), suggesting that activation of G_i and release of G are critical for starfish ooctye activation. These contrasting results are not surprising, however. First, 1-methyladenine-induced maturation of starfish oocytes is inhibited by pertussis toxin (53-55), whereas progesterone-induced maturation of Xenopus oocytes is not (26, 56-58).² This supports the involvement of G_i in starfish oocyte maturation and argues against its importance for Xenopus oocyte maturation. Second, 1-methyladenine binding to starfish oocyte membranes decreases in the presence of GTP (53), whereas GTPS had no effect on high affinity progesterone binding to Xenopus oocyte membranes (Fig. 1D), suggesting that 1-methyladenine binds to its membrane receptor in a fashion typical for a GPCR agonist, whereas progesterone does not. Taken together, these results indicate that early signaling events in oocyte maturation may be quite different between starfish and Xenopus; thus, comparisons between the two should be made with caution.

Although G promotes re-entry into the cell cycle in starfish oocytes, the homologous complex in Saccharomyces cerevisiae, Ste4p/Ste18p, arrests the cell cycle in the haploid mating response (59). The mechanism behind this cell cycle arrest appears to involve Ste4p/Ste18-induced activation of the MAPK pathway. Experiments in mammalian systems have also demonstrated that G can activate the MAPK pathway (60, 61). Although our data demonstrate that G can mediate cell cycle arrest in Xenopus oocytes, G does not appear to activate the MAPK cascade. In fact, overexpression of G attenuates, whereas sequestration of G enhances, ERK1 phosphorylation over the course of 4 h (Figs. 5-7). These results are supported by earlier work demonstrating that progesterone-induced MAPK activation in Xenopus oocytes is primarily mediated by the Mos protein and not by G (31, 44, 62-65). In fact, G may be playing a role in regulating Mos protein expression, because preliminary results indicate that sequestration of G enhances Mos expression (data not shown).

The observation that endogenous G inhibits maturation offers an intriguing model whereby maturation is held in check by low levels of constitutive G signaling. Resting G activity has been observed before in Xenopus oocytes and in other systems. Constitutive G-mediated G protein-coupled inward rectifying potassium channel activity in resting oocytes can be inhibited by sequestration of free G (45, 48, 66). In addition, free G activity has also been proposed to constitutively permit endocytosis in mammalian CV1 cells (67). Progesterone may be inducing maturation by antagonizing this constitutive inhibitory G activity. For example, progesterone could attenuate G activity by binding directly to G or to another molecule that interferes with G signaling. Of note, we observed no increase in progesterone binding to membranes from oocytes overexpressing G subunits (data not shown). Alternatively, one tantalizing possibility is that progesterone acts as an antagonist, or even an inverse agonist, on an unknown constitutively active GPCR that signals via G to inhibit maturation. This type of "nonagonist" interaction between progesterone and a GPCR is consistent with our binding data demonstrating no change in progesterone binding to its receptor in membranes treated with GTPS. Interestingly, this release of inhibition model is reminiscent of the oxytocin receptor story, where progesterone may act by competing with oxytocin for binding to its GPCR (38). Of note, oxytocin had no effect on any of the described experiments with progesterone (data not shown). Improving our understanding of early signaling events in progesterone-mediated maturation may provide us with useful clues in searching for the elusive membrane progesterone binding protein and may prove helpful in elucidating the mechanisms involved in other nongenomic steroid signaling pathways as well.

	ACKNOWLEDGEMENTS

We are extremely thankful for all of the support and help from Dr. Shaun Coughlin at the University of California at San Francisco. Interest for this work began in his laboratory and his generosity and ideas were critical for this project. We also thank Alex Yi and Dr. L. Jan at the University of California at San Francisco for invaluable help, ideas, and reagents. Special thanks is also given to Drs. A. Gilman, E. Ross, and R. Auchus for critical review of this manuscript.

	FOOTNOTES

^* The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

To whom correspondence should be addressed: Div. of Endocrinology, Dept. of Internal Medicine, University of Texas Southwestern Medical School, 5323 Harry Hines Blvd., Dallas, TX 75390-8857. Tel.: 214-648-4793; Fax: 214-648-8917; E-mail: stephen.hammes@email.swmed.edu.

Published, JBC Papers in Press, October 3, 2000, DOI 10.1074/jbc.M006757200

² S. R. Hammes, unpublished results.

	ABBREVIATIONS

The abbreviations used are: MAPK, mitogen-activated protein kinase; GPCR, G protein-coupled receptor; MSBH, modified Barth's solution; ERK, extracellular signal-regulated kinase; GTPS, guanosine 5'-3-O-(thio)triphosphate.

	REFERENCES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES