|
Originally published In Press as doi:10.1074/jbc.M006757200 on October 3, 2000
J. Biol. Chem., Vol. 275, Issue 52, 41512-41520, December 29, 2000
G Protein  Subunits Inhibit Nongenomic Progesterone-induced
Signaling and Maturation in Xenopus laevis Oocytes
EVIDENCE FOR A RELEASE OF INHIBITION MECHANISM FOR CELL CYCLE
PROGRESSION*
Lindsey B.
Lutz,
Bonnie
Kim,
David
Jahani, and
Stephen R.
Hammes
From the Department of Internal Medicine, University of Texas
Southwestern Medical School, Dallas, Texas 75390-8857
Received for publication, July 27, 2000, and in revised form, September 12, 2000
 |
ABSTRACT |
Progesterone-induced maturation of
Xenopus oocytes is a well known example of nongenomic
signaling by steroids; however, little is known about the early
signaling events involved in this process. Previous work has suggested
that G proteins and G protein-coupled receptors may be involved
in progesterone-mediated oocyte maturation as well as in other
nongenomic steroid-induced signaling events. To investigate the role of
G proteins in nongenomic signaling by progesterone, the effects of
modulating G and G levels in Xenopus oocytes on
progesterone-induced signaling and maturation were examined. Our
results demonstrate that G subunits, rather than G , are the
principal mediators of progesterone action in this system. We show that
overexpression of G inhibits both progesterone-induced maturation
and activation of the MAPK pathway, whereas sequestration of endogenous
G subunits enhances progesterone-mediated signaling and
maturation. These data are consistent with a model whereby endogenous
free Xenopus G subunits constitutively inhibit oocyte
maturation. Progesterone may induce maturation by antagonizing this inhibition and therefore allowing cell cycle progression to occur.
These studies offer new insight into the early signaling events
mediated by progesterone and may be useful in characterizing and
identifying the membrane progesterone receptor in oocytes.
 |
INTRODUCTION |
Steroid hormones are traditionally known to mediate their
signaling and subsequent biological activities via nuclear receptors (1). Interestingly, many steroid-induced signaling events appear to be
triggered independently from the classic nuclear receptor pathways. In
fact, these processes likely involve steroid signaling via membrane
receptors (2). Examples of rapid, nongenomic signaling by steroids are
myriad, including aldosterone-induced increases in intracellular
calcium in vascular smooth muscle cells (3-8), estrogen-mediated
induction of nitric-oxide synthase in vascular endothelial cells
(9-12), vitamin D-induced increases in intracellular calcium in
osteosarcoma cells (13-15), and progesterone-mediated maturation of
amphibian and fish oocytes (16-18).
The phenomenon of progesterone-induced maturation of Xenopus
oocytes serves as a useful experimental model for studying nongenomic steroid signaling (16, 19-21). The maturation of an oocyte refers to
the meiotic stage at which an oocyte rests. "Immature" oocytes are
arrested in prophase of meiosis I. Before ovulation, oocytes are
induced to re-enter the cell cycle, finally resting in metaphase II.
These "mature" oocytes are then competent for ovulation and subsequent fertilization, after which the final stages of meiosis are
completed (16).
Evidence suggests that progesterone-induced maturation of
Xenopus oocytes is mediated by cell surface rather than
nuclear receptors. First, maturation is unaffected by the
transcriptional inhibitor actinomycin D (21). Second, progesterone
covalently attached to either polymers or bovine serum albumin and
therefore unable to diffuse through the oocyte membrane still mediates
maturation (16, 22). Third, progesterone injection directly into
oocytes does not induce maturation (16, 21, 23). Finally, progesterone appears to bind specifically and with relatively high affinity to
oocyte membranes (24, 25). At this point, however, no progesterone binding proteins have been identified in Xenopus oocyte membranes.
Progesterone signaling may be coupled to G proteins. Progesterone
treatment of oocytes results in a rapid decrease in intracellular cAMP,
perhaps through attenuation of adenylyl cyclase activity (26-29). This
suggests that G i, and therefore a
G i-coupled receptor, may be involved in
progesterone-mediated signaling. In addition, progesterone activates
the mitogen-activated protein kinase
(MAPK)1 cascade in oocytes
(30-34), which could be mediated by G subunits. Finally,
1-methyladenine induces maturation of starfish oocytes in a
pertussis toxin-sensitive fashion, suggesting that G i
mediates oocyte maturation in a comparable system (35-37).
Interestingly, progesterone binds to the G protein-coupled oxytocin
receptor, thereby partially blocking oxytocin binding and
oxytocin-mediated signaling (38). One hypothesis is that the high
amounts of progesterone present during pregnancy bind to the oxytocin
receptor and prevent the induction of labor. When progesterone levels
decrease at the end of pregnancy, this "release of inhibition" may
allow oxytocin-mediated contractions, and therefore labor, to begin.
Again, these data are consistent with progesterone modulation of G
protein-coupled receptor signaling.
The role of G proteins in progesterone-mediated Xenopus
oocyte maturation was examined by systematically depleting or
overexpressing G protein subunits in Xenopus oocytes. Our
data suggest that, in fact, G i is not important for this
process. Rather, G subunits appear to be the principal mediators
of progesterone action in Xenopus oocytes, acting as
inhibitors of oocyte maturation. Progesterone may therefore induce
maturation by antagonizing constitutive G -mediated inhibition of
cell cycle progression.
 |
EXPERIMENTAL PROCEDURES |
Oocyte Preparation--
Oocytes were harvested from female
Xenopus laevis (Nasco) and treated as described previously
(39, 40). Briefly, follicular cells were removed by incubation of the
oocytes for 3-4 h at room temperature with 1 mg/ml collagenase A
(Roche Molecular Biochemicals) in modified Barth's solution (MSBH)
without Ca2+. Oocytes were then washed extensively and
incubated overnight at 16 °C in MSBH II (MSBH with 1 mg/ml bovine
serum albumin, 1 mg/ml Ficoll, 100 units/ml penicillin, and 100 µg/ml
streptomycin). Stage V-VI oocytes were selected, and maturation assays
were performed on each preparation to determine its sensitivity to
progesterone-induced maturation.
Progesterone Maturation Assay--
Injected or uninjected stage
V-VI ooctyes were washed extensively with MSBH to remove the bovine
serum albumin from the storage buffer. They were then incubated with
various doses of progesterone (Sigma) for the times indicated in the
figure legends. The ethanol concentration was always kept constant at
0.1% regardless of the progesterone concentration. Maturation was
detected by visualizing germinal vesicle breakdown, which manifests
itself as a white spot on the dark animal pole of the oocyte (16).
Oocyte Membrane Preparation--
Oocyte membranes were prepared
from Stage V-VI or Stage I-IIII oocytes as described (25). In
summary, oocytes were homogenized with a Dounce homogenizer (Kontes,
pestle A, 15 strokes) in membrane buffer (83 mM NaCl, 1 mM MgCl2, 1 mM phenylmethylsulfonyl
fluoride, 10 mM Hepes, pH 7.6) at 4 °C. The homogenate
was centrifuged at 800 × g for 10 min, and the
supernatant was removed and centrifuged again at 800 × g. After a third centrifugation at 800 × g,
the supernatant was centrifuged at 20,000 × g for 25 min, and the membrane pellet was resuspended in membrane buffer, taking
caution to avoid disturbing the black melanin component of the pellet. Membranes were centrifuged two more times at 20,000 × g and finally resuspended in MSBH at a protein concentration
of 5 mg/ml. Samples were then frozen at 80 °C until needed.
Binding Assay--
1,2,6,7-3H(N)]-progesterone
(PerkinElmer Life Sciences) was diluted in ethanol on ice to 100× the
final concentrations indicated in the figure legends. 5 µl of each of
the 100× solutions was added to individual 1.5-ml polypropylene
microcentrifuge tubes with either 1 µl of unlabeled progesterone
stock in ethanol (concentration indicated in the figure legends) or 1 µl of ethanol alone. Each condition (i.e. concentration of
radiolabeled progesterone) was tested in triplicate for every
experiment. Membranes were diluted to the concentrations indicated in
the figure legends in MSBH at 4 °C, and 500 µl of this mixture was
added to each tube containing radiolabeled steroid. The tubes were then
rocked at 4 °C for 1 h. 25 µl was collected from each tube,
diluted in scintillation fluid, and counted to determine the
concentration of free progesterone at the end of the assay. Glass
microfiber filters (Millipore) that had been preincubated in MSBH at
4 °C were placed on a prechilled vacuum filter holder (Millipore),
and 400 µl of each sample was applied to individual filters. The
filters were washed with 20 ml of cold MSBH, removed, and placed in 5 ml of scintillation fluid (Budget-Solve, Research Products
International Corp.) for counting on a Beckman LS1801 scintillation counter.
Oligonucleotide Design, Plasmid Construction, cRNA Synthesis, and
cRNA Injection--
Sense and antisense oligonucleotides directed
against sequences near the start codons of Xenopus
G i1 (accession number AF086606), G i2
(accession number X56089), and G i3 (accession number X56090) (41) were synthesized by Life Technologies, Inc. These
sequences were as follows: ATCGCTGCCATGGGCTGCACCTCGAGCGCC (G i1), GCTGAACGGAGAACCGTCGCCATGGGATGTACT
(G i2), and CGGGAGGCGCCGAGCGAAGTAAAATGATC (G i3). 50.6 nl of 2 mg/ml solutions of oligonucleotides
in 10 mM Hepes were injected into each oocyte as indicated
in the figure legend.
The Xenopus G i1, G i2, and
G i3 cDNAs were cloned by polymerase chain reaction
from a Xenopus oocyte cDNA library created from purified
Xenopus oocyte mRNA (Fast-Track, Invitrogen) using standard techniques. The modified G i2 cDNA
(G i2-Mod) contains the following 5' sequence:
CCAGCCATGGGTTGCACA. The G i2-Mod cDNA will match with
only 12 of 33 nucleotides of the G i2 antisense oligonucleotide. The rat G i-WT and
G i-Q203L cDNAs were a gift from A. Gilman
(UTSW). All of these cDNAs were cloned into the Xenopus oocyte expression vector pGEM HE (a gift from L. Jan, University of California at San Francisco) and were sequenced using the dideoxy method. The bovine G 1 cDNA in pGEM
HE and bovine G 2 cDNA in pFROG were gifts from L. Jan (University of California at San Francisco). The bovine
transducin G cDNA in pFROG was a gift from S. Coughlin
(University of California at San Francisco), and the GRK-minigene in
pGEM HE was a gift from E. Reuveny (Tel Aviv). All constructs were
linearized and transcribed in vitro with either T7 or SP6
(Promega transcription kit). Stage V-VI oocytes were injected with
50.6 nl of cRNA at a concentration of approximately 200 ng/µl using a
Drummond automatic injector, and injected oocytes were then incubated
30-48 h in MSBH II before the maturation or MAPK assays were performed.
MAPK Assay--
Injected oocytes were washed with MSBH and
incubated with 50 nM progesterone as described in the
experimental procedures under "Progesterone Maturation
Assay." Oocytes were lysed at the indicated times with lysis
buffer (150 mM NaCl, 2 mM EDTA, 0.5 mM sodium vanadate, 2 mM NaF, 1% Tx-100, 20 mM Tris, pH 7.6) at 4 °C. 20 µl of lysis buffer was
used per oocyte. Lysates were microcentrifuged at full speed for 10 min, and the supernatant was removed and diluted in 2× Laemmli sample
buffer. Samples were resolved by electrophoresis on 10% polyacrylamide
gels, and proteins were transferred to Immobilon membranes (Millipore).
Membranes were blocked with 5% nonfat dry milk in TBST (100 mM NaCl, 0.1% Tween-20, 50 mM Tris, pH 7.4)
for 1 h, incubated overnight at 4 °C with a rabbit
anti-phospho-p44/42 MAPK antibody (New England Biolabs), washed four
times with TBST, incubated for 1 h at room temperature with
horseradish peroxidase-conjugated goat anti-rabbit antibody (1:4000,
Bio-Rad), and washed another four times with TBST. Blots were then
treated with ECL-Plus (Amersham Pharmacia Biotech) to visualize the
proteins. Next, blots were stripped in 100 mM
2-mercaptoethanol, 2% SDS, 62.5 mM Tris, pH 6.7 at
55 °C for 30 min, washed four times with TBST, and reblotted as
above using a rabbit anti-p44/42 MAPK polyclonal antibody (New England
Biolabs) that will bind all p44/p42 regardless of its phosphorylation status.
 |
RESULTS |
The EC50 of Progesterone-induced Maturation Correlated
with Specific High Affinity Binding of Progesterone to
Maturation-competent Oocyte Membranes--
Maturation experiments
using increasing concentrations of progesterone revealed an
EC50 for maturation in the range of 75-150 nM,
depending upon the oocyte preparation (Fig.
1A). The sensitivity of the
in vitro maturation response to low concentrations of
progesterone suggests that it could be relevant in vivo,
where physiologic concentrations of progesterone in the ovary could
easily be in the 100 nM range (38). The maturation response
was also relatively specific to progesterone, because much higher
concentrations of pregnenolone (EC50 = ~1
µM), 17-OH progesterone, corticosterone, and aldosterone
(all with EC50 values of ~0.5-1 µM) were
needed to induce maturation (data not shown).

View larger version (15K):
[in this window]
[in a new window]
|
Fig. 1.
Progesterone-mediated oocyte maturation and
progesterone binding to oocyte membranes. A, the
EC50 for progesterone-mediated maturation was determined by
treating oocytes with the indicated concentrations of progesterone
(x axis) for 18 h. Maturation, which was detected by
looking for germinal vesicle breakdown, is displayed on the
y axis as a percentage of the total number of
oocytes/concentration of progesterone (n = 20). This
experiment was performed over 10 times with a range of EC50
from 50 to 150 nM. B, binding studies on stage
V-VI oocyte membranes using a wide range of radiolabeled progesterone
concentrations was performed. 300 µg of membranes were used for each
sample. Data represent the means of three samples at each concentration
of progesterone and are expressed as a Scatchard plot. This experiment
was performed three times with three different membrane preparations
with nearly identical results. C, binding assays were
performed on membranes from stage I-III and stage V-VI oocytes. 50 µg of membranes were incubated with 10 nM radiolabeled
progesterone ± 100 nM unlabeled progesterone for each
sample. Data represent the means ± S.D. (n = 3)
of the total counts after subtracting background, with background
defined as the number of counts in samples incubated with labeled plus
excess unlabeled progesterone. The total counts bound in Stage V-VI
membranes was approximately 2-fold above background. D,
binding studies on stage V-VI oocyte membranes (300 µg/point) were
done using the indicated radiolabeled progesterone concentrations.
Experiments were performed as described in the experimental procedures
only the MSBH contained 5 mM MgCl2, and half of
the membranes were preincubated with 200 µM GTP S in
MSBH for 30 min at 4 °C (open squares) before being added
to the radiolabeled progesterone. Data represent the means of three
samples at each concentration. This experiment was performed three
times with nearly identical results.
|
|
Progesterone binding studies were performed on Xenopus
oocyte membranes to compare the affinity of progesterone binding to the
EC50 for progesterone-induced maturation. Scatchard
analysis revealed two different sets of progesterone binding sites on
the oocyte membranes: a set of lower affinity sites
(Kd = 140 nM), which most likely
represented nonspecific binding, and a set of high affinity sites
(Kd = 3 nM), which likely represented
the specific progesterone binding sites (Fig. 1B). The
density of high affinity binding sites in this experiment was
approximately 1 × 10 13 mol/mg (~3 × 108 molecules/oocyte).
The EC50 for progesterone-induced maturation correlated
with the equilibrium constants calculated for both sets of binding sites, suggesting that progesterone binding to either set of receptors could be mediating the maturation response. To confirm that the high
affinity sites were mainly responsible for progesterone-mediated effects, membranes from maturation-competent (Stage V-VI) and incompetent (Stage I-III) oocytes were tested for progesterone binding. A radiolabeled progesterone concentration of 10 nM
was used to favor detection of the high affinity binding sites.
Although stage V-VI oocytes contained specific high affinity binding
sites for [3H]progesterone, the earlier stage oocytes
(Stages I-III) did not (Fig. 1C). The presence of the high
affinity progesterone binding sites almost exclusively on
maturation-competent oocytes suggests that the specific binding of
progesterone to the high affinity sites may indeed be linked to the
maturation process. Competition studies with other steroids revealed
that progesterone binding to the stage V-VI oocyte membranes was
specific, because over 100-fold more corticosterone, testosterone, and
aldosterone were needed to compete for the high affinity progesterone
binding sites (data not shown).
Progesterone Binding to Its Membrane Receptor Was Unaffected by the
State of G Activation--
The affinity of a GPCR agonist for its
receptor is generally decreased when associated G subunits are in
the GTP-bound, activated state (42). For example, agonist affinity for
the -adrenergic receptor is markedly decreased in the presence of
GTP (43). If progesterone is acting as a GPCR agonist to mediate oocyte maturation, then, accordingly, its affinity for this receptor might be
expected to be lower when G subunits are in the activated state.
Xenopus oocyte membranes were incubated both with and
without the nonhydroyzable GTP analogue GTP S. As demonstrated in
Fig. 1D, incubation with GTP S had no effect on
progesterone binding to the oocyte membranes, suggesting that
progesterone is not binding to its receptor in a fashion typical for a
GPCR agonist.
Progesterone-induced Maturation of Xenopus Oocytes Was Affected by
Changes in G i Expression--
The role of
G i in progesterone-induced maturation was examined by
modulating its expression in oocytes. Depletion of endogenous G i was attained by injection of antisense
oligonucleotides directed against mRNAs encoding three known
Xenopus G i proteins into oocytes. Antisense
experiments work well in oocytes because the oligonucleotides can be
injected directly into the cell, thus avoiding the usual problems of
degradation and inconsistent uptake seen with cultured cells (44). Note
that progesterone concentrations used in this and subsequent
experiments were just below the EC50 calculated from Fig.
1A. This allowed more subtle changes in progesterone sensitivity to be detected. Given the slight variability in
EC50 between oocyte preparations, however, all experiments
were performed multiple times to confirm the results. Injection of
antisense oligonucleotides against mRNA encoding each individual
G i subunit (G i1, G i2, and
G i3) had minimal effect on progesterone-induced maturation when compared with injection of matching sense
oligonucleotides (Fig. 2A). In
contrast, simultaneous injection of antisense oligonucleotides against
mRNAs encoding all three G i subunits significantly
attenuated progesterone-mediated maturation when compared with oocytes
injected with matching sense oligonucleotides (Fig. 2A).

View larger version (13K):
[in this window]
[in a new window]
|
Fig. 2.
Modulation of
G i levels in Xenopus
oocytes. A, sense and antisense oligonucleotides
directed against three Xenopus oocyte G i
subunits were injected into oocytes as indicated on the x
axis at a total concentration of 2 mg/ml. After 30 h oocytes were
washed with MSBH and treated with 100 nM progesterone for
15 h. The y axis represents the percent inhibition of
maturation by the antisense oligonucleotides compared with matching
sense oligonucleotides (100 (percentage of maturation of
antisense injected)/(percentage of maturation of sense injected)).
Approximately 70 oocytes were used for each condition, and this
experiment was performed three times using two different preparations
of oligonucleotides with nearly identical results. B,
oocytes were injected with 10 mM Hepes (mock), nonspecific
cRNA encoding the thrombin receptor (PAR1), or an equal amount of cRNA
encoding the Xenopus G i2 protein
(Xe-G i2). Spontaneous maturation was measured after
30 h of incubation in MSBH. 80 oocytes were used for each
condition, and the y axis represents the percentage of
mature oocytes per condition. This experiment was performed several
times using multiple cRNA preparations with similar results.
C, oocytes were co-injected with cRNA encoding either the
wild-type (G i2-WT) or modified (G i2-Mod)
Xe-G i2 plus either the sense or antisense
oligonucleotide directed against Xe-G i2 (concentration,
2 mg/ml). Spontaneous maturation was measured after 30 h of
incubation in MSBH, and the y axis represents the percentage
of inhibition of maturation by the antisense oligonucleotides compared
with matching sense oligonucleotides. 30 oocytes were used for each
condition, and this experiment was performed twice using different cRNA
preparations with similar results.
|
|
The results from these antisense experiments are difficult to
interpret, because antibodies against Xenopus
G i proteins are not available to confirm that the
antisense oligonucleotides are indeed reducing G i
expression. To further examine the effects of G i on
maturation, cRNA encoding the Xenopus G i2
protein was injected into oocytes. Injection of this cRNA resulted in
marked spontaneous maturation when compared with oocytes injected with 10 mM Hepes (mock) or nonspecific cRNA (PAR1) (Fig.
2B). Interestingly, this spontaneous maturation was
inhibited by nearly 80% with co-injection of the antisense
oligonucleotide directed against G i2 (Fig.
2C, G i2-WT). In contrast,
co-injection of the G i2 antisense oligonucleotide with a
modified cRNA encoding the wild-type G i2 protein but
containing 21 of 33 mismatches in the region corresponding to antisense
oligonucleotide binding had less of an inhibitory effect on maturation
(Fig. 2C, G i2-Mod). This
suggests that at least the G i2 antisense oligonucleotide
can inhibit G i activity via binding to its complementary
RNA sequence. Together, these results indicate that the amount of
G i expressed in oocytes directly correlates with the
maturation response to progesterone.
G Inhibited Progesterone-induced Maturation of Xenopus
Oocytes--
Two interpretations can explain the observation that
decreased G i attenuated, whereas excess
G i enhanced, progesterone-induced maturation. First,
G i itself may be signaling to induce maturation. Second,
G that is released by activation of G i may be
affecting the maturation response. To differentiate between these two
possibilities, oocytes were injected with cRNAs encoding bovine
G 1 or G 2 subunits. These cRNAs encode
functional proteins, because they have been injected together into
Xenopus oocytes and markedly enhanced
G -dependent G protein inward rectifying potassium
channel activity
(45).2 Individual
expression of either G 1 or G 2 had no
effect on progesterone-induced maturation when a progesterone
concentration just below the EC50 was used (50 nM). In contrast, simultaneous expression of both subunits
in oocytes significantly attenuated progesterone-induced maturation
(Fig. 3A). Incubation with
higher concentrations of progesterone overcame this inhibition by
G (Fig. 3B), indicating that the processes of
G -mediated inhibition and progesterone-mediated induction of
maturation can compete with each other. In addition, these data
demonstrate that injected G subunits are not simply damaging
their host oocytes in a nonspecific fashion.

View larger version (18K):
[in this window]
[in a new window]
|
Fig. 3.
G
effects on progesterone-induced maturation of oocytes.
A, oocytes were injected with 10 mM Hepes (Mock)
or approximately 10 ng of cRNA encoding either G , G , or both G + G . After 30 h, injected oocytes were washed extensively with
MSBH and incubated in MSBH containing either 0.1% ethanol
(gray) or 50 nM progesterone (final ethanol
concentration, 0.1%; black) for 18 h. B,
oocytes were injected as indicated and treated as above, only
increasing amounts of progesterone were added, keeping the final
ethanol concentration constant at 0.1% (x axis).
C and D, oocytes were injected with either Hepes
(Mock) or cRNA encoding the indicated proteins and treated as above.
For each of A-D, 20 oocytes were used for each condition,
and the y axis indicates the percentage of mature oocytes
for each condition. Similar experiments were performed at least three
times for each study using different cRNA preparations with similar
results.
|
|
The effect of lowering endogenous Xenopus G was
examined by injecting oocytes with cRNA encoding the bovine retinal
transducin G subunit. Transducin G itself has no apparent
activity in oocytes but has been used as a G "sink" to
inhibit G -mediated signaling (46). Oocytes injected with
transducin G exhibited enhancement of progesterone-induced
maturation (Figs. 3C and 2B). In addition, injection of a GRK minigene encoding the carboxyl portion of the GRK1
protein, which has been shown to inhibit G function in a very
specific fashion (47, 48), markedly enhanced progesterone-mediated maturation at a concentration of progesterone just below the
EC50 (50 nM) (Fig. 3D). The
observation that sequestration of endogenous G enhances, while
overexpression of exogenous G attenuates, progesterone-induced
maturation suggests that increased G i activity is not
activating maturation; instead, endogenous G is inhibiting maturation.
GTP S Inhibited Progesterone-induced Maturation--
One way to
formally prove that G , and not G , is important for
progesterone-induced maturation would be to examine the effect of
injected GTP S on progesterone-induced maturation. GTP S would be
expected to bind irreversibly to G subunits, thus activating all GTP
binding proteins within the oocytes. In addition, the activated G
subunits would no longer interact with G subunits; thus, free
G activity would be expected to increase as well. Indeed,
injection of GTP S has been shown to enhance signaling by
G -activated G protein inward rectifying potassium channels (49,
50). Injection of GTP S significantly blocked oocyte maturation in
response to all concentrations of progesterone tested when compared
with Mock-injected cells (Fig.
4A), providing further evidence that intrinsic G activity is not stimulating oocyte maturation; rather, G subunits are inhibiting maturation.

View larger version (9K):
[in this window]
[in a new window]
|
Fig. 4.
The effect of activated G
proteins on progesterone-induced maturation. A,
oocytes were injected with 50.6 nl of either 10 mM Hepes
(Mock, dark) or 100 µM GTP S
(gray) and incubated in MSBH II for 6 h. Oocytes were
then washed extensively with MSBH and incubated with progesterone at
the indicated concentrations (final ethanol concentration, 0.1%) for
18 h. B, oocytes were injected with 10 mM
Hepes (Mock) or cRNA encoding either wild-type rat G i
(G i-WT) or a constitutively active isoform
(G i-Q204L). Injected oocytes were incubated for 30 h in MSBH II, washed extensively with MSBH, and incubated with either
0.1% ethanol or 100 nM progesterone (final ethanol
concentration, 0.1%) for 18 h. 20 ooyctes were used for each
condition, and the y axis indicates the percentage of mature
oocytes/point. Similar experiments were performed using multiple cRNA
and GTP S preparations with nearly identical results.
|
|
Constitutively Activated G i Had Minimal Effect on
Progesterone-induced Oocyte Maturation--
Injection of GTP S
inhibited maturation in the presence of relatively high concentrations
of progesterone (1 µM; Fig. 4A). GTP S may
therefore be inhibiting maturation simply by disabling the oocyte in a
nonspecific fashion. A more elegant way to delineate the role of
G i and G subunits in oocyte maturation would be to
compare the effects of a constitutively active rat G i
protein to its matched wild-type isoform. If G suppression is
indeed the more important signaling event, then wild-type rat
G i should behave similarly to the Xenopus
G i, whereas the constitutively active G i
protein, which cannot bind to and sequester G , should have little
effect on progesterone-induced maturation. As expected, wild-type rat
G i markedly enhanced progesterone-induced maturation at
progesterone concentrations just below the EC50 (50 nM). In contrast, constitutively active rat
G i containing a mutation that decreased the intrinsic
GTPase activity of the protein (Q204L) had minimal effect on maturation
(Fig. 4B). The lack of any substantial change in
progesterone sensitivity in oocytes overexpressing the activated
G i clearly implies that G i activity is
not important in the progesterone-mediated maturation response.
Note that expression of these two G i proteins was equal
as measured by Western blot analysis of extracts from injected oocytes
(see Fig. 7C).
G Effects Are Taking Place Upstream of Activation of
Extracellular Signal-regulated Kinase Phosphorylation--
One of the
early signaling events triggered by progesterone is activation of the
MAPK cascade. This process can be measured by immunoblotting for
phosphorylated MAPK p42 (ERK1). Of note, Xenopus oocytes
contain only the p42 isoform of ERK (51, 52). Ooctyes were injected
with cRNAs encoding the aforementioned G proteins to determine whether
their effects were occurring proximal to this point. Overexpression of
G resulted in decreased phosphorylation of ERK1 in response to
sub-optimal concentration of progesterone (50 nM) over the
course of 4 h (Fig. 5A),
which correlated with the decrease in maturation observed over an 18-h
time period (Fig. 3). In contrast, injection of the GRK minigene
markedly enhanced both the rate and amount of progesterone-induced ERK
phosphorylation, consistent with the GRK protein's ability to enhance
progesterone-mediated maturation (Fig.
6A). Overexpression of
transducin had a similar effect on ERK phosphorylation in response to
progesterone (data not shown). Finally, injection of wild-type rat
G i enhanced both the rate and amount of
progesterone-induced ERK phosphorylation, whereas expression of the
constitutively active G i (Q204L) had minimal overall
effect on MAPK activation (Fig.
7A). Although phosphorylated
ERK was detected at the 2-h time point in
G i-Q204L-injected oocytes, the amount of phosphorylation
at 4 h remained similar to mock injected cells. This contrasted
with the markedly increased phosphorylation of ERK1 after 4 h
detected in G i-WT expressing cells. Of note, Western
blot analysis of these samples using an antibody against rat
G i protein revealed that both G i subunits were equally expressed in the injected oocytes (Fig. 7C). In
addition, equal amounts of sample were present in each lane, as
confirmed by blotting for total ERK (Figs. 5B,
6B, and 7B). Together, these data indicate that
G effects are occurring early in the progesterone-mediated signaling pathway, upstream of MAPK activation.

View larger version (69K):
[in this window]
[in a new window]
|
Fig. 5.
Progesterone-induced phosphorylation of p42
MAPK in the presence of excess G
proteins. Oocytes were injected with either 10 mM Hepes (Mock) or cRNAs encoding both both G and G
(G ) and incubated for 48 h in MSBH. Oocytes were then
extensively washed with MSBH and incubated with 50 nM
progesterone for the indicated times. Extracts from each of these
samples were first probed with antiserum against phosphorylated
p42 (A) and stripped and then blotted for all p42 protein
(B). 15 oocytes were used for each sample and this
experiment was performed three times using multiple cRNA preparations
with similar results.
|
|

View larger version (54K):
[in this window]
[in a new window]
|
Fig. 6.
The effect of
G sequestration on
progesterone-induced phosphorylation of p42 MAPK. Oocytes were
injected with either 10 mM Hepes (Mock) or cRNA encoding
the GRK minigene and treated as described in Fig. 5. 15 oocytes
were used for each sample, and these experiments were performed three
times using multiple cRNA preparations.
|
|

View larger version (53K):
[in this window]
[in a new window]
|
Fig. 7.
The effects of
G i proteins on
progesterone-induced phosphorylation of p42 MAPK. A and
B, oocytes were injected with either 10 mM Hepes
(Mock) or the indicated cRNAs and treated as described in Fig. 5.
C, extracts from the t = 0 samples of
A were resolved by SDS-polyacrylamide gel electrophoresis
and blotted with an anti-G i polyclonal antibody (A. Gilman, University of Texas Southwestern Medical Center). 15 oocytes were used for each sample, and these experiments were performed
three times using multiple cRNA preparations with similar
results.
|
|
 |
DISCUSSION |
Progesterone induces maturation of Xenopus oocytes via
a nongenomic pathway. Very little is currently understood about the early progesterone-induced signaling events, including the identity of
the putative membrane progesterone binding protein. Previous work
reported the presence of specific high affinity progesterone binding
sites on Xenopus membranes (24, 25). Our results confirm these reports, demonstrating high affinity progesterone binding sites
(Kd = 3 nM) on Stage V-VI oocyte
membranes but not on Stage I-III oocyte membranes (Fig. 1). The
presence of high affinity sites almost exclusively on
maturation-competent oocytes, combined with the similarities between
the Kd for high affinity progesterone binding and
the EC50 for progesterone-induced maturation (~100
nM; Fig. 1A), suggest that the specific binding of progesterone to these sites is linked to the maturation process. An
active role for the lower affinity sites cannot be completely ruled
out, however, given that their equilibrium constant (140 nM) is also close to the EC50 value.
Earlier work has implicated G i as a possible mediator of
progesterone signaling in Xenopus oocytes (16, 26-29). The
inability of constitutively active rat G i to
significantly alter progesterone-mediated maturation and MAPK
signaling, whereas wild-type rat G i enhanced both
maturation and MAPK activation (Figs. 4B and 7A),
argues against this hypothesis. Instead, these data suggest that
intrinsic G i activity (for example, its ability to
inhibit adenylyl cyclase) is unimportant for progesterone-induced
maturation. We propose that the changes in progesterone sensitivity
observed by modulating G i levels in oocytes are in fact
due to changes in free G levels. If so, G must be acting as
an inhibitor of maturation: the more free G , the less sensitivity
to progesterone-induced maturation. Accordingly, reduction of
endogenous G i, which would increase intracellular free
G , inhibited progesterone-induced maturation (Fig.
2A). Overexpression of G i, which would
deplete free G , enhanced progesterone-induced maturation as well
as MAPK activation (Figs. 2B, 4B, and
7A). Finally, constitutively active G i, which cannot bind to G and therefore would not alter endogenous G levels, minimally affected both progesterone-mediated signaling and
maturation (Figs. 4B and 7A).
In further support of the inhbitory role of G in maturation,
overexpression of bovine G in oocytes markedly reduced the sensitivity of the maturation response to progesterone. More
importantly, sequestration of endogenous G by overexpression of
either transducin or the more specific G -binding mini-GRK protein
enhanced responses to progesterone. This suggests that endogenous
G plays a real role in attenuating Xenopus oocyte
maturation in response to progesterone and perhaps in resting oocytes
as well.
It is still possible that progesterone-induced maturation is mediated
by a G subunit other than G i. An argument against this possibility is that injection of GTP S, which activates all G
subunits, still inhibited maturation (Fig. 5A). In addition, progesterone-mediated activation of G s would be unlikely
given the observed decrease in cAMP after progesterone treatment
(26-29). Formal exclusion of this possibility is difficult, however,
and will involve examining the effects of overexpression of all of the
known classes of G subunits, and perhaps of their respective constitutively active forms, on progesterone-induced maturation. To
date, in addition to the G subunits presented in these studies, G i2, as well as multiple mammalian and
Xenopus G i subunits, enhance maturation when
overexpressed in oocytes (data not shown).
Our results are strikingly different than earlier data reported using
starfish oocytes. Injection of G i subunits into starfish oocytes inhibits, whereas injection of G enhances, maturation (35, 37), suggesting that activation of G i and release
of G are critical for starfish ooctye activation. These
contrasting results are not surprising, however. First,
1-methyladenine-induced maturation of starfish oocytes is inhibited
by pertussis toxin (53-55), whereas progesterone-induced maturation of
Xenopus oocytes is not (26, 56-58).2 This
supports the involvement of G i in starfish oocyte
maturation and argues against its importance for Xenopus
oocyte maturation. Second, 1-methyladenine binding to starfish oocyte
membranes decreases in the presence of GTP (53), whereas GTP S had no
effect on high affinity progesterone binding to Xenopus
oocyte membranes (Fig. 1D), suggesting that 1-methyladenine
binds to its membrane receptor in a fashion typical for a GPCR agonist,
whereas progesterone does not. Taken together, these results indicate
that early signaling events in oocyte maturation may be quite different
between starfish and Xenopus; thus, comparisons between the
two should be made with caution.
Although G promotes re-entry into the cell cycle in starfish
oocytes, the homologous complex in Saccharomyces cerevisiae, Ste4p/Ste18p, arrests the cell cycle in the haploid mating response (59). The mechanism behind this cell cycle arrest appears to involve
Ste4p/Ste18-induced activation of the MAPK pathway. Experiments in
mammalian systems have also demonstrated that G can activate the
MAPK pathway (60, 61). Although our data demonstrate that G can
mediate cell cycle arrest in Xenopus oocytes, G does not appear to activate the MAPK cascade. In fact, overexpression of
G attenuates, whereas sequestration of G enhances, ERK1 phosphorylation over the course of 4 h (Figs. 5-7). These results are supported by earlier work demonstrating that progesterone-induced MAPK activation in Xenopus oocytes is primarily mediated by
the Mos protein and not by G (31, 44, 62-65). In fact, G
may be playing a role in regulating Mos protein expression, because preliminary results indicate that sequestration of G enhances Mos
expression (data not shown).
The observation that endogenous G inhibits maturation offers an
intriguing model whereby maturation is held in check by low levels of
constitutive G signaling. Resting G activity has been
observed before in Xenopus oocytes and in other systems. Constitutive G -mediated G protein-coupled inward rectifying potassium channel activity in resting oocytes can be inhibited by
sequestration of free G (45, 48, 66). In addition, free G
activity has also been proposed to constitutively permit endocytosis in
mammalian CV1 cells (67). Progesterone may be inducing maturation by
antagonizing this constitutive inhibitory G activity. For
example, progesterone could attenuate G activity by binding
directly to G or to another molecule that interferes with G
signaling. Of note, we observed no increase in progesterone binding to
membranes from oocytes overexpressing G subunits (data not
shown). Alternatively, one tantalizing possibility is that progesterone
acts as an antagonist, or even an inverse agonist, on an unknown
constitutively active GPCR that signals via G to inhibit
maturation. This type of "nonagonist" interaction between progesterone and a GPCR is consistent with our binding data
demonstrating no change in progesterone binding to its receptor in
membranes treated with GTP S. Interestingly, this release of
inhibition model is reminiscent of the oxytocin receptor story, where
progesterone may act by competing with oxytocin for binding to its GPCR
(38). Of note, oxytocin had no effect on any of the described
experiments with progesterone (data not shown). Improving our
understanding of early signaling events in progesterone-mediated
maturation may provide us with useful clues in searching for the
elusive membrane progesterone binding protein and may prove helpful in elucidating the mechanisms involved in other nongenomic steroid signaling pathways as well.
 |
ACKNOWLEDGEMENTS |
We are extremely thankful for all of the
support and help from Dr. Shaun Coughlin at the University of
California at San Francisco. Interest for this work began in his
laboratory and his generosity and ideas were critical for this project.
We also thank Alex Yi and Dr. L. Jan at the University of California at
San Francisco for invaluable help, ideas, and reagents. Special thanks
is also given to Drs. A. Gilman, E. Ross, and R. Auchus for critical
review of this manuscript.
 |
FOOTNOTES |
*
The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
To whom correspondence should be addressed: Div. of
Endocrinology, Dept. of Internal Medicine, University of Texas
Southwestern Medical School, 5323 Harry Hines Blvd., Dallas, TX
75390-8857. Tel.: 214-648-4793; Fax: 214-648-8917; E-mail:
stephen.hammes@email.swmed.edu.
Published, JBC Papers in Press, October 3, 2000, DOI 10.1074/jbc.M006757200
2
S. R. Hammes, unpublished results.
 |
ABBREVIATIONS |
The abbreviations used are:
MAPK, mitogen-activated protein kinase;
GPCR, G protein-coupled receptor;
MSBH, modified Barth's solution;
ERK, extracellular signal-regulated
kinase;
GTP S, guanosine 5'-3-O-(thio)triphosphate.
 |
REFERENCES |
| 1.
|
Meier, C. A.
(1997)
J. Recept. Signal Transduct. Res.
17,
319-335
|
| 2.
|
Wehling, M.
(1997)
Annu. Rev. Physiol.
59,
365-393
|
| 3.
|
Christ, M.,
Douwes, K.,
Eisen, C.,
Bechtner, G.,
Theisen, K.,
and Wehling, M.
(1995)
Hypertension
25,
117-123
|
| 4.
|
Christ, M.,
Eisen, C.,
Aktas, J.,
Theisen, K.,
and Wehling, M.
(1993)
J. Clin. Endocrinol. Metab.
77,
1452-1457
|
| 5.
|
Schneider, M.,
Ulsenheimer, A.,
Christ, M.,
and Wehling, M.
(1997)
Am. J. Physiol.
272,
E616-E620
|
| 6.
|
Wehling, M.,
Eisen, C.,
and Christ, M.
(1992)
Mol. Cell. Endocrinol.
90,
C5-C9
|
| 7.
|
Wehling, M.,
Neylon, C. B.,
Fullerton, M.,
Bobik, A.,
and Funder, J. W.
(1995)
Circ. Res.
76,
973-979
|
| 8.
|
Wehling, M.,
Ulsenheimer, A.,
Schneider, M.,
Neylon, C.,
and Christ, M.
(1994)
Biochem. Biophys. Res. Commun.
204,
475-481
|
| 9.
|
Chen, Z.,
Yuhanna, I. S.,
Galcheva-Gargova, Z.,
Karas, R. H.,
Mendelsohn, M. E.,
and Shaul, P. W.
(1999)
J. Clin. Invest.
103,
401-406
|
| 10.
|
Kirsch, E. A.,
Yuhanna, I. S.,
Chen, Z.,
German, Z.,
Sherman, T. S.,
and Shaul, P. W.
(1999)
Am. J. Respir. Cell Mol. Biol.
20,
658-666
|
| 11.
|
Razandi, M.,
Pedram, A.,
Greene, G. L.,
and Levin, E. R.
(1999)
Mol Endocrinol.
13,
307-319
|
| 12.
|
Shaul, P. W.
(1999)
Steroids
64,
28-34
|
| 13.
|
Norman, A. W.,
Bishop, J. E.,
Collins, E. D.,
Seo, E. G.,
Satchell, D. P.,
Dormanen, M. C.,
Zanello, S. B.,
Farach-Carson, M. C.,
Bouillon, R.,
and Okamura, W. H.
(1996)
J. Steroid Biochem. Mol. Biol.
56,
13-22
|
| 14.
|
Lieberherr, M.
(1987)
J. Biol. Chem.
262,
13168-13173
|
| 15.
|
Caffrey, J. M.,
and Farach-Carson, M. C.
(1989)
J. Biol. Chem.
264,
20265-20274
|
| 16.
|
Maller, J. L.,
and Krebs, E. G.
(1980)
Curr. Top. Cell. Regul.
16,
271-311
|
| 17.
|
Nagahama, Y.,
Yoshikuni, M.,
Yamashita, M.,
Tokumoto, T.,
and Katsu, Y.
(1995)
Curr. Top. Dev. Biol.
30,
103-145
|
| 18.
|
Nagahama, Y.
(1997)
Steroids
62,
190-196
|
| 19.
|
Maller, J. L.,
and Krebs, E. G.
(1977)
J. Biol. Chem.
252,
1712-1718
|
| 20.
|
Smith, L. D.,
and Ecker, R. E.
(1969)
Dev. Biol.
19,
281-309
|
| 21.
|
Smith, L. D.,
and Ecker, R. E.
(1971)
Dev. Biol.
25,
232-247
|
| 22.
|
Godeau, J. F.,
Schorderet-Slatkine, S.,
Hubert, P.,
and Baulieu, E. E.
(1978)
Proc. Natl. Acad. Sci. U. S. A.
75,
2353-2357
|
| 23.
|
Masui, Y.,
and Markert, C. L.
(1971)
J. Exp. Zool.
177,
129-145
|
| 24.
|
Blondeau, J. P.,
and Baulieu, E. E.
(1984)
Biochem. J.
219,
785-792
|
| 25.
|
Liu, Z.,
and Patino, R.
(1993)
Biol. Reprod.
49,
980-988
|
| 26.
|
Sadler, S. E.,
Maller, J. L.,
and Cooper, D. M.
(1984)
Mol. Pharmacol.
26,
526-531
|
| 27.
|
Sadler, S. E.,
and Maller, J. L.
(1983)
J. Biol. Chem.
258,
7935-7941
|
| 28.
|
Sadler, S. E.,
and Maller, J. L.
(1981)
J. Biol. Chem.
256,
6368-6373
|
| 29.
|
Sadler, S. E.,
and Maller, J. L.
(1985)
Adv. Cyclic Nucleotide Protein Phosphorylation Res.
19,
179-194
|
| 30.
|
Kosako, H.,
Gotoh, Y.,
and Nishida, E.
(1994)
J. Cell Sci. Suppl
18,
115-119
|
| 31.
|
Kosako, H.,
Gotoh, Y.,
and Nishida, E.
(1994)
EMBO J.
13,
2131-2138
|
| 32.
|
Kosako, H.,
Nishida, E.,
and Gotoh, Y.
(1993)
EMBO J.
12,
787-794
|
| 33.
|
Fabian, J. R.,
Morrison, D. K.,
and Daar, I. O.
(1993)
J. Cell Biol.
122,
645-652
|
| 34.
|
Ferrell, J. E., Jr.,
and Machleder, E. M.
(1998)
Science
280,
895-898
|
| 35.
|
Chiba, K.,
Kontani, K.,
Tadenuma, H.,
Katada, T.,
and Hoshi, M.
(1993)
Mol. Biol. Cell
4,
1027-1034
|
| 36.
|
Chiba, K.,
Longo, F. J.,
Kontani, K.,
Katada, T.,
and Hoshi, M.
(1995)
Dev. Biol.
169,
415-420
|
| 37.
|
Jaffe, L. A.,
Gallo, C. J.,
Lee, R. H.,
Ho, Y. K.,
and Jones, T. L.
(1993)
J. Cell Biol.
121,
775-783
|
| 38.
|
Grazzini, E.,
Guillon, G.,
Mouillac, B.,
and Zingg, H. H.
(1998)
Nature
392,
509-512
|
| 39.
|
Vu, T.-K. H.,
Hung, D. T.,
Wheaton, V. I.,
and Coughlin, S. R.
(1991)
Cell
64,
1057-1068
|
| 40.
|
Williams, J. A.,
McChesney, D. J.,
Calayag, M. C.,
Lingappa, V. R.,
and Logsdon, C. D.
(1988)
Proc. Natl. Acad. Sci. U. S. A.
85,
4939-4943
|
| 41.
|
Olate, J.,
Martinez, S.,
Purcell, P.,
Jorquera, H.,
Codina, J.,
Birnbaumer, L.,
and Allende, J.
(1990)
FEBS Lett.
268,
27-31
|
| 42.
|
Ross, E. M.
(1989)
Neuron
3,
141-152
|
| 43.
|
Maguire, M. E.,
Van Arsdale, P. M.,
and Gilman, A. G.
(1976)
Mol. Pharmacol.
12,
335-339
|
| 44.
|
Sagata, N.,
Oskarsson, M.,
Copeland, T.,
Brumbaugh, J.,
and Vande Woude, G. F.
(1988)
Nature
335,
519-525
|
| 45.
|
Reuveny, E.,
Slesinger, P. A.,
Inglese, J.,
Morales, J. M.,
Iniguez-Lluhi, J. A.,
Lefkowitz, R. J.,
Bourne, H. R.,
Jan, Y. N.,
and Jan, L. Y.
(1994)
Nature
370,
143-146
|
| 46.
|
Miller, B. A.,
Bell, L.,
Hansen, C. A.,
Robishaw, J. D.,
Linder, M. E.,
and Cheung, J. Y.
(1996)
J. Clin. Invest.
98,
1728-1736
|
| 47.
|
Koch, W. J.,
Hawes, B. E.,
Inglese, J.,
Luttrell, L. M.,
and Lefkowitz, R. J.
(1994)
J. Biol. Chem.
269,
6193-6197
|
| 48.
|
Jing, J.,
Chikvashvili, D.,
Singer-Lahat, D.,
Thornhill, W. B.,
Reuveny, E.,
and Lotan, I.
(1999)
EMBO J.
18,
1245-1256
|
| 49.
|
Chen, Y.,
and Yu, L.
(1994)
J. Biol. Chem.
269,
7839-7842
|
| 50.
|
Dascal, N.,
Lim, N. F.,
Schreibmayer, W.,
Wang, W.,
Davidson, N.,
and Lester, H. A.
(1993)
Proc. Natl. Acad. Sci. U. S. A.
90,
6596-6600
|
| 51.
|
Gotoh, Y.,
Moriyama, K.,
Matsuda, S.,
Okumura, E.,
Kishimoto, T.,
Kawasaki, H.,
Suzuki, K.,
Yahara, I.,
Sakai, H.,
and Nishida, E.
(1991)
EMBO J.
10,
2661-2668
|
| 52.
|
Posada, J.,
Sanghera, J.,
Pelech, S.,
Aebersold, R.,
and Cooper, J. A.
(1991)
Mol. Cell. Biol.
11,
2517-2528
|
| 53.
|
Tadenuma, H.,
Takahashi, K.,
Chiba, K.,
Hoshi, M.,
and Katada, T.
(1992)
Biochem. Biophys. Res. Commun.
186,
114-121
|
| 54.
|
Shilling, F.,
Chiba, K.,
Hoshi, M.,
Kishimoto, T.,
and Jaffe, L. A.
(1989)
Dev. Biol.
133,
605-608
|
| 55.
|
Chiba, K.,
and Hoshi, M.
(1995)
Prog. Cell. Cycle Res.
1,
255-263
|
| 56.
|
Mulner, O.,
Megret, F.,
Alouf, J. E.,
and Ozon, R.
(1985)
FEBS Lett.
181,
397-402
|
| 57.
|
Goodhardt, M.,
Ferry, N.,
Buscaglia, M.,
Baulieu, E. E.,
and Hanoune, J.
(1984)
EMBO J.
3,
2653-2657
|
| 58.
|
Olate, J.,
Allende, C. C.,
Allende, J. E.,
Sekura, R. D.,
and Birnbaumer, L.
(1984)
FEBS Lett.
175,
25-30
|
| 59.
|
Herskowitz, I.
(1995)
Cell
80,
187-197
|
| 60.
|
Birnbaumer, L.
(1992)
Cell
71,
1069-1072
|
| 61.
|
Clapham, D. E.,
and Neer, E. J.
(1997)
Annu. Rev. Pharmacol. Toxicol.
37,
167-203
|
| 62.
|
Sagata, N.
(1997)
Bioessays
19,
13-21
|
| 63.
|
Shibuya, E. K.,
Polverino, A. J.,
Chang, E.,
Wigler, M.,
and Ruderman, J. V.
(1992)
Proc. Natl. Acad. Sci. U. S. A.
89,
9831-9835
|
| 64.
|
Shibuya, E. K.,
Morris, J.,
Rapp, U. R.,
and Ruderman, J. V.
(1996)
Cell Growth Differ.
7,
235-241
|
| 65.
|
Posada, J.,
Yew, N.,
Ahn, N. G.,
Vande Woude, G. F.,
and Cooper, J. A.
(1993)
Mol. Cell. Biol.
13,
2546-2353
|
| 66.
|
Luchian, T.,
Dascal, N.,
Dessauer, C.,
Platzer, D.,
Davidson, N.,
Lester, H. A.,
and Schreibmayer, W.
(1997)
J. Physiol. (Lond.)
505,
13-22
|
| 67.
|
Lin, H. C.,
Duncan, J. A.,
Kozasa, T.,
and Gilman, A. G.
(1998)
Proc. Natl. Acad. Sci. U. S. A.
95,
5057-5060
|
Copyright © 2000 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
K. Evaul and S. R. Hammes
Cross-talk between G Protein-coupled and Epidermal Growth Factor Receptors Regulates Gonadotropin-mediated Steroidogenesis in Leydig Cells
J. Biol. Chem.,
October 10, 2008;
283(41):
27525 - 27533.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Deng, S. Lang, C. Wylie, and S. R. Hammes
The Xenopus laevis Isoform of G Protein-Coupled Receptor 3 (GPR3) Is a Constitutively Active Cell Surface Receptor that Participates in Maintaining Meiotic Arrest in X. laevis Oocytes
Mol. Endocrinol.,
August 1, 2008;
22(8):
1853 - 1865.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
X.-D. Fu, M. Flamini, A. M. Sanchez, L. Goglia, M. S. Giretti, A. R. Genazzani, and T. Simoncini
Progestogens regulate endothelial actin cytoskeleton and cell movement via the actin-binding protein moesin
Mol. Hum. Reprod.,
April 1, 2008;
14(4):
225 - 234.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. R. Hammes and E. R. Levin
Extranuclear Steroid Receptors: Nature and Actions
Endocr. Rev.,
December 1, 2007;
28(7):
726 - 741.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
W. El-Jouni, S. Haun, R. Hodeify, A. Hosein Walker, and K. Machaca
Vesicular traffic at the cell membrane regulates oocyte meiotic arrest
Development,
September 15, 2007;
134(18):
3307 - 3315.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Evaul, M. Jamnongjit, B. Bhagavath, and S. R. Hammes
Testosterone and Progesterone Rapidly Attenuate Plasma Membrane G{beta}{gamma}-Mediated Signaling in Xenopus laevis Oocytes by Signaling through Classical Steroid Receptors
Mol. Endocrinol.,
January 1, 2007;
21(1):
186 - 196.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Rasar, D. B. DeFranco, and S. R. Hammes
Paxillin Regulates Steroid-triggered Meiotic Resumption in Oocytes by Enhancing an All-or-None Positive Feedback Kinase Loop
J. Biol. Chem.,
December 22, 2006;
281(51):
39455 - 39464.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. Haas, S. N. White, L. B. Lutz, M. Rasar, and S. R. Hammes
The Modulator of Nongenomic Actions of the Estrogen Receptor (MNAR) Regulates Transcription-Independent Androgen Receptor-Mediated Signaling: Evidence that MNAR Participates in G Protein-Regulated Meiosis in Xenopus laevis Oocytes
Mol. Endocrinol.,
August 1, 2005;
19(8):
2035 - 2046.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Q. Zhang, A. Dickson, and C. A. Doupnik
G{beta}{gamma}-activated Inwardly Rectifying K+ (GIRK) Channel Activation Kinetics via G{alpha}i and G{alpha}o-coupled Receptors Are Determined by G{alpha}-specific Interdomain Interactions That Affect GDP Release Rates
J. Biol. Chem.,
July 9, 2004;
279(28):
29787 - 29796.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. E. Sadler and N. D. Jacobs
Stimulation of Xenopus laevis Oocyte Maturation by Methyl-{beta}-Cyclodextrin
Biol Reprod,
June 1, 2004;
70(6):
1685 - 1692.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. R. Beker-van Woudenberg, H. T.A. van Tol, B. A.J. Roelen, B. Colenbrander, and M. M. Bevers
Estradiol and Its Membrane-Impermeable Conjugate (Estradiol-Bovine Serum Albumin) During In Vitro Maturation of Bovine Oocytes: Effects on Nuclear and Cytoplasmic Maturation, Cytoskeleton, and Embryo Quality
Biol Reprod,
May 1, 2004;
70(5):
1465 - 1474.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. R. Hammes
Steroids and Oocyte Maturation--A New Look at an Old Story
Mol. Endocrinol.,
April 1, 2004;
18(4):
769 - 775.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Gill, M. Jamnongjit, and S. R. Hammes
Androgens Promote Maturation and Signaling in Mouse Oocytes Independent of Transcription: A Release of Inhibition Model for Mammalian Oocyte Meiosis
Mol. Endocrinol.,
January 1, 2004;
18(1):
97 - 104.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. M. LOSEL, E. FALKENSTEIN, M. FEURING, A. SCHULTZ, H.-C. TILLMANN, K. ROSSOL-HASEROTH, and M. WEHLING
Nongenomic Steroid Action: Controversies, Questions, and Answers
Physiol Rev,
July 1, 2003;
83(3):
965 - 1016.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. B. Lutz, M. Jamnongjit, W.-H. Yang, D. Jahani, A. Gill, and S. R. Hammes
Selective Modulation of Genomic and Nongenomic Androgen Responses by Androgen Receptor Ligands
Mol. Endocrinol.,
June 1, 2003;
17(6):
1106 - 1116.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Wang and X. J. Liu
A G Protein-coupled Receptor Kinase Induces Xenopus Oocyte Maturation
J. Biol. Chem.,
April 25, 2003;
278(18):
15809 - 15814.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
W.-H. Yang, L. B. Lutz, and S. R. Hammes
Xenopus laevis Ovarian CYP17 Is a Highly Potent Enzyme Expressed Exclusively in Oocytes. EVIDENCE THAT OOCYTES PLAY A CRITICAL ROLE IN XENOPUS OVARIAN ANDROGEN PRODUCTION
J. Biol. Chem.,
March 7, 2003;
278(11):
9552 - 9559.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. R. Hammes
The further redefining of steroid-mediated signaling
PNAS,
March 4, 2003;
100(5):
2168 - 2170.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Zhu, C. D. Rice, Y. Pang, M. Pace, and P. Thomas
From the Cover: Cloning, expression, and characterization of a membrane progestin receptor and evidence it is an intermediary in meiotic maturation of fish oocytes
PNAS,
March 4, 2003;
100(5):
2231 - 2236.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H.-Y. Fan, C. Tong, L. Lian, S.-W. Li, W.-X. Gao, Y. Cheng, D.-Y. Chen, H. Schatten, and Q.-Y. Sun
Characterization of Ribosomal S6 Protein Kinase p90rsk During Meiotic Maturation and Fertilization in Pig Oocytes: Mitogen-Activated Protein Kinase-Associated Activation and Localization
Biol Reprod,
March 1, 2003;
68(3):
968 - 977.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
I. Rishal, T. Keren-Raifman, D. Yakubovich, T. Ivanina, C. W. Dessauer, V. Z. Slepak, and N. Dascal
Na+ Promotes the Dissociation between Galpha GDP and Gbeta gamma , Activating G Protein-gated K+ Channels
J. Biol. Chem.,
January 31, 2003;
278(6):
3840 - 3845.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Grondahl, J. Breinholt, P. Wahl, A. Murray, T. H. Hansen, I. Faerge, C. E. Stidsen, K. Raun, and C. Hegele-Hartung
Physiology of meiosis-activating sterol: endogenous formation and mode of action
Hum. Reprod.,
January 1, 2003;
18(1):
122 - 129.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. C. Duckworth, J. S. Weaver, and J. V. Ruderman
G2 arrest in Xenopus oocytes depends on phosphorylation of cdc25 by protein kinase A
PNAS,
December 24, 2002;
99(26):
16794 - 16799.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. B. Lutz, L. M. Cole, M. K. Gupta, K. W. Kwist, R. J. Auchus, and S. R. Hammes
Evidence that androgens are the primary steroids produced by Xenopus laevis ovaries and may signal through the classical androgen receptor to promote oocyte maturation
PNAS,
November 9, 2001;
(2001)
241471598.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. B. Lutz, L. M. Cole, M. K. Gupta, K. W. Kwist, R. J. Auchus, and S. R. Hammes
Evidence that androgens are the primary steroids produced by Xenopus laevis ovaries and may signal through the classical androgen receptor to promote oocyte maturation
PNAS,
November 20, 2001;
98(24):
13728 - 13733.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 2000 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|