Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Originally published In Press as doi:10.1074/jbc.M006757200 on October 3, 2000

J. Biol. Chem., Vol. 275, Issue 52, 41512-41520, December 29, 2000
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
275/52/41512    most recent
M006757200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lutz, L. B.
Right arrow Articles by Hammes, S. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lutz, L. B.
Right arrow Articles by Hammes, S. R.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

G Protein beta gamma Subunits Inhibit Nongenomic Progesterone-induced Signaling and Maturation in Xenopus laevis Oocytes

EVIDENCE FOR A RELEASE OF INHIBITION MECHANISM FOR CELL CYCLE PROGRESSION*

Lindsey B. Lutz, Bonnie Kim, David Jahani, and Stephen R. HammesDagger

From the Department of Internal Medicine, University of Texas Southwestern Medical School, Dallas, Texas 75390-8857

Received for publication, July 27, 2000, and in revised form, September 12, 2000

    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Progesterone-induced maturation of Xenopus oocytes is a well known example of nongenomic signaling by steroids; however, little is known about the early signaling events involved in this process. Previous work has suggested that G proteins and G protein-coupled receptors may be involved in progesterone-mediated oocyte maturation as well as in other nongenomic steroid-induced signaling events. To investigate the role of G proteins in nongenomic signaling by progesterone, the effects of modulating Galpha and Gbeta gamma levels in Xenopus oocytes on progesterone-induced signaling and maturation were examined. Our results demonstrate that Gbeta gamma subunits, rather than Galpha , are the principal mediators of progesterone action in this system. We show that overexpression of Gbeta gamma inhibits both progesterone-induced maturation and activation of the MAPK pathway, whereas sequestration of endogenous Gbeta gamma subunits enhances progesterone-mediated signaling and maturation. These data are consistent with a model whereby endogenous free Xenopus Gbeta gamma subunits constitutively inhibit oocyte maturation. Progesterone may induce maturation by antagonizing this inhibition and therefore allowing cell cycle progression to occur. These studies offer new insight into the early signaling events mediated by progesterone and may be useful in characterizing and identifying the membrane progesterone receptor in oocytes.

    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Steroid hormones are traditionally known to mediate their signaling and subsequent biological activities via nuclear receptors (1). Interestingly, many steroid-induced signaling events appear to be triggered independently from the classic nuclear receptor pathways. In fact, these processes likely involve steroid signaling via membrane receptors (2). Examples of rapid, nongenomic signaling by steroids are myriad, including aldosterone-induced increases in intracellular calcium in vascular smooth muscle cells (3-8), estrogen-mediated induction of nitric-oxide synthase in vascular endothelial cells (9-12), vitamin D-induced increases in intracellular calcium in osteosarcoma cells (13-15), and progesterone-mediated maturation of amphibian and fish oocytes (16-18).

The phenomenon of progesterone-induced maturation of Xenopus oocytes serves as a useful experimental model for studying nongenomic steroid signaling (16, 19-21). The maturation of an oocyte refers to the meiotic stage at which an oocyte rests. "Immature" oocytes are arrested in prophase of meiosis I. Before ovulation, oocytes are induced to re-enter the cell cycle, finally resting in metaphase II. These "mature" oocytes are then competent for ovulation and subsequent fertilization, after which the final stages of meiosis are completed (16).

Evidence suggests that progesterone-induced maturation of Xenopus oocytes is mediated by cell surface rather than nuclear receptors. First, maturation is unaffected by the transcriptional inhibitor actinomycin D (21). Second, progesterone covalently attached to either polymers or bovine serum albumin and therefore unable to diffuse through the oocyte membrane still mediates maturation (16, 22). Third, progesterone injection directly into oocytes does not induce maturation (16, 21, 23). Finally, progesterone appears to bind specifically and with relatively high affinity to oocyte membranes (24, 25). At this point, however, no progesterone binding proteins have been identified in Xenopus oocyte membranes.

Progesterone signaling may be coupled to G proteins. Progesterone treatment of oocytes results in a rapid decrease in intracellular cAMP, perhaps through attenuation of adenylyl cyclase activity (26-29). This suggests that Galpha i, and therefore a Galpha i-coupled receptor, may be involved in progesterone-mediated signaling. In addition, progesterone activates the mitogen-activated protein kinase (MAPK)1 cascade in oocytes (30-34), which could be mediated by Gbeta gamma subunits. Finally, 1-methyladenine induces maturation of starfish oocytes in a pertussis toxin-sensitive fashion, suggesting that Galpha i mediates oocyte maturation in a comparable system (35-37). Interestingly, progesterone binds to the G protein-coupled oxytocin receptor, thereby partially blocking oxytocin binding and oxytocin-mediated signaling (38). One hypothesis is that the high amounts of progesterone present during pregnancy bind to the oxytocin receptor and prevent the induction of labor. When progesterone levels decrease at the end of pregnancy, this "release of inhibition" may allow oxytocin-mediated contractions, and therefore labor, to begin. Again, these data are consistent with progesterone modulation of G protein-coupled receptor signaling.

The role of G proteins in progesterone-mediated Xenopus oocyte maturation was examined by systematically depleting or overexpressing G protein subunits in Xenopus oocytes. Our data suggest that, in fact, Galpha i is not important for this process. Rather, Gbeta gamma subunits appear to be the principal mediators of progesterone action in Xenopus oocytes, acting as inhibitors of oocyte maturation. Progesterone may therefore induce maturation by antagonizing constitutive Gbeta gamma -mediated inhibition of cell cycle progression.

    EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Oocyte Preparation-- Oocytes were harvested from female Xenopus laevis (Nasco) and treated as described previously (39, 40). Briefly, follicular cells were removed by incubation of the oocytes for 3-4 h at room temperature with 1 mg/ml collagenase A (Roche Molecular Biochemicals) in modified Barth's solution (MSBH) without Ca2+. Oocytes were then washed extensively and incubated overnight at 16 °C in MSBH II (MSBH with 1 mg/ml bovine serum albumin, 1 mg/ml Ficoll, 100 units/ml penicillin, and 100 µg/ml streptomycin). Stage V-VI oocytes were selected, and maturation assays were performed on each preparation to determine its sensitivity to progesterone-induced maturation.

Progesterone Maturation Assay-- Injected or uninjected stage V-VI ooctyes were washed extensively with MSBH to remove the bovine serum albumin from the storage buffer. They were then incubated with various doses of progesterone (Sigma) for the times indicated in the figure legends. The ethanol concentration was always kept constant at 0.1% regardless of the progesterone concentration. Maturation was detected by visualizing germinal vesicle breakdown, which manifests itself as a white spot on the dark animal pole of the oocyte (16).

Oocyte Membrane Preparation-- Oocyte membranes were prepared from Stage V-VI or Stage I-IIII oocytes as described (25). In summary, oocytes were homogenized with a Dounce homogenizer (Kontes, pestle A, 15 strokes) in membrane buffer (83 mM NaCl, 1 mM MgCl2, 1 mM phenylmethylsulfonyl fluoride, 10 mM Hepes, pH 7.6) at 4 °C. The homogenate was centrifuged at 800 × g for 10 min, and the supernatant was removed and centrifuged again at 800 × g. After a third centrifugation at 800 × g, the supernatant was centrifuged at 20,000 × g for 25 min, and the membrane pellet was resuspended in membrane buffer, taking caution to avoid disturbing the black melanin component of the pellet. Membranes were centrifuged two more times at 20,000 × g and finally resuspended in MSBH at a protein concentration of 5 mg/ml. Samples were then frozen at -80 °C until needed.

Binding Assay-- 1,2,6,7-3H(N)]-progesterone (PerkinElmer Life Sciences) was diluted in ethanol on ice to 100× the final concentrations indicated in the figure legends. 5 µl of each of the 100× solutions was added to individual 1.5-ml polypropylene microcentrifuge tubes with either 1 µl of unlabeled progesterone stock in ethanol (concentration indicated in the figure legends) or 1 µl of ethanol alone. Each condition (i.e. concentration of radiolabeled progesterone) was tested in triplicate for every experiment. Membranes were diluted to the concentrations indicated in the figure legends in MSBH at 4 °C, and 500 µl of this mixture was added to each tube containing radiolabeled steroid. The tubes were then rocked at 4 °C for 1 h. 25 µl was collected from each tube, diluted in scintillation fluid, and counted to determine the concentration of free progesterone at the end of the assay. Glass microfiber filters (Millipore) that had been preincubated in MSBH at 4 °C were placed on a prechilled vacuum filter holder (Millipore), and 400 µl of each sample was applied to individual filters. The filters were washed with 20 ml of cold MSBH, removed, and placed in 5 ml of scintillation fluid (Budget-Solve, Research Products International Corp.) for counting on a Beckman LS1801 scintillation counter.

Oligonucleotide Design, Plasmid Construction, cRNA Synthesis, and cRNA Injection-- Sense and antisense oligonucleotides directed against sequences near the start codons of Xenopus Galpha i1 (accession number AF086606), Galpha i2 (accession number X56089), and Galpha i3 (accession number X56090) (41) were synthesized by Life Technologies, Inc. These sequences were as follows: ATCGCTGCCATGGGCTGCACCTCGAGCGCC (Galpha i1), GCTGAACGGAGAACCGTCGCCATGGGATGTACT (Galpha i2), and CGGGAGGCGCCGAGCGAAGTAAAATGATC (Galpha i3). 50.6 nl of 2 mg/ml solutions of oligonucleotides in 10 mM Hepes were injected into each oocyte as indicated in the figure legend.

The Xenopus Galpha i1, Galpha i2, and Galpha i3 cDNAs were cloned by polymerase chain reaction from a Xenopus oocyte cDNA library created from purified Xenopus oocyte mRNA (Fast-Track, Invitrogen) using standard techniques. The modified Galpha i2 cDNA (Galpha i2-Mod) contains the following 5' sequence: CCAGCCATGGGTTGCACA. The Galpha i2-Mod cDNA will match with only 12 of 33 nucleotides of the Galpha i2 antisense oligonucleotide. The rat Galpha i-WT and Galpha i-Q203L cDNAs were a gift from A. Gilman (UTSW). All of these cDNAs were cloned into the Xenopus oocyte expression vector pGEM HE (a gift from L. Jan, University of California at San Francisco) and were sequenced using the dideoxy method. The bovine Gbeta 1 cDNA in pGEM HE and bovine Ggamma 2 cDNA in pFROG were gifts from L. Jan (University of California at San Francisco). The bovine transducin Galpha cDNA in pFROG was a gift from S. Coughlin (University of California at San Francisco), and the GRK-minigene in pGEM HE was a gift from E. Reuveny (Tel Aviv). All constructs were linearized and transcribed in vitro with either T7 or SP6 (Promega transcription kit). Stage V-VI oocytes were injected with 50.6 nl of cRNA at a concentration of approximately 200 ng/µl using a Drummond automatic injector, and injected oocytes were then incubated 30-48 h in MSBH II before the maturation or MAPK assays were performed.

MAPK Assay-- Injected oocytes were washed with MSBH and incubated with 50 nM progesterone as described in the experimental procedures under "Progesterone Maturation Assay." Oocytes were lysed at the indicated times with lysis buffer (150 mM NaCl, 2 mM EDTA, 0.5 mM sodium vanadate, 2 mM NaF, 1% Tx-100, 20 mM Tris, pH 7.6) at 4 °C. 20 µl of lysis buffer was used per oocyte. Lysates were microcentrifuged at full speed for 10 min, and the supernatant was removed and diluted in 2× Laemmli sample buffer. Samples were resolved by electrophoresis on 10% polyacrylamide gels, and proteins were transferred to Immobilon membranes (Millipore). Membranes were blocked with 5% nonfat dry milk in TBST (100 mM NaCl, 0.1% Tween-20, 50 mM Tris, pH 7.4) for 1 h, incubated overnight at 4 °C with a rabbit anti-phospho-p44/42 MAPK antibody (New England Biolabs), washed four times with TBST, incubated for 1 h at room temperature with horseradish peroxidase-conjugated goat anti-rabbit antibody (1:4000, Bio-Rad), and washed another four times with TBST. Blots were then treated with ECL-Plus (Amersham Pharmacia Biotech) to visualize the proteins. Next, blots were stripped in 100 mM 2-mercaptoethanol, 2% SDS, 62.5 mM Tris, pH 6.7 at 55 °C for 30 min, washed four times with TBST, and reblotted as above using a rabbit anti-p44/42 MAPK polyclonal antibody (New England Biolabs) that will bind all p44/p42 regardless of its phosphorylation status.

    RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

The EC50 of Progesterone-induced Maturation Correlated with Specific High Affinity Binding of Progesterone to Maturation-competent Oocyte Membranes-- Maturation experiments using increasing concentrations of progesterone revealed an EC50 for maturation in the range of 75-150 nM, depending upon the oocyte preparation (Fig. 1A). The sensitivity of the in vitro maturation response to low concentrations of progesterone suggests that it could be relevant in vivo, where physiologic concentrations of progesterone in the ovary could easily be in the 100 nM range (38). The maturation response was also relatively specific to progesterone, because much higher concentrations of pregnenolone (EC50 = ~1 µM), 17-OH progesterone, corticosterone, and aldosterone (all with EC50 values of ~0.5-1 µM) were needed to induce maturation (data not shown).


View larger version (15K):
[in this window]
[in a new window]
 
Fig. 1.   Progesterone-mediated oocyte maturation and progesterone binding to oocyte membranes. A, the EC50 for progesterone-mediated maturation was determined by treating oocytes with the indicated concentrations of progesterone (x axis) for 18 h. Maturation, which was detected by looking for germinal vesicle breakdown, is displayed on the y axis as a percentage of the total number of oocytes/concentration of progesterone (n = 20). This experiment was performed over 10 times with a range of EC50 from 50 to 150 nM. B, binding studies on stage V-VI oocyte membranes using a wide range of radiolabeled progesterone concentrations was performed. 300 µg of membranes were used for each sample. Data represent the means of three samples at each concentration of progesterone and are expressed as a Scatchard plot. This experiment was performed three times with three different membrane preparations with nearly identical results. C, binding assays were performed on membranes from stage I-III and stage V-VI oocytes. 50 µg of membranes were incubated with 10 nM radiolabeled progesterone ± 100 nM unlabeled progesterone for each sample. Data represent the means ± S.D. (n = 3) of the total counts after subtracting background, with background defined as the number of counts in samples incubated with labeled plus excess unlabeled progesterone. The total counts bound in Stage V-VI membranes was approximately 2-fold above background. D, binding studies on stage V-VI oocyte membranes (300 µg/point) were done using the indicated radiolabeled progesterone concentrations. Experiments were performed as described in the experimental procedures only the MSBH contained 5 mM MgCl2, and half of the membranes were preincubated with 200 µM GTPgamma S in MSBH for 30 min at 4 °C (open squares) before being added to the radiolabeled progesterone. Data represent the means of three samples at each concentration. This experiment was performed three times with nearly identical results.

Progesterone binding studies were performed on Xenopus oocyte membranes to compare the affinity of progesterone binding to the EC50 for progesterone-induced maturation. Scatchard analysis revealed two different sets of progesterone binding sites on the oocyte membranes: a set of lower affinity sites (Kd = 140 nM), which most likely represented nonspecific binding, and a set of high affinity sites (Kd = 3 nM), which likely represented the specific progesterone binding sites (Fig. 1B). The density of high affinity binding sites in this experiment was approximately 1 × 10-13 mol/mg (~3 × 108 molecules/oocyte).

The EC50 for progesterone-induced maturation correlated with the equilibrium constants calculated for both sets of binding sites, suggesting that progesterone binding to either set of receptors could be mediating the maturation response. To confirm that the high affinity sites were mainly responsible for progesterone-mediated effects, membranes from maturation-competent (Stage V-VI) and incompetent (Stage I-III) oocytes were tested for progesterone binding. A radiolabeled progesterone concentration of 10 nM was used to favor detection of the high affinity binding sites. Although stage V-VI oocytes contained specific high affinity binding sites for [3H]progesterone, the earlier stage oocytes (Stages I-III) did not (Fig. 1C). The presence of the high affinity progesterone binding sites almost exclusively on maturation-competent oocytes suggests that the specific binding of progesterone to the high affinity sites may indeed be linked to the maturation process. Competition studies with other steroids revealed that progesterone binding to the stage V-VI oocyte membranes was specific, because over 100-fold more corticosterone, testosterone, and aldosterone were needed to compete for the high affinity progesterone binding sites (data not shown).

Progesterone Binding to Its Membrane Receptor Was Unaffected by the State of Galpha Activation-- The affinity of a GPCR agonist for its receptor is generally decreased when associated Galpha subunits are in the GTP-bound, activated state (42). For example, agonist affinity for the beta -adrenergic receptor is markedly decreased in the presence of GTP (43). If progesterone is acting as a GPCR agonist to mediate oocyte maturation, then, accordingly, its affinity for this receptor might be expected to be lower when Galpha subunits are in the activated state. Xenopus oocyte membranes were incubated both with and without the nonhydroyzable GTP analogue GTPgamma S. As demonstrated in Fig. 1D, incubation with GTPgamma S had no effect on progesterone binding to the oocyte membranes, suggesting that progesterone is not binding to its receptor in a fashion typical for a GPCR agonist.

Progesterone-induced Maturation of Xenopus Oocytes Was Affected by Changes in Galpha i Expression-- The role of Galpha i in progesterone-induced maturation was examined by modulating its expression in oocytes. Depletion of endogenous Galpha i was attained by injection of antisense oligonucleotides directed against mRNAs encoding three known Xenopus Galpha i proteins into oocytes. Antisense experiments work well in oocytes because the oligonucleotides can be injected directly into the cell, thus avoiding the usual problems of degradation and inconsistent uptake seen with cultured cells (44). Note that progesterone concentrations used in this and subsequent experiments were just below the EC50 calculated from Fig. 1A. This allowed more subtle changes in progesterone sensitivity to be detected. Given the slight variability in EC50 between oocyte preparations, however, all experiments were performed multiple times to confirm the results. Injection of antisense oligonucleotides against mRNA encoding each individual Galpha i subunit (Galpha i1, Galpha i2, and Galpha i3) had minimal effect on progesterone-induced maturation when compared with injection of matching sense oligonucleotides (Fig. 2A). In contrast, simultaneous injection of antisense oligonucleotides against mRNAs encoding all three Galpha i subunits significantly attenuated progesterone-mediated maturation when compared with oocytes injected with matching sense oligonucleotides (Fig. 2A).


View larger version (13K):
[in this window]
[in a new window]
 
Fig. 2.   Modulation of Galpha i levels in Xenopus oocytes. A, sense and antisense oligonucleotides directed against three Xenopus oocyte Galpha i subunits were injected into oocytes as indicated on the x axis at a total concentration of 2 mg/ml. After 30 h oocytes were washed with MSBH and treated with 100 nM progesterone for 15 h. The y axis represents the percent inhibition of maturation by the antisense oligonucleotides compared with matching sense oligonucleotides (100 - (percentage of maturation of antisense injected)/(percentage of maturation of sense injected)). Approximately 70 oocytes were used for each condition, and this experiment was performed three times using two different preparations of oligonucleotides with nearly identical results. B, oocytes were injected with 10 mM Hepes (mock), nonspecific cRNA encoding the thrombin receptor (PAR1), or an equal amount of cRNA encoding the Xenopus Galpha i2 protein (Xe-Galpha i2). Spontaneous maturation was measured after 30 h of incubation in MSBH. 80 oocytes were used for each condition, and the y axis represents the percentage of mature oocytes per condition. This experiment was performed several times using multiple cRNA preparations with similar results. C, oocytes were co-injected with cRNA encoding either the wild-type (Galpha i2-WT) or modified (Galpha i2-Mod) Xe-Galpha i2 plus either the sense or antisense oligonucleotide directed against Xe-Galpha i2 (concentration, 2 mg/ml). Spontaneous maturation was measured after 30 h of incubation in MSBH, and the y axis represents the percentage of inhibition of maturation by the antisense oligonucleotides compared with matching sense oligonucleotides. 30 oocytes were used for each condition, and this experiment was performed twice using different cRNA preparations with similar results.

The results from these antisense experiments are difficult to interpret, because antibodies against Xenopus Galpha i proteins are not available to confirm that the antisense oligonucleotides are indeed reducing Galpha i expression. To further examine the effects of Galpha i on maturation, cRNA encoding the Xenopus Galpha i2 protein was injected into oocytes. Injection of this cRNA resulted in marked spontaneous maturation when compared with oocytes injected with 10 mM Hepes (mock) or nonspecific cRNA (PAR1) (Fig. 2B). Interestingly, this spontaneous maturation was inhibited by nearly 80% with co-injection of the antisense oligonucleotide directed against Galpha i2 (Fig. 2C, Galpha i2-WT). In contrast, co-injection of the Galpha i2 antisense oligonucleotide with a modified cRNA encoding the wild-type Galpha i2 protein but containing 21 of 33 mismatches in the region corresponding to antisense oligonucleotide binding had less of an inhibitory effect on maturation (Fig. 2C, Galpha i2-Mod). This suggests that at least the Galpha i2 antisense oligonucleotide can inhibit Galpha i activity via binding to its complementary RNA sequence. Together, these results indicate that the amount of Galpha i expressed in oocytes directly correlates with the maturation response to progesterone.

Gbeta gamma Inhibited Progesterone-induced Maturation of Xenopus Oocytes-- Two interpretations can explain the observation that decreased Galpha i attenuated, whereas excess Galpha i enhanced, progesterone-induced maturation. First, Galpha i itself may be signaling to induce maturation. Second, Gbeta gamma that is released by activation of Galpha i may be affecting the maturation response. To differentiate between these two possibilities, oocytes were injected with cRNAs encoding bovine Gbeta 1 or Ggamma 2 subunits. These cRNAs encode functional proteins, because they have been injected together into Xenopus oocytes and markedly enhanced Gbeta gamma -dependent G protein inward rectifying potassium channel activity (45).2 Individual expression of either Gbeta 1 or Ggamma 2 had no effect on progesterone-induced maturation when a progesterone concentration just below the EC50 was used (50 nM). In contrast, simultaneous expression of both subunits in oocytes significantly attenuated progesterone-induced maturation (Fig. 3A). Incubation with higher concentrations of progesterone overcame this inhibition by Gbeta gamma (Fig. 3B), indicating that the processes of Gbeta gamma -mediated inhibition and progesterone-mediated induction of maturation can compete with each other. In addition, these data demonstrate that injected Gbeta gamma subunits are not simply damaging their host oocytes in a nonspecific fashion.


View larger version (18K):
[in this window]
[in a new window]
 
Fig. 3.   Gbeta gamma effects on progesterone-induced maturation of oocytes. A, oocytes were injected with 10 mM Hepes (Mock) or approximately 10 ng of cRNA encoding either Gbeta , Ggamma , or both Gbeta  + Ggamma . After 30 h, injected oocytes were washed extensively with MSBH and incubated in MSBH containing either 0.1% ethanol (gray) or 50 nM progesterone (final ethanol concentration, 0.1%; black) for 18 h. B, oocytes were injected as indicated and treated as above, only increasing amounts of progesterone were added, keeping the final ethanol concentration constant at 0.1% (x axis). C and D, oocytes were injected with either Hepes (Mock) or cRNA encoding the indicated proteins and treated as above. For each of A-D, 20 oocytes were used for each condition, and the y axis indicates the percentage of mature oocytes for each condition. Similar experiments were performed at least three times for each study using different cRNA preparations with similar results.

The effect of lowering endogenous Xenopus Gbeta gamma was examined by injecting oocytes with cRNA encoding the bovine retinal transducin Galpha subunit. Transducin Galpha itself has no apparent activity in oocytes but has been used as a Gbeta gamma "sink" to inhibit Gbeta gamma -mediated signaling (46). Oocytes injected with transducin Galpha exhibited enhancement of progesterone-induced maturation (Figs. 3C and 2B). In addition, injection of a GRK minigene encoding the carboxyl portion of the GRK1 protein, which has been shown to inhibit Gbeta gamma function in a very specific fashion (47, 48), markedly enhanced progesterone-mediated maturation at a concentration of progesterone just below the EC50 (50 nM) (Fig. 3D). The observation that sequestration of endogenous Gbeta gamma enhances, while overexpression of exogenous Gbeta gamma attenuates, progesterone-induced maturation suggests that increased Galpha i activity is not activating maturation; instead, endogenous Gbeta gamma is inhibiting maturation.

GTPgamma S Inhibited Progesterone-induced Maturation-- One way to formally prove that Gbeta gamma , and not Galpha , is important for progesterone-induced maturation would be to examine the effect of injected GTPgamma S on progesterone-induced maturation. GTPgamma S would be expected to bind irreversibly to Galpha subunits, thus activating all GTP binding proteins within the oocytes. In addition, the activated Galpha subunits would no longer interact with Gbeta gamma subunits; thus, free Gbeta gamma activity would be expected to increase as well. Indeed, injection of GTPgamma S has been shown to enhance signaling by Gbeta gamma -activated G protein inward rectifying potassium channels (49, 50). Injection of GTPgamma S significantly blocked oocyte maturation in response to all concentrations of progesterone tested when compared with Mock-injected cells (Fig. 4A), providing further evidence that intrinsic Galpha activity is not stimulating oocyte maturation; rather, Gbeta gamma subunits are inhibiting maturation.


View larger version (9K):
[in this window]
[in a new window]
 
Fig. 4.   The effect of activated Galpha proteins on progesterone-induced maturation. A, oocytes were injected with 50.6 nl of either 10 mM Hepes (Mock, dark) or 100 µM GTPgamma S (gray) and incubated in MSBH II for 6 h. Oocytes were then washed extensively with MSBH and incubated with progesterone at the indicated concentrations (final ethanol concentration, 0.1%) for 18 h. B, oocytes were injected with 10 mM Hepes (Mock) or cRNA encoding either wild-type rat Galpha i (Galpha i-WT) or a constitutively active isoform (Galpha i-Q204L). Injected oocytes were incubated for 30 h in MSBH II, washed extensively with MSBH, and incubated with either 0.1% ethanol or 100 nM progesterone (final ethanol concentration, 0.1%) for 18 h. 20 ooyctes were used for each condition, and the y axis indicates the percentage of mature oocytes/point. Similar experiments were performed using multiple cRNA and GTPgamma S preparations with nearly identical results.

Constitutively Activated Galpha i Had Minimal Effect on Progesterone-induced Oocyte Maturation-- Injection of GTPgamma S inhibited maturation in the presence of relatively high concentrations of progesterone (1 µM; Fig. 4A). GTPgamma S may therefore be inhibiting maturation simply by disabling the oocyte in a nonspecific fashion. A more elegant way to delineate the role of Galpha i and Gbeta gamma subunits in oocyte maturation would be to compare the effects of a constitutively active rat Galpha i protein to its matched wild-type isoform. If Gbeta gamma suppression is indeed the more important signaling event, then wild-type rat Galpha i should behave similarly to the Xenopus Galpha i, whereas the constitutively active Galpha i protein, which cannot bind to and sequester Gbeta gamma , should have little effect on progesterone-induced maturation. As expected, wild-type rat Galpha i markedly enhanced progesterone-induced maturation at progesterone concentrations just below the EC50 (50 nM). In contrast, constitutively active rat Galpha i containing a mutation that decreased the intrinsic GTPase activity of the protein (Q204L) had minimal effect on maturation (Fig. 4B). The lack of any substantial change in progesterone sensitivity in oocytes overexpressing the activated Galpha i clearly implies that Galpha i activity is not important in the progesterone-mediated maturation response. Note that expression of these two Galpha i proteins was equal as measured by Western blot analysis of extracts from injected oocytes (see Fig. 7C).

Gbeta gamma Effects Are Taking Place Upstream of Activation of Extracellular Signal-regulated Kinase Phosphorylation-- One of the early signaling events triggered by progesterone is activation of the MAPK cascade. This process can be measured by immunoblotting for phosphorylated MAPK p42 (ERK1). Of note, Xenopus oocytes contain only the p42 isoform of ERK (51, 52). Ooctyes were injected with cRNAs encoding the aforementioned G proteins to determine whether their effects were occurring proximal to this point. Overexpression of Gbeta gamma resulted in decreased phosphorylation of ERK1 in response to sub-optimal concentration of progesterone (50 nM) over the course of 4 h (Fig. 5A), which correlated with the decrease in maturation observed over an 18-h time period (Fig. 3). In contrast, injection of the GRK minigene markedly enhanced both the rate and amount of progesterone-induced ERK phosphorylation, consistent with the GRK protein's ability to enhance progesterone-mediated maturation (Fig. 6A). Overexpression of transducin had a similar effect on ERK phosphorylation in response to progesterone (data not shown). Finally, injection of wild-type rat Galpha i enhanced both the rate and amount of progesterone-induced ERK phosphorylation, whereas expression of the constitutively active Galpha i (Q204L) had minimal overall effect on MAPK activation (Fig. 7A). Although phosphorylated ERK was detected at the 2-h time point in Galpha i-Q204L-injected oocytes, the amount of phosphorylation at 4 h remained similar to mock injected cells. This contrasted with the markedly increased phosphorylation of ERK1 after 4 h detected in Galpha i-WT expressing cells. Of note, Western blot analysis of these samples using an antibody against rat Galpha i protein revealed that both Galpha i subunits were equally expressed in the injected oocytes (Fig. 7C). In addition, equal amounts of sample were present in each lane, as confirmed by blotting for total ERK (Figs. 5B, 6B, and 7B). Together, these data indicate that Gbeta gamma effects are occurring early in the progesterone-mediated signaling pathway, upstream of MAPK activation.


View larger version (69K):
[in this window]
[in a new window]
 
Fig. 5.   Progesterone-induced phosphorylation of p42 MAPK in the presence of excess Gbeta gamma proteins. Oocytes were injected with either 10 mM Hepes (Mock) or cRNAs encoding both both Gbeta and Ggamma (Gbeta gamma ) and incubated for 48 h in MSBH. Oocytes were then extensively washed with MSBH and incubated with 50 nM progesterone for the indicated times. Extracts from each of these samples were first probed with antiserum against phosphorylated p42 (A) and stripped and then blotted for all p42 protein (B). 15 oocytes were used for each sample and this experiment was performed three times using multiple cRNA preparations with similar results.


View larger version (54K):
[in this window]
[in a new window]
 
Fig. 6.   The effect of Gbeta gamma sequestration on progesterone-induced phosphorylation of p42 MAPK. Oocytes were injected with either 10 mM Hepes (Mock) or cRNA encoding the GRK minigene and treated as described in Fig. 5. 15 oocytes were used for each sample, and these experiments were performed three times using multiple cRNA preparations.


View larger version (53K):
[in this window]
[in a new window]
 
Fig. 7.   The effects of Galpha i proteins on progesterone-induced phosphorylation of p42 MAPK. A and B, oocytes were injected with either 10 mM Hepes (Mock) or the indicated cRNAs and treated as described in Fig. 5. C, extracts from the t = 0 samples of A were resolved by SDS-polyacrylamide gel electrophoresis and blotted with an anti-Galpha i polyclonal antibody (A. Gilman, University of Texas Southwestern Medical Center). 15 oocytes were used for each sample, and these experiments were performed three times using multiple cRNA preparations with similar results.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Progesterone induces maturation of Xenopus oocytes via a nongenomic pathway. Very little is currently understood about the early progesterone-induced signaling events, including the identity of the putative membrane progesterone binding protein. Previous work reported the presence of specific high affinity progesterone binding sites on Xenopus membranes (24, 25). Our results confirm these reports, demonstrating high affinity progesterone binding sites (Kd = 3 nM) on Stage V-VI oocyte membranes but not on Stage I-III oocyte membranes (Fig. 1). The presence of high affinity sites almost exclusively on maturation-competent oocytes, combined with the similarities between the Kd for high affinity progesterone binding and the EC50 for progesterone-induced maturation (~100 nM; Fig. 1A), suggest that the specific binding of progesterone to these sites is linked to the maturation process. An active role for the lower affinity sites cannot be completely ruled out, however, given that their equilibrium constant (140 nM) is also close to the EC50 value.

Earlier work has implicated Galpha i as a possible mediator of progesterone signaling in Xenopus oocytes (16, 26-29). The inability of constitutively active rat Galpha i to significantly alter progesterone-mediated maturation and MAPK signaling, whereas wild-type rat Galpha i enhanced both maturation and MAPK activation (Figs. 4B and 7A), argues against this hypothesis. Instead, these data suggest that intrinsic Galpha i activity (for example, its ability to inhibit adenylyl cyclase) is unimportant for progesterone-induced maturation. We propose that the changes in progesterone sensitivity observed by modulating Galpha i levels in oocytes are in fact due to changes in free Gbeta gamma levels. If so, Gbeta gamma must be acting as an inhibitor of maturation: the more free Gbeta gamma , the less sensitivity to progesterone-induced maturation. Accordingly, reduction of endogenous Galpha i, which would increase intracellular free Gbeta gamma , inhibited progesterone-induced maturation (Fig. 2A). Overexpression of Galpha i, which would deplete free Gbeta gamma , enhanced progesterone-induced maturation as well as MAPK activation (Figs. 2B, 4B, and 7A). Finally, constitutively active Galpha i, which cannot bind to Gbeta gamma and therefore would not alter endogenous Gbeta gamma levels, minimally affected both progesterone-mediated signaling and maturation (Figs. 4B and 7A).

In further support of the inhbitory role of Gbeta gamma in maturation, overexpression of bovine Gbeta gamma in oocytes markedly reduced the sensitivity of the maturation response to progesterone. More importantly, sequestration of endogenous Gbeta gamma by overexpression of either transducin or the more specific Gbeta gamma -binding mini-GRK protein enhanced responses to progesterone. This suggests that endogenous Gbeta gamma plays a real role in attenuating Xenopus oocyte maturation in response to progesterone and perhaps in resting oocytes as well.

It is still possible that progesterone-induced maturation is mediated by a Galpha subunit other than Galpha i. An argument against this possibility is that injection of GTPgamma S, which activates all Galpha subunits, still inhibited maturation (Fig. 5A). In addition, progesterone-mediated activation of Galpha s would be unlikely given the observed decrease in cAMP after progesterone treatment (26-29). Formal exclusion of this possibility is difficult, however, and will involve examining the effects of overexpression of all of the known classes of Galpha subunits, and perhaps of their respective constitutively active forms, on progesterone-induced maturation. To date, in addition to the Galpha subunits presented in these studies, Galpha i2, as well as multiple mammalian and Xenopus Galpha i subunits, enhance maturation when overexpressed in oocytes (data not shown).

Our results are strikingly different than earlier data reported using starfish oocytes. Injection of Galpha i subunits into starfish oocytes inhibits, whereas injection of Gbeta gamma enhances, maturation (35, 37), suggesting that activation of Galpha i and release of Gbeta gamma are critical for starfish ooctye activation. These contrasting results are not surprising, however. First, 1-methyladenine-induced maturation of starfish oocytes is inhibited by pertussis toxin (53-55), whereas progesterone-induced maturation of Xenopus oocytes is not (26, 56-58).2 This supports the involvement of Galpha i in starfish oocyte maturation and argues against its importance for Xenopus oocyte maturation. Second, 1-methyladenine binding to starfish oocyte membranes decreases in the presence of GTP (53), whereas GTPgamma S had no effect on high affinity progesterone binding to Xenopus oocyte membranes (Fig. 1D), suggesting that 1-methyladenine binds to its membrane receptor in a fashion typical for a GPCR agonist, whereas progesterone does not. Taken together, these results indicate that early signaling events in oocyte maturation may be quite different between starfish and Xenopus; thus, comparisons between the two should be made with caution.

Although Gbeta gamma promotes re-entry into the cell cycle in starfish oocytes, the homologous complex in Saccharomyces cerevisiae, Ste4p/Ste18p, arrests the cell cycle in the haploid mating response (59). The mechanism behind this cell cycle arrest appears to involve Ste4p/Ste18-induced activation of the MAPK pathway. Experiments in mammalian systems have also demonstrated that Gbeta gamma can activate the MAPK pathway (60, 61). Although our data demonstrate that Gbeta gamma can mediate cell cycle arrest in Xenopus oocytes, Gbeta gamma does not appear to activate the MAPK cascade. In fact, overexpression of Gbeta gamma attenuates, whereas sequestration of Gbeta gamma enhances, ERK1 phosphorylation over the course of 4 h (Figs. 5-7). These results are supported by earlier work demonstrating that progesterone-induced MAPK activation in Xenopus oocytes is primarily mediated by the Mos protein and not by Gbeta gamma (31, 44, 62-65). In fact, Gbeta gamma may be playing a role in regulating Mos protein expression, because preliminary results indicate that sequestration of Gbeta gamma enhances Mos expression (data not shown).

The observation that endogenous Gbeta gamma inhibits maturation offers an intriguing model whereby maturation is held in check by low levels of constitutive Gbeta gamma signaling. Resting Gbeta gamma activity has been observed before in Xenopus oocytes and in other systems. Constitutive Gbeta gamma -mediated G protein-coupled inward rectifying potassium channel activity in resting oocytes can be inhibited by sequestration of free Gbeta gamma (45, 48, 66). In addition, free Gbeta gamma activity has also been proposed to constitutively permit endocytosis in mammalian CV1 cells (67). Progesterone may be inducing maturation by antagonizing this constitutive inhibitory Gbeta gamma activity. For example, progesterone could attenuate Gbeta gamma activity by binding directly to Gbeta gamma or to another molecule that interferes with Gbeta gamma signaling. Of note, we observed no increase in progesterone binding to membranes from oocytes overexpressing Gbeta gamma subunits (data not shown). Alternatively, one tantalizing possibility is that progesterone acts as an antagonist, or even an inverse agonist, on an unknown constitutively active GPCR that signals via Gbeta gamma to inhibit maturation. This type of "nonagonist" interaction between progesterone and a GPCR is consistent with our binding data demonstrating no change in progesterone binding to its receptor in membranes treated with GTPgamma S. Interestingly, this release of inhibition model is reminiscent of the oxytocin receptor story, where progesterone may act by competing with oxytocin for binding to its GPCR (38). Of note, oxytocin had no effect on any of the described experiments with progesterone (data not shown). Improving our understanding of early signaling events in progesterone-mediated maturation may provide us with useful clues in searching for the elusive membrane progesterone binding protein and may prove helpful in elucidating the mechanisms involved in other nongenomic steroid signaling pathways as well.

    ACKNOWLEDGEMENTS

We are extremely thankful for all of the support and help from Dr. Shaun Coughlin at the University of California at San Francisco. Interest for this work began in his laboratory and his generosity and ideas were critical for this project. We also thank Alex Yi and Dr. L. Jan at the University of California at San Francisco for invaluable help, ideas, and reagents. Special thanks is also given to Drs. A. Gilman, E. Ross, and R. Auchus for critical review of this manuscript.

    FOOTNOTES

* The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Dagger To whom correspondence should be addressed: Div. of Endocrinology, Dept. of Internal Medicine, University of Texas Southwestern Medical School, 5323 Harry Hines Blvd., Dallas, TX 75390-8857. Tel.: 214-648-4793; Fax: 214-648-8917; E-mail: stephen.hammes@email.swmed.edu.

Published, JBC Papers in Press, October 3, 2000, DOI 10.1074/jbc.M006757200

2 S. R. Hammes, unpublished results.

    ABBREVIATIONS

The abbreviations used are: MAPK, mitogen-activated protein kinase; GPCR, G protein-coupled receptor; MSBH, modified Barth's solution; ERK, extracellular signal-regulated kinase; GTPgamma S, guanosine 5'-3-O-(thio)triphosphate.

    REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

1. Meier, C. A. (1997) J. Recept. Signal Transduct. Res. 17, 319-335
2. Wehling, M. (1997) Annu. Rev. Physiol. 59, 365-393
3. Christ, M., Douwes, K., Eisen, C., Bechtner, G., Theisen, K., and Wehling, M. (1995) Hypertension 25, 117-123
4. Christ, M., Eisen, C., Aktas, J., Theisen, K., and Wehling, M. (1993) J. Clin. Endocrinol. Metab. 77, 1452-1457
5. Schneider, M., Ulsenheimer, A., Christ, M., and Wehling, M. (1997) Am. J. Physiol. 272, E616-E620
6. Wehling, M., Eisen, C., and Christ, M. (1992) Mol. Cell. Endocrinol. 90, C5-C9
7. Wehling, M., Neylon, C. B., Fullerton, M., Bobik, A., and Funder, J. W. (1995) Circ. Res. 76, 973-979
8. Wehling, M., Ulsenheimer, A., Schneider, M., Neylon, C., and Christ, M. (1994) Biochem. Biophys. Res. Commun. 204, 475-481
9. Chen, Z., Yuhanna, I. S., Galcheva-Gargova, Z., Karas, R. H., Mendelsohn, M. E., and Shaul, P. W. (1999) J. Clin. Invest. 103, 401-406
10. Kirsch, E. A., Yuhanna, I. S., Chen, Z., German, Z., Sherman, T. S., and Shaul, P. W. (1999) Am. J. Respir. Cell Mol. Biol. 20, 658-666
11. Razandi, M., Pedram, A., Greene, G. L., and Levin, E. R. (1999) Mol Endocrinol. 13, 307-319
12. Shaul, P. W. (1999) Steroids 64, 28-34
13. Norman, A. W., Bishop, J. E., Collins, E. D., Seo, E. G., Satchell, D. P., Dormanen, M. C., Zanello, S. B., Farach-Carson, M. C., Bouillon, R., and Okamura, W. H. (1996) J. Steroid Biochem. Mol. Biol. 56, 13-22
14. Lieberherr, M. (1987) J. Biol. Chem. 262, 13168-13173
15. Caffrey, J. M., and Farach-Carson, M. C. (1989) J. Biol. Chem. 264, 20265-20274
16. Maller, J. L., and Krebs, E. G. (1980) Curr. Top. Cell. Regul. 16, 271-311
17. Nagahama, Y., Yoshikuni, M., Yamashita, M., Tokumoto, T., and Katsu, Y. (1995) Curr. Top. Dev. Biol. 30, 103-145
18. Nagahama, Y. (1997) Steroids 62, 190-196
19. Maller, J. L., and Krebs, E. G. (1977) J. Biol. Chem. 252, 1712-1718
20. Smith, L. D., and Ecker, R. E. (1969) Dev. Biol. 19, 281-309
21. Smith, L. D., and Ecker, R. E. (1971) Dev. Biol. 25, 232-247
22. Godeau, J. F., Schorderet-Slatkine, S., Hubert, P., and Baulieu, E. E. (1978) Proc. Natl. Acad. Sci. U. S. A. 75, 2353-2357
23. Masui, Y., and Markert, C. L. (1971) J. Exp. Zool. 177, 129-145
24. Blondeau, J. P., and Baulieu, E. E. (1984) Biochem. J. 219, 785-792
25. Liu, Z., and Patino, R. (1993) Biol. Reprod. 49, 980-988
26. Sadler, S. E., Maller, J. L., and Cooper, D. M. (1984) Mol. Pharmacol. 26, 526-531
27. Sadler, S. E., and Maller, J. L. (1983) J. Biol. Chem. 258, 7935-7941
28. Sadler, S. E., and Maller, J. L. (1981) J. Biol. Chem. 256, 6368-6373
29. Sadler, S. E., and Maller, J. L. (1985) Adv. Cyclic Nucleotide Protein Phosphorylation Res. 19, 179-194
30. Kosako, H., Gotoh, Y., and Nishida, E. (1994) J. Cell Sci. Suppl 18, 115-119
31. Kosako, H., Gotoh, Y., and Nishida, E. (1994) EMBO J. 13, 2131-2138
32. Kosako, H., Nishida, E., and Gotoh, Y. (1993) EMBO J. 12, 787-794
33. Fabian, J. R., Morrison, D. K., and Daar, I. O. (1993) J. Cell Biol. 122, 645-652
34. Ferrell, J. E., Jr., and Machleder, E. M. (1998) Science 280, 895-898
35. Chiba, K., Kontani, K., Tadenuma, H., Katada, T., and Hoshi, M. (1993) Mol. Biol. Cell 4, 1027-1034
36. Chiba, K., Longo, F. J., Kontani, K., Katada, T., and Hoshi, M. (1995) Dev. Biol. 169, 415-420
37. Jaffe, L. A., Gallo, C. J., Lee, R. H., Ho, Y. K., and Jones, T. L. (1993) J. Cell Biol. 121, 775-783
38. Grazzini, E., Guillon, G., Mouillac, B., and Zingg, H. H. (1998) Nature 392, 509-512
39. Vu, T.-K. H., Hung, D. T., Wheaton, V. I., and Coughlin, S. R. (1991) Cell 64, 1057-1068
40. Williams, J. A., McChesney, D. J., Calayag, M. C., Lingappa, V. R., and Logsdon, C. D. (1988) Proc. Natl. Acad. Sci. U. S. A. 85, 4939-4943
41. Olate, J., Martinez, S., Purcell, P., Jorquera, H., Codina, J., Birnbaumer, L., and Allende, J. (1990) FEBS Lett. 268, 27-31
42. Ross, E. M. (1989) Neuron 3, 141-152
43. Maguire, M. E., Van Arsdale, P. M., and Gilman, A. G. (1976) Mol. Pharmacol. 12, 335-339
44. Sagata, N., Oskarsson, M., Copeland, T., Brumbaugh, J., and Vande Woude, G. F. (1988) Nature 335, 519-525
45. Reuveny, E., Slesinger, P. A., Inglese, J., Morales, J. M., Iniguez-Lluhi, J. A., Lefkowitz, R. J., Bourne, H. R., Jan, Y. N., and Jan, L. Y. (1994) Nature 370, 143-146
46. Miller, B. A., Bell, L., Hansen, C. A., Robishaw, J. D., Linder, M. E., and Cheung, J. Y. (1996) J. Clin. Invest. 98, 1728-1736
47. Koch, W. J., Hawes, B. E., Inglese, J., Luttrell, L. M., and Lefkowitz, R. J. (1994) J. Biol. Chem. 269, 6193-6197
48. Jing, J., Chikvashvili, D., Singer-Lahat, D., Thornhill, W. B., Reuveny, E., and Lotan, I. (1999) EMBO J. 18, 1245-1256
49. Chen, Y., and Yu, L. (1994) J. Biol. Chem. 269, 7839-7842
50. Dascal, N., Lim, N. F., Schreibmayer, W., Wang, W., Davidson, N., and Lester, H. A. (1993) Proc. Natl. Acad. Sci. U. S. A. 90, 6596-6600
51. Gotoh, Y., Moriyama, K., Matsuda, S., Okumura, E., Kishimoto, T., Kawasaki, H., Suzuki, K., Yahara, I., Sakai, H., and Nishida, E. (1991) EMBO J. 10, 2661-2668
52. Posada, J., Sanghera, J., Pelech, S., Aebersold, R., and Cooper, J. A. (1991) Mol. Cell. Biol. 11, 2517-2528
53. Tadenuma, H., Takahashi, K., Chiba, K., Hoshi, M., and Katada, T. (1992) Biochem. Biophys. Res. Commun. 186, 114-121
54. Shilling, F., Chiba, K., Hoshi, M., Kishimoto, T., and Jaffe, L. A. (1989) Dev. Biol. 133, 605-608
55. Chiba, K., and Hoshi, M. (1995) Prog. Cell. Cycle Res. 1, 255-263
56. Mulner, O., Megret, F., Alouf, J. E., and Ozon, R. (1985) FEBS Lett. 181, 397-402
57. Goodhardt, M., Ferry, N., Buscaglia, M., Baulieu, E. E., and Hanoune, J. (1984) EMBO J. 3, 2653-2657
58. Olate, J., Allende, C. C., Allende, J. E., Sekura, R. D., and Birnbaumer, L. (1984) FEBS Lett. 175, 25-30
59. Herskowitz, I. (1995) Cell 80, 187-197
60. Birnbaumer, L. (1992) Cell 71, 1069-1072
61. Clapham, D. E., and Neer, E. J. (1997) Annu. Rev. Pharmacol. Toxicol. 37, 167-203
62. Sagata, N. (1997) Bioessays 19, 13-21
63. Shibuya, E. K., Polverino, A. J., Chang, E., Wigler, M., and Ruderman, J. V. (1992) Proc. Natl. Acad. Sci. U. S. A. 89, 9831-9835
64. Shibuya, E. K., Morris, J., Rapp, U. R., and Ruderman, J. V. (1996) Cell Growth Differ. 7, 235-241
65. Posada, J., Yew, N., Ahn, N. G., Vande Woude, G. F., and Cooper, J. A. (1993) Mol. Cell. Biol. 13, 2546-2353
66. Luchian, T., Dascal, N., Dessauer, C., Platzer, D., Davidson, N., Lester, H. A., and Schreibmayer, W. (1997) J. Physiol. (Lond.) 505, 13-22
67. Lin, H. C., Duncan, J. A., Kozasa, T., and Gilman, A. G. (1998) Proc. Natl. Acad. Sci. U. S. A. 95, 5057-5060


Copyright © 2000 by The American Society for Biochemistry and Molecular Biology, Inc.
Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
K. Evaul and S. R. Hammes
Cross-talk between G Protein-coupled and Epidermal Growth Factor Receptors Regulates Gonadotropin-mediated Steroidogenesis in Leydig Cells
J. Biol. Chem., October 10, 2008; 283(41): 27525 - 27533.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
J. Deng, S. Lang, C. Wylie, and S. R. Hammes
The Xenopus laevis Isoform of G Protein-Coupled Receptor 3 (GPR3) Is a Constitutively Active Cell Surface Receptor that Participates in Maintaining Meiotic Arrest in X. laevis Oocytes
Mol. Endocrinol., August 1, 2008; 22(8): 1853 - 1865.
[Abstract] [Full Text] [PDF]


Home page
Mol Hum ReprodHome page
X.-D. Fu, M. Flamini, A. M. Sanchez, L. Goglia, M. S. Giretti, A. R. Genazzani, and T. Simoncini
Progestogens regulate endothelial actin cytoskeleton and cell movement via the actin-binding protein moesin
Mol. Hum. Reprod., April 1, 2008; 14(4): 225 - 234.
[Abstract] [Full Text] [PDF]


Home page
Endocr. Rev.Home page
S. R. Hammes and E. R. Levin
Extranuclear Steroid Receptors: Nature and Actions
Endocr. Rev., December 1, 2007; 28(7): 726 - 741.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
W. El-Jouni, S. Haun, R. Hodeify, A. Hosein Walker, and K. Machaca
Vesicular traffic at the cell membrane regulates oocyte meiotic arrest
Development, September 15, 2007; 134(18): 3307 - 3315.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
K. Evaul, M. Jamnongjit, B. Bhagavath, and S. R. Hammes
Testosterone and Progesterone Rapidly Attenuate Plasma Membrane G{beta}{gamma}-Mediated Signaling in Xenopus laevis Oocytes by Signaling through Classical Steroid Receptors
Mol. Endocrinol., January 1, 2007; 21(1): 186 - 196.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Rasar, D. B. DeFranco, and S. R. Hammes
Paxillin Regulates Steroid-triggered Meiotic Resumption in Oocytes by Enhancing an All-or-None Positive Feedback Kinase Loop
J. Biol. Chem., December 22, 2006; 281(51): 39455 - 39464.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
D. Haas, S. N. White, L. B. Lutz, M. Rasar, and S. R. Hammes
The Modulator of Nongenomic Actions of the Estrogen Receptor (MNAR) Regulates Transcription-Independent Androgen Receptor-Mediated Signaling: Evidence that MNAR Participates in G Protein-Regulated Meiosis in Xenopus laevis Oocytes
Mol. Endocrinol., August 1, 2005; 19(8): 2035 - 2046.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Q. Zhang, A. Dickson, and C. A. Doupnik
G{beta}{gamma}-activated Inwardly Rectifying K+ (GIRK) Channel Activation Kinetics via G{alpha}i and G{alpha}o-coupled Receptors Are Determined by G{alpha}-specific Interdomain Interactions That Affect GDP Release Rates
J. Biol. Chem., July 9, 2004; 279(28): 29787 - 29796.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
S. E. Sadler and N. D. Jacobs
Stimulation of Xenopus laevis Oocyte Maturation by Methyl-{beta}-Cyclodextrin
Biol Reprod, June 1, 2004; 70(6): 1685 - 1692.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
A. R. Beker-van Woudenberg, H. T.A. van Tol, B. A.J. Roelen, B. Colenbrander, and M. M. Bevers
Estradiol and Its Membrane-Impermeable Conjugate (Estradiol-Bovine Serum Albumin) During In Vitro Maturation of Bovine Oocytes: Effects on Nuclear and Cytoplasmic Maturation, Cytoskeleton, and Embryo Quality
Biol Reprod, May 1, 2004; 70(5): 1465 - 1474.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
S. R. Hammes
Steroids and Oocyte Maturation--A New Look at an Old Story
Mol. Endocrinol., April 1, 2004; 18(4): 769 - 775.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
A. Gill, M. Jamnongjit, and S. R. Hammes
Androgens Promote Maturation and Signaling in Mouse Oocytes Independent of Transcription: A Release of Inhibition Model for Mammalian Oocyte Meiosis
Mol. Endocrinol., January 1, 2004; 18(1): 97 - 104.
[Abstract] [Full Text] [PDF]


Home page
Physiol. Rev.Home page
R. M. LOSEL, E. FALKENSTEIN, M. FEURING, A. SCHULTZ, H.-C. TILLMANN, K. ROSSOL-HASEROTH, and M. WEHLING
Nongenomic Steroid Action: Controversies, Questions, and Answers
Physiol Rev, July 1, 2003; 83(3): 965 - 1016.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
L. B. Lutz, M. Jamnongjit, W.-H. Yang, D. Jahani, A. Gill, and S. R. Hammes
Selective Modulation of Genomic and Nongenomic Androgen Responses by Androgen Receptor Ligands
Mol. Endocrinol., June 1, 2003; 17(6): 1106 - 1116.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. Wang and X. J. Liu
A G Protein-coupled Receptor Kinase Induces Xenopus Oocyte Maturation
J. Biol. Chem., April 25, 2003; 278(18): 15809 - 15814.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
W.-H. Yang, L. B. Lutz, and S. R. Hammes
Xenopus laevis Ovarian CYP17 Is a Highly Potent Enzyme Expressed Exclusively in Oocytes. EVIDENCE THAT OOCYTES PLAY A CRITICAL ROLE IN XENOPUS OVARIAN ANDROGEN PRODUCTION
J. Biol. Chem., March 7, 2003; 278(11): 9552 - 9559.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
S. R. Hammes
The further redefining of steroid-mediated signaling
PNAS, March 4, 2003; 100(5): 2168 - 2170.
[Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
Y. Zhu, C. D. Rice, Y. Pang, M. Pace, and P. Thomas
From the Cover: Cloning, expression, and characterization of a membrane progestin receptor and evidence it is an intermediary in meiotic maturation of fish oocytes
PNAS, March 4, 2003; 100(5): 2231 - 2236.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
H.-Y. Fan, C. Tong, L. Lian, S.-W. Li, W.-X. Gao, Y. Cheng, D.-Y. Chen, H. Schatten, and Q.-Y. Sun
Characterization of Ribosomal S6 Protein Kinase p90rsk During Meiotic Maturation and Fertilization in Pig Oocytes: Mitogen-Activated Protein Kinase-Associated Activation and Localization
Biol Reprod, March 1, 2003; 68(3): 968 - 977.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
I. Rishal, T. Keren-Raifman, D. Yakubovich, T. Ivanina, C. W. Dessauer, V. Z. Slepak, and N. Dascal
Na+ Promotes the Dissociation between Galpha GDP and Gbeta gamma , Activating G Protein-gated K+ Channels
J. Biol. Chem., January 31, 2003; 278(6): 3840 - 3845.
[Abstract] [Full Text] [PDF]


Home page
Hum ReprodHome page
C. Grondahl, J. Breinholt, P. Wahl, A. Murray, T. H. Hansen, I. Faerge, C. E. Stidsen, K. Raun, and C. Hegele-Hartung
Physiology of meiosis-activating sterol: endogenous formation and mode of action
Hum. Reprod., January 1, 2003; 18(1): 122 - 129.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
B. C. Duckworth, J. S. Weaver, and J. V. Ruderman
G2 arrest in Xenopus oocytes depends on phosphorylation of cdc25 by protein kinase A
PNAS, December 24, 2002; 99(26): 16794 - 16799.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
L. B. Lutz, L. M. Cole, M. K. Gupta, K. W. Kwist, R. J. Auchus, and S. R. Hammes
Evidence that androgens are the primary steroids produced by Xenopus laevis ovaries and may signal through the classical androgen receptor to promote oocyte maturation
PNAS, November 9, 2001; (2001) 241471598.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
L. B. Lutz, L. M. Cole, M. K. Gupta, K. W. Kwist, R. J. Auchus, and S. R. Hammes
Evidence that androgens are the primary steroids produced by Xenopus laevis ovaries and may signal through the classical androgen receptor to promote oocyte maturation
PNAS, November 20, 2001; 98(24): 13728 - 13733.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
275/52/41512    most recent
M006757200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lutz, L. B.
Right arrow Articles by Hammes, S. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lutz, L. B.
Right arrow Articles by Hammes, S. R.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2000 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement