|
J Biol Chem, Vol. 275, Issue 6, 3977-3983, February 11, 2000
The Multiple Activities of Polyphosphate Kinase of
Escherichia coli and Their Subunit Structure Determined by
Radiation Target Analysis*
Chi-Meng
Tzeng and
Arthur
Kornberg
From the Department of Biochemistry, Stanford University,
Stanford, California 94305-5307
 |
ABSTRACT |
Polyphosphate kinase (PPK), the principal enzyme
required for the synthesis of inorganic polyphosphate (polyP) from ATP,
also exhibits other enzymatic activities, which differ significantly in
their biochemical optima and responses to chemical agents. These
several activities include: polyP synthesis (forward reaction), nATP
polyPn + nADP (Equation 1); ATP synthesis from
polyP (reverse reaction), ADP + polyPn ATP + polyPn 1 (Equation 2); general nucleoside-diphosphate
kinase, GDP + polyPn GTP + polyPn 1
(Equation 3); linear guanosine 5'-tetraphosphate (ppppG) synthesis, GDP + polyPn ppppG + polyPn 2 (Equation 4); and autophosphorylation, PPK + ATP PPK-P + ADP (Equation 5).
The Mg2+ optima are 5, 2, 1, and 0.2 mM,
respectively, for the activities in Equations 1, 2, 3, and 4. Inorganic
pyrophosphate inhibits the activities in Equations 1 and 3 but
stimulates that in Equation 4. The kinetics of the activities in
Equations 1, 2, and 3 are highly processive, whereas the transfer of a
pyrophosphoryl group from polyP to GDP (Equation 4) is distributive and
demonstrates a rapid equilibrium, random Bi-Bi catalytic mechanism.
Radiation target analysis revealed that the principal functional unit
of the homotetrameric PPK is a dimer. Exceptions are a trimer for the
synthesis of ppppG (Equation 4) and a tetrameric state for the
autophosphorylation of PPK (Equation 5) at low ATP concentrations. Thus, the diverse functions of this enzyme involve different subunit organizations and conformations. The highly conserved homology of PPK
among 18 microorganisms was used to determine important residues and
conserved regions by alanine substitution, by site-directed mutagenesis, and by deletion mutagenesis. Of 46 single-site mutants, seven exhibit none of the five enzymatic activities; in one mutant, ATP
synthesis from polyP is reduced relative to GTP synthesis. Among
deletion mutants, some lost all five PPK activities, but others
retained partial activity for some reactions but not for others.
 |
INTRODUCTION |
Inorganic polyphosphate
(polyP),1 a linear polymer of
hundreds of phosphate residues (Pi) linked by
phosphoanhydride bonds, is found in all cells in nature (1). The
principal enzyme that synthesizes polyP from ATP in
Escherichia coli is polyP kinase (PPK), a
peripheral, membrane-bound homotetramer of 80-kDa subunits (2). PPK is
highly conserved in many bacterial species, including some of the major
pathogens (e.g. Helicobacter pylori, Mycobacterium tuberculosis, and Neisseria meningitidis) and is a
plausible antimicrobial target (3). E. coli ppk mutants fail
to make the adaptive changes in the stationary phase needed for
resistance to various stresses and for survival (4).
An initial event in converting the -phosphate of ATP into polyP
chains of 700-800 residues (Equation 1) is the phosphorylation of
critical histidine residues His-435 and His-454 (Equation 5) (5). This
is followed by highly processive polymerization with no detectable
intermediates; neither ATP, Pi, nor polyP chains prime the
reaction (6). The reverse reaction (Equation 2), in which ADP is
converted to ATP by polyP, is kinetically slower than the forward
reaction but can be driven to completion by an excess of ADP. More
generally, PPK functions as a nucleoside-diphosphate kinase, converting
GDP, CDP, and UDP to their respective nucleoside triphosphates (7).
Another novel feature of PPK is catalysis of the attack by GDP on a
subterminal linkage of polyP, resulting in the transfer of a
pyrophosphoryl group to generate the linear guanosine tetraphosphate
(ppppG) (7).
Radiation target analysis was used to examine all five PPK activities
with regard to optimal reaction conditions, the effects of chemical
agents, the catalytic mechanism of ppppG synthesis, and the subunit
organization needed for each of the activities. Furthermore,
site-directed mutagenesis by alanine substitution and deletion
mutagenesis were used to identify key residues and fragments within the
highly conserved regions of PPK.
 |
EXPERIMENTAL PROCEDURES |
Biochemical Assays--
Purified PPK (100 ng) was added to a
reaction buffer (50 mM Hepes (pH 7.5), 50 mM
ammonium sulfate, 5 mM MgCl2) at 37 °C, as
described previously (2). Quantification of polyP, ATP, GTP, and ppppG
spots on TLC plates was as described previously (7). PolyP accumulation
in vivo and enzyme activities in vitro were
measured initially in a high throughput, 96-well format and then
checked individually. PolyP levels and enzyme activities were measured
both by a radioactive method (6) and by a luciferase-based nonradioactive method (8).
To assay for PPK autophosphorylation, 60-100 ng of an irradiated
enzyme was incubated in 50 mM Hepes-KOH (pH 7.2), 40 mM ammonium sulfate, 10 mM MgCl2,
and either 5 µM or 1 mM
[ -32P]ATP on ice for 5 min; the reaction was
terminated by adding 40 mM EDTA. The complex was
precipitated with two volumes of acetone and then washed with ethanol
to remove the unreacted ATP. The pellet was resuspended in SDS-PAGE
buffer, electrophoresed on a 12% gel, and analyzed with a digital
scanner (5).
PolyP synthesis or degradation was measured in several activity assays:
for polyP synthesis from ATP (Equation 1; for nucleoside-diphosphate kinase (NDK) activities, reverse reaction Equation 2; and GTP synthesis, Equation 3) and for ppppG synthesis (Equation 4). The reactions were terminated by adding 5× urea-PAGE buffer dye (450 mM Tris borate, 15 mM EDTA, 0.125% bromphenol
blue, and 50% sucrose). The samples were electrophoresed on 6%
urea-polyacrylamide gels at 300 V until the dye migrated 6-8 cm from
the top of wells. Labeled polyP was stained with toluidine blue
followed by exposure on a PhosphorImager.
60Co Irradiation--
A 50-µl aliquot of purified
PPK (0.2-0.5 µg/ml) in a 0.5-ml microcentrifuge tube was frozen at
80 °C and shipped on dry ice to Taiwan for radiation inactivation.
The samples were exposed to -rays at 63 °C at 1.5 Mrad/h for
various times to obtain the desired dose; nonirradiated samples were
assayed as controls. Glucose-6-phosphate dehydrogenase (G6PDHase) was
used as an internal standard to measure the functional decay after
irradiation by monitoring the rate of NADPH appearance at an absorbance
of 340 nm as follows. An assay mixture of 50 mM Tris-HCl
(pH 8.0), 1 mM EDTA, 10 mM MgCl2, 3 mM glucose 6-phosphate, and 0.3 mM NADP was
incubated with G6PDHase at room temperature. The linear rate of NADPH
absorbance during the first 2 min was used to calculate the activity as
before (9). The functional size of G6PDHase with a native molecular
mass of 104 kDa was 112 kDa as determined by this method. To determine
the structural size of PPK, irradiated samples were electrophoresed
directly on 12% SDS-PAGE gels (Amersham Pharmacia Biotech Phast System).
Functional sizes and D37 values were calculated from the
equation, log m = 5.89 D37,T 0.0028T where the
D37,T is the radiation dosage in Mrad required
to inactivate the activity to 37% that of the control at temperature
T (°C); m is the functional size in daltons,
and T is the irradiation temperature (10).
Kinetic Studies--
The kinetic parameters
Km, kcat, and
Ki were determined in duplicate by Lineweaver-Burk
plots and time-course titrations (11, 12). For initial rate studies,
the reactions were started by adding 5 µl of purified enzyme (~100
ng) to 15 µl of reaction mixture (50 mM Hepes, pH 7.5, 50 mM ammonium sulfate, and 0.2 mM magnesium
chloride) at 37 °C containing either 1 mM GDP with
1-100 µM polyP or 0.1-2 mM of GDP with 10 µM polyP. For product-analog inhibition experiments, the
conditions used were 0-20 µM polyP65 (Sigma)
or 0-2 mM GMP (Sigma) as inhibitors. Reactions were
spotted onto TLC plates and separated in 0.75 M
KH2PO4 as the mobile phase; the products were
quantified using a PhosphorImager (Molecular Dynamics).
Mutagenesis--
Plasmid pQE30ppk (5) was used as a template for
site-directed mutagenesis and the construction of deletion mutants by
polymerase chain reaction. The pQE30 (QIAexpressTM, QIAGEN)
plasmid vector with the highly efficient
isopropyl-1-thio- -D-galactopyranoside-inducible T5
promoter, and a Hisx6 tag coding sequence was used for overexpression and purification of the wild type and mutant PPK enzymes. E. coli XL2-blue (QIAexpressTM, QIAGEN) was the host
strain used for the screening and propagation of plasmids. E. coli CF5802 (MG1655
ppk ppx::kan) (4) was the host
strain for overexpression. Site-directed, alanine substitution mutagenesis was performed with the QuikChangeTM
site-directed mutagenesis kit (Stratagene Inc.). The mutagenic oligonucleotide primers were all 27 base pairs in length with the
target codon in the center changed to GCT for Ala (A).
Alignments of PPK amino acid sequences from 18 microorganisms revealed
three highly conserved regions at residues 10-60, 350-480, and
550-630 of the 687-residue E. coli PPK (3). Amino acids within the carboxyl-terminal portion were chosen for site-directed mutagenesis, particularly the charged and the hydrophobic residues. Seven polymerase chain reaction oligonucleotide primers were
synthesized: 5'-a, CTCGGATCCATGGGTCAGGAAAAG; 5'-b,
CTCGCATGCATTACGCCGATTTTA; 5'-c, CTCGCATGCTTCCGCAATGGTTTT; 3'-a,
CTCAAGCTTTTATTGAGGTTGTTC; 3'-b, GAAGCATGCGGGCAGCCCTTGCTG; 3'-c,
GAAGCATGCTTTATCAAACCAAAT; and 3'-d, GTTGCATGCGTGCTGACGCAGATA
with restriction sites added for subcloning into pQE30. These
primers were used to generate six deletion mutants (the expected sizes
on agarose gels are given in parentheses): PPK 135-687 (0.5 kb),
PPK 327-687 (0.98 kb), PPK 532-687 (1.6 kb), PPK 1-134 (1.6 kb), PPK 135-326 (1.5 kb), and PPK 1-326 (1.09 kb), as well as
the wild type (2.07 kb). The expected sizes of the 1 mM
isopropyl-1-thio- -D-galactopyranoside-induced proteins
(given in parentheses): PPK 135-687 (15 kDa), PPK 327-687 (36 kDa), PPK 532-687 (55 kDa), PPK 1-134 (50 kDa), and PPK 1-326 (40 kDa), PPK 135-326 (58 kDa), and wild type (72 kDa), agreed with
the values determined by denaturing gel electrophoresis and Western
blotting (data not shown). To verify that the mutations were
constructed properly, the entire ppk region of each mutant was sequenced. Standard molecular biology and transformation procedures were used.
Expression and Purification of PPK Mutants--
Wild type and
mutant cells were grown in Luria-Bertani (LB) medium with or without
100 µg/ml ampicillin and 25 µg/ml kanamycin at 37 °C and with
aeration until the A600 reached 1.0. Isopropyl-1-thio- -D-galactopyranoside was then added to
a final concentration of 1.0 mM, and the cultures were
grown for an additional 2 h at 30 °C. Cells were collected by
centrifugation at 6000 × g for 10 min and resuspended
to 3 volume/g of wet weight in lysis buffer (50 mM
Tris-HCl, pH 7.4, 10% (v/v) glycerol, 5 mM
MgCl2, 1 mM dithiothreitol, and 250 µg/ml lysozyme). The samples were then incubated at 37 °C for 10 min, subjected to three freeze-thaw cycles and sonication for 1 min, and
treated with 25 µg/ml each of DNase and RNase for 30 min at 4 °C.
At final concentrations of 1 M KCl, 100 mM
Na2CO3, and 0.05% Triton X-100 added
sequentially, the mixture was incubated for 2 h at 4 °C and
then sonicated for 1 min to solubilize PPK from the membrane.
Cell debris was pelleted by centrifugation at 40,000 × g for 20 min, and the supernatant was applied to a
nickel-nitrilotriacetic acid column previously equilibrated with 50 mM Tris-HCl, pH 7.4, 10% (v/v) glycerol, 5 mM
MgCl2, 1 mM dithiothreitol, 0.05% Triton X-100, and 100 mM imidazole. After 10 bed-volume washes,
bound PPK was eluted with 10 mM EDTA and pooled by passing
through a PD-10 desalting column. Samples were verified by SDS-PAGE and Western blotting and further characterized by activity assays.
 |
RESULTS |
Effects of chemical agents on PPK activities--
E.
coli PPK transfers the -phosphate of ATP processively to
generate polyP chains of lengths of 700 to 800 residues.
|
(Eq. 1)
|
As a NDK, PPK catalyzes the transfer of a terminal phosphate
residue to ADP (the reverse reaction) or GDP as well as CDP and
UDP.
|
(Eq. 2)
|
|
(Eq. 3)
|
A GDP attack on the subterminal linkage of a polyP chain generates
the linear ppppG.
|
(Eq. 4)
|
Under conditions that favor the reaction in Equation 4 and inhibit
the reaction in Equation 3 (see below and Table
I), the polyP chains diminish in size
progressively (Fig. 1), a distributive reaction in contrast to the highly processive reaction in Equations 1-3.

View larger version (101K):
[in this window]
[in a new window]
|
Fig. 1.
Nonprocessive synthesis of ppppG from GDP and
polyP. At intervals, [ -32P]polyP was isolated and
separated by 6% urea-PAGE (see "Experimental Procedures").
A, 5 mM Mg2+ without
PPi; B, 5 mM Mg2+ with
10 mM PPi; C, 0.2 mM
Mg2+ without PPi. Toluidine blue was used to
stain the polyP markers.
|
|
Guanidine HCl at the low concentration of 5 mM inhibited
the synthesis of polyP (Equation 1) by 50%, had no effect on the synthesis of ATP and GTP (Equations 2 and 3), and stimulated the reaction in Equation 4 by 20% (Table I). The optimal Mg2+
levels differ widely for the activities in Equations 1-4, with respective values of 5, 2, 1, and 0.2 mM. Whereas 10 mM inorganic pyrophosphate inhibited the activities in
Equation 1 by 66% and those in Equation 3 by 75%, it increased those
in Equation 4 by 100%. With regard to the synthesis of ppppG at low
Mg2+ in the absence of PPi (Fig. 1C), the
removal of polyP is distributive, but the appearance of ppppG is
delayed. The basis of these kinetics needs to be explored further.
Subunit Structures Required for PPK Activities as Determined by
Radiation Target Analysis--
Gel-filtration and
sedimentation-velocity measurements indicated that native PPK is a
homotetramer (6), but the functional sizes for each of the four
activities was not known. To determine these, radiation inactivation
was employed in which the function of the target molecule is destroyed
with progressive doses of -rays or high energy electrons. The
exponential rate of the functional decay is compared with standards in
which the mass value has been determined for many proteins by other
methods (10).
The decay rates observed for the first four PPK activities (Fig.
2, A and B; Table
II) indicate that a minimal functional size for the synthesis of polyP (Equation 1), of ATP (Equation 2), and
of GTP (Equation 3) is 138-156 kDa which corresponds to a dimer (Fig.
2). The unusual pattern of the ppppG synthesis decay rate can be
interpreted as a two-phase reaction (Fig. 2, A and C) in which an inactive tetramer (306 kDa) decays to a
trimeric state as judged by the subsequent decay rate indicative of a
trimer (222 kDa). The decay rate of the tetramer in the first phase was calculated by correcting for the rate determined for the subsequent decay of the trimer.

View larger version (17K):
[in this window]
[in a new window]
|
Fig. 2.
Radiation inactivation of PPK
activities. A, the TLC plate was developed with 0.75 M KH2PO4, pH 3.5, and
autoradiographed for polyP, ATP, GTP, and ppppG; C+ is the
positive control without irradiation, and C- is the negative
control without PPK. B, the radiation-induced loss of PPK
activities follows first-order kinetics, yielding functional size
values of 156, 138, and 149 kDa for polyP ( ), ATP ( ), and GTP
( ) synthesis (Equations 1-3), respectively, the internal standard
of G6PDHase (112 kDa) ( ) also follows an exponential decay as a
function of dosage. C, radiation inactivation of ppppG
synthesis (Equation 4). The fraction of activity remaining plotted
versus exposure dose generated a binormal line composed of
two linear portions determined by drawing tangents to the decay curve
at doses >2 Mrad ( ). The difference between the extrapolated linear
regression and the data obtained at less than 2 Mrad is shown by .
The results in A, B, and C were
obtained in two independent experiments.
|
|
View this table:
[in this window]
[in a new window]
|
Table II
Functional oligomeric size of PPK activities
Values are averages of at least two independent experiments.
D37 is the radiation dosage in megarad required to inactivate
the activity to 37% that of the control. The minimal functional size
of G6PDHase, the internal standard, is 110 ± 4 kDa compared to
its native size of 102 kDa.
|
|
Autophosphorylation of PPK at histidine residues His-435 and
His-454 (Equation 5) to a limit of about 0.2/monomer occurs rapidly at
an ATP concentration of 5 µM (5, 6). The reaction is far
more extensive (3/monomer) at 1 mM ATP, a concentration
near the Km for polyP synthesis. Radiation target
analysis revealed that the functional size for PPK phosphorylation is a tetramer (293 kDa) at 5 µM ATP, whereas the active form,
as in polyP synthesis at 1 mM ATP, is a dimer (159 kDa)
(Fig. 3). When degraded by ionization,
purified PPK becomes a monomer (80 kDa) as determined by
denaturing SDS-PAGE analysis.

View larger version (36K):
[in this window]
[in a new window]
|
Fig. 3.
Radiation inactivation of PPK
autophosphorylation. A, 20 ng of irradiated PPK were
separated by electrophoresis and silver stained (upper
panel). A 10-µl reaction mixture containing 30 ng of irradiated
PPK, PPK buffer, [32P]ATP at 5 µM
(middle panel) or at 1 mM (bottom
panel) was incubated on ice for 5 min, separated by
electrophoresis, and then autoradiographed. B, inactivation
rates for the 72-kDa PPK band ( ), autophosphorylation at 5 µM ( ), and 1 mM ( ) ATP are fitted by
linear regression constrained to the 100% intercept. The fraction of
remaining intensity from at least two independent experiments is
plotted as a function of absorbed dose at 63 °C.
|
|
Kinetic Mechanism of ppppG Synthesis--
The kinetic constants
for ppppG synthesis and the order of substrate binding based on the
initial rate as a function of both GDP and polyP concentrations in
Lineweaver-Burk plots ruled out a ping-pong mechanism for Equation 4.
Regression lines through the data of the reciprocal of rate (1/V)
versus the reciprocal of GDP concentration and of 1/V
versus the reciprocal of polyP concentration plots do not
intersect on the 1/V axis (data not shown). These data were used to
determine the following kinetic constants for ppppG synthesis: the
Km for GDP was 160 ± 29 µM and
the kcat (turnover number) was 28.9 ± 1.6 min 1, whereas the Km for polyP was
35 ± 10 µM and kcat was 62.4 ± 7.4 min 1 (Table
III). The catalytic efficiencies
(kcat/Km) were calculated to
be 1782 min 1 mM 1 for polyP and
180 min 1 mM 1 for GDP (11).
View this table:
[in this window]
[in a new window]
|
Table III
Kinetics of ppppG synthesis
The values are averages of two independent experiments. The
Mg2+ concentration was 0.2 mM to favor ppppG
synthesis.
|
|
To differentiate between ordered and random sequential mechanisms for
ppppG synthesis (11-13), the analogs for the products, polyP65 and GMP, were used in inhibition experiments.
P65 proved to be a competitive inhibitor of
polyP750 and of GDP, both when GDP was held constant
(Ki = 7.6 ± 0.9 mM) and of GDP when polyP750 was held constant (Ki = 1.2 ± 0.3 µM). GMP also proved to be a
competitive inhibitor of both polyP750 and GDP, both when
GDP was held constant (Ki = 1.4 ± 0.3 mM) and of GDP when polyP750 was held constant
(Ki = 0.7 ± 0.09 µM). These
initial-rate and product-analog inhibition studies demonstrate
that ppppG synthesis at 0.2 mM MgCl2 occurs by
a rapid equilibrium, random Bi-Bi mechanism.
Generation of PPK Mutants--
The amino acid alignment of 18 prokaryotic PPK sequences demonstrates a high degree of conservation,
particularly within specific regions (17% of residues overall and 69%
over the 60% most homologous regions). The MEME program (14) revealed
10 motifs of the highest homology among these PPKs. Five of the six
most homologous motifs occur in the 300 residues of the carboxyl
terminus of E. coli PPK (amino acids ~360-687) (Fig.
4). The motif with the lowest degree of
homology is located between residues ~130 and 320.

View larger version (72K):
[in this window]
[in a new window]
|
Fig. 4.
Alignments of PPK from 18 different
microorganisms show regions of high homology. The MEME program
(14) was used to identify regions of over 60% conserved residues shown
on the top as rectangular boxes within the 687 amino acid E. coli PPK. Arrows at residues 134, 326, and 532 indicate
the locations of the deletion fragments. Numbers I-VI refer to regions
with high homology, I being the highest. Underneath the alignments, *
indicates identical (100% homologous) residues; : indicates
more than 60% homologous residues. The phosphohistidylated site at
His-454 is indicated by @. Conserved residues modified by alanine
substitution site-directed mutagenesis are underlined.
Abbreviations for the organisms are: E.C., E. coli (2);
S.T., Salmonella typhimurium (GeneBankTM AAC
34890); K.A., Klebsiella aerogenes (33); C.C.,
Campylobacter coli (GeneBankTM CAA 68899); V.C.,
V. cholerae (GeneBankTM AAC 32883); P.A.,
Pseudomonas aeruginosa (36); A.C., Acinetobacter
calcoaceticus (37); H.P., H. pylori (38); N.M.,
N. meningitidis (35); M.T., M. tuberculosis (34);
M.L., Mycobacterium leprae (GeneBankTM (CAB
16451); S.C., Streptococcus coelicolor (C. Villar and A. Kornberg, unpublished data); D.R., Deinococcus
radiodurans (TIGR data base); S-sp, Synechocystis 6803 (32); Y.P., Yersinia pestis (Sanger data base); C.J.,
Campylobacter jejuni (TIGR data base); C.T., Chlorobium
tepidum (TIGR data base); P.G., Porphyromonas
gingivalis (TIGR data base); D.D., Dictyostelium
discoideum (M. Simms, personal communication.).
|
|
To determine the critical residues and regions within the 300-residue
carboxyl terminus, site-directed mutagenesis was performed based on
both sequence-homology analysis and the previous structure-function dissociation results. Initially, 46 single-site alanine-substituted mutants were constructed and verified. Four PPK activities (Equations 1-4) in these 46 mutants were assayed at least three times in a 96-well high-throughput
format.2 Of the 46 mutants,
34 exhibited PPK activities similar to those of the wild type. Eight
mutants with activities that differed from wild type were further
purified, checked by SDS-PAGE and Western blotting (data not shown),
and characterized in detail (Table
IV).
Properties of PPK Mutants--
Single-site mutants R375A, S380A,
F488A, P507A, R564A, R621A, and Q674A lost all five PPK activities
demonstrating that these amino acids are essential (Table IV). Y468A
exhibited high levels (120-140%) of polyP, GTP, and ppppG synthesis
and autophosphorylation activities (Equations 1 and 3-5) but
diminished (20-50%) ATP synthesis activity (Equation 2). The PPK
activities of the deletion mutants were also characterized in detail
(Table IV). Only PPK 327-687 and PPK 532-687 exhibited partial
polyP and ATP synthesis activities (Equations 1 and 2), suggesting that
the essential fragment or domain for these functions is in the
amino-terminal region.
None of deletion mutants retained GTP and ppppG synthesis activities
(Equations 3 and 4) implying that these require a native structure. In
addition, none of the deletion mutants underwent autophosphorylation
(Equation 5), indicating that an intact native protein is also required
for this activity. In mutants R564A, PPK 327-687, and PPK 532-687
the polyP synthesis (Equation 1) and autophosphorylation (Equation 5)
activities were dissociated; R564A autophosphorylated to 20% that of
the wild type but lost all four other PPK activities. PPK 327-687
and PPK 532-687 did not display any autophosphorylation, but
retained residual (10-35%) polyP (Equation 1) and ATP (Equation 2)
synthesis activities.
Mutant Y468A was examined for its NDK activity in substrate competition
experiments (Fig. 5). In the presence of
1 mM ADP and 1 mM GDP, the ratio of ATP to GTP
synthesis of the wild type enzyme is about 8:1, whereas for the mutant,
the ratio is 1:3, and ppppG synthesis is reduced 40-fold relative to
the wild type. The ratio of GTP to ppppG synthesis was also changed
from 15:1 in the wild type to 25:1 in the mutant. These findings
indicate that the catalytic sites of ATP and GTP synthesis are
shared.

View larger version (79K):
[in this window]
[in a new window]
|
Fig. 5.
Alternation in relative ATP and GTP synthesis
activities of the Y468A mutant. ADP and GDP are compared as
substrates for NTP synthesis with the mutant and wild type
(WT) PPKs. The enzyme (10 ng) was incubated with PPK buffer,
1 mM ATP, and varying concentrations of GDP (0-5
mM) at 37 °C for 30 min. The TLC plate was developed
with 0.75 M KH2PO4 (pH 3.5) and
autoradiographed.
|
|
 |
DISCUSSION |
PPK of E. coli has several discrete functions: the
synthesis of polyP specifically from ATP, the reverse reaction to form ATP from polyP and ADP, and the substitution for ADP in the reverse reaction by GDP, CDP, and UDP, in essence a nucleoside-diphosphate kinase activity. The contribution of the reverse reactions in the
disposal of polyP compared with that of exopolyphosphatase has not been
determined, nor has the synthesis of GTP, CTP, and UTP as auxiliary to
the activity of the major nucleoside-diphosphate kinase activity been
evaluated. In addition to these activities, PPK autophosphorylates
certain histidine residues to generate a putative intermediate and also
catalyzes the transfer of a pyrophosphoryl group to GDP to generate the
linear ppppG.
The aforementioned activities of PPK can be distinguished by several
agents, such as the optimal concentration of Mg2+ and the
effects of guanidine-HCl and inorganic pyrophosphate (Table II).
Inasmuch as the native state of PPK is that of a tetramer of 80-kDa
subunits, these distinctive effects may depend in part on its
oligomeric state. To this end, the subunit structure of the oligomer
for each of the five activities was determined by radiation target analysis.
Radiation inactivation of an enzyme activity has been used to measure
the target size of the functional unit (9, 10). The dosage of the
-rays, generated by 60Co required to inactivate a number
of enzymes of known size (e.g. glucose-6-phosphate
dehydrogenase), provides a scale that can be used to measure the
functional size of another enzyme activity. With regard to PPK, the
dimeric state best fits the functional size of the forward and reverse
activities (Table III; Fig. 2, A and B); the
tetrameric state appears to be optimal for autophosphorylation at 5 µM ATP, but the dimer is preferred at 1 mM
ATP, the concentration needed for the forward and reverse reactions
(Table II; Fig. 3, A and B). The functional size
for the ppppG synthesis activity is judged to be a trimer (Table II;
Fig. 2, A and C) as indicated by the increase in
activity as the tetramer is inactivated and the rate of subsequent
decay of activity, consistent with the size of a trimer.
The PPK of Propionibacterium shermanii like that of E. coli PPK has a subunit mass of 83 kDa and synthesizes polyP
processively to a limit of about 750 residues, but unlike E. coli PPK appears to be monomeric (15, 16). However, the
glucokinase of P. shermanii, which utilizes polyP to
phosphorylate glucose, is a homodimer of 33-kDa subunits (17) by either
processive (polyP700) or nonprocessive (polyP30) mechanisms (18). In M. tuberculosis,
polyP glucokinase utilizes the long-chain polyP nonprocessively by an
ordered Bi-Bi mechanism (13).
The amino acid sequences of NDKs are highly conserved between E. coli and humans (43% identity) and are believed to be essential for DNA and RNA synthesis (19), as well as for bacterial growth, virulence, cell-signaling, and polysaccharide synthesis (20). Pyruvate
kinase (21) and adenylate kinase (22) may also function as NDKs in
E. coli. Inasmuch as knockout mutants of E. coli
(ndk- and ndk-/pyk-) are still viable (23), PPK
by utilizing polyP may provide a backup function as an NDK in
vivo.
The capacity of PPK to catalyze the attack by GDP on a subterminal
linkage of polyP generates ppppG. The activity predominates over the
GDP attack on the terminal linkage when the Mg2+
concentration is at the low level of 0.2 mM and inorganic
pyrophosphate is present. Such a pyrophosphoryl transfer was not
observed with ADP. Unlike the forward and reverse reactions, which are
highly processive, the synthesis of ppppG is distributive (Fig. 1) and occurs by a rapid equilibrium, random Bi-Bi mechanism (Table III). In
yeast, ppppG can be generated by phosphoglycerate kinase (24) and
digested by an exopolyphosphatase (25); ppppG can also stimulate mammalian adenylate cyclase (26). However, unlike ppGpp for which
regulatory roles are established (27-30), the cellular presence of
ppppG and its functions are unknown.
The availability of high copy number plasmids bearing the
ppk gene and His tags for PPK should attract proper
structural studies of the enzyme to account for its multiple functions.
In the meantime, we have carried out some mutational studies and also
examined some other bacterial PPKs for comparison with the E. coli enzyme.
Site-directed mutagenesis was focused on regions where the amino acid
alignments of 18 bacterial PPK sequence show a high degree of
conservation. Alanine substitutions at 46 sites were made in five of
the six most homologous regions (over 60% identity) that make up the
300 residues at the carboxyl end (360-687). Among these, the PPKs
isolated from several of them showed a virtual loss of all five
activities. However, in one mutant (Y468A) all the activity levels were
enhanced except for the synthesis of ATP, which was diminished. Thus,
the active site, altered at this residue, discriminates against GDP far
less than in the wild type. Mutants in which 100 or more residues were
deleted at the amino- and carboxyl-terminal ends, as well as in between
(Fig. 4) retained no significant levels of any of the activities.
Efforts to separate the functional domains of PPK by proteolytic
digestion were not successful. Individual peptides of PPK generated by
treatment with trypsin were isolated by fast protein liquid
chromatography and high pressure liquid chromatography, but none
contained any of the five PPK activities, although low levels were
detected in pools of the digests.
The PPKs of H. pylori and Vibrio cholerae have
been purified and characterized as
homotetramers.2,3 They also
generate polyP with about 750 residues and behave much like that of
E. coli PPK. However, The
kcat/Km of the reverse
activity of both PPKs was near 100 times greater than that of E. coli PPK, suggesting that PPK in H. pylori and V. cholerae may play more important roles in generating ATP from
polyP.
PPKs, partially purified from N. meningitidis and P. shermanii, were reported to have masses of 72 and 83 kDa,
respectively, as determined by SDS-PAGE. The values for
Km (1.5-2.0 mM) and turnover number
(40-60/subunit/second), calculated from the efficiency and yield of
the purification, are similar to those published for E. coli. Those enzymes also appeared to be attached to cell membranes
(31). An E. coli overproducer of PPK and an isopropyl-1-thio- -D-galactopyranoside-induced,
overexpressed His-tagged PPK are now available for crystallography to
explore structure-function relationships.
 |
ACKNOWLEDGEMENTS |
We thank Dr. Rong-Long Pan for providing the
60Co radiation apparatus, Dr. Cresson D. Fraley and Leroy
Bertsch for critical evaluation of the manuscript, and Dr. Sung-Kay
Chiu, Dr. Nobuo Ogawa, and Dr. Dana Ault-Riché for helpful
discussions during this study.
 |
FOOTNOTES |
*
This work was supported by Grant GM07581-38 from the
National Institutes of Health.The costs of publication of this
article were defrayed in part by the
payment of page charges. The article must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
To whom correspondence should be addressed. Tel.: 650-723-6167;
Fax: 650-723-6783; E-mail: akornber@cmgm.stanford.edu.
2
C. M. Tzeng and A. Kornberg, unpublished data.
3
N. Ogawa and A. Kornberg, unpublished results.
 |
ABBREVIATIONS |
The abbreviations used are:
polyP, polyphosphate;
PPK, polyphosphate kinase;
ppppG, guanosine
tetraphosphate;
PAGE, polyacrylamide gel electrophoresis;
kb, kilobase(s);
NDK, nucleoside-diphosphate kinase;
Mrad, megarad;
G6PDHase, glucose-6-phosphate dehydrogenase.
 |
REFERENCES |
| 1.
|
Kulaev, I. S.
(1979)
The Biochemistry of Inorganic Polyphosphate
, pp. 11-35, John Wiley & Sons, Inc., New York
|
| 2.
|
Akiyama, M.,
Crooke, E.,
and Kornberg, A.
(1992)
J. Biol. Chem.
267,
22556-22561[Abstract/Free Full Text]
|
| 3.
|
Tzeng, C. M.,
and Kornberg, A.
(1998)
Mol. Microbiol.
29,
381-383[CrossRef][Medline]
[Order article via Infotrieve]
|
| 4.
|
Rao, N. N.,
and Kornberg, A.
(1996)
J. Bacteriol.
178,
1394-1400[Abstract/Free Full Text]
|
| 5.
|
Kumble, K. D.,
Ahn, K.,
and Kornberg, A.
(1996)
Proc. Natl. Acad. Sci. U. S. A.
93,
14391-14395[Abstract/Free Full Text]
|
| 6.
|
Ahn, K.,
and Kornberg, A.
(1990)
J. Biol. Chem.
265,
11734-11739[Abstract/Free Full Text]
|
| 7.
|
Kuroda, A.,
and Kornberg, A.
(1997)
Proc. Natl. Acad. Sci. U. S. A.
94,
439-442[Abstract/Free Full Text]
|
| 8.
|
Ault-Riché, D.,
Fraley, C. D.,
Tzeng, C. M.,
and Kornberg, A.
(1998)
J. Bacteriol.
180,
1841-1847[Abstract/Free Full Text]
|
| 9.
|
Tzeng, C. M.,
Yang, S. Y.,
Yang, S. J.,
Jiang, S. S.,
Kuo, S. Y.,
Hung, S. H.,
Ma, J. T.,
and Pan, R. L.
(1996)
Biochem. J.
316,
143-47
|
| 10.
|
Kempner, E. S.
(1993)
Trends Biochem. Sci.
18,
236-239[CrossRef][Medline]
[Order article via Infotrieve]
|
| 11.
|
Cleland, W. W.
(1979)
Methods Enzymol.
63,
103-38[Medline]
[Order article via Infotrieve]
|
| 12.
|
Segel, I. H.
(1975)
Enzyme Kinetics: Behavior and Analysis of Rapid Equilibrium and Steady-state Enzyme Systems
, pp. 506-845, Wiley-Interscience, New York
|
| 13.
|
Hsieh, P. C.,
Kowalczyk, T. H.,
and Phillips, N. F.
(1996)
Biochemistry
35,
9772-9781[CrossRef][Medline]
[Order article via Infotrieve]
|
| 14.
|
Bailey, T. L.,
and Elkan, C.
(1994)
Fitting a Mixture Model by Expectation Maximization to Discover Motifs in Biopolymers: Proceedings of the Second International Conference on Intelligent Systems for Molecular Biology
, pp. 28-36, AAAI Press, Menlo Park, CA
|
| 15.
|
Robinson, N. A.,
Clark, J. E.,
and Wood, H. G.
(1987)
J. Biol. Chem.
262,
5216-5222[Abstract/Free Full Text]
|
| 16.
|
Robinson, N. A.,
and Wood, H. G.
(1986)
J. Biol. Chem.
261,
4481-4485[Abstract/Free Full Text]
|
| 17.
|
Phillips, N. F. B.,
Horn, P. J.,
and Wood, H. G.
(1993)
Arch. Biochem. Biophys.
300,
309-319[CrossRef][Medline]
[Order article via Infotrieve]
|
| 18.
|
Pepin, C. A.,
and Wood, H. G.
(1986)
J. Biol. Chem.
261,
4476-4480[Abstract/Free Full Text]
|
| 19.
|
De La Rosa, A.,
Williams, R. L.,
and Steeg, P. S.
(1995)
Bioessays
17,
53-62[CrossRef][Medline]
[Order article via Infotrieve]
|
| 20.
|
Chakrabarty, A. M.
(1998)
Mol. Microbiol.
28,
875-882[CrossRef][Medline]
[Order article via Infotrieve]
|
| 21.
|
Saeki, T.,
Hori, M.,
and Umezawa, H.
(1974)
J. Antibiot. (Tokyo)
28,
974-981
|
| 22.
|
Lu, Q.,
and Inouye, M.
(1996)
Proc. Natl. Acad. Sci. U. S. A.
93,
5720-5725[Abstract/Free Full Text]
|
| 23.
|
Lu, Q.,
Zhang, X.,
Almaula, N.,
Mathews, C. K.,
and Inouye, M.
(1995)
J. Mol. Biol.
254,
337-341[CrossRef][Medline]
[Order article via Infotrieve]
|
| 24.
|
Garcia Diaz, M.,
Canales, J.,
Sillero, M. A. G.,
Sillero, A.,
and Cameselle, J. C.
(1989)
Biochem. Int.
19,
1253-1264[Medline]
[Order article via Infotrieve]
|
| 25.
|
Kulakovskaya, T. V.,
Andreeva, N. A.,
and Kulaev, I. S.
(1997)
Biochemistry
62,
1051-1052[Medline]
[Order article via Infotrieve]
|
| 26.
|
Ignarro, L. J.,
and Gross, R. A.
(1978)
Biochim. Biophys. Acta
541,
170-180[Medline]
[Order article via Infotrieve]
|
| 27.
|
Kuroda, A.,
Murphy, H.,
Cashel, M.,
and Kornberg, A.
(1997)
J. Biol. Chem.
272,
21240-21243[Abstract/Free Full Text]
|
| 28.
|
Cashel, M.,
and Rudd, K. E.
(1987)
in
Escherichia coli and Salmonella typhimurium: Cellular and Molecular Biology
(Neidhardt, F. C.
, Ingraham, J. L.
, Low, K. B.
, Magasanik, B.
, Schaechter, M.
, and Umbarger, H. E., eds)
, pp. 1410-1438, American Society for Microbiology, Washington, D. C.
|
| 29.
|
Spira, B.,
Silberstein, N.,
and Yagil, E.
(1995)
J. Bacteriol.
177,
4053-4058[Abstract/Free Full Text]
|
| 30.
|
Voelz, H.,
Voelz, U.,
and Ortigoza, R. O.
(1966)
Arch. Microbiol.
53,
371-388
|
| 31.
|
Tinsley, C. R.,
Manjula, B. N.,
and Gotschlich, E. C.
(1993)
Infect. Immun.
61,
3703-3710[Abstract/Free Full Text]
|
| 32.
|
Kaneko, T.,
Sato, S.,
Kotani, H.,
Tanaka, A.,
Asamizu, E.,
Nakamura, Y.,
Miyajima, N.,
Hirosawa, M.,
Sugiura, M.,
Sasamoto, S.,
Kimura, T.,
Hosouchi, T.,
et al..
(1996)
DNA Res.
3,
109-136[Abstract]
|
| 33.
|
Kato, J.,
Yamamoto, T.,
Yamada, K.,
and Ohtake, H.
(1993)
Gene (Amst.)
137,
237-242[CrossRef][Medline]
[Order article via Infotrieve]
|
| 34.
|
Cole, S. T.,
et al..
(1998)
Nature
393,
537-544[CrossRef][Medline]
[Order article via Infotrieve]
|
| 35.
|
Tinsley, C. R.,
and Gotschlich, E. C.
(1995)
Infect. Immun.
63,
1624-1630[Abstract]
|
| 36.
|
Ishige, K.,
Kameda, A.,
Noguchi, T.,
and Shiba, T.
(1998)
DNA Res.
5,
157-162[Abstract]
|
| 37.
|
Geissdorfer, W.,
Ratajczak, A.,
and Hillen, W.
(1998)
Appl. Environ. Microbiol.
64,
896-901[Abstract/Free Full Text]
|
| 38.
|
Tomb, J. F.,
et al..
(1997)
Nature
388,
539-547[CrossRef][Medline]
[Order article via Infotrieve]
|
Copyright © 2000 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
R. Jain and S. Shuman
Polyphosphatase Activity of CthTTM, a Bacterial Triphosphate Tunnel Metalloenzyme
J. Biol. Chem.,
November 7, 2008;
283(45):
31047 - 31057.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. D. Fraley, M. H. Rashid, S. S. K. Lee, R. Gottschalk, J. Harrison, P. J. Wood, M. R. W. Brown, and A. Kornberg
A polyphosphate kinase 1 (ppk1) mutant of Pseudomonas aeruginosa exhibits multiple ultrastructural and functional defects
PNAS,
February 27, 2007;
104(9):
3526 - 3531.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Ghorbel, A. Smirnov, H. Chouayekh, B. Sperandio, C. Esnault, J. Kormanec, and M.-J. Virolle
Regulation of ppk Expression and In Vivo Function of Ppk in Streptomyces lividans TK24.
J. Bacteriol.,
September 1, 2006;
188(17):
6269 - 6276.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
W. Chen, R. J. Palmer, and H. K. Kuramitsu
Role of Polyphosphate Kinase in Biofilm Formation by Porphyromonas gingivalis
Infect. Immun.,
August 1, 2002;
70(8):
4708 - 4715.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Stephenson and J. A. Hoch
PAS-A domain of phosphorelay sensor kinase A: A catalytic ATP-binding domain involved in the initiation of development in Bacillus subtilis
PNAS,
November 29, 2001;
(2001)
251408398.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Cardona, F. Remonsellez, N. Guiliani, and C. A. Jerez
The Glycogen-Bound Polyphosphate Kinase from Sulfolobus acidocaldarius Is Actually a Glycogen Synthase
Appl. Envir. Microbiol.,
October 1, 2001;
67(10):
4773 - 4780.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
N. Ogawa, C.-M. Tzeng, C. D. Fraley, and A. Kornberg
Inorganic Polyphosphate in Vibrio cholerae: Genetic, Biochemical, and Physiologic Features
J. Bacteriol.,
December 1, 2000;
182(23):
6687 - 6693.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
W. H. Faour, Y. He, Q. W. He, M. de Ladurantaye, M. Quintero, A. Mancini, and J. A. Di Battista
Prostaglandin E2 Regulates the Level and Stability of Cyclooxygenase-2 mRNA through Activation of p38 Mitogen-activated Protein Kinase in Interleukin-1beta -treated Human Synovial Fibroblasts
J. Biol. Chem.,
August 17, 2001;
276(34):
31720 - 31731.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Stephenson and J. A. Hoch
PAS-A domain of phosphorelay sensor kinase A: A catalytic ATP-binding domain involved in the initiation of development in Bacillus subtilis
PNAS,
December 18, 2001;
98(26):
15251 - 15256.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 2000 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|