HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Tzeng, C.-M. Articles by Kornberg, A. Search for Related Content PubMed PubMed Citation Articles by Tzeng, C.-M. Articles by Kornberg, A. Social Bookmarking                      What's this?

J Biol Chem, Vol. 275, Issue 6, 3977-3983, February 11, 2000

The Multiple Activities of Polyphosphate Kinase of Escherichia coli and Their Subunit Structure Determined by Radiation Target Analysis^*

Chi-Meng Tzeng and Arthur Kornberg

From the Department of Biochemistry, Stanford University, Stanford, California 94305-5307

	ABSTRACT

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Polyphosphate kinase (PPK), the principal enzyme required for the synthesis of inorganic polyphosphate (polyP) from ATP, also exhibits other enzymatic activities, which differ significantly in their biochemical optima and responses to chemical agents. These several activities include: polyP synthesis (forward reaction), nATP  polyP_n + nADP (Equation 1); ATP synthesis from polyP (reverse reaction), ADP + polyP_n  ATP + polyP_n  1 (Equation 2); general nucleoside-diphosphate kinase, GDP + polyP_n  GTP + polyP_n  1 (Equation 3); linear guanosine 5'-tetraphosphate (ppppG) synthesis, GDP + polyP_n  ppppG + polyP_n  2 (Equation 4); and autophosphorylation, PPK + ATP  PPK-P + ADP (Equation 5). The Mg²⁺ optima are 5, 2, 1, and 0.2 mM, respectively, for the activities in Equations 1, 2, 3, and 4. Inorganic pyrophosphate inhibits the activities in Equations 1 and 3 but stimulates that in Equation 4. The kinetics of the activities in Equations 1, 2, and 3 are highly processive, whereas the transfer of a pyrophosphoryl group from polyP to GDP (Equation 4) is distributive and demonstrates a rapid equilibrium, random Bi-Bi catalytic mechanism. Radiation target analysis revealed that the principal functional unit of the homotetrameric PPK is a dimer. Exceptions are a trimer for the synthesis of ppppG (Equation 4) and a tetrameric state for the autophosphorylation of PPK (Equation 5) at low ATP concentrations. Thus, the diverse functions of this enzyme involve different subunit organizations and conformations. The highly conserved homology of PPK among 18 microorganisms was used to determine important residues and conserved regions by alanine substitution, by site-directed mutagenesis, and by deletion mutagenesis. Of 46 single-site mutants, seven exhibit none of the five enzymatic activities; in one mutant, ATP synthesis from polyP is reduced relative to GTP synthesis. Among deletion mutants, some lost all five PPK activities, but others retained partial activity for some reactions but not for others.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Inorganic polyphosphate (polyP),¹ a linear polymer of hundreds of phosphate residues (P_i) linked by phosphoanhydride bonds, is found in all cells in nature (1). The principal enzyme that synthesizes polyP from ATP in Escherichia coli is polyP kinase (PPK), a peripheral, membrane-bound homotetramer of 80-kDa subunits (2). PPK is highly conserved in many bacterial species, including some of the major pathogens (e.g. Helicobacter pylori, Mycobacterium tuberculosis, and Neisseria meningitidis) and is a plausible antimicrobial target (3). E. coli ppk mutants fail to make the adaptive changes in the stationary phase needed for resistance to various stresses and for survival (4).

An initial event in converting the -phosphate of ATP into polyP chains of 700-800 residues (Equation 1) is the phosphorylation of critical histidine residues His-435 and His-454 (Equation 5) (5). This is followed by highly processive polymerization with no detectable intermediates; neither ATP, P_i, nor polyP chains prime the reaction (6). The reverse reaction (Equation 2), in which ADP is converted to ATP by polyP, is kinetically slower than the forward reaction but can be driven to completion by an excess of ADP. More generally, PPK functions as a nucleoside-diphosphate kinase, converting GDP, CDP, and UDP to their respective nucleoside triphosphates (7). Another novel feature of PPK is catalysis of the attack by GDP on a subterminal linkage of polyP, resulting in the transfer of a pyrophosphoryl group to generate the linear guanosine tetraphosphate (ppppG) (7).

Radiation target analysis was used to examine all five PPK activities with regard to optimal reaction conditions, the effects of chemical agents, the catalytic mechanism of ppppG synthesis, and the subunit organization needed for each of the activities. Furthermore, site-directed mutagenesis by alanine substitution and deletion mutagenesis were used to identify key residues and fragments within the highly conserved regions of PPK.

	EXPERIMENTAL PROCEDURES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Biochemical Assays-- Purified PPK (100 ng) was added to a reaction buffer (50 mM Hepes (pH 7.5), 50 mM ammonium sulfate, 5 mM MgCl₂) at 37 °C, as described previously (2). Quantification of polyP, ATP, GTP, and ppppG spots on TLC plates was as described previously (7). PolyP accumulation in vivo and enzyme activities in vitro were measured initially in a high throughput, 96-well format and then checked individually. PolyP levels and enzyme activities were measured both by a radioactive method (6) and by a luciferase-based nonradioactive method (8).

To assay for PPK autophosphorylation, 60-100 ng of an irradiated enzyme was incubated in 50 mM Hepes-KOH (pH 7.2), 40 mM ammonium sulfate, 10 mM MgCl₂, and either 5 µM or 1 mM [-³²P]ATP on ice for 5 min; the reaction was terminated by adding 40 mM EDTA. The complex was precipitated with two volumes of acetone and then washed with ethanol to remove the unreacted ATP. The pellet was resuspended in SDS-PAGE buffer, electrophoresed on a 12% gel, and analyzed with a digital scanner (5).

PolyP synthesis or degradation was measured in several activity assays: for polyP synthesis from ATP (Equation 1; for nucleoside-diphosphate kinase (NDK) activities, reverse reaction Equation 2; and GTP synthesis, Equation 3) and for ppppG synthesis (Equation 4). The reactions were terminated by adding 5× urea-PAGE buffer dye (450 mM Tris borate, 15 mM EDTA, 0.125% bromphenol blue, and 50% sucrose). The samples were electrophoresed on 6% urea-polyacrylamide gels at 300 V until the dye migrated 6-8 cm from the top of wells. Labeled polyP was stained with toluidine blue followed by exposure on a PhosphorImager.

⁶⁰Co Irradiation-- A 50-µl aliquot of purified PPK (0.2-0.5 µg/ml) in a 0.5-ml microcentrifuge tube was frozen at 80 °C and shipped on dry ice to Taiwan for radiation inactivation. The samples were exposed to -rays at 63 °C at 1.5 Mrad/h for various times to obtain the desired dose; nonirradiated samples were assayed as controls. Glucose-6-phosphate dehydrogenase (G6PDHase) was used as an internal standard to measure the functional decay after irradiation by monitoring the rate of NADPH appearance at an absorbance of 340 nm as follows. An assay mixture of 50 mM Tris-HCl (pH 8.0), 1 mM EDTA, 10 mM MgCl₂, 3 mM glucose 6-phosphate, and 0.3 mM NADP was incubated with G6PDHase at room temperature. The linear rate of NADPH absorbance during the first 2 min was used to calculate the activity as before (9). The functional size of G6PDHase with a native molecular mass of 104 kDa was 112 kDa as determined by this method. To determine the structural size of PPK, irradiated samples were electrophoresed directly on 12% SDS-PAGE gels (Amersham Pharmacia Biotech Phast System).

Functional sizes and D₃₇ values were calculated from the equation, log m = 5.89  D_37,T  0.0028T where the D_37,T is the radiation dosage in Mrad required to inactivate the activity to 37% that of the control at temperature T (°C); m is the functional size in daltons, and T is the irradiation temperature (10).

Kinetic Studies-- The kinetic parameters K_m, k_cat, and K_i were determined in duplicate by Lineweaver-Burk plots and time-course titrations (11, 12). For initial rate studies, the reactions were started by adding 5 µl of purified enzyme (~100 ng) to 15 µl of reaction mixture (50 mM Hepes, pH 7.5, 50 mM ammonium sulfate, and 0.2 mM magnesium chloride) at 37 °C containing either 1 mM GDP with 1-100 µM polyP or 0.1-2 mM of GDP with 10 µM polyP. For product-analog inhibition experiments, the conditions used were 0-20 µM polyP₆₅ (Sigma) or 0-2 mM GMP (Sigma) as inhibitors. Reactions were spotted onto TLC plates and separated in 0.75 M KH₂PO₄ as the mobile phase; the products were quantified using a PhosphorImager (Molecular Dynamics).

Mutagenesis-- Plasmid pQE30ppk (5) was used as a template for site-directed mutagenesis and the construction of deletion mutants by polymerase chain reaction. The pQE30 (QIAexpress^TM, QIAGEN) plasmid vector with the highly efficient isopropyl-1-thio--D-galactopyranoside-inducible T5 promoter, and a Hisx6 tag coding sequence was used for overexpression and purification of the wild type and mutant PPK enzymes. E. coli XL2-blue (QIAexpress^TM, QIAGEN) was the host strain used for the screening and propagation of plasmids. E. coli CF5802 (MG1655 ppkppx::kan) (4) was the host strain for overexpression. Site-directed, alanine substitution mutagenesis was performed with the QuikChange^TM site-directed mutagenesis kit (Stratagene Inc.). The mutagenic oligonucleotide primers were all 27 base pairs in length with the target codon in the center changed to GCT for Ala (A).

Alignments of PPK amino acid sequences from 18 microorganisms revealed three highly conserved regions at residues 10-60, 350-480, and 550-630 of the 687-residue E. coli PPK (3). Amino acids within the carboxyl-terminal portion were chosen for site-directed mutagenesis, particularly the charged and the hydrophobic residues. Seven polymerase chain reaction oligonucleotide primers were synthesized: 5'-a, CTCGGATCCATGGGTCAGGAAAAG; 5'-b, CTCGCATGCATTACGCCGATTTTA; 5'-c, CTCGCATGCTTCCGCAATGGTTTT; 3'-a, CTCAAGCTTTTATTGAGGTTGTTC; 3'-b, GAAGCATGCGGGCAGCCCTTGCTG; 3'-c, GAAGCATGCTTTATCAAACCAAAT; and 3'-d, GTTGCATGCGTGCTGACGCAGATA with restriction sites added for subcloning into pQE30. These primers were used to generate six deletion mutants (the expected sizes on agarose gels are given in parentheses): PPK135-687 (0.5 kb), PPK327-687 (0.98 kb), PPK532-687 (1.6 kb), PPK1-134 (1.6 kb), PPK135-326 (1.5 kb), and PPK1-326 (1.09 kb), as well as the wild type (2.07 kb). The expected sizes of the 1 mM isopropyl-1-thio--D-galactopyranoside-induced proteins (given in parentheses): PPK135-687 (15 kDa), PPK327-687 (36 kDa), PPK532-687 (55 kDa), PPK1-134 (50 kDa), and PPK1-326 (40 kDa), PPK135-326 (58 kDa), and wild type (72 kDa), agreed with the values determined by denaturing gel electrophoresis and Western blotting (data not shown). To verify that the mutations were constructed properly, the entire ppk region of each mutant was sequenced. Standard molecular biology and transformation procedures were used.

Expression and Purification of PPK Mutants-- Wild type and mutant cells were grown in Luria-Bertani (LB) medium with or without 100 µg/ml ampicillin and 25 µg/ml kanamycin at 37 °C and with aeration until the A₆₀₀ reached 1.0. Isopropyl-1-thio--D-galactopyranoside was then added to a final concentration of 1.0 mM, and the cultures were grown for an additional 2 h at 30 °C. Cells were collected by centrifugation at 6000 × g for 10 min and resuspended to 3 volume/g of wet weight in lysis buffer (50 mM Tris-HCl, pH 7.4, 10% (v/v) glycerol, 5 mM MgCl₂, 1 mM dithiothreitol, and 250 µg/ml lysozyme). The samples were then incubated at 37 °C for 10 min, subjected to three freeze-thaw cycles and sonication for 1 min, and treated with 25 µg/ml each of DNase and RNase for 30 min at 4 °C. At final concentrations of 1 M KCl, 100 mM Na₂CO₃, and 0.05% Triton X-100 added sequentially, the mixture was incubated for 2 h at 4 °C and then sonicated for 1 min to solubilize PPK from the membrane. Cell debris was pelleted by centrifugation at 40,000 × g for 20 min, and the supernatant was applied to a nickel-nitrilotriacetic acid column previously equilibrated with 50 mM Tris-HCl, pH 7.4, 10% (v/v) glycerol, 5 mM MgCl₂, 1 mM dithiothreitol, 0.05% Triton X-100, and 100 mM imidazole. After 10 bed-volume washes, bound PPK was eluted with 10 mM EDTA and pooled by passing through a PD-10 desalting column. Samples were verified by SDS-PAGE and Western blotting and further characterized by activity assays.

	RESULTS

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Effects of chemical agents on PPK activities-- E. coli PPK transfers the -phosphate of ATP processively to generate polyP chains of lengths of 700 to 800 residues.

(Eq. 1)

As a NDK, PPK catalyzes the transfer of a terminal phosphate residue to ADP (the reverse reaction) or GDP as well as CDP and UDP.

(Eq. 2)

(Eq. 3)

A GDP attack on the subterminal linkage of a polyP chain generates the linear ppppG.

(Eq. 4)

Under conditions that favor the reaction in Equation 4 and inhibit the reaction in Equation 3 (see below and Table I), the polyP chains diminish in size progressively (Fig. 1), a distributive reaction in contrast to the highly processive reaction in Equations 1-3.

View larger version (101K): [in this window] [in a new window]   Fig. 1.   Nonprocessive synthesis of ppppG from GDP and polyP. At intervals, [-32P]polyP was isolated and separated by 6% urea-PAGE (see "Experimental Procedures"). A, 5 mM Mg2+ without PPi; B, 5 mM Mg2+ with 10 mM PPi; C, 0.2 mM Mg2+ without PPi. Toluidine blue was used to stain the polyP markers.

Guanidine HCl at the low concentration of 5 mM inhibited the synthesis of polyP (Equation 1) by 50%, had no effect on the synthesis of ATP and GTP (Equations 2 and 3), and stimulated the reaction in Equation 4 by 20% (Table I). The optimal Mg²⁺ levels differ widely for the activities in Equations 1-4, with respective values of 5, 2, 1, and 0.2 mM. Whereas 10 mM inorganic pyrophosphate inhibited the activities in Equation 1 by 66% and those in Equation 3 by 75%, it increased those in Equation 4 by 100%. With regard to the synthesis of ppppG at low Mg²⁺ in the absence of PPi (Fig. 1C), the removal of polyP is distributive, but the appearance of ppppG is delayed. The basis of these kinetics needs to be explored further.

Subunit Structures Required for PPK Activities as Determined by Radiation Target Analysis-- Gel-filtration and sedimentation-velocity measurements indicated that native PPK is a homotetramer (6), but the functional sizes for each of the four activities was not known. To determine these, radiation inactivation was employed in which the function of the target molecule is destroyed with progressive doses of -rays or high energy electrons. The exponential rate of the functional decay is compared with standards in which the mass value has been determined for many proteins by other methods (10).

The decay rates observed for the first four PPK activities (Fig. 2, A and B; Table II) indicate that a minimal functional size for the synthesis of polyP (Equation 1), of ATP (Equation 2), and of GTP (Equation 3) is 138-156 kDa which corresponds to a dimer (Fig. 2). The unusual pattern of the ppppG synthesis decay rate can be interpreted as a two-phase reaction (Fig. 2, A and C) in which an inactive tetramer (306 kDa) decays to a trimeric state as judged by the subsequent decay rate indicative of a trimer (222 kDa). The decay rate of the tetramer in the first phase was calculated by correcting for the rate determined for the subsequent decay of the trimer.

View larger version (17K): [in this window] [in a new window]   Fig. 2.   Radiation inactivation of PPK activities. A, the TLC plate was developed with 0.75 M KH2PO4, pH 3.5, and autoradiographed for polyP, ATP, GTP, and ppppG; C+ is the positive control without irradiation, and C- is the negative control without PPK. B, the radiation-induced loss of PPK activities follows first-order kinetics, yielding functional size values of 156, 138, and 149 kDa for polyP (), ATP (), and GTP () synthesis (Equations 1-3), respectively, the internal standard of G6PDHase (112 kDa) () also follows an exponential decay as a function of dosage. C, radiation inactivation of ppppG synthesis (Equation 4). The fraction of activity remaining plotted versus exposure dose generated a binormal line composed of two linear portions determined by drawing tangents to the decay curve at doses >2 Mrad (). The difference between the extrapolated linear regression and the data obtained at less than 2 Mrad is shown by . The results in A, B, and C were obtained in two independent experiments.

Autophosphorylation of PPK at histidine residues His-435 and His-454 (Equation 5) to a limit of about 0.2/monomer occurs rapidly at an ATP concentration of 5 µM (5, 6). The reaction is far more extensive (3/monomer) at 1 mM ATP, a concentration near the K_m for polyP synthesis. Radiation target analysis revealed that the functional size for PPK phosphorylation is a tetramer (293 kDa) at 5 µM ATP, whereas the active form, as in polyP synthesis at 1 mM ATP, is a dimer (159 kDa) (Fig. 3). When degraded by ionization, purified PPK becomes a monomer (80 kDa) as determined by denaturing SDS-PAGE analysis.

View larger version (36K): [in this window] [in a new window]   Fig. 3.   Radiation inactivation of PPK autophosphorylation. A, 20 ng of irradiated PPK were separated by electrophoresis and silver stained (upper panel). A 10-µl reaction mixture containing 30 ng of irradiated PPK, PPK buffer, [32P]ATP at 5 µM (middle panel) or at 1 mM (bottom panel) was incubated on ice for 5 min, separated by electrophoresis, and then autoradiographed. B, inactivation rates for the 72-kDa PPK band (), autophosphorylation at 5 µM (), and 1 mM () ATP are fitted by linear regression constrained to the 100% intercept. The fraction of remaining intensity from at least two independent experiments is plotted as a function of absorbed dose at 63 °C.

Kinetic Mechanism of ppppG Synthesis-- The kinetic constants for ppppG synthesis and the order of substrate binding based on the initial rate as a function of both GDP and polyP concentrations in Lineweaver-Burk plots ruled out a ping-pong mechanism for Equation 4. Regression lines through the data of the reciprocal of rate (1/V) versus the reciprocal of GDP concentration and of 1/V versus the reciprocal of polyP concentration plots do not intersect on the 1/V axis (data not shown). These data were used to determine the following kinetic constants for ppppG synthesis: the K_m for GDP was 160 ± 29 µM and the k_cat (turnover number) was 28.9 ± 1.6 min¹, whereas the K_m for polyP was 35 ± 10 µM and k_cat was 62.4 ± 7.4 min¹ (Table III). The catalytic efficiencies (k_cat/K_m) were calculated to be 1782 min¹ mM¹ for polyP and 180 min¹ mM¹ for GDP (11).

To differentiate between ordered and random sequential mechanisms for ppppG synthesis (11-13), the analogs for the products, polyP₆₅ and GMP, were used in inhibition experiments. P₆₅ proved to be a competitive inhibitor of polyP₇₅₀ and of GDP, both when GDP was held constant (K_i = 7.6 ± 0.9 mM) and of GDP when polyP₇₅₀ was held constant (K_i = 1.2 ± 0.3 µM). GMP also proved to be a competitive inhibitor of both polyP₇₅₀ and GDP, both when GDP was held constant (K_i = 1.4 ± 0.3 mM) and of GDP when polyP₇₅₀ was held constant (K_i = 0.7 ± 0.09 µM). These initial-rate and product-analog inhibition studies demonstrate that ppppG synthesis at 0.2 mM MgCl₂ occurs by a rapid equilibrium, random Bi-Bi mechanism.

Generation of PPK Mutants-- The amino acid alignment of 18 prokaryotic PPK sequences demonstrates a high degree of conservation, particularly within specific regions (17% of residues overall and 69% over the 60% most homologous regions). The MEME program (14) revealed 10 motifs of the highest homology among these PPKs. Five of the six most homologous motifs occur in the 300 residues of the carboxyl terminus of E. coli PPK (amino acids ~360-687) (Fig. 4). The motif with the lowest degree of homology is located between residues ~130 and 320. 

View larger version (72K): [in this window] [in a new window]   Fig. 4.   Alignments of PPK from 18 different microorganisms show regions of high homology. The MEME program (14) was used to identify regions of over 60% conserved residues shown on the top as rectangular boxes within the 687 amino acid E. coli PPK. Arrows at residues 134, 326, and 532 indicate the locations of the deletion fragments. Numbers I-VI refer to regions with high homology, I being the highest. Underneath the alignments, * indicates identical (100% homologous) residues; : indicates more than 60% homologous residues. The phosphohistidylated site at His-454 is indicated by @. Conserved residues modified by alanine substitution site-directed mutagenesis are underlined. Abbreviations for the organisms are: E.C., E. coli (2); S.T., Salmonella typhimurium (GeneBankTM AAC 34890); K.A., Klebsiella aerogenes (33); C.C., Campylobacter coli (GeneBankTM CAA 68899); V.C., V. cholerae (GeneBankTM AAC 32883); P.A., Pseudomonas aeruginosa (36); A.C., Acinetobacter calcoaceticus (37); H.P., H. pylori (38); N.M., N. meningitidis (35); M.T., M. tuberculosis (34); M.L., Mycobacterium leprae (GeneBankTM (CAB 16451); S.C., Streptococcus coelicolor (C. Villar and A. Kornberg, unpublished data); D.R., Deinococcus radiodurans (TIGR data base); S-sp, Synechocystis 6803 (32); Y.P., Yersinia pestis (Sanger data base); C.J., Campylobacter jejuni (TIGR data base); C.T., Chlorobium tepidum (TIGR data base); P.G., Porphyromonas gingivalis (TIGR data base); D.D., Dictyostelium discoideum (M. Simms, personal communication.).

To determine the critical residues and regions within the 300-residue carboxyl terminus, site-directed mutagenesis was performed based on both sequence-homology analysis and the previous structure-function dissociation results. Initially, 46 single-site alanine-substituted mutants were constructed and verified. Four PPK activities (Equations 1-4) in these 46 mutants were assayed at least three times in a 96-well high-throughput format.² Of the 46 mutants, 34 exhibited PPK activities similar to those of the wild type. Eight mutants with activities that differed from wild type were further purified, checked by SDS-PAGE and Western blotting (data not shown), and characterized in detail (Table IV).

Properties of PPK Mutants-- Single-site mutants R375A, S380A, F488A, P507A, R564A, R621A, and Q674A lost all five PPK activities demonstrating that these amino acids are essential (Table IV). Y468A exhibited high levels (120-140%) of polyP, GTP, and ppppG synthesis and autophosphorylation activities (Equations 1 and 3-5) but diminished (20-50%) ATP synthesis activity (Equation 2). The PPK activities of the deletion mutants were also characterized in detail (Table IV). Only PPK327-687 and PPK532-687 exhibited partial polyP and ATP synthesis activities (Equations 1 and 2), suggesting that the essential fragment or domain for these functions is in the amino-terminal region.

None of deletion mutants retained GTP and ppppG synthesis activities (Equations 3 and 4) implying that these require a native structure. In addition, none of the deletion mutants underwent autophosphorylation (Equation 5), indicating that an intact native protein is also required for this activity. In mutants R564A, PPK327-687, and PPK532-687 the polyP synthesis (Equation 1) and autophosphorylation (Equation 5) activities were dissociated; R564A autophosphorylated to 20% that of the wild type but lost all four other PPK activities. PPK327-687 and PPK532-687 did not display any autophosphorylation, but retained residual (10-35%) polyP (Equation 1) and ATP (Equation 2) synthesis activities.

Mutant Y468A was examined for its NDK activity in substrate competition experiments (Fig. 5). In the presence of 1 mM ADP and 1 mM GDP, the ratio of ATP to GTP synthesis of the wild type enzyme is about 8:1, whereas for the mutant, the ratio is 1:3, and ppppG synthesis is reduced 40-fold relative to the wild type. The ratio of GTP to ppppG synthesis was also changed from 15:1 in the wild type to 25:1 in the mutant. These findings indicate that the catalytic sites of ATP and GTP synthesis are shared.

View larger version (79K): [in this window] [in a new window]   Fig. 5.   Alternation in relative ATP and GTP synthesis activities of the Y468A mutant. ADP and GDP are compared as substrates for NTP synthesis with the mutant and wild type (WT) PPKs. The enzyme (10 ng) was incubated with PPK buffer, 1 mM ATP, and varying concentrations of GDP (0-5 mM) at 37 °C for 30 min. The TLC plate was developed with 0.75 M KH2PO4 (pH 3.5) and autoradiographed.

	DISCUSSION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

PPK of E. coli has several discrete functions: the synthesis of polyP specifically from ATP, the reverse reaction to form ATP from polyP and ADP, and the substitution for ADP in the reverse reaction by GDP, CDP, and UDP, in essence a nucleoside-diphosphate kinase activity. The contribution of the reverse reactions in the disposal of polyP compared with that of exopolyphosphatase has not been determined, nor has the synthesis of GTP, CTP, and UTP as auxiliary to the activity of the major nucleoside-diphosphate kinase activity been evaluated. In addition to these activities, PPK autophosphorylates certain histidine residues to generate a putative intermediate and also catalyzes the transfer of a pyrophosphoryl group to GDP to generate the linear ppppG.

The aforementioned activities of PPK can be distinguished by several agents, such as the optimal concentration of Mg²⁺ and the effects of guanidine-HCl and inorganic pyrophosphate (Table II). Inasmuch as the native state of PPK is that of a tetramer of 80-kDa subunits, these distinctive effects may depend in part on its oligomeric state. To this end, the subunit structure of the oligomer for each of the five activities was determined by radiation target analysis.

Radiation inactivation of an enzyme activity has been used to measure the target size of the functional unit (9, 10). The dosage of the -rays, generated by ⁶⁰Co required to inactivate a number of enzymes of known size (e.g. glucose-6-phosphate dehydrogenase), provides a scale that can be used to measure the functional size of another enzyme activity. With regard to PPK, the dimeric state best fits the functional size of the forward and reverse activities (Table III; Fig. 2, A and B); the tetrameric state appears to be optimal for autophosphorylation at 5 µM ATP, but the dimer is preferred at 1 mM ATP, the concentration needed for the forward and reverse reactions (Table II; Fig. 3, A and B). The functional size for the ppppG synthesis activity is judged to be a trimer (Table II; Fig. 2, A and C) as indicated by the increase in activity as the tetramer is inactivated and the rate of subsequent decay of activity, consistent with the size of a trimer.

The PPK of Propionibacterium shermanii like that of E. coli PPK has a subunit mass of 83 kDa and synthesizes polyP processively to a limit of about 750 residues, but unlike E. coli PPK appears to be monomeric (15, 16). However, the glucokinase of P. shermanii, which utilizes polyP to phosphorylate glucose, is a homodimer of 33-kDa subunits (17) by either processive (polyP₇₀₀) or nonprocessive (polyP₃₀) mechanisms (18). In M. tuberculosis, polyP glucokinase utilizes the long-chain polyP nonprocessively by an ordered Bi-Bi mechanism (13).

The amino acid sequences of NDKs are highly conserved between E. coli and humans (43% identity) and are believed to be essential for DNA and RNA synthesis (19), as well as for bacterial growth, virulence, cell-signaling, and polysaccharide synthesis (20). Pyruvate kinase (21) and adenylate kinase (22) may also function as NDKs in E. coli. Inasmuch as knockout mutants of E. coli (ndk- and ndk-/pyk-) are still viable (23), PPK by utilizing polyP may provide a backup function as an NDK in vivo.

The capacity of PPK to catalyze the attack by GDP on a subterminal linkage of polyP generates ppppG. The activity predominates over the GDP attack on the terminal linkage when the Mg²⁺ concentration is at the low level of 0.2 mM and inorganic pyrophosphate is present. Such a pyrophosphoryl transfer was not observed with ADP. Unlike the forward and reverse reactions, which are highly processive, the synthesis of ppppG is distributive (Fig. 1) and occurs by a rapid equilibrium, random Bi-Bi mechanism (Table III). In yeast, ppppG can be generated by phosphoglycerate kinase (24) and digested by an exopolyphosphatase (25); ppppG can also stimulate mammalian adenylate cyclase (26). However, unlike ppGpp for which regulatory roles are established (27-30), the cellular presence of ppppG and its functions are unknown.

The availability of high copy number plasmids bearing the ppk gene and His tags for PPK should attract proper structural studies of the enzyme to account for its multiple functions. In the meantime, we have carried out some mutational studies and also examined some other bacterial PPKs for comparison with the E. coli enzyme.

Site-directed mutagenesis was focused on regions where the amino acid alignments of 18 bacterial PPK sequence show a high degree of conservation. Alanine substitutions at 46 sites were made in five of the six most homologous regions (over 60% identity) that make up the 300 residues at the carboxyl end (360-687). Among these, the PPKs isolated from several of them showed a virtual loss of all five activities. However, in one mutant (Y468A) all the activity levels were enhanced except for the synthesis of ATP, which was diminished. Thus, the active site, altered at this residue, discriminates against GDP far less than in the wild type. Mutants in which 100 or more residues were deleted at the amino- and carboxyl-terminal ends, as well as in between (Fig. 4) retained no significant levels of any of the activities. Efforts to separate the functional domains of PPK by proteolytic digestion were not successful. Individual peptides of PPK generated by treatment with trypsin were isolated by fast protein liquid chromatography and high pressure liquid chromatography, but none contained any of the five PPK activities, although low levels were detected in pools of the digests.

The PPKs of H. pylori and Vibrio cholerae have been purified and characterized as homotetramers.^2,3 They also generate polyP with about 750 residues and behave much like that of E. coli PPK. However, The k_cat/K_m of the reverse activity of both PPKs was near 100 times greater than that of E. coli PPK, suggesting that PPK in H. pylori and V. cholerae may play more important roles in generating ATP from polyP.

PPKs, partially purified from N. meningitidis and P. shermanii, were reported to have masses of 72 and 83 kDa, respectively, as determined by SDS-PAGE. The values for K_m (1.5-2.0 mM) and turnover number (40-60/subunit/second), calculated from the efficiency and yield of the purification, are similar to those published for E. coli. Those enzymes also appeared to be attached to cell membranes (31). An E. coli overproducer of PPK and an isopropyl-1-thio--D-galactopyranoside-induced, overexpressed His-tagged PPK are now available for crystallography to explore structure-function relationships.

	ACKNOWLEDGEMENTS

We thank Dr. Rong-Long Pan for providing the ⁶⁰Co radiation apparatus, Dr. Cresson D. Fraley and Leroy Bertsch for critical evaluation of the manuscript, and Dr. Sung-Kay Chiu, Dr. Nobuo Ogawa, and Dr. Dana Ault-Riché for helpful discussions during this study.

	FOOTNOTES

^* This work was supported by Grant GM07581-38 from the National Institutes of Health.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

To whom correspondence should be addressed. Tel.: 650-723-6167; Fax: 650-723-6783; E-mail: akornber@cmgm.stanford.edu.

² C. M. Tzeng and A. Kornberg, unpublished data.

³ N. Ogawa and A. Kornberg, unpublished results.

	ABBREVIATIONS

The abbreviations used are: polyP, polyphosphate; PPK, polyphosphate kinase; ppppG, guanosine tetraphosphate; PAGE, polyacrylamide gel electrophoresis; kb, kilobase(s); NDK, nucleoside-diphosphate kinase; Mrad, megarad; G6PDHase, glucose-6-phosphate dehydrogenase.

	REFERENCES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

CiteULike

Complore

Connotea

Del.icio.us

Digg

Reddit

Technorati

This article has been cited by other articles:

				C. D. Fraley, M. H. Rashid, S. S. K. Lee, R. Gottschalk, J. Harrison, P. J. Wood, M. R. W. Brown, and A. Kornberg A polyphosphate kinase 1 (ppk1) mutant of Pseudomonas aeruginosa exhibits multiple ultrastructural and functional defects PNAS, February 27, 2007; 104(9): 3526 - 3531. [Abstract] [Full Text] [PDF]

				S. Ghorbel, A. Smirnov, H. Chouayekh, B. Sperandio, C. Esnault, J. Kormanec, and M.-J. Virolle Regulation of ppk Expression and In Vivo Function of Ppk in Streptomyces lividans TK24. J. Bacteriol., September 1, 2006; 188(17): 6269 - 6276. [Abstract] [Full Text] [PDF]

				W. Chen, R. J. Palmer, and H. K. Kuramitsu Role of Polyphosphate Kinase in Biofilm Formation by Porphyromonas gingivalis Infect. Immun., August 1, 2002; 70(8): 4708 - 4715. [Abstract] [Full Text] [PDF]

				K. Stephenson and J. A. Hoch PAS-A domain of phosphorelay sensor kinase A: A catalytic ATP-binding domain involved in the initiation of development in Bacillus subtilis PNAS, November 29, 2001; (2001) 251408398. [Abstract] [Full Text] [PDF]

				S. Cardona, F. Remonsellez, N. Guiliani, and C. A. Jerez The Glycogen-Bound Polyphosphate Kinase from Sulfolobus acidocaldarius Is Actually a Glycogen Synthase Appl. Envir. Microbiol., October 1, 2001; 67(10): 4773 - 4780. [Abstract] [Full Text]

				N. Ogawa, C.-M. Tzeng, C. D. Fraley, and A. Kornberg Inorganic Polyphosphate in Vibrio cholerae: Genetic, Biochemical, and Physiologic Features J. Bacteriol., December 1, 2000; 182(23): 6687 - 6693. [Abstract] [Full Text]

				W. H. Faour, Y. He, Q. W. He, M. de Ladurantaye, M. Quintero, A. Mancini, and J. A. Di Battista Prostaglandin E2 Regulates the Level and Stability of Cyclooxygenase-2 mRNA through Activation of p38 Mitogen-activated Protein Kinase in Interleukin-1beta -treated Human Synovial Fibroblasts J. Biol. Chem., August 17, 2001; 276(34): 31720 - 31731. [Abstract] [Full Text] [PDF]

				K. Stephenson and J. A. Hoch PAS-A domain of phosphorelay sensor kinase A: A catalytic ATP-binding domain involved in the initiation of development in Bacillus subtilis PNAS, December 18, 2001; 98(26): 15251 - 15256. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted