|
|
|
|||||||
|
|||||||||
J Biol Chem, Vol. 275, Issue 7, 4541-4544, February 18, 2000
From the T lymphocyte activation is highlighted by the
induction of interleukin-2 (IL-2) gene expression, which governs much
of the early lymphocyte proliferation responses. Peroxisome
proliferator-activated receptor- T-cell activation is a key step in the initiation of an
immunological response. An activating stimulus initiates a complex signaling cascade, resulting in cell proliferation and secretion of
cytokines that enhance the immune response (1, 2). Interleukin-2 (IL-2)1 plays a key role in
controlling T-cell proliferation, and consequently, numerous studies
have focused on understanding IL-2 gene regulation (2). Peroxisome
proliferator-activated receptors (PPARs) are transcription factors and
members of the nuclear receptor superfamily (3). To date, three
different PPARs, named PPAR Cell Culture--
Fresh human peripheral blood T lymphocytes
obtained from normal healthy donors (10) and Jurkat T cells were
maintained as described (9, 10).
Proliferation Assays--
T cells (5 × 104/well) were plated in 96-well microtiter plates in the
presence or absence of PHA (1 µg/ml). Cells were treated for 72 h with troglitazone (Parke-Davis), 15d-PGJ2 (Calbiochem), or Wy14643 (Biomol) and pulsed for the remaining 4 h of the assay with [3H]thymidine (0.5 µCi/200 µl). The
incorporation was analyzed by liquid scintillation counting.
IL-2 Measured by ELISA--
T cells were grown to approximately
2.5 × 106 cells/ml and treated with PHA/PMA in the
presence or absence of the different ligands. Cell supernatants were
collected and assayed for human IL-2 using Endogen kits (Wolburn).
Electrophoretic Mobility Shift Assay (EMSA)--
The
sequences of the oligonucleotides (5' to 3') used as probes were
AATTGGAGGAAAAACTGTTTCATACAGAAGGCGT (NFATwt),
AATTGGACCTCCCACTGTTTCATACAGAAGGCGT (NFATmt), and
ATTGGATCGGGGCGG GGCGAGC (Sp-1). The EMSA was performed as
described (11).
Ribonuclease Protection Assays--
Total RNA was isolated using
TriZOL (Life Technologies, Inc.) and a RNase protection assay was
performed as described (11). 20 µg of RNA was hybridized with
33P-labeled probes corresponding to IL-2 (Pharmingen).
Transient Transfection--
Transient transfections of Jurkat T
cells were performed using DEAE-dextran methods (11). After 24 h
of transfection, cells were treated with or without different ligands
for an additional 24 h in the presence or absence of PHA/PMA.
Flow Cytometry and Sterile Cell Sorting--
Cell sorting for
green fluorescent protein (GFP) and propidium iodide fluorescence were
performed (12) using a FACStar Plus (Becton Dickinson, San Jose, CA)
with INNOVA 70-4 argon laser.
Luciferase Assays--
The transfected cells were pelleted,
lysed, and measured by a luminometer (Monolight 3010, Pharmingen)
according to the manufacturer's instruction.
Co-immunoprecipitation Assays--
Cells were lysed in 10 mM HEPES (pH 7.9), 1.5 mM MgCl2, 10 mM KCl, and 0.5% Nonidet P-40. Immunoprecipitation was
carried out using polyclonal anti-PPAR To determine whether PPAR Because the induction of IL-2 gene expression is a pivotal event in
early T lymphocyte activation, we next performed RNase protection
assays of human peripheral blood T cells stimulated with PHA/PMA in the
presence or absence of troglitazone or 15d-PGJ2. Total RNA
was isolated and probed for IL-2 mRNA. As shown in Fig. 1C, IL-2 mRNA steady-state levels were detected as early
as 6 h and strongly increased after 12 h of PHA/PMA
stimulation. Treatment with troglitazone or 15d-PGJ2
totally abrogated expression of IL-2 mRNA. The quantification of
decreased IL-2 mRNA levels was performed by normalizing
densitometric traces against L32 mRNA. The IL-2 transcript was
reduced by greater than 90% as compared with controls, suggesting that
PPAR Because transfection efficiency of circulating human T cells is very
poor, we chose to use the human T cell line Jurkat that expresses
little detectable PPAR
ACCELERATED PUBLICATION
Activation of Human T Lymphocytes Is Inhibited by Peroxisome
Proliferator-activated Receptor 
(PPAR) Agonists
PPAR
CO-ASSOCIATION WITH TRANSCRIPTION FACTOR NFAT*
,,,, and
Intramural Research Support Program, SAIC
Frederick and the § Cytokine Molecular Mechanisms Section,
Laboratory of Molecular Immunoregulation, NCI-Frederick Cancer Research
and Development Center and the ¶ ABL-Basic Research Program, NCI,
National Institutes of Health, Frederick, Maryland 21702
ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS AND DISCUSSION
REFERENCES
(PPAR) is a member of the
nuclear receptor superfamily of ligand-activated transcription factors.
PPAR mRNA expression was found in human peripheral blood T
lymphocytes, raising the possibility of PPAR involvement in the
regulation of T cell function. Here we show that PPAR ligands,
troglitazone and 15-deoxy-
12,14 prostaglandin
J2, but not PPAR
agonist Wy14643, inhibited IL-2 production and phytohemagglutinin-inducible proliferation in human peripheral blood T-cells in a dose-dependent manner. This
inhibitory effect on IL-2 was restricted to the PPAR2-expressing,
not the PPAR-lacking, subpopulation of transfected Jurkat cells. The activated PPAR physically associates with transcriptional factor NFAT regulating the IL-2 promoter, blocking NFAT DNA binding and transcriptional activity. This interaction with T-cell-specific transcription factors indicates an important immunomodulatory role for
PPAR in T lymphocytes and could suggest a previously unrecognized
clinical potential for PPAR ligands as immunotherapeutic drugs to
treat T-cell-mediated diseases by targeting IL-2 gene expression.
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS AND DISCUSSION
REFERENCES
, PPAR
, and PPAR, have been
identified in mammalian cells. PPAR is primarily involved in the
regulation of genes related to lipid metabolism and plays a role in
adipocyte differentiation (4, 5). However, in higher organisms, the
widespread tissue distribution of PPAR (6) suggests an involvement
of the nuclear receptor in multiple biological processes. Recent
findings have indicated that PPAR is a negative regulator of
macrophage activation and inhibits production of monocyte inflammatory
cytokines (7, 8). It is well known that the activation of T lymphocytes
is much different from monocytes because it proceeds by the initial
activation of transcription factors that ultimately fulfill the
biological amplification of the immune response. Although PPAR
mRNA is expressed in human peripheral blood T lymphocytes (9),
nothing is known about the physiologic regulation of PPAR in T-cell
activation. Here we demonstrate that the activated PPAR physically
associates with the T-cell specific transcriptional factor NFAT and
blocks NFAT DNA binding and transcriptional activity. Ultimately, the transcription and production of the vital T-cell cytokine IL-2 is blocked.
EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS AND DISCUSSION
REFERENCES
antibodies (Santa Cruz).
Western blot was performed as described (11).
RESULTS AND DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS AND DISCUSSION
REFERENCES
interferes with T lymphocyte
activation, we investigated the effect of the PPAR ligands on
PHA-mediated T-cell proliferation and IL-2 production. Human peripheral
blood T cells were stimulated by PHA and cultured with various
concentrations of different ligands for 72 h. As shown in Fig.
1A, the specific PPAR
agonist of the thiazolidinedione family, troglitazone (13), completely
abolished PHA-inducible [3H]thymidine incorporation in a
dose-dependent manner. Similar effects were observed in the
presence of 15d-PGJ2 (14), which is a natural PPAR
ligand. By contrast, the PPAR-specific ligand Wy14643 did not
inhibit PHA-mediated T-cell proliferation. Furthermore, PHA/PMA-induced
IL-2 synthesis assayed by ELISA was also restricted by the co-addition
of troglitazone or 15d-PGJ2 in a dose-dependent manner (Fig. 1B).
View larger version (20K):
[in a new window]
Fig. 1.
Inhibition of PHA-induced proliferation and
IL-2 production by PPAR ligands in human T
cell. A, PHA-induced cell proliferation is inhibited by
troglitazone (
) or 15d-PGJ2 (
), but not by Wy14643
(
), in human peripheral blood T cells in dose-dependent
manner. The incorporation of [3H]thymidine was plotted on
the abscissa expressed as total counts/min
(n = 6). B, troglitazone and
15d-PGJ2, but not Wy14643, inhibit PHA/PMA-mediated
induction of IL-2 in human T cells. Freshly prepared human T cells were
incubated in medium containing PHA/PMA and ligands for 12 h. The
concentration of IL-2 released into the medium was determined by ELISA.
Error bars show mean ± S.D. of the three
determinations. 
, 
PHA/PMA; , +PHA/PMA. C, PPAR
ligands inhibit PHA/PMA-inducible IL-2 mRNA expression in human T
cells. Cells were stimulated by PHA/PMA and treated with troglitazone
(25 µM), 15d-PGJ2 (10 µM), or
dimethyl sulfoxide. Total RNA was isolated and subjected to analysis by
RNase protection assay for expression of human IL-2 or L32 control
genes using 33P-labeled probe.
ligands blocked transcription of the IL-2 gene.
mRNA (9) as a model system to directly
assess the actual role of PPAR expression in the PPAR
ligand-induced inhibitory effects on T lymphocyte activation. The
Jurkat cells were transfected with PPAR2 wild type expression vector
(pSG5hPPAR2) (15) or control pSG5 plasmid. For this study, we used
GFP as a cotransfected biomarker to simplify the selection of
transfected target cells (13) by FACS sorting and assay for IL-2
production. As shown in Fig.
2A, PPAR ligands troglitazone and 15d-PGJ2 inhibited IL-2 production only in
the PPAR2-expressing, but not in PPAR2-nonexpressing,
subpopulation of transfected Jurkat cells. Interestingly, Wy14643 did
not also show this inhibitory effect. Thus, from the data presented, it is clear that such inhibitory effects on T-cell activation are mediated
by PPAR.
View larger version (17K):
[in a new window]
Fig. 2.
Troglitazone and 15d-PGJ2 inhibit
transcription and production of IL-2 in transfected Jurkat T cells in a
PPAR -dependent manner.
A, Jurkat cells were transfected with either control vector
(pSG5) or PPAR2 wild type expression vector (pSG5hPPAR2) and
co-transfected with pEGFPC1 plasmid. Transfected target cells were
sorted by FACS and then assayed for IL-2 production. B,
upper panel, Jurkat cells were co-transfected with a
PPAR-expression plasmid (+PPAR2) or control
DNA (PPAR2) and a PPRE reporter gene
(AOx-TK). Cells were treated with 15d-PGJ2 or troglitazone
for an additional 24 h. The luciferase activity was determined.
Lower panel, Jurkat cells were co-transfected with an IL-2
promoter-luciferase reporter plasmid and a PPAR expression plasmid
(+PPAR) or control DNA (PPAR). Cells were treated with ligands,
stimulated by PHA/PMA, and collected for analysis of reporter gene
activity 24 h later.
To verify that the human PPAR2 cDNA is capable of activating
gene transcription through a PPRE in human T cells, we introduced a
PPAR2 expression vector (pSG5hPPAR2) together with a PPRE-driven luciferase reporter construct (AOx-TK) (14) into Jurkat T cells. Fig.
2B (upper panel) shows that activation of a
PPAR-dependent promoter required co-expression of PPAR
in Jurkat T cells. Upon addition of the PPAR ligand troglitazone or
15d-PGJ2, luciferase activity was significantly increased
corresponding to overexpression of PPAR. To determine whether
changes in IL-2 mRNA levels can be ascribed, at least in part, to
differences in promoter activity, Jurkat T cells were co-transfected
with IL-2 luciferase reporter constructs and a PPAR expression
plasmid. PMA/PHA treatment resulted in a marked increase in IL-2
promoter activity. Lack of PPAR expression rendered the Jurkat cells
unresponsive to the inhibitory effects of troglitazone and
15d-PGJ2 on PHA/PMA-induced IL-2 promoter activation (Fig.
2B, lower panel). However, this effect was
restored by transfection of PPAR. These data suggest that the
inhibitory effects of troglitazone and 15d-PGJ2 on IL-2
promoter activity are directly dependent on the expression and
activation of PPAR.
The transcription factor NFAT plays an essential role in IL-2
gene expression. NF-ATc1 is also involved in the proliferation of
peripheral T lymphocytes (16). Therefore, we evaluated transcriptional activity and DNA binding of NFAT to determine whether NFAT might be a
target for negative regulation of T-cell activation by PPAR ligands.
As shown in Fig. 3A, the
specific binding of NFAT probe corresponding to the human IL-2 promoter
is strongly induced by PHA/PMA, whereas equivalent nuclear extracts
from troglitazone- or 15d-PGJ2-treated cells displayed
diminished binding capacity to the 32P-radiolabeled probes.
Moreover, the inhibitory effect of PPAR ligands on NF-
B and AP-1
DNA-binding activities was also observed in T cells activated by
PHA/PMA (data not shown). In contrast, the DNA binding of Sp-1 (17) was
unaffected by troglitazone and 15d-PGJ2 (Fig.
3B). The EMSA data obtained correlated with the effect of
PPAR ligands on the transcriptional activity analyzed by a reporter
construct directed by the NFAT distal site of the IL-2 promoter. The
transcriptional activation of the above reporter construct was
abrogated by troglitazone or 15d-PGJ2 in the presence of
PPAR overexpression (Fig. 3C). Thus, one conceivable
explanation for the repression of IL-2 transcription in troglitazone-
or 15d-PGJ2-treated cells could be due to selective
disruption of the transcriptional regulation of the IL-2 promoter.
|
Next we focused our attention on how functional co-association of
PPAR with transcription factors NFAT might mediate T-cell suppression. We tested for complex formation between PPAR and NFAT in a co-immunoprecipitation experiment. Fresh human peripheral blood T cells were induced by PMA/PHA and treated with troglitazone or
15d-PGJ2. Cell extracts were prepared and
immunoprecipitated with a PPAR-specific antibody; immunoprecipitates
were developed on Western blots with an NFATc1-specific antibody. As
shown in Fig. 4, The NFATc1 complex can
be co-precipitated with PPAR in cells induced by PMA/PHA and
troglitazone or 15d-PGJ2. Furthermore, the addition of
anti-PPAR antibody induced high affinity binding of extracts to the
NFAT probes as determined by EMSA (data not shown), demonstrating that
removal of PPAR with this antiserum increases the target specificity
of NFAT. These data indicate that a direct physical protein-protein
interaction occurs between nuclear receptor PPAR and transcription
factors NFAT.
|
Recent studies have provided insights into the mechanisms by which
steroid nuclear receptors regulate cytokine genes (18). Corticosteroids
may bind directly as a dimer to regulatory sequences (GRE) in target
gene promoters and subsequently affect activation of transcription.
Dexamethasone has also been shown to inhibit the IL-2 promoter by
interference with AP-1. The current model of dexamethasone inhibition
has demonstrated a physical interaction between corticosteroid receptor
and NF-B. In the case of PPAR, a non-steroid nuclear receptor, it
has been reported that PPAR agonists specifically inhibit expression
of tumor necrosis factor through inhibition of tumor necrosis
factor promoter activity in monocytes (9). However, no physical
co-precipitation of PPAR with other transcription factors was shown.
The data presented here demonstrate that PPAR ligands suppress
transactivation of IL-2 via down-regulation of the IL-2 promoter in a
PPAR-dependent manner. The transcriptional regulation of
the IL-2 gene has been analyzed extensively at the level of the IL-2
promoter. cis-Acting elements for several transcription
factors have been identified within this regulatory region. The factors
that bind to these motifs include NFAT, AP-1, and NF-B proteins.
Also, a binding site for Sp-1 has been identified immediately upstream
of the distal NFAT site. Our data show that PPAR ligands selectively block DNA binding and transcriptional activation of transcription factors such as NFAT regulating the IL-2 promoter in T cells.
From our data, PPAR down-regulates the IL-2 promoter by a novel
mechanism that involves protein-protein interactions. As shown in Fig.
4, formation of a molecular complex between PPAR and NFAT may occur
in T cells, which could block PHA/PMA-induced DNA binding and
transactivation. Although we have focused on the interaction between
NFAT and PPAR, we cannot exclude the possibility that PPAR
interaction with AP-1 or NF-B may also play an important role in
blocking IL-2 gene transcription. However, activation and function of
NFAT is an absolute requirement for IL-2 transcription.
Taken together, these data provided the evidence that the inhibitory
role of PPAR in the immunomodulation of T lymphocytes is based on
functional interaction between PPAR and T-cell-specific transcription factors. Such a model could highlight the importance of
transcriptional cross-talk in T-cell biology and may lead to a new
molecular class of immunomodulators. PPAR ligands may be of
therapeutic value in human T-cell-mediated diseases by targeting IL-2
gene expression.
| |
ACKNOWLEDGEMENTS |
|---|
We are very grateful to G. Crabtree, R. Evans, M. Lazar, B. Seed, A. Elbrecht, N. Rice, and R. Kehlenbach for providing us with critical plasmids that made this work possible. We also acknowledge Dr. Joost Oppenheim for his critical review of the manuscript.
| |
FOOTNOTES |
|---|
* This project has been funded in whole or in part with Federal funds from the NCI, National Institutes of Health, under Contract NO1-CO-56000 and sponsored in part by the NCI, Department of Health and Human Services, under a contract with ABL.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
To whom correspondence should be addressed: National Cancer
Institute, P.O. Box B, Bldg. 560, Rm. 31-76, Frederick, MD 21702. Tel.:
301-846-1503; Fax: 301-846-6019; E-mail:
farrar@mail.ncifcrf.gov.
| |
ABBREVIATIONS |
|---|
The abbreviations used are:
IL-2, interleukin-2;
PPAR, peroxisome proliferator-activated receptor;
GFP, green
fluorescent protein;
EMSA, electrophoretic mobility shift assay;
NFAT, nuclear factor of activated T cells;
FACS, fluorescence-activated cell
sorter;
AP-1, activator protein-1;
NF-B, nuclear factor- binding;
PHA, phytohemagglutinin;
PMA, phorbol 12-myristate 13-acetate;
ELISA, enzyme-linked immunosorbent assay;
PPRE, PPAR response
elements.
| |
REFERENCES |
|---|
|
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS AND DISCUSSION
REFERENCES
|
|---|
| 1. |
Crabtree, G. R.
(1989)
Science
243,
355-361 |
| 2. | Jain, J., Loh, C., and Rao, A. (1995) Curr. Opin. Immunol. 7, 333-342[CrossRef][Medline] [Order article via Infotrieve] |
| 3. | Schoonjans, K., Martin, G., Staels, B., and Auwerx, J. (1997) Curr. Opin. Lipidol. 8, 159-166[Medline] [Order article via Infotrieve] |
| 4. | Brun, R. P., Kim, J. B., Hu, E., and Spiegelman, B. M. (1997) Curr. Opin. Lipidol. 8, 212-218[Medline] [Order article via Infotrieve] |
| 5. | Lemberger, T., Desvergne, B., and Wahli, W. (1996) Annu. Rev. Cell Dev. Biol. 12, 335-363[CrossRef][Medline] [Order article via Infotrieve] |
| 6. | Spiegelman, B. M. (1998) Cell 93, 153-155[CrossRef][Medline] [Order article via Infotrieve] |
| 7. | Ricote, M., Li, A. C., Willson, T. M., Kelly, C. J., and Glass, C. K. (1998) Nature 391, 79-82[CrossRef][Medline] [Order article via Infotrieve] |
| 8. | Jiang, C., Ting, A. T., and Seed, B. (1998) Nature 391, 82-86[CrossRef][Medline] [Order article via Infotrieve] |
| 9. | Greene, M. E., Blumberg, B., McBride, O. W., Yi, H. F., Kronquist, K., Kwan, K., Hsieh, L., Greene, G., and Nimer, S. D. (1995) Gene Expr. 4, 281-299[Medline] [Order article via Infotrieve] |
| 10. |
Evans, G. A,
Garcia, G. G.,
Erwin, R.,
Howard, O. M.,
and Farrar, W. L.
(1994)
J. Biol. Chem.
269,
23407-23412 |
| 11. |
Wang, L. H.,
Kirken, R. A.,
Erwin, R. A., Yu, C. R.,
and Farrar, W. L.
(1999)
J. Immunol.
162,
3897-3904 |
| 12. |
Chen, R.,
Greene, E. L.,
Collinsworth, G.,
Grewal, J. S.,
Houghton, O.,
Zeng, H.,
Garnovskaya, M.,
Paul, R. V.,
and Raymond, J. R.
(1999)
Am. J. Physiol.
276,
F777-F785 |
| 13. | Sarraf, P., Mueller, E., Smith, W. M., Wright, H. M., Kum, J. B., Aaltonen, L. A., de la Chapelle, A., Spiegelman, B. M., and Eng, C. (1999) Mol. Cell 3, 799-804[CrossRef][Medline] [Order article via Infotrieve] |
| 14. | Forman, B. M., Tontonoz, P., Chen, J., Brun, R. P., Spiegelman, B. M., and Evans, R. M. (1995) Cell 83, 803-812[CrossRef][Medline] [Order article via Infotrieve] |
| 15. | Elbrecht, A., Elbrecht, A., Chen, Y., Cullinan, C. A., Hayes, N., Leibowitz, M., Moller, D. E., and Berger, J. (1996) Biochem. Biophys. Res. Commun. 224, 431-437[CrossRef][Medline] [Order article via Infotrieve] |
| 16. | Rao, A., Luo, C., and Hogan, P. G. (1997) Annu. Rev. Immunol. 15, 707-747[CrossRef][Medline] [Order article via Infotrieve] |
| 17. |
Skerka, C.,
Decker, E. L.,
and Zipfel, P. F.
(1995)
J. Biol. Chem.
270,
22500-22506 |
| 18. | Gottlicher, M., Heck, S., and Herrlich, P. (1998) J. Mol. Med. 76, 480-489[CrossRef][Medline] [Order article via Infotrieve] |
Copyright © 2000 by The American Society for Biochemistry and Molecular Biology, Inc.
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati What's this?
This article has been cited by other articles:
|
|
 |
|
  L. Klotz, S. Hucke, D. Thimm, S. Classen, A. Gaarz, J. Schultze, F. Edenhofer, C. Kurts, T. Klockgether, A. Limmer, et al. Increased Antigen Cross-Presentation but Impaired Cross-Priming after Activation of Peroxisome Proliferator-Activated Receptor {gamma} Is Mediated by Up-Regulation of B7H1 J. Immunol., July 1, 2009; 183(1): 129 - 136. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R Marion-Letellier, P Dechelotte, M Iacucci, and S Ghosh Dietary modulation of peroxisome proliferator-activated receptor gamma Gut, April 1, 2009; 58(4): 586 - 593. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. R. Gocke, R. Z. Hussain, Y. Yang, H. Peng, J. Weiner, L.-H. Ben, P. D. Drew, O. Stuve, A. E. Lovett-Racke, and M. K. Racke Transcriptional Modulation of the Immune Response by Peroxisome Proliferator-Activated Receptor-{alpha} Agonists in Autoimmune Disease J. Immunol., April 1, 2009; 182(7): 4479 - 4487. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. M. Garcia-Bates, S. H. Bernstein, and R. P. Phipps Peroxisome Proliferator-Activated Receptor {gamma} Overexpression Suppresses Growth and Induces Apoptosis in Human Multiple Myeloma Cells Clin. Cancer Res., October 15, 2008; 14(20): 6414 - 6425. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Collino, N. S.A. Patel, and C. Thiemermann Review: PPARs as new therapeutic targets for the treatment of cerebral ischemia/reperfusion injury Therapeutic Advances in Cardiovascular Disease, June 1, 2008; 2(3): 179 - 197. [Abstract] [PDF]
|
|
|
|
 |
|
 C. Fionda, F. Nappi, M. Piccoli, L. Frati, A. Santoni, and M. Cippitelli Inhibition of Trail Gene Expression by Cyclopentenonic Prostaglandin 15-Deoxy-{Delta}12,14-Prostaglandin J2 in T Lymphocytes Mol. Pharmacol., November 1, 2007; 72(5): 1246 - 1257. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Fionda, F. Nappi, M. Piccoli, L. Frati, A. Santoni, and M. Cippitelli 15-Deoxy-{Delta}12,14-Prostaglandin J2 Negatively Regulates rankl Gene Expression in Activated T Lymphocytes: Role of NF-{kappa}B and Early Growth Response Transcription Factors J. Immunol., April 1, 2007; 178(7): 4039 - 4050. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Ohga, K. Shikata, K. Yozai, S. Okada, D. Ogawa, H. Usui, J. Wada, Y. Shikata, and H. Makino Thiazolidinedione ameliorates renal injury in experimental diabetic rats through anti-inflammatory effects mediated by inhibition of NF-{kappa}B activation Am J Physiol Renal Physiol, April 1, 2007; 292(4): F1141 - F1150. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Klotz, I. Dani, F. Edenhofer, L. Nolden, B. Evert, B. Paul, W. Kolanus, T. Klockgether, P. Knolle, and L. Diehl Peroxisome Proliferator-Activated Receptor {gamma} Control of Dendritic Cell Function Contributes to Development of CD4+ T Cell Anergy J. Immunol., February 15, 2007; 178(4): 2122 - 2131. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. S. Lee, S. J. Park, S. R. Kim, K. H. Min, S. M. Jin, H. K. Lee, and Y. C. Lee Modulation of Airway Remodeling and Airway Inflammation by Peroxisome Proliferator-Activated Receptor {gamma} in a Murine Model of Toluene Diisocyanate-Induced Asthma J. Immunol., October 15, 2006; 177(8): 5248 - 5257. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S.-H. Jo, C. Yang, Q. Miao, M. Marzec, M. A. Wasik, P. Lu, and Y. L. Wang Peroxisome Proliferator-Activated Receptor {gamma} Promotes Lymphocyte Survival through Its Actions on Cellular Metabolic Activities J. Immunol., September 15, 2006; 177(6): 3737 - 3745. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 X. Yu, P. A. Egner, J. Wakabayashi, N. Wakabayashi, M. Yamamoto, and T. W. Kensler Nrf2-mediated Induction of Cytoprotective Enzymes by 15-Deoxy-{Delta}12,14-Prostaglandin J2 Is Attenuated by Alkenal/one Oxidoreductase J. Biol. Chem., September 8, 2006; 281(36): 26245 - 26252. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L Dubuquoy, C Rousseaux, X Thuru, L Peyrin-Biroulet, O Romano, P Chavatte, M Chamaillard, and P Desreumaux PPAR{gamma} as a new therapeutic target in inflammatory bowel diseases. Gut, September 1, 2006; 55(9): 1341 - 1349. [Full Text] [PDF]
|
|
|
|
 |
|
 A. Yessoufou, A. Hichami, P. Besnard, K. Moutairou, and N. A. Khan Peroxisome Proliferator-Activated Receptor {alpha} Deficiency Increases the Risk of Maternal Abortion and Neonatal Mortality in Murine Pregnancy with or without Diabetes Mellitus: Modulation of T Cell Differentiation Endocrinology, September 1, 2006; 147(9): 4410 - 4418. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M Adachi, R Kurotani, K Morimura, Y Shah, M Sanford, B B Madison, D L Gumucio, H E Marin, J M Peters, H A Young, et al. Peroxisome proliferator activated receptor {gamma} in colonic epithelial cells protects against experimental inflammatory bowel disease Gut, August 1, 2006; 55(8): 1104 - 1113. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. E. Rockwell, N. T. Snider, J. T. Thompson, J. P. Vanden Heuvel, and N. E. Kaminski Interleukin-2 Suppression by 2-Arachidonyl Glycerol Is Mediated through Peroxisome Proliferator-Activated Receptor {gamma} Independently of Cannabinoid Receptors 1 and 2 Mol. Pharmacol., July 1, 2006; 70(1): 101 - 111. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. Kosuge, G. Haraguchi, N. Koga, Y. Maejima, J.-i. Suzuki, and M. Isobe Pioglitazone Prevents Acute and Chronic Cardiac Allograft Rejection Circulation, June 6, 2006; 113(22): 2613 - 2622. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. J Deckelbaum, T. S Worgall, and T. Seo n-3 Fatty acids and gene expression Am. J. Clinical Nutrition, June 1, 2006; 83(6): S1520 - 1525S. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. G. Trivedi, J. Newson, R. Rajakariar, T. S. Jacques, R. Hannon, Y. Kanaoka, N. Eguchi, P. Colville-Nash, and D. W. Gilroy Essential role for hematopoietic prostaglandin D2 synthase in the control of delayed type hypersensitivity PNAS, March 28, 2006; 103(13): 5179 - 5184. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. K. Racke, A. R. Gocke, M. Muir, A. Diab, P. D. Drew, and A. E. Lovett-Racke Nuclear Receptors and Autoimmune Disease: The Potential of PPAR Agonists to Treat Multiple Sclerosis J. Nutr., March 1, 2006; 136(3): 700 - 703. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Klotz, M. Schmidt, T. Giese, M. Sastre, P. Knolle, T. Klockgether, and M. T. Heneka Proinflammatory Stimulation and Pioglitazone Treatment Regulate Peroxisome Proliferator-Activated Receptor {gamma} Levels in Peripheral Blood Mononuclear Cells from Healthy Controls and Multiple Sclerosis Patients J. Immunol., October 15, 2005; 175(8): 4948 - 4955. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Li, N. Gokden, M. D. Okusa, R. Bhatt, and D. Portilla Anti-inflammatory effect of fibrate protects from cisplatin-induced ARF Am J Physiol Renal Physiol, August 1, 2005; 289(2): F469 - F480. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. L. F. Kaplan, Y. Ouyang, C. E. Rockwell, G. K. Rao, and N. E. Kaminski 2-Arachidonoyl-glycerol suppresses interferon-{gamma} production in phorbol ester/ionomycin-activated mouse splenocytes independent of CB1 or CB2 J. Leukoc. Biol., June 1, 2005; 77(6): 966 - 974. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Brys, A. Beschin, G. Raes, G. H. Ghassabeh, W. Noel, J. Brandt, F. Brombacher, and P. D. Baetselier Reactive Oxygen Species and 12/15-Lipoxygenase Contribute to the Antiproliferative Capacity of Alternatively Activated Myeloid Cells Elicited during Helminth Infection J. Immunol., May 15, 2005; 174(10): 6095 - 6104. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. Migita and J. Morser 15-Deoxy-{Delta}12,14-Prostaglandin J2 (15d-PGJ2) Signals Through Retinoic Acid Receptor-Related Orphan Receptor-{alpha} but Not Peroxisome Proliferator-Activated Receptor-{gamma} in Human Vascular Endothelial Cells: The Effect of 15d-PGJ2 on Tumor Necrosis Factor-{alpha}-Induced Gene Expression Arterioscler. Thromb. Vasc. Biol., April 1, 2005; 25(4): 710 - 716. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Abdelrahman, A. Sivarajah, and C. Thiemermann Beneficial effects of PPAR-{gamma} ligands in ischemia-reperfusion injury, inflammation and shock Cardiovasc Res, March 1, 2005; 65(4): 772 - 781. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. E. Rockwell and N. E. Kaminski A Cyclooxygenase Metabolite of Anandamide Causes Inhibition of Interleukin-2 Secretion in Murine Splenocytes J. Pharmacol. Exp. Ther., November 1, 2004; 311(2): 683 - 690. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Wakino, K. Hayashi, T. Kanda, S. Tatematsu, K. Homma, K. Yoshioka, I. Takamatsu, and T. Saruta Peroxisome Proliferator-Activated Receptor {gamma} Ligands Inhibit Rho/Rho Kinase Pathway by Inducing Protein Tyrosine Phosphatase SHP-2 Circ. Res., September 3, 2004; 95(5): e45 - e55. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. J. Schlezinger, G. J. Howard, C. H. Hurst, J. K. Emberley, D. J. Waxman, T. Webster, and D. H. Sherr Environmental and Endogenous Peroxisome Proliferator-Activated Receptor {gamma} Agonists Induce Bone Marrow B Cell Growth Arrest and Apoptosis: Interactions between Mono(2-ethylhexyl)phthalate, 9-cis-Retinoic Acid, and 15-Deoxy-{Delta}12,14-prostaglandin J2 J. Immunol., September 1, 2004; 173(5): 3165 - 3177. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. Walcher, M. Aleksic, V. Jerg, V. Hombach, A. Zieske, S. Homma, J. Strong, and N. Marx C-Peptide Induces Chemotaxis of Human CD4-Positive Cells: Involvement of Pertussis Toxin-Sensitive G-Proteins and Phosphoinositide 3-Kinase Diabetes, July 1, 2004; 53(7): 1664 - 1670. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Cunard, Y. Eto, J. T. Muljadi, C. K. Glass, C. J. Kelly, and M. Ricote Repression of IFN-{gamma} Expression by Peroxisome Proliferator-Activated Receptor {gamma} J. Immunol., June 15, 2004; 172(12): 7530 - 7536. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Alvarez-Maqueda, R. E. Bekay, G. Alba, J. Monteseirin, P. Chacon, A. Vega, J. Martin-Nieto, F. J. Bedoya, E. Pintado, and F. Sobrino 15-Deoxy-{Delta}12,14-prostaglandin J2 Induces Heme Oxygenase-1 Gene Expression in a Reactive Oxygen Species-dependent Manner in Human Lymphocytes J. Biol. Chem., May 21, 2004; 279(21): 21929 - 21937. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Cheng, H. Afif, J. Martel-Pelletier, J.-P. Pelletier, X. Li, K. Farrajota, M. Lavigne, and H. Fahmi Activation of Peroxisome Proliferator-activated Receptor {gamma} Inhibits Interleukin-1{beta}-induced Membrane-associated Prostaglandin E2 Synthase-1 Expression in Human Synovial Fibroblasts by Interfering with Egr-1 J. Biol. Chem., May 21, 2004; 279(21): 22057 - 22065. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. Marx, H. Duez, J.-C. Fruchart, and B. Staels Peroxisome Proliferator-Activated Receptors and Atherogenesis: Regulators of Gene Expression in Vascular Cells Circ. Res., May 14, 2004; 94(9): 1168 - 1178. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. E. Lovett-Racke, R. Z. Hussain, S. Northrop, J. Choy, A. Rocchini, L. Matthes, J. A. Chavis, A. Diab, P. D. Drew, and M. K. Racke Peroxisome Proliferator-Activated Receptor {alpha} Agonists as Therapy for Autoimmune Disease J. Immunol., May 1, 2004; 172(9): 5790 - 5798. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. M. van Heeckeren, M. Schluchter, L. Xue, J. Alvarez, S. Freedman, J. St. George, and P. B. Davis Nutritional Effects on Host Response to Lung Infections with Mucoid Pseudomonas aeruginosa in Mice Infect. Immun., March 1, 2004; 72(3): 1479 - 1486. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Schmidt, E. Moric, M. Schmidt, M. Sastre, D. L. Feinstein, and M. T. Heneka Anti-inflammatory and antiproliferative actions of PPAR-{gamma} agonists on T lymphocytes derived from MS patients J. Leukoc. Biol., March 1, 2004; 75(3): 478 - 485. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. Hammad, H. J. de Heer, T. Soullie, V. Angeli, F. Trottein, H. C. Hoogsteden, and B. N. Lambrecht Activation of Peroxisome Proliferator-Activated Receptor-{gamma} in Dendritic Cells Inhibits the Development of Eosinophilic Airway Inflammation in a Mouse Model of Asthma Am. J. Pathol., January 1, 2004; 164(1): 263 - 271. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Nencioni, K. Lauber, F. Grunebach, L. Van Parijs, C. Denzlinger, S. Wesselborg, and P. Brossart Cyclopentenone Prostaglandins Induce Lymphocyte Apoptosis by Activating the Mitochondrial Apoptosis Pathway Independent of External Death Receptor Signaling J. Immunol., November 15, 2003; 171(10): 5148 - 5156. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. W. Chung, B. Y. Kang, and T. S. Kim Inhibition of Interleukin-4 Production in CD4+ T Cells by Peroxisome Proliferator-Activated Receptor-{gamma} (PPAR-{gamma}) Ligands: Involvement of Physical Association between PPAR-{gamma} and the Nuclear Factor of Activated T Cells Transcription Factor Mol. Pharmacol., November 1, 2003; 64(5): 1169 - 1179. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. G. Hogan, L. Chen, J. Nardone, and A. Rao Transcriptional regulation by calcium, calcineurin, and NFAT Genes & Dev., September 15, 2003; 17(18): 2205 - 2232. [Full Text] [PDF]
|
|
|
|
 |
|
 G. Woerly, K. Honda, M. Loyens, J.-P. Papin, J. Auwerx, B. Staels, M. Capron, and D. Dombrowicz Peroxisome Proliferator-activated Receptors {alpha} and {gamma} Down-regulate Allergic Inflammation and Eosinophil Activation J. Exp. Med., August 4, 2003; 198(3): 411 - 421. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
V. Angeli, H. Hammad, B. Staels, M. Capron, B. N. Lambrecht, and F. Trottein Peroxisome Proliferator-Activated Receptor {gamma} Inhibits the Migration of Dendritic Cells: Consequences for the Immune Response J. Immunol., May 15, 2003; 170(10): 5295 - 5301. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Tautenhahn, B. Brune, and A. von Knethen Activation-induced PPAR{gamma} expression sensitizes primary human T cells toward apoptosis J. Leukoc. Biol., May 1, 2003; 73(5): 665 - 672. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Cippitelli, C. Fionda, D. Di Bona, A. Lupo, M. Piccoli, L. Frati, and A. Santoni The Cyclopentenone-Type Prostaglandin 15-Deoxy-{Delta}12,14-Prostaglandin J2 Inhibits CD95 Ligand Gene Expression in T Lymphocytes: Interference with Promoter Activation Via Peroxisome Proliferator-Activated Receptor-{gamma}-Independent Mechanisms J. Immunol., May 1, 2003; 170(9): 4578 - 4592. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Cunard, D. DiCampli, D. C. Archer, J. L. Stevenson, M. Ricote, C. K. Glass, and C. J. Kelly WY14,643, a PPAR{alpha} Ligand, Has Profound Effects on Immune Responses In Vivo J. Immunol., December 15, 2002; 169(12): 6806 - 6812. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. J. Schlezinger, B. A. Jensen, K. K. Mann, H.-Y. Ryu, and D. H. Sherr Peroxisome Proliferator-Activated Receptor {gamma}-Mediated NF-{kappa}B Activation and Apoptosis in Pre-B Cells J. Immunol., December 15, 2002; 169(12): 6831 - 6841. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. L. Wang, K. A. Frauwirth, S. M. Rangwala, M. A. Lazar, and C. B. Thompson Thiazolidinedione Activation of Peroxisome Proliferator-activated Receptor gamma Can Enhance Mitochondrial Potential and Promote Cell Survival J. Biol. Chem., August 23, 2002; 277(35): 31781 - 31788. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. Bishop-Bailey, T. Hla, and T. D. Warner Intimal Smooth Muscle Cells as a Target for Peroxisome Proliferator-Activated Receptor-{gamma} Ligand Therapy Circ. Res., August 9, 2002; 91(3): 210 - 217. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Nencioni, F. Grunebach, A. Zobywlaski, C. Denzlinger, W. Brugger, and P. Brossart Dendritic Cell Immunogenicity Is Regulated by Peroxisome Proliferator-Activated Receptor {gamma} J. Immunol., August 1, 2002; 169(3): 1228 - 1235. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. T. C. Yang, Q. Xiong, H. Enslen, R. J. Davis, and C.-W. Chow Phosphorylation of NFATc4 by p38 Mitogen-Activated Protein Kinases Mol. Cell. Biol., June 1, 2002; 22(11): 3892 - 3904. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
O. Barbier, I. P. Torra, Y. Duguay, C. Blanquart, J.-C. Fruchart, C. Glineur, and B. Staels Pleiotropic Actions of Peroxisome Proliferator-Activated Receptors in Lipid Metabolism and Atherosclerosis Arterioscler. Thromb. Vasc. Biol., May 1, 2002; 22(5): 717 - 726. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. Marx, B. Kehrle, K. Kohlhammer, M. Grub, W. Koenig, V. Hombach, P. Libby, and J. Plutzky PPAR Activators as Antiinflammatory Mediators in Human T Lymphocytes: Implications for Atherosclerosis and Transplantation-Associated Arteriosclerosis Circ. Res., April 5, 2002; 90(6): 703 - 710. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Cunard, M. Ricote, D. DiCampli, D. C. Archer, D. A. Kahn, C. K. Glass, and C. J. Kelly Regulation of Cytokine Expression by Ligands of Peroxisome Proliferator Activated Receptors J. Immunol., March 15, 2002; 168(6): 2795 - 2802. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. B. Clark The role of PPARs in inflammation and immunity J. Leukoc. Biol., March 1, 2002; 71(3): 388 - 400. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
X. Y. Yang, L. H. Wang, K. Mihalic, W. Xiao, T. Chen, P. Li, L. M. Wahl, and W. L. Farrar Interleukin (IL)-4 Indirectly Suppresses IL-2 Production by Human T Lymphocytes via Peroxisome Proliferator-activated Receptor gamma Activated by Macrophage-derived 12/15-Lipoxygenase Ligands J. Biol. Chem., February 1, 2002; 277(6): 3973 - 3978. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. G. Harris, R. S. Smith, and R. P. Phipps 15-Deoxy-{Delta}12,1412,14-PGJ2 Induces IL-8 Production in Human T Cells by a Mitogen-Activated Protein Kinase Pathway J. Immunol., February 1, 2002; 168(3): 1372 - 1379. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Yang, R. J. Davis, and C.-W. Chow Requirement of Two NFATc4 Transactivation Domains for CBP Potentiation J. Biol. Chem., October 19, 2001; 276(43): 39569 - 39576. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
X. Zhang, J. M. Wang, W. H. Gong, N. Mukaida, and H. A. Young Differential Regulation of Chemokine Gene Expression by 15-Deoxy-{{Delta}}12,1412,14 Prostaglandin J2 J. Immunol., June 15, 2001; 166(12): 7104 - 7111. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. X. Cheng and T. Kupper A New Rexinoid for Cutaneous T-Cell Lymphoma Arch Dermatol, May 1, 2001; 137(5): 649 - 652. [Full Text] [PDF]
|
|
|
|
|
|
S. W. Han, M. E. Greene, J. Pitts, R. K. Wada, and N. Sidell Novel Expression and Function of Peroxisome Proliferator-activated Receptor Gamma (PPAR{{gamma}}) in Human Neuroblastoma Cells Clin. Cancer Res., January 1, 2001; 7(1): 98 - 104. [Abstract] [Full Text]
|
|
|
|
 |
|
 M. T. Heneka, T. Klockgether, and D. L. Feinstein Peroxisome Proliferator-Activated Receptor-gamma Ligands Reduce Neuronal Inducible Nitric Oxide Synthase Expression and Cell Death In Vivo J. Neurosci., September 15, 2000; 20(18): 6862 - 6867. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. N. Ellis, J. Varani, G. J. Fisher, M. E. Zeigler, H. A. Pershadsingh, S. C. Benson, Y. Chi, and T. W. Kurtz Troglitazone Improves Psoriasis and Normalizes Models of Proliferative Skin Disease: Ligands for Peroxisome Proliferator-Activated Receptor-{gamma} Inhibit Keratinocyte Proliferation Arch Dermatol, May 1, 2000; 136(5): 609 - 616. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. H. Wang, X. Y. Yang, K. Mihalic, W. Xiao, D. Li, and W. L. Farrar Activation of Estrogen Receptor Blocks Interleukin-6-inducible Cell Growth of Human Multiple Myeloma Involving Molecular Cross-talk between Estrogen Receptor and STAT3 Mediated by Co-regulator PIAS3 J. Biol. Chem., August 17, 2001; 276(34): 31839 - 31844. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. C. Jones, X. Ding, and R. A. Daynes Nuclear Receptor Peroxisome Proliferator-activated Receptor alpha (PPARalpha ) Is Expressed in Resting Murine Lymphocytes. THE PPARalpha IN T AND B LYMPHOCYTES IS BOTH TRANSACTIVATION AND TRANSREPRESSION COMPETENT J. Biol. Chem., February 22, 2002; 277(9): 6838 - 6845. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Schinner, C. Dellas, M. Schroder, C. A. Heinlein, C. Chang, J. Fischer, and W. Knepel Repression of Glucagon Gene Transcription by Peroxisome Proliferator-activated Receptor gamma through Inhibition of Pax6 Transcriptional Activity J. Biol. Chem., January 11, 2002; 277(3): 1941 - 1948. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
F. Zheng, A. Fornoni, S. J. Elliot, Y. Guan, M. D. Breyer, L. J. Striker, and G. E. Striker Upregulation of type I collagen by TGF-beta in mesangial cells is blocked by PPARgamma activation Am J Physiol Renal Physiol, April 1, 2002; 282(4): F639 - F648. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. Marx, B. Kehrle, K. Kohlhammer, M. Grub, W. Koenig, V. Hombach, P. Libby, and J. Plutzky PPAR Activators as Antiinflammatory Mediators in Human T Lymphocytes: Implications for Atherosclerosis and Transplantation-Associated Arteriosclerosis Circ. Res., April 5, 2002; 90(6): 703 - 710. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| All ASBMB Journals | Molecular and Cellular Proteomics |
| Journal of Lipid Research | ASBMB Today |