![]()
|
|
||||||||
J Biol Chem, Vol. 275, Issue 7, 4628-4634, February 18, 2000
,Department of Molecular Life Science, Tokai University School of Medicine, Isehara 259-1193, Japan
| |
ABSTRACT |
|---|
|
|
|---|
Resistance of Pseudomonas aeruginosa
to multiple species of antibiotics is largely attributable to
expression of the MexA, B-OprM efflux pump. The MexA protein is thought
to be located at the inner membrane and has been assumed to link the
xenobiotics-exporting subunit, MexB, and the outer membrane channel
protein, OprM. To verify this assumption, we analyzed membrane
anchoring and localization of the MexA protein.
n-[9,10-3H]Palmitic acid incorporation
experiments revealed that MexA was radiolabeled with palmitic acid,
suggesting that the MexA anchors the inner membrane via the fatty acid
moiety. To evaluate the role of lipid modification and inner membrane
anchoring, we substituted cysteine 24 with phenylalanine or tyrosine
and tested whether or not these mutant MexAs function properly. When
the mutant mexAs were expressed in the strain lacking chromosomal
mexA in the presence of
n-[9,10-3H]palmitic acid, we found
undetectable radiolabeling at the MexA band. These transformants
restored antibiotic resistance to the level of the wild-type strain,
indicating that lipid modification is not essential for MexA function.
These mutant strains contained both processed and unprocessed forms of
the MexA proteins. Cellular fractionation experiments revealed that an
unprocessed form of MexA anchored the inner membrane probably via an
uncleaved signal sequence, whereas the processed form was undetectable
in the membrane fraction. To assure that the lipid-free MexA
polypeptide could be unbound to the membrane, we analyzed the
two-dimensional membrane topology by the gene fusion technique. A total
of 78 mexA-blaM fusions covering the entire MexA polypeptide were
constructed, and all fusion sites were shown to be located at the
periplasm. To answer the question of whether or not membrane anchoring
is essential for the MexA function, we replaced the signal sequence of
the MexA protein with that of the azurin protein, which contains a
cleavable signal sequence but no lipid modification site. The signal
sequence of the azurin-MexA hybrid protein was properly processed and
bore the mature MexA, which was fully recovered in the soluble
fraction. The transformant, which expressed azurin-MexA hybrid protein
restored the antibiotic resistance to a level indistinguishable from
that of the wild-type strain. We concluded from these results that the
MexA protein is fully functional as expressed in the periplasmic space
without anchoring the inner membrane. This finding questioned the
assumption that the membrane fusion proteins connect the inner and
outer membranes.
Pseudomonas aeruginosa often infects immuno-compromised
patients with cancer, dialysis, cystic fibrosis, and transplantation. Problems associated with P. aeruginosa infection are that
this organism is naturally resistant to many noxious compounds such as
A MexA,B-OprM pump, encoded by the mexA,B-oprM
genes, consists of two inner membrane-associated components, MexA and
MexB, and an outer membrane component, OprM (6). It has been assumed on
the basis of computer-aided structural prediction that MexA belongs to
a membrane fusion protein family that is thought to connect the inner
and the outer membranes (7, 8). It has been suggested that each of MexB
and OprM functions as an antibiotic-exporting component and an
antibiotic exit outer membrane channel, respectively (3, 4, 8). Both
MexA and OprM have been assumed to be lipoproteins, since they contain
a consensus signal sequence for amino-terminal lipid modification, and
amino-terminal amino acids seem to be blocked (6, 9). However, the
membrane topology and precise localization of these proteins remain
obscure, except for the two-dimensional structure of the MexB protein,
which spans the cytoplasmic membrane 12 times and forms 2 large
hydrophilic domains extending toward the periplasmic space (10). This
protein was predicted to function as the substrate-exporting subunit
across the cytoplasmic membrane.
Computer-aided hydropathy analysis of membrane fusion proteins
suggested that they might be highly hydrophilic (7, 11). Preliminary
analyses of the topology of the MexA homologues, such as CzcB of
Alcaligenes eutrophus and CvaA, HlyD, and AcrA of
Escherichia coli, suggested that they might be largely
located at the periplasmic space (12-15). However, the precise
membrane topology and localization of the MexA protein remained
unclear. We analyzed whether or not the MexA protein can function
without a lipid moiety and report that the lipid-free MexA protein was
soluble in the periplasmic space and fully functional in the
antibiotic export.
Bacterial Strains, Plasmids, and Growth
Conditions--
Bacterial strains and plasmids used are listed in
Table I. Cells were grown aerobically in
L-broth containing 10 g of Tryptone, 5 g of yeast extract,
and 5 g of NaCl/liter (pH 7.2) at 37 °C. pKM1 is a new version
of pYZ5 (16).
Incorporation of [9,10-3H]Palmitic Acid--
Cells were grown in L-broth overnight and diluted with 1 ml of
fresh L-broth to A600 = 0.2. To this was added
1.48 × 106 Bq of [9,10-3H]palmitic acid
(Amersham Pharmacia Biotech), and the tubes were incubated at 37 °C
overnight. Cells were harvested by centrifugation, washed once with 1 ml of 50 mM sodium phosphate buffer containing 150 mM NaCl (pH 7.2; 50 mM
PBS1), suspended in 800 µl
of 50 mM PBS. The cells were mixed with 200 µl of 10% of
octyl- Manipulation of the DNA--
Preparation of the plasmid DNA, the
restriction enzyme treatment, ligation, and transformation were carried
out essentially as described by Sambrook et al. (18). A
series of nested deletions of the mexA gene was obtained by
exonuclease III (TOYOBO) treatment (19). Construction of
mexA-blaM fusions was carried out as follows. A 1.7-kilobase
NcoI/BamHI fragment encompassing the entire
mexA gene was subcloned into pYZ4 pretreated with
BamHI and NcoI to yield pMEXA2. pMEXA2 treated
with KpnI and BamHI was incubated with
exonuclease III for various lengths of time, then treated with
SacI. A nested series of the deleted mexA gene
was ligated with the blaM gene (coding for ampicillinase
without a signal peptide) isolated by digesting pKM1 with
SmaI and SacI to obtain mexA-blaM
fusions. Transformants harboring the mexA-blaM fusions were
screened on L-agar plates containing 12.5 µg/ml kanamycin. The
oligonucleotide primers used to confirm the junction between the
mexA and the blaM was CTCGTGCACCCAACTGA or
TGTTGAGATCCAGTTCG for the anticoding strand.
Construction of Polyhistidine-tagged mexA Gene--
We
incorporated six histidines at the carboxyl-terminal glycine residue by
polymerase chain reaction using forward and reverse primers,
TCGAATTCTCCGAGGTTTCCG and
GGATCCCCTTGATCAGTGGTGATGGTGGTGATGGCCCTTGCTGTCGGTTTTCGC, respectively. Polymerase chain reaction was performed with AmpliTaq Gold (Applied Biosystems, Inc.) according to the manufacturer's instructions. Amplified products were treated with T4-DNA polymerase (New England Biolabs) and EcoRI and cloned into pBluescript
II SK+ pretreated with SmaI, EcoRI, and shrimp
alkaline phosphatase (Roche Molecular Biochemicals). The nucleotide
sequence was confirmed subsequently for all the polymerase chain
reaction products. Next, an HindIII-EcoRI
fragment (about 1,100 base pairs) covering the amino-terminal half of
mexA was subcloned into the pBluescript II SK+ (Stratagene)
pretreated with HindIII, EcoRI, and shrimp alkaline phosphatase. A HindIII-BamHI fragment
(about 1,570 base pairs) covering the entire mexA gene plus
six histidines was subcloned into pHSG397 (20) pretreated with
HindIII and BamHI (pMexA-His-397), then into
pMMB67HE (21) pretreated with HindIII and BamHI
to yield pMexA-His.
Site-directed Mutagenesis of Cysteine Residue--
We replaced
cysteine 24 with phenylalanine or tyrosine by site-directed mutagenesis
using forward primers GGTCGCGATTTCGGCCCTTTCCGGGTTCGG and
GGTCGCGATTTCGGCCCTTTCCGGGTACGG for phenylalanine and tyrosine, respectively, and reverse primer GACTGCAGGTAGGCGGCATTGGCG. Polymerase chain reaction was performed with AmpliTaq Gold (Applied Biosystems, Inc.). Amplified products were treated with T4 DNA polymerase followed
by PstI digestion and subcloning into pBluescript II SK+
digested with EcoRV and PstI. Next, the
NruI-PstI fragment from the mutant
mexA was subcloned into the NruI and
PstI sites of mexA, contained upstream of the
mexA gene through one of the two PstI sites in
the mexA gene. A PstI-SmaI (about 900 base pairs) fragment containing the second PstI site was
subcloned into the above plasmids pretreated with PstI and
EcoRV. Next, the SacI-HindIII fragment
of these plasmids containing the entire mexA gene with the
respective mutation was subcloned into pMMB67EH (21) pretreated with
SacI and HindIII to yield pMexA(C24F) and
pMexA(C24Y), respectively. To construct histidine-tagged
mexA with a mutation at residue 24, a
SacI-BsaI fragment (about 1,100 base pairs) from
each mutant plasmid was subcloned into pMexA-His-397 pretreated with
BsaI and SacI. A SacI-BamHI
fragment of each mutagenized mexA was then subcloned into
pMMB67EH pretreated with SacI and BamHI.
Site-specific Insertion of the blaM Gene--
To insert the
blaM gene next to Leu-43 of mexA, the
amino-terminal region of the mexA gene was amplified by
AmpliTaq Gold (PE Applied Biosystems) using forward,
TCTGAATATGGGCCATGGCG, and backward, TAAGGTACCAGGGTCACGATCCCGAC,
primers. The amplified products were digested with KpnI and
NcoI, then ligated to pYZ4 pretreated with KpnI
and NcoI. The recombinant plasmid DNA was treated with KpnI, then with T4 DNA polymerase to trim the 3'-protruding
nucleotides. This was followed by SacI digestion. Next, the
blaM gene, isolated from pKM1 by digestion with
SmaI and SacI, was ligated directionally to the
above site.
Construction of Soluble and Membrane-bound MexAs--
To
construct a mexA gene in which the signal sequence was
replaced with that of the azurin gene, we annealed the sense and antisense oligonucleotides,
AGCTTGCCTAGGAGGCTGCTCCATGCTACGTAAACTCGCTGCGGTATCCCTGCTGTCCCTGCTCAGTGCGCCGCTGCTGGCTGCCGAG and
TCGACTCGGCAGCCAGCAGCGGCGCACTGAGCAGGGACAGCAGGGATACCGCAGCGAGTTTACGTAGCATGGAGCAGCCTCCTAGGCA, respectively, followed by HindIII and SalI
digestion to subclone into pHSG398 (20) pretreated with
HindIII and SalI (pAZU398). The DNA fragment
encoding mature MexA was amplified by LA Taq (Takara, Japan)
using the forward and reverse primers, CCGCTCGAGCGGAAAAAGCGAG and
CGGGATCCCCTTGATCAGCCCTTGC, respectively, according to the manufacturer's instructions. The fragment was treated with
BamHI and XhoI to subclone into pAZU398
pretreated with BamHI and SalI. A
BamHI-HindIII fragment containing the whole
recombinant gene of this plasmid was subcloned into pMMB67HE pretreated
with BamHI and HindIII to yield pAzu-MexA.
To construct a mexA gene containing the first transmembrane
segment of the mexF gene, we first amplified the DNA
fragment encoding mature MexA by LA Taq (Takara) with
forward and reverse primers, TCCCTCGAGGGAAAAAGCGAGGCG and
GGGGTACCCCTTGATCAGCCCTTG, respectively, and subcloned it into
pHSG397. Next, the first transmembrane segment of the mexF
gene was amplified by LA Taq using forward and reverse
primers, CCGGATCCGGCGATAGGAAGAACCGATG and
CAAGTCGACTTCCGGGTATTCGCTGATGG, respectively, and the amplified
fragments treated with BamHI and SalI were
subcloned into the above plasmid pretreated with BamHI and
XhoI. Next, the HindIII-KpnI fragment
containing the entire fusion gene was subcloned into pMMB67HE
pretreated with HindIII and KpnI to yield
pMexF-MexA.
Single-cell Minimum Inhibitory Concentration (MIC) of
Antibiotics--
E. coli XL1-Blue harboring the fusion
plasmid was grown in Mueller-Hinton broth containing 0.4% (w/v)
KNO3 and 12.5 µg/ml kanamycin at 37 °C overnight
without shaking. Cells were diluted 104-fold with Mueller-Hinton broth,
and about 40 bacteria were inoculated using a microplanter (Model
MIT-P, Sakuma Co., Japan) on Mueller-Hinton Agar medium (Becton
Dickinson) containing 2-fold serially diluted ampicillin. The single
cell MIC was defined as the lowest concentration of ampicillin that
inhibited the growth of the bacteria after overnight incubation at
37 °C.
Preparation of Inner and Outer Membrane Fractions--
E.
coli XL1-Blue harboring the fusion plasmid was grown overnight in
20 ml of L-broth, diluted with 200 ml of the same fresh medium
containing 12.5 µg/ml kanamycin, and rotated at 37 °C for 1 h. Next, 1 mM
isopropyl-1-thio- Other Methods--
SDS-PAGE was carried out as described by
Laemmli (23). MexA-BlaM fusion products were visualized with
the anti-ampicillinase antibody (5 Prime Deletion of the Lipid Moiety by Replacing Cysteine 24 with Another
Amino Acid--
Since the amino-terminal region of MexA contains the
lipid modification consensus sequence LSGC (9), we carried out a
[3H]palmitic acid incorporation experiment (Fig.
1). Fluorography showed that the extracts
of TNP071 exhibited a radiolabeled protein band corresponding to the
MexA, 42 kDa (Fig. 1, lane 2). In contrast, radiolabeling in
the sample from the MexA deletion mutant, TNP070, was undetectable
(Fig. 1, lane 1). Although the chemical nature of bonding
between the fatty acid moiety and MexA was not confirmed, it is likely
that the fatty acid moiety covalently attached to the MexA protein,
because the lipid(s) moiety could withstand heating at 100 °C for 5 min in SDS solution. It is also likely that the lipid moiety plays a
role in anchoring the MexA protein to the inner membrane.
This raises the question of whether or not lipid modification at
cysteine 24 is essential in the localization and function of MexA. To
answer this question, we substituted cysteine 24 with phenylalanine or
tyrosine (designated as C24F-MexA or C24Y-MexA, respectively). When the
modified mexA gene was expressed in the mutant lacking MexA,
TNP070, and analyzed by the immunoblotting method using anti-MexA
antibody (17), we found an extra band(s) in addition to the band
corresponding to the mature form of the wild-type MexA (Fig.
2a). In addition to this band,
both mutants showed a band with a higher molecular mass than the mature
form, which is most likely the MexA protein with an unprocessed signal sequence. The mutant C24Y-MexA showed a band in-between mature MexA and
high molecular mass MexA, which is most likely the protein processed at
another site. A cellular fractionation experiment revealed that the
processed form of C24F-MexA was recovered in the supernatant fraction
of the EDTA-lysozyme-treated cells, whereas the unprocessed C24F-MexA
appeared in the inner membrane fraction (Fig. 2b). To
confirm the nature of these molecules, we constructed the
histidine-tagged C24F-MexA and C24Y-MexA (designated as C24F-MexA-His and C24Y-MexA-His, respectively), and the proteins were purified by
affinity chromatography using nickel-nitrilotriacetic acid-agarose. Amino-terminal amino acid sequence analysis showed that the two bands
in C24F-MexA-His appeared to be MQRTPAM and FGKSEAPPPA, which were
identical to the amino-terminal amino acid sequence of mature MexA and
the MexA processed at glycine 23, respectively. The two bands appearing
in C24Y-MexA-His were MQRTPAMRVL and KSEAPPPAQT, corresponding to the
amino-terminal sequence of the mature form and the sequence after
glycine 25, respectively. To assure that C24F-MexA and C24Y-MexA were
free of lipid modification, we carried out the
[3H]palmitic acid incorporation experiment. As expected,
the radiolabeling in both MexAs were undetectable, although the
wild-type MexA expressed from the plasmid was heavily radiolabeled
(Fig. 2c). These results indicated that both C24F-MexA and
C24Y-MexA were not acylated. TNP070 transformed with either one of
these modified mexA genes fully restored the susceptibility
to azthreonam and chloramphenicol to the level of their parent strain
PAO4290 (Table II), indicating that lipid
modification is not essential for the MexA function.
Function of Soluble and Membrane-bound MexA--
Since the above
result showed that the lipid moiety is not essential for the pump
function and the processed and unprocessed forms of C24F-MexA were
fractionated in the soluble and inner membrane fraction, respectively,
the question arises about which form of MexA retains activity. To
address this issue, we constructed the recombinant mexA
genes containing a signal sequence of the azurin gene, a periplasmic
protein, or an amino-terminal transmembrane segment of mexF,
an inner membrane protein. When Azu-MexA or MexF-MexA was expressed in
the strain lacking MexA, a single band corresponding to Azu-MexA or
MexF-MexA was detectable (Fig. 3,
lanes 5 and 8). To characterize the products, we
analyzed the amino-terminal sequence of Azu-MexA-His, and it appeared
to be AESSGKSEAP, indicating that proper processing of the hybrid MexA
has occurred at the correct site.
We next localized the Azu-MexA protein by cellular fractionation and
analyzed it by the immunoblotting method (Fig. 3, lanes 6 and 7). The Azu-MexA protein was found only in the whole
cell lysate but was undetectable in either the inner or outer membrane fraction. Therefore, we concluded that the Azu-MexA protein was processed, and the MexA became soluble in the periplasm. Using a
similar technique, we analyzed the localization of MexF-MexA and found
that the protein was only detectable in the inner membrane fraction.
The molecular mass of MexF-MexA was a little larger than the wild-type
MexA (Fig. 3, lanes 8 and 9), indicating that the
MexF-MexA anchored the membrane via the amino-terminal hydrophobic segment of MexF. We carried out the [9,10-3H]palmitic
acid incorporation experiment using the strain expressing Azu-MexA or
MexF-MexA and found that the radiolabeling in the bands corresponding
to these recombinant MexAs was undetectable (data not shown). Thus, we
were successful in constructing the lipid-free MexA variants localized
either only in the periplasm or inner membrane.
Antibiotic susceptibility of the MexA variants was determined, and the
results are shown in Table II. The TNP070 strain expressing C24F-MexA
or C24Y-MexA fully restored the antibiotic susceptibility to the level
of the wild-type strain. However, it is not certain whether the soluble
form of MexA or the membrane-bound form is functional as the pump
subunit, because these transformants expressed both forms of MexA. To
ascertain this point, we tested to see if the antibiotic susceptibility
of TNP070 expressed either one of Azu-MexA or MexF-MexA (Table II).
Both transformants restored the antibiotic susceptibility against
azthreonam and chloramphenicol similar to the strain expressing the
wild-type MexA (Table II). These results unequivocally demonstrated
that membrane anchoring is not essential for the function of MexA, at
least for the extrusion of antibiotics.
Construction and Expression of the Reporter Gene, mexA-blaM
Fusion--
The results described above suggested that
processed forms of the cysteine 24-modified MexA and Azu-MexA
could be soluble in the periplasmic space and functioned properly in
the intact cell. Hydropathy analysis by the TOP-PRED II program (25)
predicted that the MexA protein bears two hydrophobic segments at a
site proximal to the amino-terminal end. One is likely to be the
topology-determining signal sequence. Another is a stretch of segment
immediately downstream of the signal peptide. To verify whether or not
MexA contains membrane-anchoring segments, we constructed
mexA-blaM fusions as described under "Experimental
Procedures." We obtained 77 independent fusion genes with correct
framing (Table III). The gaps between one
fusion site to the nearest neighboring sites were consistently less
than 21 amino acid residues, excepting that there were 33 amino acid
residues between Ser-27 and Ala-60. To cover this region we constructed
an additional fusion at Leu-43. Accordingly, we obtained a total of 78 clones covering the residue Gly-23 to the carboxyl-terminal end.
To ascertain proper expression of the hybrid proteins in the E. coli host, we ran SDS-PAGE of the inner membrane fraction prepared
from the cells harboring the plasmids, and the protein was visualized
by the immunoblotting method using an antibody raised against
ampicillinase (Fig. 4). The result shown
in Fig. 4 depicted that the hybrid proteins from G383-BlaM through
G23-BlaM were lined up in decreasing molecular mass as the fusion sites became more distal from the carboxyl-terminal end. The size of all
hybrid proteins was consistent with the size predicted from the length
of the truncated MexA plus the size of the reporter protein. The size
of the G23 hybrid protein was slightly larger than the S27 hybrid
protein, suggesting that the sequence LSGC acts as a cleavage and lipid
modification signal sequence in the E. coli host (Fig. 4,
lanes 12 and 13). In fact, the
[3H]palmitic acid radiolabeling was positively
demonstrated in isolate 77 but not in isolate 78 (data not shown).
Faint protein bands with a low molecular mass below that of the
expected hybrid proteins were most likely the degradative products of
the hybrid proteins often seen in blaM fusion in other
proteins (16, 26). A faint protein band seen in Fig. 4, lane
13 with the mass about 30 kDa might be an unidentified protein
derived from the E. coli host.
Localization of the Reporter Protein and Membrane Topology of the
MexA Protein--
The strains expressing the MexA-BlaM hybrid protein
in the periplasm are expected to be All the living organisms may be exposed to the external milieu,
which may contain noxious compounds such as surfactants, hydrophobic materials, heavy metals, cytotoxic agents, and drugs. Most, if not all,
of them must defend against the hazards of these noxious compounds by
several means of detoxification. An efficient way to avoid suffering
from such agents would be to lower the intracellular concentration of
the noxious compounds by active extrusion. P. aeruginosa
appeared to bear the efflux pumps, of which up-regulation renders this
bacterium resistance to many antibiotics, dyes, surfactants, and
organic solvents (5, 6, 27-29). Since P. aeruginosa is a
Gram-negative bacterium, the efflux pump assembly consists of the inner
membrane efflux pump, the outer membrane exit channel, and the membrane
fusion protein (3, 4, 8).
The MexA subunit of the MexA,B-OprM pump has been assumed to function
as the membrane fusion protein, which connects the inner membrane pump,
MexB, and the outer membrane exit channel, OprM (7, 8, 11). The MexA
protein contains the lipoprotein consensus sequence at the amino
terminus (9), yet the biological significance of the lipid modification
has remained obscure. We addressed this issue by replacing cysteine 24 with phenylalanine or tyrosine. These MexA variants had both processed
and unprocessed forms of MexA (Fig. 2a), as confirmed by
analysis of the amino-terminal amino acid sequence. Strains expressing
only the mutant MexA restored an antibiotic susceptibility
indistinguishable from that of the wild-type strain. This result is
consistent with the E. coli membrane fusion protein, AcrA,
in that modification of the cysteine residue did not grossly affected
the function (30). Our result demonstrated unequivocally that lipid
modification was not essential for the function of MexA but did not
answer the question of whether or not membrane anchoring is essential
to the function of MexA.
We addressed this issue by constructing a recombinant MexA containing
the signal peptide of azurin and found that the signal peptide was
properly cleaved and that the mature MexA became a soluble protein
(Fig. 3). Surprisingly, MexA protein without a membrane anchor fully
functioned for antibiotic export. An analogous experiment has been
carried out by subcloning the signal sequence-less acrA gene
downstream from the OmpA signal sequence (30). Since E. coli
cells harboring this recombinant gene expressed both processed and
unprocessed forms of the AcrA proteins, these materials cannot be used
to test whether the soluble form of AcrA is functional or not. The
periplasmic localization of the entire MexA protein was confirmed by
the expression of 78 MexA- The function of MexA can be predicted from these results. Two essential
functions are conceivable. (i) MexA functions as a hollow, connecting
MexB and OprM, forming the antibiotic path. (ii) MexA interacts with
MexB, and when MexB pumps out noxious compounds using the transmembrane
proton gradient, MexA transmits this energy to OprM and opens the gate,
which blocks the OprM channel. The latter possibility is analogous to
the function of the TonB protein in ferric ion transport across the
outer membrane (31).
We have analyzed the membrane topology of the MexB protein and reported
our findings as follows (10). (i) The MexB protein spans the inner
membrane 12 times, leaving both amino and carboxyl termini at the
cytoplasmic side of the inner membrane. (ii) The 1st and the 4th
periplasmic domains contain large polypeptides, consisting of 311 and
314 amino acid residues, respectively, and are extended largely to the
periplasmic space. In contrast, the present study revealed that a large
part, if not all, of the MexA is exposed to the periplasmic space.
Based on these structural analyses of two inner membrane proteins of
the MexA, B-OprM pump, we propose the following two topological models.
It is conceivable that the MexA protein was held by the largely
extended two periplasmic domains of the MexB protein, as illustrated in
Fig. 5a. Based on this
assumption, a tight combination of MexA and MexB is essential for
interaction with OprM, energy transmission to OprM, and for outward
delivery of noxious compounds. Alternatively, the MexA protein may be
located over the large periplasmic loops of the MexB protein and may
interact with OprM forming a hollow tube (Fig. 5b). The
former model is supported by our previous result that tight coupling of
MexA and MexB is essential for pump functioning (32). The latter model
is consistent with the hypothesis that the MexA protein forms a noxious
compound path tubing, through which the out-coming chemicals can be
delivered to the outer membrane protein (8). In any case, either MexB
or a combination of MexB and MexA should be able to transmit cellular
energy to OprM in order to open the channel gate of OprM. Further
investigations are needed to clarify the precise role of individual
subunits in the proper function of the MexA, B-OprM pump. Furthermore, the present finding that MexA protein free from the membrane fully functions in the antibiotic export encourages further structural analysis of the MexA, B-OprM pump.
![]()
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
-lactam antibiotics, fluoroquinolones, chloramphenicol, and tetracycline (1). Upon exposure to antibiotics, the organism easily
elevates the antibiotic resistance to a higher level than the wild type
strain (2). Recent studies have suggested that both basal and elevated
levels of intrinsic multiantibiotic resistance in this organism are
mainly attributable to interplay between the antibiotic efflux pumps
and low outer membrane permeability (3, 4). Among several efflux pumps
reported in P. aeruginosa, the MexA, B-OprM pump plays a
central role in antibiotic resistance because it is expressed in the
wild-type strain and up-regulated upon nalB mutation (5).
![]()
EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
Bacterial strains and plasmids
-glucoside and 2 µl of 500 mM
phenylmethylsulfonyl fluoride and incubated at 4 °C for 45 min. The
resulting cell lysate was incubated for 135 min after adding 23 µg of
DNaseI and centrifuged by an Eppendorf 5412 for 10 min. The supernatant was mixed with 10 µl of anti-MexA rabbit antibody (17) and protein A-agarose (Roche Molecular Biochemicals) then incubated at 4 °C overnight. The protein A-agarose was washed 4 times with a solution containing 1 M NaCl, 1% octyl-
-glucoside, 50 mM sodium phosphate (pH 7.2) and once with a solution of
1% octyl-
-glucoside and 50 mM sodium phosphate (pH
7.2). The resulting precipitates were extracted by 20 µl of Laemmli
solubilizer at 100 °C for 5 min, then subjected to
SDS-polyacrylamide gel electrophoresis (PAGE, 10% gel), after which
the dried gel was exposed to Biomax MR film (Eastman Kodak Co.).
-D-galactopyranoside was added, and the
cells were grown for an additional 4 h at 37 °C. Cells were
harvested by centrifugation, washed once with 20 mM sodium phosphate buffer (pH 7.2) containing 150 mM NaCl (20 mM PBS), and resuspended in 20 ml of 20 mM PBS
containing 0.5 mM p-toluenesulfonyl fluoride.
The suspension was subjected to sonic oscillation in an ice bath for 15 min with 24-s exposure and 36-s intermittent cooling/min (Cell
Disrupter 200, Branson). Unbroken cells and large fragments were
removed by centrifugation at 10,000 × g for 15 min at
23 °C, and the crude membrane fraction was obtained by
centrifugation at 130,000 × g for 1 h at
15 °C. The membrane fraction was washed once with 20 mM
PBS and suspended in 2.2 ml of PBS. To the membrane fraction (1.84 ml),
0.16 ml of 10% of sodium sarcosinate was added, and the mixture was
incubated at 30 °C for 30 min, then centrifuged at 130,000 × g for 1 h at 15 °C. The supernatant was used as the
inner membrane fraction. The inner and outer membrane fractions of
P. aeruginosa were also obtained by the method described
earlier (22).
3 Prime, Inc., Boulder,
CO) using alkaline phosphatase-conjugated secondary antibody (16).
Protein concentration was quantified by the method of Lowry (24).
![]()
RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

View larger version (43K):
[in a new window]
Fig. 1.
[3H]Palmitic acid incorporation
into MexA. P. aeruginosa cells were grown in the
presence of [3H]palmitic acid (1.48 × 106 Bq/ml)
overnight, and the MexA protein was immunoprecipitated with anti-MexA
antibody. Lane 1, TNP070 (MexA-deficient mutant derived from
PAO4290); lane 2, TNP071 (MexB-deficient mutant derived from
PAO4290).

View larger version (40K):
[in a new window]
Fig. 2.
a, Western blot analysis of delipidated
MexA. Whole cell lysate (10 µg of protein) of P. aeruginosa cells expressing C24F-MexA or C24Y-MexA were subjected
to SDS-PAGE (12% gel), blotted onto the polyvinylidene difluoride
membrane, and visualized with anti-MexA antibody. Lane 1,
molecular weight marker in kDa; lane 2, wild-type MexA;
lane 3, C24F-MexA; lane 4, C24Y-MexA.
b, cellular fractionation of C24F-MexA. Each fraction was
subjected to SDS-PAGE (10%), blotted onto the polyvinylidene
difluoride membrane, and visualized with anti-MexA antibody. Lane
1, molecular weight marker in kDa; lane 2, whole cell
lysate of C24F-MexA (10 µg of protein); lane 3, outer
membrane fraction (5 µg of protein); lane 4, inner
membrane fraction (5 µg of protein); lane 5,
EDTA-lysozyme-treated supernatant (5 µg of protein). c,
[3H]palmitic acid incorporation into modified MexAs.
P. aeruginosa cells (A600 = 1.0)
harboring pMexA(C24F) or pMexA(C24Y) were grown in the presence of
[3H]palmitic acid (3.7 × 106 Bq/ml) and
isopropyl-1-thio-
-D-galactopyranoside (2 mM)
for 6 h, and the MexA was immunoprecipitated with anti-MexA
antibody. The signals were visualized by fluoroimage analyzer FLA-2000
(Fuji Film Co., Japan). Lane 1, TNP070 harboring
pMexA(C24Y); lane 2, TNP070 harboring pMexA(C24F);
lane 3, TNP070 harboring pMexA1; lane 4, TNP070.
The lower panel shows the same gel stained by Coomassie
Brilliant Blue. The mature form of MexA is indicated at the right
side.
MIC of azthreonam and chloramphenicol for transformants expressing
mutagenized MexA

View larger version (108K):
[in a new window]
Fig. 3.
Cellular fractionation of recombinant
MexA. MexA and recombinant MexAs were fractionated as described
under "Experimental Procedures." Inner and outer membrane (2 µg
of protein) and whole cell lysate (10 µg of protein) were subjected
to SDS-PAGE (12% gel) and visualized with anti-MexA antibody.
Lane 1, whole cell lysate of PAO4290; lane 2,
whole cell lysate of wild-type MexA; lane 3, inner membrane
of wild-type MexA; lane 4, outer membrane of wild-type MexA;
lane 5, whole cell lysate of Azu-MexA; lane 6,
inner membrane of Azu-MexA; lane 7, outer membrane of
Azu-MexA; lane 8, whole cell lysate of MexF-MexA; lane
9, inner membrane of MexF-MexA; lane 10, outer membrane
of MexF-MexA. The mature form of MexA is indicated at the left
side.
MIC of ampicillin for transformants expressing each MexA-BlaM hybrid
protein obtained by exonuclease III treatment and site-directed
mutagenesis

View larger version (81K):
[in a new window]
Fig. 4.
Expression of the MexA-BlaM hybrid protein in
the inner membrane of the E. coli cell. The inner
membrane protein (10 µg of protein) was resolved by SDS-PAGE (12%
gel), blotted to the polyvinylidene difluoride membrane, and visualized
by the anti-ampicillinase antibody. Lanes 1 and
8, E. coli XL1-blue harboring pYZ4; lane
2, isolate 1; lane 3, isolate 7; lane 4,
isolate 17; lane 5, isolate 25; lane 6, isolate
37; lane 7, isolate 49; lane 9, isolate 62;
lane 10, isolate 71; lane 11, isolate 76;
lane 12, isolate 77; lane 13, isolate 78. Molecular weight markers in kDa are shown at both ends of the
figure.
-lactam-resistant, whereas the
strains carrying the fusion in the cytoplasm will be
-lactam-susceptible. To ascertain the localization of the hybrid
proteins, we determined ampicillin susceptibility of the cells
harboring the mexA-blaM fusion gene. Table III shows that
all the transformants carrying the mexA-blaM fusion
exhibited the MICs of ampicillin 50 to more than 800 µg/ml. The MIC
of ampicillin for the host cell harboring pYZ4 without BlaM fusion
appeared to be 3.13 µg/ml. These results clearly indicated that the
entire MexA polypeptide is located at the periplasm.
![]()
DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
-lactamase fusion proteins (Table III).
This result is consistent with topology studies previously carried out
for membrane fusion proteins: the ABC transporter in CzcB of A. eutrophus and AcrA, HlyD, and CvaA of E. coli (12-15). However, the investigators constructed only 5, 10, 16, and 11 fusion
protein, in CzcB, AcrA, HlyD, and CvaA, respectively (12-15). This
small number of constructs was not enough to account for the entire
length of polypeptides with a molecular mass of about 50 kDa.

View larger version (41K):
[in a new window]
Fig. 5.
Schematic presentation of the MexA-MexB-OprM
efflux pump assembly. For details, see "Discussion."
a, intimate association between MexA and MexB is essential
for interaction with OprM. b, MexA is located over the large
periplasmic loops of the MexB and interacts with OprM.
| |
ACKNOWLEDGEMENT |
|---|
We are grateful to J. K. Broome-Smith at the University of Sussex, UK, for her kind gift of the plasmids pYZ4 and pKM1 and helpful discussion on the gene fusion technique.
| |
FOOTNOTES |
|---|
* This study was supported in part by grants from the Ministry of Education, Science, Sports, and Culture of Japan, the Ministry of Health and Welfare of Japan under the Microbial Resistance Program, the Japan Society for Promotion of Science, and the Tokai University School of Medicine Project research.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
To whom correspondence should be addressed: Dept. of Molecular
Life Science, Tokai University School of Medicine, Isehara-City, Shimokasuya 259-1193, Japan. Tel.: 81-463-93-5436; Fax:
81-463-93-5437; E-mail: yoneyama@is.icc.u-tokai.ac.jp.
| |
ABBREVIATIONS |
|---|
The abbreviations used are: PBS, phosphate-buffered saline; PAGE, polyacrylamide gel electrophoresis; MIC, minimum inhibitory concentration; Azu, azurin.
| |
REFERENCES |
|---|
|
|
|---|
| 1. | Bryan, L. E. (1979) in Pseudomonas aeruginosa (Doggett, R. G., ed) , pp. 219-270, Academic Press, London |
| 2. | Masuda, N., Sakagawa, E., and Ohya, S. (1995) Antimicrob. Agents Chemother. 39, 645-649[Abstract] |
| 3. | Nakae, T. (1995) Microbiol. Immunol. 39, 221-229[Medline] [Order article via Infotrieve] |
| 4. | Nikaido, H. (1996) Science 264, 382-388 |
| 5. | Moreshed, S. R. M., Lei, Y., Yoneyama, H., and Nakae, T. (1995) Biochem. Biophys. Res. Commun. 210, 356-362[CrossRef][Medline] [Order article via Infotrieve] |
| 6. |
Poole, K.,
Krebes, K.,
McNally, C.,
and Neshat, S.
(1993)
J. Bacteriol.
175,
7363-7372 |
| 7. |
Dinh, T.,
Paulsen, I. T.,
and Saier, M. H., Jr.
(1994)
J. Bacteriol.
176,
3825-3831 |
| 8. | Ma, D., Cook, D. N., Hearst, J., and Nikaido, H. (1994) Trends Microbiol. 2, 489-493[CrossRef][Medline] [Order article via Infotrieve] |
| 9. | Poole, K., Heinrichs, D. E., and Neshat, S. (1993) Mol. Microbiol. 10, 529-544[CrossRef][Medline] [Order article via Infotrieve] |
| 10. |
Guan, L.,
Ehrmann, M.,
Yoneyama, H.,
and Nakae, T.
(1999)
J. Biol. Chem.
274,
10517-10522 |
| 11. | Saier, M. H., Jr., Tam, R., Reizer, A., and Reizer, J. (1994) Mol. Microbiol. 11, 841-847[CrossRef][Medline] [Order article via Infotrieve] |
| 12. |
Rensing, C.,
Pribyl, T.,
and Nies, D. H.
(1997)
J. Bacteriol.
179,
6871-6879 |
| 13. | Schulein, R., Gentscher, I., Mollenkopf, H-J., and Goebel, W. (1992) Mol. Gen. Genet. 234, 155-163[Medline] [Order article via Infotrieve] |
| 14. |
Skvirsky, R. C.,
Reginald, S.,
and Shen, X.
(1995)
J. Bacteriol.
177,
6153-6159 |
| 15. |
Ma, D.,
Cook, D. N.,
Alberti, M.,
Pon, N. G.,
Nikaido, H.,
and Hearst, J. E.
(1993)
J. Bacteriol.
175,
6299-6313 |
| 16. | Zhang, Y., and Broome-Smith, J. K. (1990) Gene 96, 51-57[CrossRef][Medline] [Order article via Infotrieve] |
| 17. | Yoneyama, H., Ocaktan, A., Tsuda, M., and Nakae, T. (1997) Biochem. Biophys. Res. Commun. 233, 611-618[CrossRef][Medline] [Order article via Infotrieve] |
| 18. | Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual , 2nd Ed. , Cold Spring Harbor Laboratory, Cold Spring Harbor, New York |
| 19. | Yoneyama, H., and Nakae, T. (1996) Microbiology (Washington D. C.) 142, 2137-2144[Abstract] |
| 20. | Takeshita, S., Sato, M., Toba, M., Masahashi, W., and Hashimoto-Gotoh, T. (1987) Gene 61, 63-74[CrossRef][Medline] [Order article via Infotrieve] |
| 21. | Fürste, J. P., Pansegrau, W., Frank, W., Blöcker, R., Scholz, H., Bagdasarian, P., and Lanka, E. (1986) Gene 48, 119-131[CrossRef][Medline] [Order article via Infotrieve] |
| 22. |
Mizuno, T.,
and Kageyama, M.
(1978)
J. Biochem. (Tokyo)
84,
179-191 |
| 23. | Laemmli, U. K. (1970) Nature 227, 680-685[CrossRef][Medline] [Order article via Infotrieve] |
| 24. |
Lowry, O. H.,
Rosebrough, N. J.,
Farr, A. L.,
and Randall, R. J.
(1951)
J. Biol. Chem.
193,
265-275 |
| 25. | von Heijne, G. (1992) J. Mol. Biol. 225, 487-494[CrossRef][Medline] [Order article via Infotrieve] |
| 26. | Bowler, L. D., and Spratt, B. D. (1989) Mol. Microbiol. 3, 1277-1286[CrossRef][Medline] [Order article via Infotrieve] |
| 27. | Köhler, T., Michael-Hamzehpour, M., Henz, U., Gotoh, N., Curty, L. K., and Pechere, J. (1997) Mol. Microbiol. 23, 345-354[CrossRef][Medline] [Order article via Infotrieve] |
| 28. |
Li, X.,
Zhang, L.,
and Poole, K.
(1998)
J. Bacteriol.
180,
2987-2991 |
| 29. | Poole, K., Gotoh, N., Tsujimoto, H., Zhao, Q., Wada, A., and Yamasaki, T. (1996) Mol. Microbiol. 21, 713-724[CrossRef][Medline] [Order article via Infotrieve] |
| 30. | Zgurskaya, H. I., and Nikaido, H. (1999) J. Mol. Biol. 285, 409-420[CrossRef][Medline] [Order article via Infotrieve] |
| 31. |
Silver, S.,
and Walderhaug, M.
(1992)
Microbiol. Rev.
56,
195-228 |
| 32. | Yoneyama, H., Ocaktan, A., Gotoh, N., Nishino, T., and Nakae, T. (1998) Biochem. Biophys. Res. Commun. 244, 898-902[CrossRef][Medline] [Order article via Infotrieve] |
This article has been cited by other articles:
![]() |
S.-i. Narita and H. Tokuda Amino Acids at Positions 3 and 4 Determine the Membrane Specificity of Pseudomonas aeruginosa Lipoproteins J. Biol. Chem., May 4, 2007; 282(18): 13372 - 13378. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Masi, J.-M. Pages, C. Villard, and E. Pradel The eefABC Multidrug Efflux Pump Operon Is Repressed by H-NS in Enterobacter aerogenes J. Bacteriol., June 1, 2005; 187(11): 3894 - 3897. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Akama, M. Kanemaki, M. Yoshimura, T. Tsukihara, T. Kashiwagi, H. Yoneyama, S.-i. Narita, A. Nakagawa, and T. Nakae Crystal Structure of the Drug Discharge Outer Membrane Protein, OprM, of Pseudomonas aeruginosa: DUAL MODES OF MEMBRANE ANCHORING AND OCCLUDED CAVITY END J. Biol. Chem., December 17, 2004; 279(51): 52816 - 52819. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. K. Higgins, E. Bokma, E. Koronakis, C. Hughes, and V. Koronakis Structure of the periplasmic component of a bacterial drug efflux pump PNAS, July 6, 2004; 101(27): 9994 - 9999. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Akama, T. Matsuura, S. Kashiwagi, H. Yoneyama, S.-i. Narita, T. Tsukihara, A. Nakagawa, and T. Nakae Crystal Structure of the Membrane Fusion Protein, MexA, of the Multidrug Transporter in Pseudomonas aeruginosa J. Biol. Chem., June 18, 2004; 279(25): 25939 - 25942. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Nehme, X.-Z. Li, R. Elliot, and K. Poole Assembly of the MexAB-OprM Multidrug Efflux System of Pseudomonas aeruginosa: Identification and Characterization of Mutations in mexA Compromising MexA Multimerization and Interaction with MexB J. Bacteriol., May 15, 2004; 186(10): 2973 - 2983. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Maseda, I. Sawada, K. Saito, H. Uchiyama, T. Nakae, and N. Nomura Enhancement of the mexAB-oprM Efflux Pump Expression by a Quorum-Sensing Autoinducer and Its Cancellation by a Regulator, MexT, of the mexEF-oprN Efflux Pump Operon in Pseudomonas aeruginosa Antimicrob. Agents Chemother., April 1, 2004; 48(4): 1320 - 1328. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Chuanchuen, C. T. Narasaki, and H. P. Schweizer The MexJK Efflux Pump of Pseudomonas aeruginosa Requires OprM for Antibiotic Efflux but Not for Efflux of Triclosan J. Bacteriol., September 15, 2002; 184(18): 5036 - 5044. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Guan and T. Nakae Identification of Essential Charged Residues in Transmembrane Segments of the Multidrug Transporter MexB of Pseudomonas aeruginosa J. Bacteriol., March 1, 2001; 183(5): 1734 - 1739. [Abstract] [Full Text] |
||||
![]() |
X.-Z. Li and K. Poole Mutational Analysis of the OprM Outer Membrane Component of the MexA-MexB-OprM Multidrug Efflux System of Pseudomonas aeruginosa J. Bacteriol., January 1, 2001; 183(1): 12 - 27. [Abstract] [Full Text] |
||||
![]() |
K. Poole Efflux-Mediated Resistance to Fluoroquinolones in Gram-Negative Bacteria Antimicrob. Agents Chemother., September 1, 2000; 44(9): 2233 - 2241. [Full Text] |
||||
![]() |
A. Nakajima, Y. Sugimoto, H. Yoneyama, and T. Nakae Localization of the Outer Membrane Subunit OprM of Resistance-Nodulation-Cell Division Family Multicomponent Efflux Pump in Pseudomonas aeruginosa J. Biol. Chem., September 22, 2000; 275(39): 30064 - 30068. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||