|
J Biol Chem, Vol. 275, Issue 8, 5958-5965, February 25, 2000
Structural Analysis of -Enolase
MAPPING THE FUNCTIONAL DOMAINS INVOLVED IN DOWN-REGULATION OF
THE c-myc PROTOONCOGENE*
Aruna
Subramanian and
Donald M.
Miller§¶
From the Comprehensive Cancer Center and Department
of Biochemistry, University of Alabama at Birmingham, Birmingham,
Alabama 35294-3300 and the § James Graham Brown Cancer
Center, University of Louisville, Louisville, Kentucky 40206
 |
ABSTRACT |
Myc-binding protein-1 (MBP-1) is a 37-kDa protein
with sequence homology to the 3' portion of the -enolase gene.
-Enolase is a 48-kDa protein, which plays a critical role in the
glycolytic pathway. MBP-1 binds to the c-myc P2 promoter
and down-regulates c-myc expression. We have investigated
the role of -enolase in regulation of the c-myc
protooncogene. RNase protection assay shows that -enolase is
transcribed into a single RNA species in HeLa cells. A start codon, 400 base pairs downstream of the -enolase ATG, corresponds to the MBP-1
ATG, suggesting that MBP-1 is an alternative translation initiation
product of the -enolase RNA. Domain mapping was performed using
constructs containing truncations of the -enolase gene. In
vitro binding to the c-myc gene was abolished after
deletion of the N-terminal portion of -enolase. In order to
determine the relationship between DNA binding activity and
transcription inhibition, we performed co-transfection assays in HeLa
cells. These studies confirmed that an N-terminal deletion of
-enolase is unable to down-regulate c-myc promoter activity. Our data suggest that -enolase plays an important role in
regulation of c-myc promoter activity in the form of an
alternative translation product MBP-1, which is distinct from its role
as a glycolytic enzyme.
 |
INTRODUCTION |
The c-myc protooncogene is a DNA-binding phosphoprotein
that plays an important role in the regulation of cell growth and differentiation (1, 2). Regulation of c-myc gene expression is quite complex and involves several mechanisms, including changes in
transcription initiation and elongation, RNA stability and turnover,
and translation (3, 4). Overexpression of the c-myc gene is
a common characteristic of many malignant cell types (5). The human
c-myc protooncogene contains two TATA box sequences separated by about 165 base pairs located near the 5' end of the first
exon (6). The transcription of c-myc from P1 and P2 is regulated by a composite of positive and negative elements located both
upstream and downstream of the promoters (7-10).
A human cDNA clone encoding MBP-1 was detected by screening a HeLa
cell cDNA library. The Myc-binding protein-1
(MBP-1)1 is a 37-kDa human
c-myc promoter-binding protein that binds in a region +123
to +153 relative to the c-myc P2 promoter (11). MBP-1 is a
negative regulator of c-myc expression and binds in the
minor groove of the c-myc P2 promoter simultaneously with the TATA-binding protein (12). Consistent with its negative regulation
of c-myc and as a potential tumor suppresser protein, transfection of human breast carcinoma cells with MBP-1 cDNA
results in inhibition of tumor formation in nude mice (13). Exogenous expression of MBP-1 has been suggested to play an important role in the
regulation of human immunodeficiency virus-1 replication in infected
cells (14). Careful sequence
reanalysis2 of MBP-1 has
shown that it has extensive homology to the sequence of the 3' portion
of the -enolase gene (11, 15).
Enolase is the glycolytic enzyme that catalyzes the formation of
phosphoenolpyruvate from 2-phosphoglycerate, the second of the two high
energy intermediates that generate ATP in glycolysis (16). The MBP-1
cDNA shares sequence homology with the -enolase cDNA, which
encodes a 1.8-kb mRNA and a polypeptide of about 48 kDa. The high
degree of sequence homology is confined to the 1.4-kb 3' region of
-enolase and the full-length 1.4-kb MBP-1 and suggests that
-enolase and MBP-1 are both products of the -enolase
gene.2 The presence of an ATG start codon followed by the
Kozak sequence suggests that MBP-1 may be the product of alternate
translation initiation from an in frame internal translation initiation
site 400 bp downstream on the -enolase cDNA (Fig.
1A).
Western blot analysis using an antibody specific to non-neuronal
enolase from human brain (Biogenesis) has identified both 48- and
37-kDa proteins in HeLa nuclear extracts (Fig.
1B). The cellular localization
of -enolase is known to be predominantly cytosolic. The function of
MBP-1 as a down-regulator of c-myc gene expression suggests
that it would be localized in the nucleus. HeLa cell extract made using
Promega reporter lysis buffer (prepared as described under
"Experimental Procedures") is primarily cytosolic and does not show
the presence of MBP-1.

View larger version (22K):
[in this window]
[in a new window]
|
Fig. 1.
A, schematic of sequence alignment of
the -enolase and MBP-1 cDNAs. The nucleotide sequences
surrounding the in-frame methionine codons of the -enolase cDNA
are shown. The nucleotides that fit the Kozak consensus cassette are
underlined. B, two -enolase gene products can
be identified in HeLa nuclear extracts: -enolase protein (lane
1), HeLa cell extract (lane 2), and HeLa nuclear
extract (lane 3) were assayed by immunoblotting with an
-enolase antibody. Positions of the molecular mass standards are
indicated. HeLa extracts assayed contained 5 µg of protein.
|
|
The presence of MBP-1 in nuclear extracts corroborates with its role in
down-regulation of c-myc promoter activity. -Enolase constructs are able to down-regulate c-myc promoter
activity, albeit to a lower extent than MBP-1.2 On the
other hand, preliminary experiments indicate that MBP-1 does not have
enolase enzyme activity.3
Here we have studied the structure-function relationship of -enolase as a negative regulator of c-myc activity using DNA binding
studies and transfection assays. Our results suggest that the
c-myc down-regulating activity of -enolase lies in the
N-terminal region of the protein also present in the alternative
translation initiation product MBP-1.
 |
EXPERIMENTAL PROCEDURES |
RNase Protection Assay--
The -enolase fragment from 181 to
600, containing the MBP-1 start site, was PCR-amplified and subcloned
into the pBluescript II SK vector (Stratagene). In order to make an
antisense RNA probe, the vector containing the 420-base pair
-enolase fragment was linearized with XhoI and in
vitro transcribed with T3 RNA polymerase and
[ -32P]CTP, using a Maxiscript T3 kit (Ambion). Labeled
probe was purified on 5% acrylamide, 8 M urea denaturing
gel and eluted overnight at 37 °C. RNase protection assay was
carried out using the RPA II kit (Ambion). The antisense cRNA probe
(1 × 106 cpm) was hybridized overnight at 37 °C
with increasing concentrations of HeLa cell RNA and then digested with
RNase A (0.5 units) and RNase T1 (20 units) for 30 min at 37 °C.
Hybridization was also performed with in vitro transcribed
-enolase and MBP-1 RNA as controls. Following ethanol precipitation,
protected fragments were separated on a 6% acrylamide, 8 M
urea denaturing gel. The sizes of the protected fragment were
determined by running a labeled Century RNA marker (Ambion) alongside.
Plasmid Construction--
The N-terminal truncations of
-enolase were generated by PCR using upstream primers that contained
the start codon. Downstream primers containing the stop codon were used
to PCR-amplify the C-terminal deletions. The PCR products were then
cloned directly into the PCR 2.1 vector using the TA cloning kit
(Invitrogen). From PCR 2.1, they were excised and cloned directionally
into the pCITE (Novagen) and pBluescript (Stratagene) vectors under control of the T7 promoter. The full-length -enolase cDNA was also cloned into these vectors. The pCITE clones were used for in
vitro transcription and translation, while the pBluescript clones
were expressed in BL21(DE3) cells. For transfection assays, the
-enolase cDNA and its deletion mutants were cloned into the pBKCMV vector (Stratagene) under control of the CMV promoter.
Site-directed Mutagenesis--
Site-directed mutagenesis was
performed using the QuikChange kit from Stratagene. Full-length
-enolase cloned into the pCITE vector was used as the template for
mutagenesis of the MBP-1 ATG. Two oligonucleotide primers, each
complementary to the opposite strands of the vector, and containing a
G C mutation were designed and extended by PCR following the
manufacturer's instructions. After incubating the PCR products with
DpnI to digest dam-methylated E. coli
DNA, the plasmid was transformed into competent cells. To make two
G C mutations, -enolase DNA containing the first mutation was used
as the template with a new set of primers containing the second
mutation. The plasmid DNA obtained from the cells was sequenced to
determine the presence of the mutations. The point-mutated -enolase
in the pCITE vector under control of the T7 promoter were linearized
with XhoI downstream of the insert and used for in
vitro transcription and translation. The point-mutated -enolase DNAs were also cloned into the pBKCMV vector for transient transfection assays.
In Vitro Transcription and Translation--
The pCITE vector
containing the full-length and truncated -enolase cDNA under
control of the T7 promoter was linearized at the XhoI site
downstream of the coding sequence. RNA was generated by in
vitro transcription using the MEGAscript system (Ambion). RNA
transcripts were quantified by absorbance at 260 nm and ethidium bromide staining on an agarose gel allowed verification of their integrity. In vitro translation in rabbit reticulocyte
lysate (Red Nova lysate from Novagen) was performed as per
instructions. Translation reactions were performed with
[35S]methionine, and the in vitro translated
products were analyzed directly by electrophoresis on a 12.5%
SDS-polyacrylamide gel. This procedure was also followed for the point
mutants of -enolase generated by site-directed mutagenesis.
Electrophoretic Mobility Shift Assay (EMSA)--
EMSA was
performed as described previously with some modification (17).
Full-length -enolase and its deletion mutants cloned into the
pBluescript vector were expressed in BL21(DE3) cells and
isopropyl-1-thio- -D-galactopyranoside induced as
described previously (11). The induced proteins were separated on a
12.5% SDS-polyacrylamide gel and analyzed by Coomassie staining. The 45-bp double-stranded oligonucleotide
(GGAGGGATCGCGCTGAGTATAAAAGCCGGTTTTCGGGGCTTTATC) corresponding to the P2 promoter region of c-myc was
32P-labeled and used as probe. The underlined G in the
above sequence was mutated to T, and this mutant c-myc probe
was used as unlabeled competitor. 15 µg of the extracts prepared from
the induced cultures were incubated with the probe (2 ng,
104 cpm) in the EMSA buffer (10 mM HEPES, pH
7.9, 100 mM KCl, 1 mM dithiothreitol, 0.05 mM EDTA, 2.5 mM MgCl2 and 6%
glycerol) in the presence of 2 mg of poly(dI-dC)·poly(dI-dC) on ice
for 30 min. Unlabeled competitor oligonucleotide or 2 µl of antibody (1 µg/µl) were incubated with the protein for 30 min on ice before addition of the labeled oligonucleotide. The resulting complexes were
then separated on a native 5% polyacrylamide gel at room temperature
in 1× Tris borate-EDTA at 10 V/cm. After electrophoresis, gel
retardation was visualized by autoradiography.
Cell Line--
The HeLa human cervical carcinoma cell line was
stably transfected with the luciferase reporter gene under control of
the c-myc P2 promoter. These stably transfected cells were
called MYC1 cells. All transient transfection assays were performed in MYC1 cells.
Transfection--
MYC1 cells were plated at an initial density
of 5 × 104 cells/well of a 24-well plate in
Dulbecco's modified Eagle's medium supplemented with 10% fetal calf
serum. Immediately prior to transfection, cells were washed three times
with sterile phosphate-buffered saline. Transient transfection of the
MYC1 cells with pBKCMV clones of full-length -enolase and its
mutants was carried out using the lipid DOTAP/DOPE method. To normalize
the transfection efficiency, the SV40-based -galactosidase
expression plasmid (SV40- -gal) was co-transfected. To transfect one
well, 8 µg of DOTAP/DOPE (1 µg/µl) was mixed with 1 µg of each
vector and incubated at room temperature for 15 min. The liposome/DNA
complexes were mixed with 500 µl of serum free media and added to
each well. Plates were incubated for 4 h at 37 °C, 500 µl of
Dulbecco's modified Eagle's medium containing 20% fetal calf serum
was then added, and cells were incubated for 24 h at 37 °C.
Luciferase Assays--
Cell extracts were made by lysing the
cells in each well of a 24-well plate with 100 µl of freshly diluted
1× Reporter lysis buffer (Promega, selected for its low background in
protein assays), which allows extracts to be used for Western blot
analysis, luciferase, and -galactosidase assays. Lysis was performed
for 30 min at room temperature with rocking. Lysate was transferred to
a 1.5-ml polypropylene tube and centrifuged at 16,000 × g for 4 min to pellet cell debris. The HeLa cell extracts
prepared in this manner are primarily cytoplasmic with minimal or no
nuclear material. Supernatant was transferred to a fresh tube and
protein concentration determined with the Bio-Rad protein assay kit
according to the manufacturer's protocol (Bio-Rad). Cell extracts were
assayed for both -galactosidase and luciferase activity at 24 h
after transfection. 50 µl of extract was added to 100 µl of
luciferase assay substrate (Promega) in a clear 12 × 75-mm
polystyrene tube. Samples were read immediately on a luminometer
(Analytical Luminescence Laboratory) and light production (relative
light units) measured for 10 s. Each value of luciferase activity
is normalized against -galactosidase and represents the mean ± S.D. from at least three independent experiments, each performed in triplicate.
Western Blotting--
Cell extracts were made as described above
from the MYC1 cells transfected with the pBKCMV expression vectors
encoding full-length -enolase or its mutants under control of the
CMV promoter and analyzed by Western blot analysis. The proteins were
electrophoresed on a 12.5% SDS-polyacrylamide gel and transferred to
polyvinylidene difluoride (Millipore) membrane by electroblotting
overnight (15 V). The -enolase proteins were detected using an
antibody specific to non-neuronal enolase from human brain raised in
sheep as a host (Biogenesis) and a chemiluminescence kit (ECL
detection, Amersham Pharmacia Biotech) according to the manufacturer's
instructions. HeLa whole cell and nuclear extracts containing 5 µg of
protein were also analyzed by Western blot analysis.
Northern Blotting--
RNA was isolated from the transiently
transfected MYC1 cells and analyzed for levels of expression of message
from the transfected constructs by Northern hybridization. The probe
was the 1.8-kb full-length -enolase cDNA labeled with
[ -32P]dCTP using Ready-To-Go DNA labeling beads
(Amersham Pharmacia Biotech). Hybridizations were performed at 42 °C
overnight in 5 ml of formamide and 100 µl of denatured salmon sperm
DNA. Filters were washed at moderate stringency (0.1× SSC, 1% SDS,
42 °C) and exposed to x-ray film overnight.
 |
RESULTS |
Expression of the -Enolase Transcript--
Although we have
hypothesized that MBP-1 and -enolase are alternate translation
products of a single -enolase mRNA, it is important to document
this fact. RNase protection assay was used to analyze expression of the
-enolase transcript. A cRNA antisense probe of 420 nucleotides
corresponding to nucleotides 181-600 of -enolase, containing the
MBP-1 start site at position 386, was synthesized together with Century
RNA markers (Ambion). The radiolabeled cRNA probe was hybridized to
total RNA derived from HeLa cells and to in vitro
transcribed -enolase and MBP-1 RNA as control (Fig.
2). In total HeLa cell RNA, a
420-nucleotide fragment was protected corresponding to the fragment
observed in the in vitro transcribed -enolase mRNA
control lane. The MBP-1 control RNA protected a 220-nucleotide fragment
that was not seen in the HeLa cell RNA. These data confirm our
hypothesis that expression of the -enolase gene gives rise to a
single transcript and that an MBP-1-specific mRNA is not
transcribed. This would also indicate that MBP-1 is not a product of
alternative RNA splicing.

View larger version (68K):
[in this window]
[in a new window]
|
Fig. 2.
RNase protection analysis using an
-enolase cDNA- derived riboprobe. A 420-bp
fragment from 181-600 nucleotides of -enolase was transcribed and
used as probe as described under "Experimental Procedures."
Lane 1 shows the RNA markers of 500, 400, 300, 200, and 100 nucleotides in length. Lanes 2 and 3 show the undigested and
digested 450-nucleotide RNA probe, respectively. Lanes 4 and
5 show RNase protection of indicated amounts of the in
vitro transcribed -enolase RNA. Lanes 6 and
7 show the 220-nucleotide fragment protected by the in
vitro transcribed MBP-1 RNA. Lanes
8-11 show RNase protection of the probe after
hybridization with indicated amounts of HeLa cell RNA.
|
|
Site-directed Mutagenesis of MBP-1 ATG on -Enolase DNA--
In
order to confirm that MBP-1 is a product of translation initiation from
an internal ATG on the -enolase cDNA, site-directed mutagenesis
was performed (Fig. 3A). The
ATG codon for methionine at position 97 of -enolase was transformed
into the ATC codon for isoleucine (Enomut1). This mutation failed to
abolish translation of the MBP-1 protein from the -enolase cDNA.
This may have been due to the presence of another in frame ATG at
position 377 of -enolase, six bases upstream of the first ATG,
coding for methionine 94, which could have been used for translation.
After mutating methionine 94 to isoleucine (Enomut2), a 37-kDa MBP-1
protein band was still visible. Site-directed mutagenesis at both
positions was performed on the same template DNA and the resulting
-enolase cDNA (Enomut3) translated into a single protein of 48 kDa (Fig. 3B).

View larger version (32K):
[in this window]
[in a new window]
|
Fig. 3.
A, the drawing shows the locations of
the separate site-directed mutations introduced into the -enolase
cDNA. Mutations were verified by nucleotide sequencing of the
mutated regions. B, in vitro translation of
-enolase RNA. In vitro transcribed RNAs from MBP-1
cDNA and from the wild type and point-mutated -enolase cDNAs
were translated in a rabbit reticulocyte lysate system, and the
products were analyzed as described in "Experimental Procedures".
Lane 1, negative control; lane
2, wild type -enolase generating -enolase and MBP-1
proteins; lane 3, MBP-1; lane
4, ATG (coding methionine 97) ATC mutant;
lane 5, ATG (coding methionine 94) ATC
mutant; lane 6, ATG (coding methionine 94 and 97)
ATC mutants. MBP-1 translation is abolished. C, Western
blot analysis. The MBP-1 cDNA and wild type and point-mutated
-enolase cDNAs under control of the CMV promoter were
transfected into HeLa cells and expression assayed by immunoblotting
with -enolase antibody. The -enolase and MBP-1 bands are
indicated. Lane 1, pure human -enolase
positive control; lane 2, pBKCMV vector control
showing endogenous -enolase expression; lane
3, CMV -enolase; lane 4, CMVMBP-1;
lane 5, CMV promoter controlled ATG ATC
mutations of methionines at position 94 and 97 of -enolase
(CMVEnomut3).
|
|
In order to determine if the -enolase protein could down-regulate
c-myc promoter activity in the absence of MBP-1 translation, Enomut3 cloned under control of the CMV promoter was used in transient transfection assays as described under "Experimental Procedures." Extracts from the MYC1-transfected cells were analyzed by Western blot,
and similar levels of protein were observed (Fig. 3C).
Luciferase assay results show that, although full-length -enolase
down-regulates c-myc promoter activity by about 40%,
Enomut3, which does not generate MBP-1 on translation, is able to
repress it by less than 20% (Fig. 4).
This indicates that the c-myc down-regulating activity of
-enolase lies in the alternative translation product MBP-1.

View larger version (29K):
[in this window]
[in a new window]
|
Fig. 4.
Regulation of c-myc promoter
activity in MYC1 cells. The effect of MBP-1 and of wild type and
point-mutated -enolase on c-myc promoter activity was
measured as luciferase activity in transfected MYC1 cells (see
"Experimental Procedures"). To eliminate the influence of
transfection efficiency, all data from the luciferase assays were
normalized against -galactosidase activity and presented as the
mean ± S.D. from at least three independent experiments, each
performed in triplicate. The activity of the c-myc promoter
when co-transfected with control (empty) pBKCMV expression vector was
assigned a value of 100.
|
|
Construction and Expression of -Enolase Deletion
Mutants--
We have demonstrated that -enolase has
c-myc down-regulation activity, although less significant
than MBP-1. In order to map the functional domains of -enolase, a
series of N and C-terminal deletion mutants were made. The set of
-enolase mutants generated is summarized in Fig.
5A. Each mutant was named for
the amino acids deleted; for example, Eno 1-236 has amino acids
1-236 deleted. Eno 1-96 is MBP-1. The expression plasmids were
tested for their ability to express full-length -enolase and its
deletion mutants. All the expression plasmids generated polypeptides of
the appropriate size after in vitro transcription and
translation (Fig. 5B). The C-terminal truncations
Eno 242-434 and Eno 373-434 also generated smaller peptides of
15 and 26 kDa, respectively, due to translation from the internal
initiation site. The 15-kDa band is not visible in Fig. 5B,
as it ran with the dye front on the gel.

View larger version (32K):
[in this window]
[in a new window]
|
Fig. 5.
A, schematic of N and C-terminal
deletion mutants of the -enolase cDNA. Each mutant was named for
the amino acids deleted, for example Eno 1-236 has amino acids
1-236 deleted. Eno 1-96 is MBP-1. B, expression of the
various deletion mutants of -enolase. In vitro
transcribed RNAs were translated in rabbit reticulocyte lysate and
separated on a 12.5% SDS-polyacrylamide gel. Arrows
indicate the positions of the full-length -enolase and deletion
mutant proteins. The positions of standards in kDa are indicated.
|
|
Binding of -Enolase and Its Deletion Mutants to the c-myc P2
Promoter--
It has been shown previously that MBP-1 binds to the
c-myc P2 promoter (11). EMSA was performed with a 50-base
pair labeled c-myc probe (see "Experimental procedures")
and lysates from induced BL21(DE3) cells expressing -enolase and its
deletion mutants. The in vitro translated full-length and
truncated -enolase proteins were initially used for gel shift
analysis. However, addition of any of the in vitro
translated proteins to the 50-base pair labeled c-myc
oligonucleotide caused a shift to the same extent in every lane. We
soon realized that endogenous enolase from Rabbit reticulocyte lysate
(in which the in vitro translation is carried out)
interfered with the EMSA. In order to get around the problem of
interference from endogenous -enolase, bacterially expressed proteins were made and used in EMSAs. The crude bacterial extracts, when analyzed by SDS-polyacrylamide gel electrophoresis and
Coomassie-stained, indicated the presence of the translation products
from full-length -enolase and its deletion mutants. However, the
smaller peptides due to translation from the internal initiation site
on the C-terminal deletions, Eno 242-434 and Eno 373-434, were
not observed (data not shown). A specific DNA-protein complex was
visualized by autoradiography in all the -enolase deletion mutants
except Eno 1-236. The visible DNA-protein complexes were not
disrupted upon addition of 100-fold molar excess of a mutant cold
competitor (Fig. 6A). The
unlabeled oligonucleotide used as competitor has been described
previously (11) and has a mutation that prevents binding of MBP-1 to
the DNA. A polyclonal -enolase antibody was able to bind to and
supershift the DNA-protein complexes (Fig. 6B). An antibody
to human c-myc was unable to supershift the full-length
-enolase-DNA complex, indicating that the supershifts obtained using
the -enolase antibody are specific. Deletion of amino acids 1-236
of -enolase prevents the protein from binding to the
c-myc P2 promoter. These results indicate that the DNA
binding region of the -enolase protein lies between amino acids 96 and 236.

View larger version (39K):
[in this window]
[in a new window]
|
Fig. 6.
A, electrophoretic mobility shift assay
of 32P-labeled, 50-base pair c-myc P2 promoter
with full-length -enolase and its deletion mutants expressed in
BL21(DE3) cells was performed as described under "Experimental
Procedures." The position of the unbound probe is indicated.
Lane 1, labeled probe; lane 2, vector-transformed
bacterial extract is used as control; lanes 3-7, 15 µg of
bacterially expressed protein as indicated; lane 8, 100-fold
molar excess of unlabeled 50-bp c-myc probe is added as
competitor; lanes 9-13, 100-fold molar excess of unlabeled
mutant Myc oligonucleotide is added as competitor to show the
specificity of the DNA-protein complexes formed. The protein used in
each reaction is indicated on the top of each lane.
B, EMSA showing supershift of the DNA-protein complexes
formed using an antibody to -enolase. The bacterial extracts
expressing full-length -enolase and its deletion mutants (as
indicated above each lane) were incubated with 2 µl of
-enolase antibody for 30 min on ice before adding labeled
c-myc probe (lanes 3-7). Antibody to human
c-myc was used as a negative control (lane
2).
|
|
Down-regulation of c-myc Promoter Activity by -Enolase and Its
Deletion Mutants--
MBP-1 has been shown to down-regulate
c-myc promoter activity (11). HeLa cells stably transfected
with the luciferase reporter gene under control of the c-myc
promoter (MYC1 cells) were transiently transfected with -enolase and
its deletions under control of the CMV promoter. Northern and Western
blot analysis confirmed expression of the mutated forms of -enolase
in the transfected cells (Fig. 7,
A and B). Similar levels of RNA were expressed from -enolase and its truncations in the MYC1 cells. Levels of protein expression from -enolase and its deletion mutants were quantified by densitometry and found to be comparable. The shorter peptide of 26 kDa translated from the internal initiation site of the
C-terminal deletions Eno 373-434 is also generated upon transfection
into MYC1 cells and can be seen in Fig. 7B. The 15-kDa peptide generated by translation initiation from the internal ATG on
Eno 242-434, which ran along with the dye front on the SDS gel, is
not shown in Fig. 7B. However, the amount of protein translated from the internal ATG is far less than that from the first
ATG of these constructs. Hence, the effect observed on c-myc promoter activity in transient transfection assays is thought to be
predominantly due to the larger proteins.

View larger version (41K):
[in this window]
[in a new window]
|
Fig. 7.
A, Northern blotting of mRNAs from
transfected HeLa cells. Total RNA was purified and analyzed by Northern
blotting as described under "Experimental Procedures" using the
32P-labeled, 1.8-kb -enolase cDNA as probe. The
plasmid used for transfection is indicated on the top of each lane.
Size standard RNAs are indicated. Blots were stripped and reprobed with
a labeled -actin cDNA probe to control for errors in gel
loading. B, expression of full-length -enolase and
deletion mutants in transfected HeLa cells was analyzed by
immunoblotting with antibody to -enolase. The positions of the bands
in kDa are indicated.
|
|
The effect of -enolase and its deletion mutants on c-myc
promoter activity were measured as luciferase activities in transfected MYC1 cells. The results indicate that Eno 1-236 does not
down-regulate c-myc promoter activity as efficiently as
full-length -enolase (Fig. 8). The
MBP-1 protein down-regulates c-myc promoter activity by
65%. These results correspond with the EMSA results and show that the
DNA binding and c-myc down-regulating activity of
-enolase lies between amino acids 96 and 236.

View larger version (31K):
[in this window]
[in a new window]
|
Fig. 8.
The effect of the
-enolase deletion mutants on c-myc
promoter activity was measured as luciferase activity in
transfected HeLa cells as described under "Experimental
Procedures." The data shown have been normalized to
-galactosidase activity and are the ±S.D. from at least three
independent experiments each performed in triplicate.
|
|
 |
DISCUSSION |
The role of -enolase as a glycolytic enzyme has been very well
characterized. The -enolase gene is transcribed into a single RNA
species, as proven by the RNase protection assay. Here we show that at
least two proteins arise from the alternative usage of translation
initiation sites present on the -enolase mRNA. MBP-1, which
negatively regulates c-myc promoter activity, was initially
identified from a human cervical carcinoma cell expression library.
Previous work (13) has demonstrated that this alternate translation
product of the -enolase gene acts as a tumor suppresser when
transfected into human breast carcinoma cells, largely preventing anchorage-independent growth and the growth of tumors in nude mice.
We examined the MBP-1 and -enolase cDNA coding sequences and
observed complete sequence homology between the MBP-1 sequence and the
1.4-kb 3' region of -enolase. A potential translation initiation
site at codon 97 of -enolase was observed, and the sequence
surrounding this ATG triplet exhibits an overall sequence homology to
the Kozak consensus cassette (18).
In a construct in which the ATG at codon 97 on the -enolase cDNA
was mutated to ATC (Enomut1), MBP-1 translation was not abolished.
Another in-frame ATG at codon 94 was observed and, after mutation of
this ATG to generate Enomut2, -enolase and MBP-1 continued to be
translated. However, when both the ATGs were mutated (Enomut3),
-enolase was the sole product of translation. Because Enomut3 gives
rise to just the 48-kDa -enolase, we can exclude the possibility
that MBP-1 arises from proteolytic cleavage of the complete protein.
Western blot analysis of pure human -enolase shows the presence of a
single band of ~48 kDa. Even after incubation of the pure human
-enolase protein in a transcription/translation system, no smaller
fragment the size of MBP-1 could be observed by Western blotting (data
not shown). Full-length -enolase cDNA after in vitro
transcription/translation gives rise to both -enolase and MBP-1
protein bands. The ratio of these two proteins remains constant when
checked on a gel after storage for a considerable period of time. These
results further confirm that MBP-1 is not a product of proteolytic
cleavage of -enolase. The single -enolase mRNA is
alternatively translated from methionine 94 or 97 to yield MBP-1. Our
data do not allow us to distinguish whether MBP-1 is translated from
the codon for methionine at position 94 or 97 on the -enolase mRNA.
Of the two isoforms of -enolase, MBP-1 better down-regulates
c-myc promoter activity. In transient transfection assays in HeLa cells, -enolase is unable to down-regulate activity of the c-myc promoter efficiently after mutation of the internal
translation initiation site to prevent translation of MBP-1. The
~20% down-regulation of c-myc promoter activity observed
after transfection with Enomut3 is due to the binding of the
full-length -enolase to the c-myc P2 promoter. These
results suggest that the -enolase gene is bifunctional, encoding two
proteins, one of which has a role in glycolysis and the other in
regulation of c-myc expression.
Evidence to suggest that -enolase may have functions other than as a
glycolytic enzyme has been generated earlier in yeast, other
vertebrates, and mammalian cells (19, 20). These include either a
direct function or indirect role in processes such as thermal
tolerance, growth control, and hypoxia tolerance (21). A structural
role in the lens of some species has been exhibited by -enolase
(22). It also functions as a cell surface receptor for plasminogen,
resulting in enhanced plasminogen activation and localization of the
proteolytic activity of plasmin on cell surfaces (23). The presence of
-enolase on the surface of pathogenic streptococci has recently been
demonstrated (24). The streptococcal surface enolase is thought to play
an important role in the disease process and in post-streptococcal
autoimmune diseases.
Our results demonstrate that MBP-1 is a product of internal translation
initiation from the -enolase gene. Internal initiation has been
described for other genes such as those for C/EBP and (25), Myc
(26), GATA-1 (27), CREM / (28), N-Oct-3 (29), and Oct-4 (30), and
appears to be an efficient and rapid means to modulate their activity.
Moreover, in most of the reported cases, this mechanism is
evolutionarily preserved in rodents and humans. It has been observed
that the in-frame internal ATGs at codons 94 and 97 of -enolase are
conserved across the human, rat, mouse, chicken, duck, and frog
-enolase sequence (31-34). The two GATA-1 isoforms share identical
binding activity but differ in their transactivation potential and in
their expression in developing mouse embryos. The 30-kDa protein
generated by alternative translation initiation of C/EBP (42 kDa)
lacks antimitotic activity (35). Although there are numerous examples
of alternative translation products, the broad disparity of function
between -enolase and MBP-1 appears to be unique.
Our preliminary observations indicate that MBP-1 lacks -enolase
enzyme activity.3 Although the cellular localization for
the -enolase protein has been thought to be predominantly cytosolic,
the presence of MBP-1 is observed only in the nuclear extract from HeLa
cells. The functional significance of this may lie in the negative
regulation of expression of the c-myc protooncogene by the
MBP-1 isoform of -enolase. This may represent a mechanism for
negative feedback regulation of c-myc. It has been shown
that Myc overexpression up-regulates liver carbohydrate metabolism
3-5-fold (36, 37). Furthermore, Myc overexpression is thought to
counteract diabetic hyperglycemia by inducing hepatic glucose uptake
and utilization and therefore blocking gluconeogenesis. Although there
is no direct evidence of the regulation of -enolase promoter
function by Myc, the plausibility of up-regulation of -enolase by
the overall carbohydrate hypermetabolic state cannot be ruled out.
Up-regulated expression of glycolytic enzymes (pyruvate kinase,
phosphofructokinase and glucokinase) as well as up-regulated glycolysis
has been shown to occur as a consequence of Myc overexpression. This is
thought to be due to the presence of two imperfect CACGTG motifs (5 out
of 6 bases match) in the carbohydrate response element of the pyruvate
kinase gene (38). Two perfect Myc-Max binding motifs (CACGTG) are also
present in the promoter of the -enolase gene (39). These findings
along with our observation of the bifunctional role of -enolase as a
glycolytic enzyme and regulator of c-myc expression present
a model that places c-myc and -enolase at the
intersection of energy metabolism and growth control.
We have used deletion mutants of -enolase to characterize its
functional domains. The finding that MBP-1 (Eno 1-96) binds to the
c-myc P2 promoter, but Eno 1-236 does not, indicates that the amino acids between 96 and 236 of -enolase are essential for DNA
interaction. Among the -enolase deletion mutants, MBP-1 was the most
efficient down-regulator of c-myc promoter activity. Our
results from the transient transfection assays corroborate those from
the DNA binding studies, since Eno 1-236 was unable to down-regulate
c-myc promoter activity. Both the C-terminal deletions of
-enolase (Eno 242-434 and Eno 373-434) contained amino acids
96-236 and were able to down-regulate expression of the
c-myc promoter by at least 40% of its activity. The region between amino acids 96 and 236 is present in the MBP-1 isoform of
-enolase, which has been shown to down-regulate c-myc
expression by 65%.
This result is consistent with the previously published work of Ghosh
et al. (40), which demonstrated transcriptional repression activity in the N-terminal portion of MBP-1. Our data show, however, that DNA binding activity correlates nicely with ability to inhibit transcription of c-myc. As seen by mutating methionine 94 and 97, the c-myc down-regulating activity of -enolase is
lost, by abolishing translation of the MBP-1 isoform. Thus, it is
possible that the bifunctional role of -enolase could be modulated
by the varying ratio of the two isoforms.
The existence of two -enolase isoforms with distinct functions
presents a unique example of a gene encoding proteins with roles in
metabolism and cell proliferation. Our data suggest that, while the
-enolase isoform functions as the glycolytic enzyme, the N-terminal
region of the MBP-1 isoform is important in binding to and
down-regulating expression of the c-myc gene. The MBP-1 isoform has been shown to inhibit anchorage-independent cell growth and
tumor growth in nude mice (13). The manner in which the coding capacity
of the -enolase mRNA for the two protein isoforms is regulated
has not been ascertained. Internal ribosome entry constitutes a novel
mechanism of gene expression regulation. This has been shown in the
case of FGF-2, whose CUG-initiated isoforms are translationally
activated in response to stress (41). Whether this kind of initiation
from the presence of an internal ribosome entry site occurs in the case
of MBP-1 remains to be determined.
 |
FOOTNOTES |
*
The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
¶
To whom correspondence should be addressed: 529 S. Jackson
St., Louisville, KY 40206. Tel.: 502-562-4790; Fax: 502-562-4368; E-mail: donaldmi@ulh.org.
2
D. Chaudhary, A. Subramanian, R. Ray, and D. M. Miller, submitted for publication.
3
A. Subramanian, J. O. Trent, and D. M. Miller,
unpublished data.
 |
ABBREVIATIONS |
The abbreviations used are:
MBP, Myc-binding
protein;
EMSA, electrophoretic mobility shift assay;
bp, base pair(s);
kb, kilobase pair(s);
PCR, polymerase chain reaction;
CMV, cytomegalovirus;
DOTAP/DOPE, 1,2 dioleyl glycero
3-phosphoethanolamine/3-trimethyl ammonium propane.
 |
REFERENCES |
| 1.
|
Marcu, K. B.,
Bossome, S. A.,
and Patel, A. J.
(1992)
Annu. Rev. Biochem.
61,
809-860[CrossRef][Medline]
[Order article via Infotrieve]
|
| 2.
|
Spencer, C. A.,
and Groudine, M.
(1991)
Adv. Cancer Res.
56,
1-48[Medline]
[Order article via Infotrieve]
|
| 3.
|
Bentley, D. L.,
and Groudine, M.
(1986)
Nature
321,
702-706[CrossRef][Medline]
[Order article via Infotrieve]
|
| 4.
|
Levine, R. A.,
McCormack, J. E.,
Buckler, A.,
and Sonenshein, G. E.
(1986)
Mol. Cell. Biol.
6,
4112-4116[Abstract/Free Full Text]
|
| 5.
|
Cole, M.
(1986)
Annu. Rev. Genet.
20,
361-384[CrossRef][Medline]
[Order article via Infotrieve]
|
| 6.
|
Battey, J.,
Moulding, C.,
Tabu, R.,
Murphy, W.,
Stewart, T.,
Potter, M.,
Lenoir, G.,
and Leder, P.
(1983)
EMBO J.
2,
2375-2383[Medline]
[Order article via Infotrieve]
|
| 7.
|
Chung, J.,
Shin, E.,
Reed, R. R.,
and Leder, P.
(1986)
Proc. Natl. Acad. Sci. U. S. A.
83,
7918-7922[Abstract/Free Full Text]
|
| 8.
|
Hay, N.,
Bishop, J. M.,
and Levens, D.
(1987)
Genes Dev.
1,
657-671
|
| 9.
|
Lipp, M.,
Schilling, R.,
Wiest, S.,
Laux, G.,
and Bornkamm, G. W.
(1987)
Mol. Cell. Biol.
7,
1393-1400[Abstract/Free Full Text]
|
| 10.
|
Siebenlist, U.,
Hennighausen, L.,
Battey, J.,
and Leder, P.
(1984)
Cell
37,
381-391[CrossRef][Medline]
[Order article via Infotrieve]
|
| 11.
|
Ray, R.,
and Miller, D. M.
(1991)
Mol. Cell. Biol.
11,
2154-2161[Abstract/Free Full Text]
|
| 12.
|
Chaudhary, D.,
and Miller, D. M.
(1995)
Biochemistry
34,
3438-3445[CrossRef][Medline]
[Order article via Infotrieve]
|
| 13.
|
Ray, R. B.,
Steele, R.,
Seftor, E.,
and Hendrix, M.
(1995)
Cancer Res.
55,
3747-3751[Abstract/Free Full Text]
|
| 14.
|
Ray, R. B.,
and Srinivas, R. V.
(1997)
J. Cell. Biochem.
64,
565-572[CrossRef][Medline]
[Order article via Infotrieve]
|
| 15.
|
Giallongo, A.,
Feo, S.,
Moore, R.,
Croce, C. M.,
and Showe, L.
(1986)
Proc. Natl. Acad. Sci. U. S. A.
83,
6741-6745[Abstract/Free Full Text]
|
| 16.
|
Wold, F.
(1971)
in
The Enzymes
(Boyer, P. D., ed), 3rd Ed., Vol. 5
, pp. 499-508, Academic Press, New York
|
| 17.
|
Kim, C.,
Snyder, R. O.,
and Wold, M. S.
(1992)
Mol. Cell. Biol.
12,
3050-3059[Abstract/Free Full Text]
|
| 18.
|
Kozak, M.
(1986)
Cell
44,
283-292[CrossRef][Medline]
[Order article via Infotrieve]
|
| 19.
|
Cooper, J. A.,
Reiss, N. A.,
Schwartz, R. J.,
and Hunter, T.
(1983)
Nature
302,
218-223[CrossRef][Medline]
[Order article via Infotrieve]
|
| 20.
|
Graven, K. K.,
Zimmerman, L. H.,
Dickson, E. W.,
Weinhouse, G. L.,
and Farber, H. W.
(1993)
J. Cell. Physiol.
157,
544-554[CrossRef][Medline]
[Order article via Infotrieve]
|
| 21.
|
Aaronson, R. M.,
Graven, K. K.,
Tucci, M.,
McDonald, R. T.,
and Farber, H. W.
(1995)
J. Biol. Chem.
270,
27752-27757[Abstract/Free Full Text]
|
| 22.
|
Wistow, G. J.,
Lietman, T.,
Williams, L. A.,
Stapel, S. O.,
de Jong, W. N.,
Horwotz, J.,
and Piatigorsky, J.
(1988)
J. Cell Biol.
107,
2729-2736[Abstract/Free Full Text]
|
| 23.
|
Miles, L. A.,
Dahlberg, C. M.,
Plesia, J.,
Felez, J.,
Kato, K.,
and Plow, E. F.
(1991)
Biochemistry
30,
1682-1691[CrossRef][Medline]
[Order article via Infotrieve]
|
| 24.
|
Pancholi, V.,
and Fischetti, V. A.
(1998)
J. Biol. Chem.
273,
14503-14515[Abstract/Free Full Text]
|
| 25.
|
Ossipow, V.,
Descombes, P.,
and Schibler, V.
(1993)
Proc. Natl. Acad. Sci. U. S. A.
90,
8219-8223[Abstract/Free Full Text]
|
| 26.
|
Hann, S. H.,
Dixit, M.,
Sears, R. C.,
and Sealy, L.
(1994)
Genes Dev.
8,
2441-2452[Abstract/Free Full Text]
|
| 27.
|
Calligaris, R.,
Bottardi, S.,
Cogoi, S.,
Apeztegria, I.,
and Santoro, C.
(1995)
Proc. Natl. Acad. Sci. U. S. A.
92,
11598-11602[Abstract/Free Full Text]
|
| 28.
|
Delmas, V.,
Laoide, B. M.,
Masquilier, D.,
De Groot, R. P.,
Foulkes, N. S.,
and Sassone-Corsi, P.
(1992)
Proc. Natl. Acad. Sci. U. S. A.
89,
4226-4230[Abstract/Free Full Text]
|
| 29.
|
Schreiber, E.,
Tobler, A.,
Malipiero, U.,
Schaffner, W.,
and Fontana, A.
(1993)
Nucleic Acids Res.
21,
253-258[Abstract/Free Full Text]
|
| 30.
|
Scholer, H. R.,
Ruppert, S.,
Suzuki, N.,
Chowdhury, K.,
and Gruss, P.
(1990)
Nature
344,
435-439[CrossRef][Medline]
[Order article via Infotrieve]
|
| 31.
|
Segil, N.,
Shrutkowski, A.,
Dworkin, M. B.,
and Dworkin-Rastl, E.
(1988)
Biochem. J.
251,
31-39[Medline]
[Order article via Infotrieve]
|
| 32.
|
Kaghad, M.,
Dumont, X.,
Chalon, P.,
Lelias, J. M.,
Lamande, N.,
Lucas, M.,
Lazar, M.,
and Caput, D.
(1990)
Nucleic Acids Res.
18,
3638[Free Full Text]
|
| 33.
|
Hedges, S. B.
(1994)
Proc. Natl. Acad. Sci. U. S. A.
91,
2621-2624[Abstract/Free Full Text]
|
| 34.
|
Sakimura, K.,
Kushiya, E.,
Obinate, M.,
and Takahashi, Y.
(1985)
Nucleic Acids Res.
13,
4365-4378[Abstract/Free Full Text]
|
| 35.
|
Lin, F. T.,
Macdougald, O. A.,
Diehl, A. M.,
and Lane, M. D.
(1993)
Proc. Natl. Acad. Sci. U. S. A.
90,
9606-9610[Abstract/Free Full Text]
|
| 36.
|
Valera, A.,
Pujol, A.,
Gregori, X.,
Rie, E.,
Visa, J.,
and Bosch, F.
(1995)
FASEB J.
9,
1067-1078[Abstract]
|
| 37.
|
Riu, E.,
Bosch, F.,
and Valera, A.
(1996)
Proc. Natl. Acad. Sci. U. S. A.
93,
2198-2202[Abstract/Free Full Text]
|
| 38.
|
Towle, H. C.
(1995)
J. Biol. Chem.
270,
23235-23238[Free Full Text]
|
| 39.
|
Giallongo, A.,
Oliva, D.,
Cali, L.,
Barba, G.,
Barbieri, G.,
and Feo, S.
(1990)
Eur. J. Biochem.
190,
567-573[Medline]
[Order article via Infotrieve]
|
| 40.
|
Ghosh, A. K.,
Steele, R.,
and Ray, R. B.
(1999)
Mol. Cell. Biol.
19,
2880-2886[Abstract/Free Full Text]
|
| 41.
|
Vagner, S.,
Touriol, C.,
Galy, B.,
Audigier, S.,
Gensac, M. C.,
Amalric, F.,
Bayard, F.,
Prats, H.,
and Prats, A. C.
(1996)
J. Cell Biol.
135,
1391-1402[Abstract/Free Full Text]
|
Copyright © 2000 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
B. Trojanowicz, A. Winkler, K. Hammje, Z. Chen, C. Sekulla, D. Glanz, C. Schmutzler, B. Mentrup, S. Hombach-Klonisch, T. Klonisch, et al.
Retinoic acid-mediated down-regulation of ENO1/MBP-1 gene products caused decreased invasiveness of the follicular thyroid carcinoma cell lines
J. Mol. Endocrinol.,
March 1, 2009;
42(3):
249 - 260.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K.-W. Hsu, R.-H. Hsieh, Y.-H. W. Lee, C.-H. Chao, K.-J. Wu, M.-J. Tseng, and T.-S. Yeh
The Activated Notch1 Receptor Cooperates with {alpha}-Enolase and MBP-1 in Modulating c-myc Activity
Mol. Cell. Biol.,
August 1, 2008;
28(15):
4829 - 4842.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. Yohannes, J. Chang, G. J. Christ, K. P. Davies, and M. R. Chance
Proteomics Analysis Identifies Molecular Targets Related to Diabetes Mellitus-associated Bladder Dysfunction
Mol. Cell. Proteomics,
July 1, 2008;
7(7):
1270 - 1285.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Vermeulen, I. Arijs, S. Joossens, S. Vermeire, S. Clerens, K. Van den Bergh, G. Michiels, L. Arckens, F. Schuit, L. Van Lommel, et al.
Anti-{alpha}-enolase Antibodies in Patients with Inflammatory Bowel Disease
Clin. Chem.,
March 1, 2008;
54(3):
534 - 541.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. K. Ghosh, R. Steele, J. Ryerse, and R. B. Ray
Tumor-Suppressive Effects of MBP-1 in Non-Small Cell Lung Cancer Cells
Cancer Res.,
December 15, 2006;
66(24):
11907 - 11912.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. K. Ghosh, R. Steele, and R. B. Ray
c-myc Promoter-binding Protein 1 (MBP-1) Regulates Prostate Cancer Cell Growth by Inhibiting MAPK Pathway
J. Biol. Chem.,
April 8, 2005;
280(14):
14325 - 14330.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. K. Ghosh, R. Steele, and R. B. Ray
Carboxyl-Terminal Repressor Domain of MBP-1 is Sufficient for Regression of Prostate Tumor Growth in Nude Mice
Cancer Res.,
February 1, 2005;
65(3):
718 - 721.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
W. Wang, L. Wang, A. Endoh, G. Hummelke, C. L Hawks, and P. J Hornsby
Identification of {alpha}-enolase as a nuclear DNA-binding protein in the zona fasciculata but not the zona reticularis of the human adrenal cortex
J. Endocrinol.,
January 1, 2005;
184(1):
85 - 94.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Mizukami, A. Iwamatsu, T. Aki, M. Kimura, K. Nakamura, T. Nao, T. Okusa, M. Matsuzaki, K.-i. Yoshida, and S. Kobayashi
ERK1/2 Regulates Intracellular ATP Levels through {alpha}-Enolase Expression in Cardiomyocytes Exposed to Ischemic Hypoxia and Reoxygenation
J. Biol. Chem.,
November 26, 2004;
279(48):
50120 - 50131.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Lemaire and M. Wesolowski-Louvel
Enolase and Glycolytic Flux Play a Role in the Regulation of the Glucose Permease Gene RAG1 of Kluyveromyces lactis
Genetics,
October 1, 2004;
168(2):
723 - 731.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. N. Messina, J. Glasscock, W. Gish, and M. Lovett
An ORFeome-based Analysis of Human Transcription Factor Genes and the Construction of a Microarray to Interrogate Their Expression
Genome Res.,
October 1, 2004;
14(10b):
2041 - 2047.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J.-w. Kim, K. I. Zeller, Y. Wang, A. G. Jegga, B. J. Aronow, K. A. O'Donnell, and C. V. Dang
Evaluation of Myc E-Box Phylogenetic Footprints in Glycolytic Genes by Chromatin Immunoprecipitation Assays
Mol. Cell. Biol.,
July 1, 2004;
24(13):
5923 - 5936.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. S. Sathe, N. Sizemore, X. Li, K. Vithalani, M. Commane, S. M. Swiatkowski, and G. R. Stark
Mutant human cells with constitutive activation of NF-{kappa}B
PNAS,
January 6, 2004;
101(1):
192 - 197.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
V. Chinnusamy, K. Schumaker, and J.-K. Zhu
Molecular genetic perspectives on cross-talk and specificity in abiotic stress signalling in plants
J. Exp. Bot.,
January 2, 2004;
55(395):
225 - 236.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S.-T. Wang-Su, A. L. McCormack, S. Yang, M. R. Hosler, A. Mixon, M. A. Riviere, P. A. Wilmarth, U. P. Andley, D. Garland, H. Li, et al.
Proteome Analysis of Lens Epithelia, Fibers, and the HLE B-3 Cell Line
Invest. Ophthalmol. Vis. Sci.,
November 1, 2003;
44(11):
4829 - 4836.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. S. Chang, W. Wu, G. Walsh, W. K. Hong, and L. Mao
Enolase-{alpha} Is Frequently Down-Regulated in Non-Small Cell Lung Cancer and Predicts Aggressive Biological Behavior
Clin. Cancer Res.,
September 1, 2003;
9(10):
3641 - 3644.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. Janssen, A. de Groof, M. Wijers, J. Fransen, P. P. Dzeja, A. Terzic, and B. Wieringa
Adenylate Kinase 1 Deficiency Induces Molecular and Structural Adaptations to Support Muscle Energy Metabolism
J. Biol. Chem.,
April 4, 2003;
278(15):
12937 - 12945.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. Ballot, A. Bruneel, V. Labas, and C. Johanet
Identification of Rat Targets of Anti-Soluble Liver Antigen Autoantibodies by Serologic Proteome Analysis
Clin. Chem.,
April 1, 2003;
49(4):
634 - 643.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. T. O'Dwyer, A. I. Smith, M. L. Matthew, N. M. Andronicos, M. Ranson, P. J. Robinson, and P. A. Crock
Identification of the 49-kDa Autoantigen Associated with Lymphocytic Hypophysitis as {alpha}-Enolase
J. Clin. Endocrinol. Metab.,
February 1, 2002;
87(2):
752 - 757.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. K. Ghosh, M. Majumder, R. Steele, R. A. White, and R. B. Ray
A Novel 16-Kilodalton Cellular Protein Physically Interacts with and Antagonizes the Functional Activity of c-myc Promoter-Binding Protein 1
Mol. Cell. Biol.,
January 15, 2001;
21(2):
655 - 662.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
R. C. Osthus, H. Shim, S. Kim, Q. Li, R. Reddy, M. Mukherjee, Y. Xu, D. Wonsey, L. A. Lee, and C. V. Dang
Deregulation of Glucose Transporter 1 and Glycolytic Gene Expression by c-Myc
J. Biol. Chem.,
July 14, 2000;
275(29):
21797 - 21800.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 2000 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|