Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Subramanian, A.
Right arrow Articles by Miller, D. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Subramanian, A.
Right arrow Articles by Miller, D. M.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

J Biol Chem, Vol. 275, Issue 8, 5958-5965, February 25, 2000


Structural Analysis of alpha -Enolase
MAPPING THE FUNCTIONAL DOMAINS INVOLVED IN DOWN-REGULATION OF THE c-myc PROTOONCOGENE*

Aruna SubramanianDagger and Donald M. Miller§

From the Dagger  Comprehensive Cancer Center and Department of Biochemistry, University of Alabama at Birmingham, Birmingham, Alabama 35294-3300 and the § James Graham Brown Cancer Center, University of Louisville, Louisville, Kentucky 40206

    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Myc-binding protein-1 (MBP-1) is a 37-kDa protein with sequence homology to the 3' portion of the alpha -enolase gene. alpha -Enolase is a 48-kDa protein, which plays a critical role in the glycolytic pathway. MBP-1 binds to the c-myc P2 promoter and down-regulates c-myc expression. We have investigated the role of alpha -enolase in regulation of the c-myc protooncogene. RNase protection assay shows that alpha -enolase is transcribed into a single RNA species in HeLa cells. A start codon, 400 base pairs downstream of the alpha -enolase ATG, corresponds to the MBP-1 ATG, suggesting that MBP-1 is an alternative translation initiation product of the alpha -enolase RNA. Domain mapping was performed using constructs containing truncations of the alpha -enolase gene. In vitro binding to the c-myc gene was abolished after deletion of the N-terminal portion of alpha -enolase. In order to determine the relationship between DNA binding activity and transcription inhibition, we performed co-transfection assays in HeLa cells. These studies confirmed that an N-terminal deletion of alpha -enolase is unable to down-regulate c-myc promoter activity. Our data suggest that alpha -enolase plays an important role in regulation of c-myc promoter activity in the form of an alternative translation product MBP-1, which is distinct from its role as a glycolytic enzyme.

    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

The c-myc protooncogene is a DNA-binding phosphoprotein that plays an important role in the regulation of cell growth and differentiation (1, 2). Regulation of c-myc gene expression is quite complex and involves several mechanisms, including changes in transcription initiation and elongation, RNA stability and turnover, and translation (3, 4). Overexpression of the c-myc gene is a common characteristic of many malignant cell types (5). The human c-myc protooncogene contains two TATA box sequences separated by about 165 base pairs located near the 5' end of the first exon (6). The transcription of c-myc from P1 and P2 is regulated by a composite of positive and negative elements located both upstream and downstream of the promoters (7-10).

A human cDNA clone encoding MBP-1 was detected by screening a HeLa cell cDNA library. The Myc-binding protein-1 (MBP-1)1 is a 37-kDa human c-myc promoter-binding protein that binds in a region +123 to +153 relative to the c-myc P2 promoter (11). MBP-1 is a negative regulator of c-myc expression and binds in the minor groove of the c-myc P2 promoter simultaneously with the TATA-binding protein (12). Consistent with its negative regulation of c-myc and as a potential tumor suppresser protein, transfection of human breast carcinoma cells with MBP-1 cDNA results in inhibition of tumor formation in nude mice (13). Exogenous expression of MBP-1 has been suggested to play an important role in the regulation of human immunodeficiency virus-1 replication in infected cells (14). Careful sequence reanalysis2 of MBP-1 has shown that it has extensive homology to the sequence of the 3' portion of the alpha -enolase gene (11, 15).

Enolase is the glycolytic enzyme that catalyzes the formation of phosphoenolpyruvate from 2-phosphoglycerate, the second of the two high energy intermediates that generate ATP in glycolysis (16). The MBP-1 cDNA shares sequence homology with the alpha -enolase cDNA, which encodes a 1.8-kb mRNA and a polypeptide of about 48 kDa. The high degree of sequence homology is confined to the 1.4-kb 3' region of alpha -enolase and the full-length 1.4-kb MBP-1 and suggests that alpha -enolase and MBP-1 are both products of the alpha -enolase gene.2 The presence of an ATG start codon followed by the Kozak sequence suggests that MBP-1 may be the product of alternate translation initiation from an in frame internal translation initiation site 400 bp downstream on the alpha -enolase cDNA (Fig. 1A).

Western blot analysis using an antibody specific to non-neuronal enolase from human brain (Biogenesis) has identified both 48- and 37-kDa proteins in HeLa nuclear extracts (Fig. 1B). The cellular localization of alpha -enolase is known to be predominantly cytosolic. The function of MBP-1 as a down-regulator of c-myc gene expression suggests that it would be localized in the nucleus. HeLa cell extract made using Promega reporter lysis buffer (prepared as described under "Experimental Procedures") is primarily cytosolic and does not show the presence of MBP-1.


View larger version (22K):
[in this window]
[in a new window]
 
Fig. 1.   A, schematic of sequence alignment of the alpha -enolase and MBP-1 cDNAs. The nucleotide sequences surrounding the in-frame methionine codons of the alpha -enolase cDNA are shown. The nucleotides that fit the Kozak consensus cassette are underlined. B, two alpha -enolase gene products can be identified in HeLa nuclear extracts: alpha -enolase protein (lane 1), HeLa cell extract (lane 2), and HeLa nuclear extract (lane 3) were assayed by immunoblotting with an alpha -enolase antibody. Positions of the molecular mass standards are indicated. HeLa extracts assayed contained 5 µg of protein.

The presence of MBP-1 in nuclear extracts corroborates with its role in down-regulation of c-myc promoter activity. alpha -Enolase constructs are able to down-regulate c-myc promoter activity, albeit to a lower extent than MBP-1.2 On the other hand, preliminary experiments indicate that MBP-1 does not have enolase enzyme activity.3 Here we have studied the structure-function relationship of alpha -enolase as a negative regulator of c-myc activity using DNA binding studies and transfection assays. Our results suggest that the c-myc down-regulating activity of alpha -enolase lies in the N-terminal region of the protein also present in the alternative translation initiation product MBP-1.

    EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

RNase Protection Assay-- The alpha -enolase fragment from 181 to 600, containing the MBP-1 start site, was PCR-amplified and subcloned into the pBluescript II SK vector (Stratagene). In order to make an antisense RNA probe, the vector containing the 420-base pair alpha -enolase fragment was linearized with XhoI and in vitro transcribed with T3 RNA polymerase and [alpha -32P]CTP, using a Maxiscript T3 kit (Ambion). Labeled probe was purified on 5% acrylamide, 8 M urea denaturing gel and eluted overnight at 37 °C. RNase protection assay was carried out using the RPA II kit (Ambion). The antisense cRNA probe (1 × 106 cpm) was hybridized overnight at 37 °C with increasing concentrations of HeLa cell RNA and then digested with RNase A (0.5 units) and RNase T1 (20 units) for 30 min at 37 °C. Hybridization was also performed with in vitro transcribed alpha -enolase and MBP-1 RNA as controls. Following ethanol precipitation, protected fragments were separated on a 6% acrylamide, 8 M urea denaturing gel. The sizes of the protected fragment were determined by running a labeled Century RNA marker (Ambion) alongside.

Plasmid Construction-- The N-terminal truncations of alpha -enolase were generated by PCR using upstream primers that contained the start codon. Downstream primers containing the stop codon were used to PCR-amplify the C-terminal deletions. The PCR products were then cloned directly into the PCR 2.1 vector using the TA cloning kit (Invitrogen). From PCR 2.1, they were excised and cloned directionally into the pCITE (Novagen) and pBluescript (Stratagene) vectors under control of the T7 promoter. The full-length alpha -enolase cDNA was also cloned into these vectors. The pCITE clones were used for in vitro transcription and translation, while the pBluescript clones were expressed in BL21(DE3) cells. For transfection assays, the alpha -enolase cDNA and its deletion mutants were cloned into the pBKCMV vector (Stratagene) under control of the CMV promoter.

Site-directed Mutagenesis-- Site-directed mutagenesis was performed using the QuikChange kit from Stratagene. Full-length alpha -enolase cloned into the pCITE vector was used as the template for mutagenesis of the MBP-1 ATG. Two oligonucleotide primers, each complementary to the opposite strands of the vector, and containing a Gright-arrowC mutation were designed and extended by PCR following the manufacturer's instructions. After incubating the PCR products with DpnI to digest dam-methylated E. coli DNA, the plasmid was transformed into competent cells. To make two Gright-arrowC mutations, alpha -enolase DNA containing the first mutation was used as the template with a new set of primers containing the second mutation. The plasmid DNA obtained from the cells was sequenced to determine the presence of the mutations. The point-mutated alpha -enolase in the pCITE vector under control of the T7 promoter were linearized with XhoI downstream of the insert and used for in vitro transcription and translation. The point-mutated alpha -enolase DNAs were also cloned into the pBKCMV vector for transient transfection assays.

In Vitro Transcription and Translation-- The pCITE vector containing the full-length and truncated alpha -enolase cDNA under control of the T7 promoter was linearized at the XhoI site downstream of the coding sequence. RNA was generated by in vitro transcription using the MEGAscript system (Ambion). RNA transcripts were quantified by absorbance at 260 nm and ethidium bromide staining on an agarose gel allowed verification of their integrity. In vitro translation in rabbit reticulocyte lysate (Red Nova lysate from Novagen) was performed as per instructions. Translation reactions were performed with [35S]methionine, and the in vitro translated products were analyzed directly by electrophoresis on a 12.5% SDS-polyacrylamide gel. This procedure was also followed for the point mutants of alpha -enolase generated by site-directed mutagenesis.

Electrophoretic Mobility Shift Assay (EMSA)-- EMSA was performed as described previously with some modification (17). Full-length alpha -enolase and its deletion mutants cloned into the pBluescript vector were expressed in BL21(DE3) cells and isopropyl-1-thio-beta -D-galactopyranoside induced as described previously (11). The induced proteins were separated on a 12.5% SDS-polyacrylamide gel and analyzed by Coomassie staining. The 45-bp double-stranded oligonucleotide (GGAGGGATCGCGCTGAGTATAAAAGCCGGTTTTCGGGGCTTTATC) corresponding to the P2 promoter region of c-myc was 32P-labeled and used as probe. The underlined G in the above sequence was mutated to T, and this mutant c-myc probe was used as unlabeled competitor. 15 µg of the extracts prepared from the induced cultures were incubated with the probe (2 ng, 104 cpm) in the EMSA buffer (10 mM HEPES, pH 7.9, 100 mM KCl, 1 mM dithiothreitol, 0.05 mM EDTA, 2.5 mM MgCl2 and 6% glycerol) in the presence of 2 mg of poly(dI-dC)·poly(dI-dC) on ice for 30 min. Unlabeled competitor oligonucleotide or 2 µl of antibody (1 µg/µl) were incubated with the protein for 30 min on ice before addition of the labeled oligonucleotide. The resulting complexes were then separated on a native 5% polyacrylamide gel at room temperature in 1× Tris borate-EDTA at 10 V/cm. After electrophoresis, gel retardation was visualized by autoradiography.

Cell Line-- The HeLa human cervical carcinoma cell line was stably transfected with the luciferase reporter gene under control of the c-myc P2 promoter. These stably transfected cells were called MYC1 cells. All transient transfection assays were performed in MYC1 cells.

Transfection-- MYC1 cells were plated at an initial density of 5 × 104 cells/well of a 24-well plate in Dulbecco's modified Eagle's medium supplemented with 10% fetal calf serum. Immediately prior to transfection, cells were washed three times with sterile phosphate-buffered saline. Transient transfection of the MYC1 cells with pBKCMV clones of full-length alpha -enolase and its mutants was carried out using the lipid DOTAP/DOPE method. To normalize the transfection efficiency, the SV40-based beta -galactosidase expression plasmid (SV40-beta -gal) was co-transfected. To transfect one well, 8 µg of DOTAP/DOPE (1 µg/µl) was mixed with 1 µg of each vector and incubated at room temperature for 15 min. The liposome/DNA complexes were mixed with 500 µl of serum free media and added to each well. Plates were incubated for 4 h at 37 °C, 500 µl of Dulbecco's modified Eagle's medium containing 20% fetal calf serum was then added, and cells were incubated for 24 h at 37 °C.

Luciferase Assays-- Cell extracts were made by lysing the cells in each well of a 24-well plate with 100 µl of freshly diluted 1× Reporter lysis buffer (Promega, selected for its low background in protein assays), which allows extracts to be used for Western blot analysis, luciferase, and beta -galactosidase assays. Lysis was performed for 30 min at room temperature with rocking. Lysate was transferred to a 1.5-ml polypropylene tube and centrifuged at 16,000 × g for 4 min to pellet cell debris. The HeLa cell extracts prepared in this manner are primarily cytoplasmic with minimal or no nuclear material. Supernatant was transferred to a fresh tube and protein concentration determined with the Bio-Rad protein assay kit according to the manufacturer's protocol (Bio-Rad). Cell extracts were assayed for both beta -galactosidase and luciferase activity at 24 h after transfection. 50 µl of extract was added to 100 µl of luciferase assay substrate (Promega) in a clear 12 × 75-mm polystyrene tube. Samples were read immediately on a luminometer (Analytical Luminescence Laboratory) and light production (relative light units) measured for 10 s. Each value of luciferase activity is normalized against beta -galactosidase and represents the mean ± S.D. from at least three independent experiments, each performed in triplicate.

Western Blotting-- Cell extracts were made as described above from the MYC1 cells transfected with the pBKCMV expression vectors encoding full-length alpha -enolase or its mutants under control of the CMV promoter and analyzed by Western blot analysis. The proteins were electrophoresed on a 12.5% SDS-polyacrylamide gel and transferred to polyvinylidene difluoride (Millipore) membrane by electroblotting overnight (15 V). The alpha -enolase proteins were detected using an antibody specific to non-neuronal enolase from human brain raised in sheep as a host (Biogenesis) and a chemiluminescence kit (ECL detection, Amersham Pharmacia Biotech) according to the manufacturer's instructions. HeLa whole cell and nuclear extracts containing 5 µg of protein were also analyzed by Western blot analysis.

Northern Blotting-- RNA was isolated from the transiently transfected MYC1 cells and analyzed for levels of expression of message from the transfected constructs by Northern hybridization. The probe was the 1.8-kb full-length alpha -enolase cDNA labeled with [alpha -32P]dCTP using Ready-To-Go DNA labeling beads (Amersham Pharmacia Biotech). Hybridizations were performed at 42 °C overnight in 5 ml of formamide and 100 µl of denatured salmon sperm DNA. Filters were washed at moderate stringency (0.1× SSC, 1% SDS, 42 °C) and exposed to x-ray film overnight.

    RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Expression of the alpha -Enolase Transcript-- Although we have hypothesized that MBP-1 and alpha -enolase are alternate translation products of a single alpha -enolase mRNA, it is important to document this fact. RNase protection assay was used to analyze expression of the alpha -enolase transcript. A cRNA antisense probe of 420 nucleotides corresponding to nucleotides 181-600 of alpha -enolase, containing the MBP-1 start site at position 386, was synthesized together with Century RNA markers (Ambion). The radiolabeled cRNA probe was hybridized to total RNA derived from HeLa cells and to in vitro transcribed alpha -enolase and MBP-1 RNA as control (Fig. 2). In total HeLa cell RNA, a 420-nucleotide fragment was protected corresponding to the fragment observed in the in vitro transcribed alpha -enolase mRNA control lane. The MBP-1 control RNA protected a 220-nucleotide fragment that was not seen in the HeLa cell RNA. These data confirm our hypothesis that expression of the alpha -enolase gene gives rise to a single transcript and that an MBP-1-specific mRNA is not transcribed. This would also indicate that MBP-1 is not a product of alternative RNA splicing.


View larger version (68K):
[in this window]
[in a new window]
 
Fig. 2.   RNase protection analysis using an alpha -enolase cDNA- derived riboprobe. A 420-bp fragment from 181-600 nucleotides of alpha -enolase was transcribed and used as probe as described under "Experimental Procedures." Lane 1 shows the RNA markers of 500, 400, 300, 200, and 100 nucleotides in length. Lanes 2 and 3 show the undigested and digested 450-nucleotide RNA probe, respectively. Lanes 4 and 5 show RNase protection of indicated amounts of the in vitro transcribed alpha -enolase RNA. Lanes 6 and 7 show the 220-nucleotide fragment protected by the in vitro transcribed MBP-1 RNA. Lanes 8-11 show RNase protection of the probe after hybridization with indicated amounts of HeLa cell RNA.

Site-directed Mutagenesis of MBP-1 ATG on alpha -Enolase DNA-- In order to confirm that MBP-1 is a product of translation initiation from an internal ATG on the alpha -enolase cDNA, site-directed mutagenesis was performed (Fig. 3A). The ATG codon for methionine at position 97 of alpha -enolase was transformed into the ATC codon for isoleucine (Enomut1). This mutation failed to abolish translation of the MBP-1 protein from the alpha -enolase cDNA. This may have been due to the presence of another in frame ATG at position 377 of alpha -enolase, six bases upstream of the first ATG, coding for methionine 94, which could have been used for translation. After mutating methionine 94 to isoleucine (Enomut2), a 37-kDa MBP-1 protein band was still visible. Site-directed mutagenesis at both positions was performed on the same template DNA and the resulting alpha -enolase cDNA (Enomut3) translated into a single protein of 48 kDa (Fig. 3B).


View larger version (32K):
[in this window]
[in a new window]
 
Fig. 3.   A, the drawing shows the locations of the separate site-directed mutations introduced into the alpha -enolase cDNA. Mutations were verified by nucleotide sequencing of the mutated regions. B, in vitro translation of alpha -enolase RNA. In vitro transcribed RNAs from MBP-1 cDNA and from the wild type and point-mutated alpha -enolase cDNAs were translated in a rabbit reticulocyte lysate system, and the products were analyzed as described in "Experimental Procedures". Lane 1, negative control; lane 2, wild type alpha -enolase generating alpha -enolase and MBP-1 proteins; lane 3, MBP-1; lane 4, ATG (coding methionine 97) right-arrow ATC mutant; lane 5, ATG (coding methionine 94) right-arrow ATC mutant; lane 6, ATG (coding methionine 94 and 97) right-arrow ATC mutants. MBP-1 translation is abolished. C, Western blot analysis. The MBP-1 cDNA and wild type and point-mutated alpha -enolase cDNAs under control of the CMV promoter were transfected into HeLa cells and expression assayed by immunoblotting with alpha -enolase antibody. The alpha -enolase and MBP-1 bands are indicated. Lane 1, pure human alpha -enolase positive control; lane 2, pBKCMV vector control showing endogenous alpha  -enolase expression; lane 3, CMValpha -enolase; lane 4, CMVMBP-1; lane 5, CMV promoter controlled ATG right-arrow ATC mutations of methionines at position 94 and 97 of alpha -enolase (CMVEnomut3).

In order to determine if the alpha -enolase protein could down-regulate c-myc promoter activity in the absence of MBP-1 translation, Enomut3 cloned under control of the CMV promoter was used in transient transfection assays as described under "Experimental Procedures." Extracts from the MYC1-transfected cells were analyzed by Western blot, and similar levels of protein were observed (Fig. 3C). Luciferase assay results show that, although full-length alpha -enolase down-regulates c-myc promoter activity by about 40%, Enomut3, which does not generate MBP-1 on translation, is able to repress it by less than 20% (Fig. 4). This indicates that the c-myc down-regulating activity of alpha -enolase lies in the alternative translation product MBP-1.


View larger version (29K):
[in this window]
[in a new window]
 
Fig. 4.   Regulation of c-myc promoter activity in MYC1 cells. The effect of MBP-1 and of wild type and point-mutated alpha -enolase on c-myc promoter activity was measured as luciferase activity in transfected MYC1 cells (see "Experimental Procedures"). To eliminate the influence of transfection efficiency, all data from the luciferase assays were normalized against beta -galactosidase activity and presented as the mean ± S.D. from at least three independent experiments, each performed in triplicate. The activity of the c-myc promoter when co-transfected with control (empty) pBKCMV expression vector was assigned a value of 100.

Construction and Expression of alpha -Enolase Deletion Mutants-- We have demonstrated that alpha -enolase has c-myc down-regulation activity, although less significant than MBP-1. In order to map the functional domains of alpha -enolase, a series of N and C-terminal deletion mutants were made. The set of alpha -enolase mutants generated is summarized in Fig. 5A. Each mutant was named for the amino acids deleted; for example, EnoDelta 1-236 has amino acids 1-236 deleted. EnoDelta 1-96 is MBP-1. The expression plasmids were tested for their ability to express full-length alpha -enolase and its deletion mutants. All the expression plasmids generated polypeptides of the appropriate size after in vitro transcription and translation (Fig. 5B). The C-terminal truncations EnoDelta 242-434 and Eno Delta 373-434 also generated smaller peptides of 15 and 26 kDa, respectively, due to translation from the internal initiation site. The 15-kDa band is not visible in Fig. 5B, as it ran with the dye front on the gel.


View larger version (32K):
[in this window]
[in a new window]
 
Fig. 5.   A, schematic of N and C-terminal deletion mutants of the alpha -enolase cDNA. Each mutant was named for the amino acids deleted, for example EnoDelta 1-236 has amino acids 1-236 deleted. EnoDelta 1-96 is MBP-1. B, expression of the various deletion mutants of alpha -enolase. In vitro transcribed RNAs were translated in rabbit reticulocyte lysate and separated on a 12.5% SDS-polyacrylamide gel. Arrows indicate the positions of the full-length alpha -enolase and deletion mutant proteins. The positions of standards in kDa are indicated.

Binding of alpha -Enolase and Its Deletion Mutants to the c-myc P2 Promoter-- It has been shown previously that MBP-1 binds to the c-myc P2 promoter (11). EMSA was performed with a 50-base pair labeled c-myc probe (see "Experimental procedures") and lysates from induced BL21(DE3) cells expressing alpha -enolase and its deletion mutants. The in vitro translated full-length and truncated alpha -enolase proteins were initially used for gel shift analysis. However, addition of any of the in vitro translated proteins to the 50-base pair labeled c-myc oligonucleotide caused a shift to the same extent in every lane. We soon realized that endogenous enolase from Rabbit reticulocyte lysate (in which the in vitro translation is carried out) interfered with the EMSA. In order to get around the problem of interference from endogenous alpha -enolase, bacterially expressed proteins were made and used in EMSAs. The crude bacterial extracts, when analyzed by SDS-polyacrylamide gel electrophoresis and Coomassie-stained, indicated the presence of the translation products from full-length alpha -enolase and its deletion mutants. However, the smaller peptides due to translation from the internal initiation site on the C-terminal deletions, EnoDelta 242-434 and EnoDelta 373-434, were not observed (data not shown). A specific DNA-protein complex was visualized by autoradiography in all the alpha -enolase deletion mutants except EnoDelta 1-236. The visible DNA-protein complexes were not disrupted upon addition of 100-fold molar excess of a mutant cold competitor (Fig. 6A). The unlabeled oligonucleotide used as competitor has been described previously (11) and has a mutation that prevents binding of MBP-1 to the DNA. A polyclonal alpha -enolase antibody was able to bind to and supershift the DNA-protein complexes (Fig. 6B). An antibody to human c-myc was unable to supershift the full-length alpha -enolase-DNA complex, indicating that the supershifts obtained using the alpha -enolase antibody are specific. Deletion of amino acids 1-236 of alpha -enolase prevents the protein from binding to the c-myc P2 promoter. These results indicate that the DNA binding region of the alpha -enolase protein lies between amino acids 96 and 236. 


View larger version (39K):
[in this window]
[in a new window]
 
Fig. 6.   A, electrophoretic mobility shift assay of 32P-labeled, 50-base pair c-myc P2 promoter with full-length alpha -enolase and its deletion mutants expressed in BL21(DE3) cells was performed as described under "Experimental Procedures." The position of the unbound probe is indicated. Lane 1, labeled probe; lane 2, vector-transformed bacterial extract is used as control; lanes 3-7, 15 µg of bacterially expressed protein as indicated; lane 8, 100-fold molar excess of unlabeled 50-bp c-myc probe is added as competitor; lanes 9-13, 100-fold molar excess of unlabeled mutant Myc oligonucleotide is added as competitor to show the specificity of the DNA-protein complexes formed. The protein used in each reaction is indicated on the top of each lane. B, EMSA showing supershift of the DNA-protein complexes formed using an antibody to alpha -enolase. The bacterial extracts expressing full-length alpha -enolase and its deletion mutants (as indicated above each lane) were incubated with 2 µl of alpha -enolase antibody for 30 min on ice before adding labeled c-myc probe (lanes 3-7). Antibody to human c-myc was used as a negative control (lane 2).

Down-regulation of c-myc Promoter Activity by alpha -Enolase and Its Deletion Mutants-- MBP-1 has been shown to down-regulate c-myc promoter activity (11). HeLa cells stably transfected with the luciferase reporter gene under control of the c-myc promoter (MYC1 cells) were transiently transfected with alpha -enolase and its deletions under control of the CMV promoter. Northern and Western blot analysis confirmed expression of the mutated forms of alpha -enolase in the transfected cells (Fig. 7, A and B). Similar levels of RNA were expressed from alpha -enolase and its truncations in the MYC1 cells. Levels of protein expression from alpha -enolase and its deletion mutants were quantified by densitometry and found to be comparable. The shorter peptide of 26 kDa translated from the internal initiation site of the C-terminal deletions EnoDelta 373-434 is also generated upon transfection into MYC1 cells and can be seen in Fig. 7B. The 15-kDa peptide generated by translation initiation from the internal ATG on EnoDelta 242-434, which ran along with the dye front on the SDS gel, is not shown in Fig. 7B. However, the amount of protein translated from the internal ATG is far less than that from the first ATG of these constructs. Hence, the effect observed on c-myc promoter activity in transient transfection assays is thought to be predominantly due to the larger proteins.


View larger version (41K):
[in this window]
[in a new window]
 
Fig. 7.   A, Northern blotting of mRNAs from transfected HeLa cells. Total RNA was purified and analyzed by Northern blotting as described under "Experimental Procedures" using the 32P-labeled, 1.8-kb alpha -enolase cDNA as probe. The plasmid used for transfection is indicated on the top of each lane. Size standard RNAs are indicated. Blots were stripped and reprobed with a labeled beta -actin cDNA probe to control for errors in gel loading. B, expression of full-length alpha -enolase and deletion mutants in transfected HeLa cells was analyzed by immunoblotting with antibody to alpha -enolase. The positions of the bands in kDa are indicated.

The effect of alpha -enolase and its deletion mutants on c-myc promoter activity were measured as luciferase activities in transfected MYC1 cells. The results indicate that EnoDelta 1-236 does not down-regulate c-myc promoter activity as efficiently as full-length alpha -enolase (Fig. 8). The MBP-1 protein down-regulates c-myc promoter activity by 65%. These results correspond with the EMSA results and show that the DNA binding and c-myc down-regulating activity of alpha -enolase lies between amino acids 96 and 236. 


View larger version (31K):
[in this window]
[in a new window]
 
Fig. 8.   The effect of the alpha -enolase deletion mutants on c-myc promoter activity was measured as luciferase activity in transfected HeLa cells as described under "Experimental Procedures." The data shown have been normalized to beta -galactosidase activity and are the ±S.D. from at least three independent experiments each performed in triplicate.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

The role of alpha -enolase as a glycolytic enzyme has been very well characterized. The alpha -enolase gene is transcribed into a single RNA species, as proven by the RNase protection assay. Here we show that at least two proteins arise from the alternative usage of translation initiation sites present on the alpha -enolase mRNA. MBP-1, which negatively regulates c-myc promoter activity, was initially identified from a human cervical carcinoma cell expression library. Previous work (13) has demonstrated that this alternate translation product of the alpha -enolase gene acts as a tumor suppresser when transfected into human breast carcinoma cells, largely preventing anchorage-independent growth and the growth of tumors in nude mice.

We examined the MBP-1 and alpha -enolase cDNA coding sequences and observed complete sequence homology between the MBP-1 sequence and the 1.4-kb 3' region of alpha -enolase. A potential translation initiation site at codon 97 of alpha -enolase was observed, and the sequence surrounding this ATG triplet exhibits an overall sequence homology to the Kozak consensus cassette (18).

In a construct in which the ATG at codon 97 on the alpha -enolase cDNA was mutated to ATC (Enomut1), MBP-1 translation was not abolished. Another in-frame ATG at codon 94 was observed and, after mutation of this ATG to generate Enomut2, alpha -enolase and MBP-1 continued to be translated. However, when both the ATGs were mutated (Enomut3), alpha -enolase was the sole product of translation. Because Enomut3 gives rise to just the 48-kDa alpha -enolase, we can exclude the possibility that MBP-1 arises from proteolytic cleavage of the complete protein. Western blot analysis of pure human alpha -enolase shows the presence of a single band of ~48 kDa. Even after incubation of the pure human alpha -enolase protein in a transcription/translation system, no smaller fragment the size of MBP-1 could be observed by Western blotting (data not shown). Full-length alpha -enolase cDNA after in vitro transcription/translation gives rise to both alpha -enolase and MBP-1 protein bands. The ratio of these two proteins remains constant when checked on a gel after storage for a considerable period of time. These results further confirm that MBP-1 is not a product of proteolytic cleavage of alpha -enolase. The single alpha -enolase mRNA is alternatively translated from methionine 94 or 97 to yield MBP-1. Our data do not allow us to distinguish whether MBP-1 is translated from the codon for methionine at position 94 or 97 on the alpha -enolase mRNA.

Of the two isoforms of alpha -enolase, MBP-1 better down-regulates c-myc promoter activity. In transient transfection assays in HeLa cells, alpha -enolase is unable to down-regulate activity of the c-myc promoter efficiently after mutation of the internal translation initiation site to prevent translation of MBP-1. The ~20% down-regulation of c-myc promoter activity observed after transfection with Enomut3 is due to the binding of the full-length alpha -enolase to the c-myc P2 promoter. These results suggest that the alpha -enolase gene is bifunctional, encoding two proteins, one of which has a role in glycolysis and the other in regulation of c-myc expression.

Evidence to suggest that alpha -enolase may have functions other than as a glycolytic enzyme has been generated earlier in yeast, other vertebrates, and mammalian cells (19, 20). These include either a direct function or indirect role in processes such as thermal tolerance, growth control, and hypoxia tolerance (21). A structural role in the lens of some species has been exhibited by alpha -enolase (22). It also functions as a cell surface receptor for plasminogen, resulting in enhanced plasminogen activation and localization of the proteolytic activity of plasmin on cell surfaces (23). The presence of alpha -enolase on the surface of pathogenic streptococci has recently been demonstrated (24). The streptococcal surface enolase is thought to play an important role in the disease process and in post-streptococcal autoimmune diseases.

Our results demonstrate that MBP-1 is a product of internal translation initiation from the alpha -enolase gene. Internal initiation has been described for other genes such as those for C/EBP alpha  and beta  (25), Myc (26), GATA-1 (27), CREM alpha /beta (28), N-Oct-3 (29), and Oct-4 (30), and appears to be an efficient and rapid means to modulate their activity. Moreover, in most of the reported cases, this mechanism is evolutionarily preserved in rodents and humans. It has been observed that the in-frame internal ATGs at codons 94 and 97 of alpha -enolase are conserved across the human, rat, mouse, chicken, duck, and frog alpha -enolase sequence (31-34). The two GATA-1 isoforms share identical binding activity but differ in their transactivation potential and in their expression in developing mouse embryos. The 30-kDa protein generated by alternative translation initiation of C/EBPalpha (42 kDa) lacks antimitotic activity (35). Although there are numerous examples of alternative translation products, the broad disparity of function between alpha -enolase and MBP-1 appears to be unique.

Our preliminary observations indicate that MBP-1 lacks alpha -enolase enzyme activity.3 Although the cellular localization for the alpha -enolase protein has been thought to be predominantly cytosolic, the presence of MBP-1 is observed only in the nuclear extract from HeLa cells. The functional significance of this may lie in the negative regulation of expression of the c-myc protooncogene by the MBP-1 isoform of alpha -enolase. This may represent a mechanism for negative feedback regulation of c-myc. It has been shown that Myc overexpression up-regulates liver carbohydrate metabolism 3-5-fold (36, 37). Furthermore, Myc overexpression is thought to counteract diabetic hyperglycemia by inducing hepatic glucose uptake and utilization and therefore blocking gluconeogenesis. Although there is no direct evidence of the regulation of alpha -enolase promoter function by Myc, the plausibility of up-regulation of alpha -enolase by the overall carbohydrate hypermetabolic state cannot be ruled out.

Up-regulated expression of glycolytic enzymes (pyruvate kinase, phosphofructokinase and glucokinase) as well as up-regulated glycolysis has been shown to occur as a consequence of Myc overexpression. This is thought to be due to the presence of two imperfect CACGTG motifs (5 out of 6 bases match) in the carbohydrate response element of the pyruvate kinase gene (38). Two perfect Myc-Max binding motifs (CACGTG) are also present in the promoter of the alpha -enolase gene (39). These findings along with our observation of the bifunctional role of alpha -enolase as a glycolytic enzyme and regulator of c-myc expression present a model that places c-myc and alpha -enolase at the intersection of energy metabolism and growth control.

We have used deletion mutants of alpha -enolase to characterize its functional domains. The finding that MBP-1 (EnoDelta 1-96) binds to the c-myc P2 promoter, but EnoDelta 1-236 does not, indicates that the amino acids between 96 and 236 of alpha -enolase are essential for DNA interaction. Among the alpha -enolase deletion mutants, MBP-1 was the most efficient down-regulator of c-myc promoter activity. Our results from the transient transfection assays corroborate those from the DNA binding studies, since EnoDelta 1-236 was unable to down-regulate c-myc promoter activity. Both the C-terminal deletions of alpha -enolase (EnoDelta 242-434 and EnoDelta 373-434) contained amino acids 96-236 and were able to down-regulate expression of the c-myc promoter by at least 40% of its activity. The region between amino acids 96 and 236 is present in the MBP-1 isoform of alpha -enolase, which has been shown to down-regulate c-myc expression by 65%.

This result is consistent with the previously published work of Ghosh et al. (40), which demonstrated transcriptional repression activity in the N-terminal portion of MBP-1. Our data show, however, that DNA binding activity correlates nicely with ability to inhibit transcription of c-myc. As seen by mutating methionine 94 and 97, the c-myc down-regulating activity of alpha -enolase is lost, by abolishing translation of the MBP-1 isoform. Thus, it is possible that the bifunctional role of alpha -enolase could be modulated by the varying ratio of the two isoforms.

The existence of two alpha -enolase isoforms with distinct functions presents a unique example of a gene encoding proteins with roles in metabolism and cell proliferation. Our data suggest that, while the alpha -enolase isoform functions as the glycolytic enzyme, the N-terminal region of the MBP-1 isoform is important in binding to and down-regulating expression of the c-myc gene. The MBP-1 isoform has been shown to inhibit anchorage-independent cell growth and tumor growth in nude mice (13). The manner in which the coding capacity of the alpha -enolase mRNA for the two protein isoforms is regulated has not been ascertained. Internal ribosome entry constitutes a novel mechanism of gene expression regulation. This has been shown in the case of FGF-2, whose CUG-initiated isoforms are translationally activated in response to stress (41). Whether this kind of initiation from the presence of an internal ribosome entry site occurs in the case of MBP-1 remains to be determined.

    FOOTNOTES

* The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

To whom correspondence should be addressed: 529 S. Jackson St., Louisville, KY 40206. Tel.: 502-562-4790; Fax: 502-562-4368; E-mail: donaldmi@ulh.org.

2 D. Chaudhary, A. Subramanian, R. Ray, and D. M. Miller, submitted for publication.

3 A. Subramanian, J. O. Trent, and D. M. Miller, unpublished data.

    ABBREVIATIONS

The abbreviations used are: MBP, Myc-binding protein; EMSA, electrophoretic mobility shift assay; bp, base pair(s); kb, kilobase pair(s); PCR, polymerase chain reaction; CMV, cytomegalovirus; DOTAP/DOPE, 1,2 dioleyl glycero 3-phosphoethanolamine/3-trimethyl ammonium propane.

    REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

1. Marcu, K. B., Bossome, S. A., and Patel, A. J. (1992) Annu. Rev. Biochem. 61, 809-860[CrossRef][Medline] [Order article via Infotrieve]
2. Spencer, C. A., and Groudine, M. (1991) Adv. Cancer Res. 56, 1-48[Medline] [Order article via Infotrieve]
3. Bentley, D. L., and Groudine, M. (1986) Nature 321, 702-706[CrossRef][Medline] [Order article via Infotrieve]
4. Levine, R. A., McCormack, J. E., Buckler, A., and Sonenshein, G. E. (1986) Mol. Cell. Biol. 6, 4112-4116[Abstract/Free Full Text]
5. Cole, M. (1986) Annu. Rev. Genet. 20, 361-384[CrossRef][Medline] [Order article via Infotrieve]
6. Battey, J., Moulding, C., Tabu, R., Murphy, W., Stewart, T., Potter, M., Lenoir, G., and Leder, P. (1983) EMBO J. 2, 2375-2383[Medline] [Order article via Infotrieve]
7. Chung, J., Shin, E., Reed, R. R., and Leder, P. (1986) Proc. Natl. Acad. Sci. U. S. A. 83, 7918-7922[Abstract/Free Full Text]
8. Hay, N., Bishop, J. M., and Levens, D. (1987) Genes Dev. 1, 657-671
9. Lipp, M., Schilling, R., Wiest, S., Laux, G., and Bornkamm, G. W. (1987) Mol. Cell. Biol. 7, 1393-1400[Abstract/Free Full Text]
10. Siebenlist, U., Hennighausen, L., Battey, J., and Leder, P. (1984) Cell 37, 381-391[CrossRef][Medline] [Order article via Infotrieve]
11. Ray, R., and Miller, D. M. (1991) Mol. Cell. Biol. 11, 2154-2161[Abstract/Free Full Text]
12. Chaudhary, D., and Miller, D. M. (1995) Biochemistry 34, 3438-3445[CrossRef][Medline] [Order article via Infotrieve]
13. Ray, R. B., Steele, R., Seftor, E., and Hendrix, M. (1995) Cancer Res. 55, 3747-3751[Abstract/Free Full Text]
14. Ray, R. B., and Srinivas, R. V. (1997) J. Cell. Biochem. 64, 565-572[CrossRef][Medline] [Order article via Infotrieve]
15. Giallongo, A., Feo, S., Moore, R., Croce, C. M., and Showe, L. (1986) Proc. Natl. Acad. Sci. U. S. A. 83, 6741-6745[Abstract/Free Full Text]
16. Wold, F. (1971) in The Enzymes (Boyer, P. D., ed), 3rd Ed., Vol. 5 , pp. 499-508, Academic Press, New York
17. Kim, C., Snyder, R. O., and Wold, M. S. (1992) Mol. Cell. Biol. 12, 3050-3059[Abstract/Free Full Text]
18. Kozak, M. (1986) Cell 44, 283-292[CrossRef][Medline] [Order article via Infotrieve]
19. Cooper, J. A., Reiss, N. A., Schwartz, R. J., and Hunter, T. (1983) Nature 302, 218-223[CrossRef][Medline] [Order article via Infotrieve]
20. Graven, K. K., Zimmerman, L. H., Dickson, E. W., Weinhouse, G. L., and Farber, H. W. (1993) J. Cell. Physiol. 157, 544-554[CrossRef][Medline] [Order article via Infotrieve]
21. Aaronson, R. M., Graven, K. K., Tucci, M., McDonald, R. T., and Farber, H. W. (1995) J. Biol. Chem. 270, 27752-27757[Abstract/Free Full Text]
22. Wistow, G. J., Lietman, T., Williams, L. A., Stapel, S. O., de Jong, W. N., Horwotz, J., and Piatigorsky, J. (1988) J. Cell Biol. 107, 2729-2736[Abstract/Free Full Text]
23. Miles, L. A., Dahlberg, C. M., Plesia, J., Felez, J., Kato, K., and Plow, E. F. (1991) Biochemistry 30, 1682-1691[CrossRef][Medline] [Order article via Infotrieve]
24. Pancholi, V., and Fischetti, V. A. (1998) J. Biol. Chem. 273, 14503-14515[Abstract/Free Full Text]
25. Ossipow, V., Descombes, P., and Schibler, V. (1993) Proc. Natl. Acad. Sci. U. S. A. 90, 8219-8223[Abstract/Free Full Text]
26. Hann, S. H., Dixit, M., Sears, R. C., and Sealy, L. (1994) Genes Dev. 8, 2441-2452[Abstract/Free Full Text]
27. Calligaris, R., Bottardi, S., Cogoi, S., Apeztegria, I., and Santoro, C. (1995) Proc. Natl. Acad. Sci. U. S. A. 92, 11598-11602[Abstract/Free Full Text]
28. Delmas, V., Laoide, B. M., Masquilier, D., De Groot, R. P., Foulkes, N. S., and Sassone-Corsi, P. (1992) Proc. Natl. Acad. Sci. U. S. A. 89, 4226-4230[Abstract/Free Full Text]
29. Schreiber, E., Tobler, A., Malipiero, U., Schaffner, W., and Fontana, A. (1993) Nucleic Acids Res. 21, 253-258[Abstract/Free Full Text]
30. Scholer, H. R., Ruppert, S., Suzuki, N., Chowdhury, K., and Gruss, P. (1990) Nature 344, 435-439[CrossRef][Medline] [Order article via Infotrieve]
31. Segil, N., Shrutkowski, A., Dworkin, M. B., and Dworkin-Rastl, E. (1988) Biochem. J. 251, 31-39[Medline] [Order article via Infotrieve]
32. Kaghad, M., Dumont, X., Chalon, P., Lelias, J. M., Lamande, N., Lucas, M., Lazar, M., and Caput, D. (1990) Nucleic Acids Res. 18, 3638[Free Full Text]
33. Hedges, S. B. (1994) Proc. Natl. Acad. Sci. U. S. A. 91, 2621-2624[Abstract/Free Full Text]
34. Sakimura, K., Kushiya, E., Obinate, M., and Takahashi, Y. (1985) Nucleic Acids Res. 13, 4365-4378[Abstract/Free Full Text]
35. Lin, F. T., Macdougald, O. A., Diehl, A. M., and Lane, M. D. (1993) Proc. Natl. Acad. Sci. U. S. A. 90, 9606-9610[Abstract/Free Full Text]
36. Valera, A., Pujol, A., Gregori, X., Rie, E., Visa, J., and Bosch, F. (1995) FASEB J. 9, 1067-1078[Abstract]
37. Riu, E., Bosch, F., and Valera, A. (1996) Proc. Natl. Acad. Sci. U. S. A. 93, 2198-2202[Abstract/Free Full Text]
38. Towle, H. C. (1995) J. Biol. Chem. 270, 23235-23238[Free Full Text]
39. Giallongo, A., Oliva, D., Cali, L., Barba, G., Barbieri, G., and Feo, S. (1990) Eur. J. Biochem. 190, 567-573[Medline] [Order article via Infotrieve]
40. Ghosh, A. K., Steele, R., and Ray, R. B. (1999) Mol. Cell. Biol. 19, 2880-2886[Abstract/Free Full Text]
41. Vagner, S., Touriol, C., Galy, B., Audigier, S., Gensac, M. C., Amalric, F., Bayard, F., Prats, H., and Prats, A. C. (1996) J. Cell Biol. 135, 1391-1402[Abstract/Free Full Text]


Copyright © 2000 by The American Society for Biochemistry and Molecular Biology, Inc.
Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
J Mol EndocrinolHome page
B. Trojanowicz, A. Winkler, K. Hammje, Z. Chen, C. Sekulla, D. Glanz, C. Schmutzler, B. Mentrup, S. Hombach-Klonisch, T. Klonisch, et al.
Retinoic acid-mediated down-regulation of ENO1/MBP-1 gene products caused decreased invasiveness of the follicular thyroid carcinoma cell lines
J. Mol. Endocrinol., March 1, 2009; 42(3): 249 - 260.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
K.-W. Hsu, R.-H. Hsieh, Y.-H. W. Lee, C.-H. Chao, K.-J. Wu, M.-J. Tseng, and T.-S. Yeh
The Activated Notch1 Receptor Cooperates with {alpha}-Enolase and MBP-1 in Modulating c-myc Activity
Mol. Cell. Biol., August 1, 2008; 28(15): 4829 - 4842.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. ProteomicsHome page
E. Yohannes, J. Chang, G. J. Christ, K. P. Davies, and M. R. Chance
Proteomics Analysis Identifies Molecular Targets Related to Diabetes Mellitus-associated Bladder Dysfunction
Mol. Cell. Proteomics, July 1, 2008; 7(7): 1270 - 1285.
[Abstract] [Full Text] [PDF]


Home page
Clin. Chem.Home page
N. Vermeulen, I. Arijs, S. Joossens, S. Vermeire, S. Clerens, K. Van den Bergh, G. Michiels, L. Arckens, F. Schuit, L. Van Lommel, et al.
Anti-{alpha}-enolase Antibodies in Patients with Inflammatory Bowel Disease
Clin. Chem., March 1, 2008; 54(3): 534 - 541.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
A. K. Ghosh, R. Steele, J. Ryerse, and R. B. Ray
Tumor-Suppressive Effects of MBP-1 in Non-Small Cell Lung Cancer Cells
Cancer Res., December 15, 2006; 66(24): 11907 - 11912.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. K. Ghosh, R. Steele, and R. B. Ray
c-myc Promoter-binding Protein 1 (MBP-1) Regulates Prostate Cancer Cell Growth by Inhibiting MAPK Pathway
J. Biol. Chem., April 8, 2005; 280(14): 14325 - 14330.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
A. K. Ghosh, R. Steele, and R. B. Ray
Carboxyl-Terminal Repressor Domain of MBP-1 is Sufficient for Regression of Prostate Tumor Growth in Nude Mice
Cancer Res., February 1, 2005; 65(3): 718 - 721.
[Abstract] [Full Text] [PDF]


Home page
J EndocrinolHome page
W. Wang, L. Wang, A. Endoh, G. Hummelke, C. L Hawks, and P. J Hornsby
Identification of {alpha}-enolase as a nuclear DNA-binding protein in the zona fasciculata but not the zona reticularis of the human adrenal cortex
J. Endocrinol., January 1, 2005; 184(1): 85 - 94.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y. Mizukami, A. Iwamatsu, T. Aki, M. Kimura, K. Nakamura, T. Nao, T. Okusa, M. Matsuzaki, K.-i. Yoshida, and S. Kobayashi
ERK1/2 Regulates Intracellular ATP Levels through {alpha}-Enolase Expression in Cardiomyocytes Exposed to Ischemic Hypoxia and Reoxygenation
J. Biol. Chem., November 26, 2004; 279(48): 50120 - 50131.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
M. Lemaire and M. Wesolowski-Louvel
Enolase and Glycolytic Flux Play a Role in the Regulation of the Glucose Permease Gene RAG1 of Kluyveromyces lactis
Genetics, October 1, 2004; 168(2): 723 - 731.
[Abstract] [Full Text] [PDF]


Home page
Genome ResHome page
D. N. Messina, J. Glasscock, W. Gish, and M. Lovett
An ORFeome-based Analysis of Human Transcription Factor Genes and the Construction of a Microarray to Interrogate Their Expression
Genome Res., October 1, 2004; 14(10b): 2041 - 2047.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
J.-w. Kim, K. I. Zeller, Y. Wang, A. G. Jegga, B. J. Aronow, K. A. O'Donnell, and C. V. Dang
Evaluation of Myc E-Box Phylogenetic Footprints in Glycolytic Genes by Chromatin Immunoprecipitation Assays
Mol. Cell. Biol., July 1, 2004; 24(13): 5923 - 5936.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
S. S. Sathe, N. Sizemore, X. Li, K. Vithalani, M. Commane, S. M. Swiatkowski, and G. R. Stark
Mutant human cells with constitutive activation of NF-{kappa}B
PNAS, January 6, 2004; 101(1): 192 - 197.
[Abstract] [Full Text] [PDF]


Home page
J Exp BotHome page
V. Chinnusamy, K. Schumaker, and J.-K. Zhu
Molecular genetic perspectives on cross-talk and specificity in abiotic stress signalling in plants
J. Exp. Bot., January 2, 2004; 55(395): 225 - 236.
[Abstract] [Full Text] [PDF]


Home page
IOVSHome page
S.-T. Wang-Su, A. L. McCormack, S. Yang, M. R. Hosler, A. Mixon, M. A. Riviere, P. A. Wilmarth, U. P. Andley, D. Garland, H. Li, et al.
Proteome Analysis of Lens Epithelia, Fibers, and the HLE B-3 Cell Line
Invest. Ophthalmol. Vis. Sci., November 1, 2003; 44(11): 4829 - 4836.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
Y. S. Chang, W. Wu, G. Walsh, W. K. Hong, and L. Mao
Enolase-{alpha} Is Frequently Down-Regulated in Non-Small Cell Lung Cancer and Predicts Aggressive Biological Behavior
Clin. Cancer Res., September 1, 2003; 9(10): 3641 - 3644.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
E. Janssen, A. de Groof, M. Wijers, J. Fransen, P. P. Dzeja, A. Terzic, and B. Wieringa
Adenylate Kinase 1 Deficiency Induces Molecular and Structural Adaptations to Support Muscle Energy Metabolism
J. Biol. Chem., April 4, 2003; 278(15): 12937 - 12945.
[Abstract] [Full Text] [PDF]


Home page
Clin. Chem.Home page
E. Ballot, A. Bruneel, V. Labas, and C. Johanet
Identification of Rat Targets of Anti-Soluble Liver Antigen Autoantibodies by Serologic Proteome Analysis
Clin. Chem., April 1, 2003; 49(4): 634 - 643.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
D. T. O'Dwyer, A. I. Smith, M. L. Matthew, N. M. Andronicos, M. Ranson, P. J. Robinson, and P. A. Crock
Identification of the 49-kDa Autoantigen Associated with Lymphocytic Hypophysitis as {alpha}-Enolase
J. Clin. Endocrinol. Metab., February 1, 2002; 87(2): 752 - 757.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
A. K. Ghosh, M. Majumder, R. Steele, R. A. White, and R. B. Ray
A Novel 16-Kilodalton Cellular Protein Physically Interacts with and Antagonizes the Functional Activity of c-myc Promoter-Binding Protein 1
Mol. Cell. Biol., January 15, 2001; 21(2): 655 - 662.
[Abstract] [Full Text]


Home page
J. Biol. Chem.Home page
R. C. Osthus, H. Shim, S. Kim, Q. Li, R. Reddy, M. Mukherjee, Y. Xu, D. Wonsey, L. A. Lee, and C. V. Dang
Deregulation of Glucose Transporter 1 and Glycolytic Gene Expression by c-Myc
J. Biol. Chem., July 14, 2000; 275(29): 21797 - 21800.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Subramanian, A.
Right arrow Articles by Miller, D. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Subramanian, A.
Right arrow Articles by Miller, D. M.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2000 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement