 |
INTRODUCTION |
The bcl-2 gene was originally identified by its
involvement in the t(14;18) translocation associated with human
follicular lymphoma (1). The translocation of the bcl-2 gene
from chromosome 18q to the immunoglobulin heavy chain locus at 14q
results in the deregulated expression of bcl-2 (2). The
overexpression of bcl-2 in t(14;18) lymphoma leads to high
levels of bcl-2 mRNA and protein, which act to protect
cells from apoptosis (3). During B cell development, bcl-2
is expressed at low levels in pre-B cells, in which extensive cell
death occurs by apoptosis, whereas bcl-2 expression is
higher in mature and activated B cells (3, 4). The mechanisms of normal
and deregulated expression of bcl-2 remain unclear although
recent studies have provided some insight. In t(14;18) cells,
regulatory elements of both the bcl-2 promoter and the
immunoglobulin heavy chain enhancers are believed to play a role in
bcl-2 overexpression.
Two promoters mediate initiation of bcl-2 gene
transcription. The 5'-promoter (P1) is located 1306-1423 base pairs
upstream of the translational start site (5). This is a TATA-less,
GC-rich promoter that displays multiple start sites. The 3'-promoter
(P2) is located 1.3 kilobases downstream of the P1 promoter (5). The P2
promoter contains a TATA-box and CCAAT element. A number of negative
regulatory sites have been described in the bcl-2 promoter
region. We have previously demonstrated three 
1 binding sites, which
function as negative regulators of bcl-2 expression in pre-B
cells (6). The WT1 protein has also been shown to repress
bcl-2 activity in HeLa cells and B cells (7, 8). In
addition, a negative regulatory element upstream of the P2 promoter has
been described, although the proteins that bind to this element have
not been identified (9). The p53 tumor suppressor has been shown to
mediate repression of bcl-2 directly or indirectly through a
195-base pair region (10). We have also characterized a cyclic AMP
(cAMP)-responsive element that is responsible for the positive
regulation of bcl-2 expression during the activation of
mature B cells and during the rescue of immature B cells from calcium-dependent apoptosis (11). In chicken myeloid cells, v-Myb was reported to function as an anti-apoptotic factor by up-regulation of bcl-2 expression, whereas in murine T
cells, both c-Myb and B-Myb were shown to induce bcl-2
promoter activity (12-14). It is not clear if the Myb transcription
factors have a similar function in human B cells.
From our studies of the deregulation of bcl-2 in t(14;18)
lymphoma cells, we have shown that the cAMP-response element site in
the 5'-flanking sequence of the translocated bcl-2 gene is occupied (15). The cAMP-response element-binding protein family of
proteins was shown to bind to this site in vitro, and the
maximal increase in bcl-2 activity mediated by the
immunoglobulin heavy chain enhancers in transient transfection assays
was dependent on an intact cAMP-response element site. We have also
described an in vivo footprint over a WT1 site on the normal
silent bcl-2 allele; this site displayed a negative
regulatory activity (8). The site was not occupied on the translocated
allele, and the presence of the immunoglobulin enhancers prevented the
repression by WT1.
We now describe the positive regulation of bcl-2 promoter
activity by the A-Myb transcription factor. The Myb family of
transcription factors, which includes the structurally related A-,
B-,and c-Myb genes, is thought to play a pivotal role in
differentiation and proliferation of various cells. Each member is able
to transactivate promoters with the consensus sequence PyAAC(G/T)G
(16-19). c-Myb is expressed predominantly in immature and rapidly
dividing hematopoietic cells. B-Myb is expressed in many cell types
(20, 21), whereas A-Myb expression is limited to certain stages of
reproductive tissues, some neural cells, and a subset of normal and
neoplastic B lymphocytes (22-26). In this study, we show that A-Myb
and B-Myb, but not c-Myb, are expressed in t(14;18) lymphoma cells. We
also demonstrate that A-Myb is an effective activator of the
bcl-2 promoter in t(14;18) and mature B cells, but it does
not bind to a consensus sequence within the bcl-2 promoter.
We show that A-Myb mediates positive regulatory activity through a Cdx
homeodomain protein binding site and that A-Myb and a Cdx family
member, Cdx2, are components of the complex formed at this sequence. By
cotransfection studies, we demonstrate that the expression of A-Myb and
Cdx2 results in a marked increase in bcl-2 promoter
activity. The endogenous Bcl-2 protein is also increased when A-Myb
and/or Cdx2 are transfected into B cells. Because the role of Bcl-2 in
protection from apoptosis is well established in B cells, A-Myb
functions as an anti-apoptotic factor through its ability to
up-regulate Bcl-2 expression.
| |
EXPERIMENTAL PROCEDURES |
Plasmid Constructs--
The bcl-2-promoter-luciferase constructs
have been described previously (11). Deletions of the bcl-2
5'-flanking sequence were made by polymerase chain reaction subfragment
cloning or by insertion of restriction enzyme sites using site-directed
mutagenesis methods (CLONTECH and Stratagene)
followed by subfragment cloning. Constructs with mutations in the Cdx
or Myb binding sites were generated from the 
748 construct using the
Chameleon double-stranded site-directed mutagenesis kit (Stratagene).
The oligonucleotide sequences used as the mutagenic primers are as
follows with the transcription factor binding site
underlined and the mutated bases in boldface: Cdx
Mut,
GGGAAACGCACCTGATTTTTTACTTCGCCGTTTGTTTTTTCTTTAACCTTTTCAGC; 5'-Myb Mut,
GGGCGAGAGGTGTCGAAGGCCCCCGTTAC; 3'-Myb Mut, GCCGTTGGCCCTCGAAGCTTTTCCTCTGGG.
The construct with mutations in both Myb binding sites was generated
from the 3'-Myb Mut construct. The oligonucleotide sequence used as the mutagenic primer was:
GGGCGAGAGGTGTCGAAGGCCCTCGAAGC. All plasmid sequences were confirmed by sequencing.
The rat Cdx2 expression vector was a kind gift from Dr. Eric Sibley
(Stanford University). The human A-, B-, and c-Myb and the rat Cdx2
expression vectors consisted of the full-length coding region under the
control of the SV40 promoter or the cytomegalovirus immediate early
promoter. The Cdx2-myc tag construct (Cdx2-M) was made by polymerase
chain reaction amplification of the rat Cdx2 coding region using the
previously described Cdx2 expression vector and Pfu
polymerase (Stratagene). The antisense primer used for amplification
introduced a HindIII site in place of the stop codon,
whereas the sense primer reflected the Cdx2 sequence. The amplified
product was cloned into the pCR-BluntII-TOPO vector (Invitrogen), which
was then digested with EcoRI and HindIII. The
gel-purified Cdx2 DNA was cloned into the EcoRI and
HindIII sites of the pCMV-Tag5 vector (Stratagene) resulting
in the Cdx2 sequence followed in frame by the c-Myc epitope sequence.
The Cdx2-M construct showed the same activity on the bcl-2
promoter in transient transfection assays as the original Cdx2
construct. The deletion constructs of A-Myb have been described
previously (27, 28).
Cell Lines--
The SW480 cell line was kindly provided by Dr.
Bishr Omary (Stanford University). Culture conditions for the human B
cell lines, Nalm-6 (pre-B), DHL-9 (mature B), DHL-4 (t(14;18)), Raji (t(8;14)), and BJAB (t(8;14)), and the human myeloid cell line, IM-9,
as well as the human colon carcinoma cell lines, HT-29 and SW480, have
been described previously (6, 8, 15, 25, 29).
Transient Transfections and Luciferase Assays--
DNA
transfections were performed as described previously (8). For
cotransfections, 10 µg of the reporter plasmid was transfected with 5 µg of the A-Myb and/or Cdx2 expression vectors or empty expression
vector. The total amount of DNA transfected was kept constant at 20 µg using empty expression vector as needed. Reporter gene activity
was determined by the luciferase assay system (Promega). Each
transfection was performed at least three times in duplicate with at
least two different plasmid preparations. The normalized average values
with standard deviations were plotted.
RNA Isolation and Northern Blot Analysis--
Total RNA was
isolated using Tri-Reagent (Molecular Research Center). For each
sample, 25 µg of RNA was loaded onto a 1% agarose-formaldehyde gel.
The RNA was blotted onto a Nytran Plus filter (Schleicher & Schuell)
and UV cross-linked using a UV-Stratalinker (Stratagene). Hybridization
was performed using the high efficiency hybridization system according
to the manufacturer's instructions (Molecular Research Center). Probes
of cdx2, A-, B-, and c-myb were obtained by
digestion of the cDNA with EcoRI, SpeI,
XhoI, or BamHI, respectively. The cDNA
fragments were labeled by random priming (Amersham Pharmacia Biotech).
The human 
-actin cDNA was used to control for
variations in RNA loading.
Western Blot Analysis--
The antibodies specific for B- and
c-Myb, Bcl-2, and c-Myc were obtained from Santa Cruz Biotechnology.
The antibody to -Actin was from Sigma. The A-Myb-specific antiserum
and the immunoblotting procedure have been previously described (25).
To strip the blots for re-probing, the nitrocellulose membranes were
placed in a buffer consisting of 100 mM 2-mercaptoethanol,
2% SDS, and 62.5 mM Tris-HCl, pH 6.7, and incubated at
70 °C for 30 min. The blots were washed twice in Tris-buffered
saline-Tween for 10 min at room temperature before blocking and
incubation with antibody.
EMSA1--
The double-stranded oligonucleotides used
for EMSA of the A-Myb-responsive region
in the bcl-2 P2 promoter are shown below with the Cdx
binding site underlined and the mutated bases in boldface.
The oligonucleotides were synthesized with 5'-overhangs and
labeled by a fill-in reaction with [
-32P]dCTP and
Klenow polymerase. The binding reaction mixture contained 10mM Tris-HCl (pH 7.5), 30 mM NaCl, 0.5 mM EDTA, 1 mM dithiothreitol, 5% glycerol, 1 µg of poly(dI-dC), 6 µg of bovine serum albumin, 0.5 ng
(104cpm) of end-labeled DNA oligonucleotide probe, and
5-10µg of protein from crude nuclear extract. Electrophoresis was
performed as described previously (30).
UV Cross-linking and SDS-Polyacrylamide Gel
Electrophoresis--
EMSA was performed as above with the binding
reaction scaled up 5-fold. UV cross-linking and SDS-polyacrylamide gel
electrophoresis were performed as described previously (30).
Isolation of Nuclear Proteins Binding to Biotinylated
Probes--
Oligonucleotides representing the Bcl-2 Cdx and mutated
Cdx (Mut Cdx) sequences shown above were synthesized, and 5 µg of the
sense strand of each sequence was 3'-labeled using terminal deoxynucleotidyl transferase (Stratagene) and biotin-14-dATP (Life Technologies, Inc.). The biotin-labeled sense strands were annealed to
5 µg of their complementary antisense strand and purified over a
Sephadex column. The concentration of purified oligos was measured by a
260-nm absorbance measurement, and equal amounts of the annealed Cdx
and Mut Cdx oligos were incubated separately with strepavidin-coated magnetic beads (Promega) for 30 min at room temperature. Coupling of
the oligos to the magnetic beads was assessed by absorbance measurement
at 260 nm. For the binding reactions, 500 µg of nuclear extract
prepared from DHL-4 cells transfected with the Cdx2-M vector was
incubated with 100 µl of Cdx- or Mut Cdx-coupled beads in EMSA buffer
(30), 50 µg of bovine serum albumin, and 50 µg of poly(dI·dC) for
30 min at room temperature. The beads were then captured by a magnet,
washed three times with EMSA buffer, and resuspended in Laemmli buffer.
The samples were heated at 95 °C for 5 min, loaded onto a 10%
SDS-PAGE gel, electrophoresed, and transferred onto nitrocellulose.
Detection of Cdx2-M, A-Myb, and B-Myb was performed using the c-Myc,
A-Myb, and B-Myb antibodies and the immunoblotting procedure described above.
Selection of Transfected Cells--
DHL-9 or DHL-4 cells were
transfected using the previously described procedure with 10 µg of
the pHook2 vector (Invitrogen) and 5 µg of A-Myb and/or 5 µg of
Cdx2-M vectors or an equivalent amount of empty expression vector.
After incubation for 24 h at 37 °C, the transfected cells were
selected for sFV expression using hapten-coated magnetic beads
(Invitrogen). Equal numbers of transfected or nontransfected control
cells were lysed in Laemmli buffer and heated at 95 °C for 5 min.
The lysates were separated by SDS-PAGE and transferred onto
nitrocellulose. Western detection was done using the previously
described Bcl-2 antibody, whereas the -actin antibody was used to
assess protein loading and normalize the level of Bcl-2 expression.
| |
RESULTS |
Expression of A-, B-, and c-Myb in Different B Cell Lines--
To
elucidate the role of the Myb family of transcription factors in the
up-regulation of bcl-2 gene expression, we determined the
pattern of Myb expression in malignant B cells. We tested for A-, B-,
and c-myb RNA expression in the four B cell lines Nalm-6,
DHL-9, DHL-4, and Raji by Northern blot analysis. Using radiolabeled
probes specific for either A-, B-, or c-myb, we found that
A-myb was expressed in the two cell lines containing
translocations, DHL-4 and Raji, but A-myb was not expressed
in Nalm-6 or DHL-9 cells (Fig.
1A). In contrast to
A-myb, c-myb was not expressed in DHL-4 or Raji
cells but was expressed in Nalm-6 and DHL-9 cells (Fig. 1A).
B-myb was expressed in all four cell lines (Fig.
1A).
View larger version (25K):
[in this window]
[in a new window]
|
Fig. 1.
Myb RNA and protein expression in human
B-cell lines. A, RNA was isolated from the Nalm-6,
DHL-9, DHL-4, and Raji B-cell lines and then separated by
electrophoresis on 1% agarose-2.2 M formaldehyde gel. The
RNA was subsequently blotted onto three different membranes,
which were hybridized with the indicated 32P-labeled
probes. The -actin probe was used to ensure equivalent loading of
RNA. B, protein lysates of the indicated cell lines were
separated by SDS-polyacrylamide gel electrophoresis. The proteins were
then transferred onto nitrocellulose and probed with antisera specific
for A-, B-, or c-Myb.
|
|
To determine if myb RNA levels correlated with Myb protein
levels, we examined a number of B cell lines for A-, B-, and c-Myb protein expression by Western blot analysis. In testing for A-Myb expression, the BJAB Burkitt's cell line and the IM-9 myeloid cell
line were used as positive and negative controls, respectively. Similar
to the Northern data, A-Myb was expressed in DHL-4 cells and Raji but
not in DHL-9 or Nalm-6 cells (Fig. 1B). The Nalm-6, DHL-9,
DHL-4, and Raji cells were examined for B- and c-Myb protein expression. As shown in Fig. 1B, the pattern of B- and c-Myb
protein expression exactly paralleled the pattern of RNA expression.
A-Myb Is a Positive Regulator of the bcl-2 Promoter in B
Cells--
A schematic representation of the human bcl-2
5'-flanking and 5'-untranslated regions is shown in Fig.
2A. Sequence analysis revealed
two potential binding sites for Myb proteins in the bcl-2 P2
promoter. To determine if the Myb transcription factors were capable of
regulating the bcl-2 5'-(P1) and 3'-(P2) promoters, cotransfection experiments were performed.
View larger version (25K):
[in this window]
[in a new window]
|
Fig. 2.
Induction of the bcl-2
promoter by A-, B-, and c-Myb. A, schematic
diagram of the bcl-2 5'-flanking and untranslated regions
and the constructs used for the transient transfection assays. The
approximate positions of known transcription factor binding sites are
shown. B, transient transfection of DHL-9 cells with the
indicated bcl-2 promoter construct and an empty expression
vector (black bars), A-Myb (hatched bars), B-Myb
(dotted bars), or c-Myb (gray bars) expression
vector. The luciferase activity of each of the promoters in the
presence of the empty expression vector was assigned a value of 100, and the activity of the promoters in the presence of the A-, B-, or
c-Myb expression vectors was plotted relative to that. C,
results of transient transfection experiments of DHL-4 cells. Labels
for the bars are the same as in 2B.
|
|
Transfection of DHL-9 cells with the construct containing both the
bcl-2 P1 and P2 promoters and an A-Myb expression vector resulted in a 7-fold increase in luciferase activity over the activity
of the promoter construct when cotransfected with an empty expression
vector (Fig. 2B). When the same construct was transfected
with a B- or c-Myb expression vector, there was little change in the
promoter activity (Fig. 2B). When a construct containing the
bcl-2 P2 promoter was transfected with the A-Myb expression vector into DHL-9 cells, the result was a 6- to 7-fold increase in
luciferase activity, which was similar to that of the construct containing both the P1 and P2 promoters (Fig. 2B).
Transfection of the same construct with the B-Myb expression vector
showed less than a 3-fold induction of luciferase activity, whereas
transfection with the c-Myb expression vector resulted in less than a
2-fold increase (Fig. 2B). These data suggested that B- and
c-Myb, both of which are expressed in DHL-9 cells, have very little
effect on bcl-2 promoter activity. Although A-Myb is not
expressed in DHL-9 cells, it was a strong inducer of the
bcl-2 promoter, primarily acting through the P2 promoter.
Because A-Myb is expressed in DHL-4 cells but not in DHL-9 cells, our
studies focused on DHL-4 cells.
To assess the activity of the Myb proteins on the bcl-2
promoter in t(14;18) cells, the same constructs were transfected into the DHL-4 cell line. In these cells, A-Myb acted as a powerful inducer
of the bcl-2 promoter. When the construct containing the P1
and P2 promoters was transfected with the A-Myb expression vector into
DHL-4 cells, the result was a 30-fold increase in luciferase activity
(Fig. 2C). A-Myb also increased the activity of the
bcl-2 P2 promoter by more than 30-fold (Fig. 2C).
Unlike A-Myb, B- and c-Myb had no significant effect on the
bcl-2 P2 promoter activity in DHL-4 cells (Fig.
2C). These results suggested that A-Myb, rather than B- or
c-Myb, was the functional Myb family member with respect to
bcl-2 promoter activity in DHL-4 cells. Both the P1 and P2
promoters are utilized in DHL-4 cells, and A-Myb acts primarily through
the P2 promoter.
Identification of the Regions in the bcl-2 Promoter Responsive to
A-Myb in t(14;18) Cells--
To identify the region of the
bcl-2 P2 promoter responsive to A-Myb, deletion constructs
of this promoter were transfected with an A-Myb expression vector into
DHL-4 cells. Sequence analysis of the P2 promoter revealed a TATA-box,
a CCAAT element, an octamer site, and two potential Myb binding sites
(Fig. 3A). Surprisingly, results from the transfection studies showed that the region mediating induction by A-Myb was between 297 and 324, which is upstream of
the Myb consensus sequences (Fig. 3B). When this region was deleted, induction of the bcl-2 P2 promoter by A-Myb was
dramatically reduced (Fig. 3B). Comparison of this region
with a transcription factor data base revealed a potential binding site
for the Cdx homeodomain protein family members flanked by stretches of
AT-rich sequences. These results suggested that induction of the
bcl-2 P2 promoter by A-Myb was not mediated by the Myb
binding sites but possibly through a homeodomain protein binding
site.
View larger version (26K):
[in this window]
[in a new window]
|
Fig. 3.
Identification of the region in the
bcl-2 P2 promoter responsive to A-Myb.
A, diagram of the bcl-2 P2 promoter and the
constructs used in the transient transfection experiments. The
bcl-2 sequence was numbered relative to the ATG codon.
B, results of transient transfection analysis with
bcl-2 P2 promoter deletion constructs and an empty
expression vector (solid bars) or the A-Myb expression
vector (hatched bars) in DHL-4 cells. The activity of the
748 construct with the empty expression vector was defined as 100, and the luciferase activity of the indicated constructs was plotted
relative to that value.
|
|
Characterization of the Protein That Interacts with the
A-Myb-responsive Region in the bcl-2 P2 Promoter--
To determine if
a protein interacted specifically with the A-Myb-responsive region of
the bcl-2 P2 promoter, EMSA was performed using an
oligonucleotide encompassing the sequence. Two specific complexes and a
few nonspecific complexes formed when the labeled oligonucleotide was
incubated with DHL-4 nuclear extract (Fig. 4A, lane 1).
Formation of the specific complexes could be prevented by competition
with a 100-fold or greater molar excess of unlabeled cold
oligonucleotide (Fig. 4A, lanes 2-4), but
not by a 500-fold molar excess of a nonspecific oligonucleotide (Fig.
4A, lane 8). To assess the involvement of the Cdx
sequence in the specific complex formation, an oligonucleotide
containing a change of the core Cdx binding site from ATTA to GCGG was
used as a competitor. As shown in Fig. 4A, lanes
5-7, this oligonucleotide was not able to compete for the two
specific complexes formed by the wild-type sequence, even at a 500-fold
molar excess. When the mutant oligonucleotide was labeled and incubated
with DHL-4 nuclear extract, no specific complexes were formed (Fig.
4A, lanes 9-12).
View larger version (20K):
[in this window]
[in a new window]
|
Fig. 4.
Characterization of the protein complexes
binding to the A-Myb-responsive region in the bcl-2 P2
promoter. A, EMSA of the bcl-2
A-Myb-responsive region (Cdx site) with DHL-4 nuclear extract.
Lanes 1-8 represent the labeled wild-type probe with DHL-4
nuclear extract and in the absence (lane 1) or presence of
100-500-fold molar excess of competitors (50-250 ng), wild-type
(WT, lanes 2-4), or mutated Cdx binding site
(Mut, lanes 5-7). An irrelevant sequence from
the bcl-2 5'-promoter was used as a nonspecific competitor
(NS, lane 8). The specific complexes formed with
the wild-type probe are indicated with arrows, C1 and C2.
Lanes 9-12 represent a labeled probe with a mutation
(M) in the Cdx binding site incubated with DHL-4 nuclear
extract and the indicated 100-fold molar excess of competitor (50 ng).
B, denaturing SDS-polyacrylamide gel electrophoresis of the
UV cross-linked complexes formed with the bcl-2 P2 promoter
A-Myb-responsive region and DHL-4 nuclear extract. Protein from the
faster migrating complex, C1, is shown in the first lane, and protein
from the slower migrating complex, C2, is shown in the second lane. The
positions of the molecular mass markers are shown. After correction for
bound oligonucleotide, the molecular mass of the protein for each
complex was 32 kDa. C, recovery of nuclear proteins that
interact with the Cdx binding site. Nuclear extracts from DHL-4 cells transfected with Cdx2-M
were incubated with Cdx (lane 2) or Mut Cdx (lane
3) oligonucleotides conjugated to magnetic beads. The proteins
associated with these sequences were separated by SDS-PAGE. The
recruitment of A-Myb, B-Myb, and Cdx2-M to the Cdx binding site was
assessed by immunoblotting with anti-A-Myb, anti-B-Myb, or anti-c-Myc
antibodies, respectively. The first lane represents 100 µg of nuclear
extract and shows that A-Myb, B-Myb, and Cdx2-M are expressed in the
transfected cells.
|
|
EMSA followed by UV cross-linking and SDS denaturing gel
electrophoresis was performed to determine the composition of the two
specific complexes. In each case, a single protein was observed (Fig.
4B, lanes 1 and 2). After correction
for the bound oligonucleotide, the molecular mass was 32 kDa (Fig.
4B, lanes 1 and 2). This is approximately the size of the Cdx homeodomain proteins. There was no
antibody available against Cdx so we were not able to confirm by
Western blot analysis that this protein was a Cdx family member. We
also do not have an antibody to supershift A-Myb so we could not
confirm by EMSA that A-Myb was in the complex binding to the Cdx site.
We also attempted to characterize the faster migrating EMSA complexes
because these displayed such strong binding. Loss of these complexes in
the EMSA studies could only be achieved by mutation of the Cdx binding
site as well as the AT-rich sequences flanking the Cdx
site.2 EMSA followed by UV
cross-linking and SDS denaturing gel electrophoresis revealed that the
complexes involved a protein of 29 kDa.2 We suspect that
this protein may be one of the high mobility group family members,
because these proteins bind to AT-rich regions, and they display
relatively nonspecific binding. High mobility group 1 has a molecular
mass of 29 kDa.
Studies with in vitro translated A-Myb and Cdx2-M did not
reveal any interaction between these two proteins.2 To
determine whether an interaction required DNA or other nuclear proteins, we prepared nuclear extracts from DHL-4 cells transfected with Cdx2-M. The nuclear extract was incubated with the biotinylated Cdx or Mut Cdx oligonucleotide immobilized on strepavidin-coated magnetic beads. After washing the beads, the bound nuclear proteins were separated by SDS-PAGE and analyzed by Western blot. As shown in
Fig. 4C, Cdx2-M bound to the Cdx oligonucleotide but not to the oligonucleotide with the mutated Cdx2 site. Endogenous A-Myb but
not B-Myb was present in the protein complex that bound to the
wild-type Cdx site. These results strengthen our conclusion that the UV
cross-linked protein of 32 kDa is Cdx2 and demonstrate that A-Myb is a
component of the protein complex formed at the Cdx binding site.
A Cdx Binding Site Mediates the Positive Regulatory Activity of
A-Myb on the bcl-2 P2 Promoter in t(14;18) Cells--
To determine if
the Cdx binding sequence was responsible for the induction of the
bcl-2 P2 promoter activity by A-Myb, a construct containing
a mutant Cdx site was generated (Fig.
5A). Constructs containing
mutations in either of the two Myb consensus sequences, or both, were
also generated to eliminate the possibility that these sites were
necessary for induction of the bcl-2 P2 promoter by A-Myb
(Fig. 5A). Although some loss of basal transcriptional activity was observed with the construct containing the mutated Cdx
binding site, no change was observed in basal activity when the Myb
binding sites were mutated.2 As shown in Fig.
5B, disruption of the Cdx binding site resulted in a drastic
loss in the ability of A-Myb to induce the P2 promoter in DHL-4 cells
(Fig. 5B). In contrast, the constructs containing mutations
in the Myb sequences displayed no loss in their induction by A-Myb
(Fig. 5B). Constructs containing mutations in the AT-rich sequences flanking the Cdx binding site were also tested by transient transfection assay, but these mutations showed no loss in
bcl-2 promoter activation by A-Myb.2 Although
mutation of the Cdx binding site did not bring the level of
transcription down to that of the construct in which the binding site
was deleted, this mutation did abolish most of the activation of the
bcl-2 promoter by A-Myb. These results established that the
Cdx protein binding site accounted for the positive induction of the
bcl-2 P2 promoter by A-Myb and that the Myb consensus
sequences were not necessary.
View larger version (38K):
[in this window]
[in a new window]
|
Fig. 5.
Effect of mutations in the bcl-2
P2 promoter on induction by A-Myb. A, diagram of
the bcl-2 P2 promoter and the constructs used in the
transient transfection assays. All mutant constructs were derived from
the 748 construct. B, results of transient cotransfection
experiments with wild-type or mutant bcl-2 P2 promoter
constructs and the A-Myb expression vector. The data were plotted as
fold activation of the bcl-2 promoter construct by A-Myb
over the activity of the bcl-2 promoter when transfected
with an empty expression vector. WT, wild type.
|
|
Expression of Cdx2 in Different B Cell Lineages--
The
expression of the two cloned human Cdx family members, Cdx1 and Cdx2,
in normal tissues has been limited to the intestinal epithelium (31).
In consideration of the results showing the importance of a Cdx binding
site in the induction of the P2 promoter by A-Myb, we wanted to
determine if a Cdx family member was expressed in our malignant B cell
lines. Using a radiolabeled probe generated from the rat
cdx2 sequence, we tested for cdx expression in
the Nalm-6, DHL-9, DHL-4, and Raji B cell lines by Northern blot
analysis. The colon carcinoma cell lines SW480 and HT-29 were used as
positive and negative controls, respectively. As shown in Fig.
6, the rat cdx2 probe
hybridized to a 2.4-kilobase transcript in SW480 RNA, as well as to RNA
from all four B cell lines, but not to the HT-29 RNA. These results
suggested that cdx2 or a Cdx family member was expressed in
these malignant B cells.
View larger version (71K):
[in this window]
[in a new window]
|
Fig. 6.
Cdx2 RNA expression in human B cell and colon
carcinoma cell lines. RNA from the Nalm-6, DHL-9, DHL-4, and Raji
B-cell lines and the HT-29 and SW480 colon carcinoma cell lines was
isolated and separated on a 1% agarose-formaldehyde gel. The RNA was
blotted onto a nylon membrane, which was hybridized with a
32P-labeled fragment of the rat cdx2 cDNA.
The -actin cDNA probe was used to ensure equivalent loading of
RNA.
|
|
Cdx2 Cooperates with A-Myb to Enhance Induction of the bcl-2 P2
Promoter--
The cdx2 gene encodes a sequence-specific
transcription factor believed to play a role in the proliferation and
differentiation of intestinal epithelial cells (31-33). To assess the
ability of Cdx2 to up-regulate the bcl-2 P2 promoter, we
performed cotransfections of DHL-4 cells with a Cdx2 expression vector
alone or with the A-Myb expression vector. Cotransfections with an
empty expression vector or with the A-Myb expression vector were also
performed as a comparison. As shown in Fig.
7, cotransfection of the wild-type bcl-2 P2 promoter with the Cdx2 and A-Myb expression vectors
resulted in a 116-fold increase in luciferase activity. This was a
marked increase over that seen when the P2 promoter was transfected
with the A-Myb or Cdx2 expression vector alone (Fig. 7). The Cdx2
expression vector alone had some positive effect on the P2 promoter
construct, inducing a 5-fold increase in relative luciferase activity
(Fig. 7). When the same transfections were performed with the Cdx
binding site mutant construct, the changes in luciferase activity were significantly lower. Although Cdx2 and A-Myb together could induce the
promoter with the mutated Cdx2 site, the fold induction was significantly lower than with the wild-type construct. This activity could be due to residual binding to the mutant site because our binding
studies showed that a low level of Cdx2-M and A-Myb bound to the mutant
site (Fig. 4C). No significant changes in luciferase activity were observed when the bcl-2 P2 minimal promoter or
the 297 deletion construct was used with any of the expression vector combinations (Fig. 7). These data demonstrate that Cdx2 and A-Myb are a
powerful transactivating combination for the bcl-2 P2
promoter in DHL-4 cells.
View larger version (12K):
[in this window]
[in a new window]
|
Fig. 7.
Induction of the bcl-2 P2
promoter by A-Myb and Cdx2. Results of transient transfection of
DHL-4 cells with the 748 wild-type bcl-2 P2 promoter
construct (WT), the 748 construct with a mutation in the
Cdx binding site (Cdx Mut), the 297 construct, which is
missing the Cdx binding site, or the minimal 92 bcl-2 P2
promoter construct, with the A-Myb expression vector (hatched
bars), the Cdx2 expression vector (dotted bars), or
both A-Myb and Cdx2 expression vectors (black bars). The
data were plotted as fold activation of the bcl-2 promoter
construct when transfected with the different expression vectors over
the activity of the promoter construct when transfected with the empty
expression vector.
|
|
Up-regulation of Endogenous Bcl-2 Protein by Cdx2 and
A-Myb--
We wished to determine whether the endogenous Bcl-2 protein
was up-regulated by transfected Cdx2 and/or A-Myb. Because the transfection efficiency of DHL-4 cells is low, we selected the transfected cells by cotransfection with the pHook2 expression vector
followed by purification on hapten-coated magnetic beads. The
transfected cells were lysed, and the proteins were analyzed by Western
blot. Although DHL-4 cells express high levels of Bcl-2 protein, we
were able to detect a reproducible increase in Bcl-2 levels of
approximately 1.5-fold.2 It is not clear that this is a
significant change, however, and we do not know how much it is possible
to increase Bcl-2 expression above the already high endogenous level in
DHL-4 cells. Therefore these studies were performed with DHL-9 cells
because they express lower levels of Bcl-2. A significant induction of
Bcl-2 (6.5-11-fold) was observed with the transfection of A-Myb,
Cdx2-M, or both expression vectors as compared with the transfection of
the empty expression vector or to Bcl-2 expression in nontransfected
cells (Fig. 8, compare lanes
1, 2, and 6 to lanes 3-5).
Cdx2-M alone showed less induction of Bcl-2 (6.5-fold) than A-Myb
(10-fold) or the combination of A-Myb and Cdx2-M (11-fold). Cooperative
induction of endogenous Bcl-2 by Cdx2-M and A-Myb was not seen, perhaps
because DHL-9 cells already express high levels of Cdx-2. These results
demonstrate, however, that the endogenous Bcl-2 protein in human B
cells can be up-regulated by A-Myb and/or Cdx2 transfection.
View larger version (24K):
[in this window]
[in a new window]
|
Fig. 8.
Effect of transfection of A-Myb and Cdx2 on
endogenous Bcl-2 protein in DHL-9 cells. DHL-9 cells were
transiently transfected with the pHook2 vector and A-Myb and/or Cdx2-M
or an empty expression vector (lanes 3-6). After incubation
for 24 h, sFV-expressing cells were selected using hapten-coated
magnetic beads. Protein extracts from 5 × 104 cells
were separated by SDS-PAGE and transferred to nitrocellulose. Extracts
from nonelectroporated and electroporated DHL-9 cells were used as
controls (lanes 1 and 2). Bcl-2 expression was
assessed by an anti-Bcl-2 antibody. An anti--actin antibody was used
as a protein-loading control. Although not shown, the blot was also
probed with antibodies against A-Myb and Myc to confirm that A-Myb and
Cdx2-M were expressed in the transfected cells.
|
|
The DNA Binding and Transactivation Domains of A-Myb Are Required
for Induction of the bcl-2 P2 Promoter--
The A-Myb transcription
factor is comprised of a DNA binding domain, a transactivation domain,
and a negative regulatory region at the C terminus (27). To assess the
importance of each of these regions in the induction of the
bcl-2 P2 promoter, we transfected DHL-4 cells with a
bcl-2 P2 promoter construct and an A-Myb expression vector
containing a deletion of a functional region. Six different A-Myb
expression vectors were tested. These consisted of a wild-type A-Myb
gene, a deletion of the C terminus, a deletion of the transactivation domain, a deletion of the DNA binding domain, the DNA binding domain
alone, and the DNA binding domain attached to the VP16 transactivation
domain (Fig. 9A). Expression
of all the A-Myb mutants was verified,2 and these
constructs have also been tested for expression in previous studies
(19, 27, 28). As shown in Fig. 9B, transfection of DHL-4
cells with the bcl-2 P2 promoter construct and the A-Myb C
terminus truncation resulted in a 3.1-fold increase in relative luciferase activity as compared with the wild-type A-Myb vector (Fig.
9B). The A-Myb transactivation and DNA binding domains were both necessary for induction of the P2 promoter. Transfection results
showed a 3-fold loss in A-Myb induction with the transactivation domain
deletion construct and a 13-fold loss with the DNA binding domain
deletion construct (Fig. 9B). The DNA binding domain alone had little activity, but the construct with the VP16 transactivation domain showed increased activity (Fig. 9B).
View larger version (34K):
[in this window]
[in a new window]
|
Fig. 9.
Regions of A-Myb required for the induction
of the bcl-2 P2 promoter in DHL-4 cells.
A, diagram of the wild-type (WT) A-Myb protein
and deletion constructs of A-Myb used in the transient transfection
experiments. B, results of transient transfection assays
with the 748 bcl-2 P2 promoter construct and the indicated
A-Myb wild-type or deletion expression vector. The data were plotted as
fold activation of the bcl-2 promoter by the different A-Myb
expression vectors over the activity of the bcl-2 promoter
construct when transfected with the empty expression vector.
|
|
| |
DISCUSSION |
In these studies, we demonstrated by Northern and Western blot
analyses that the Myb family of transcription factors has a defined
pattern of expression in a number of malignant B cells lines. We showed
that A-Myb is expressed in the DHL-4 and Raji cell lines, which have
the t(14;18) and t(8;14) translocations, respectively, but not in the
pre-B cell line, Nalm-6, or the mature B cell line, DHL-9. In contrast,
c-Myb is expressed in Nalm-6 and DHL-9 cells but not in DHL-4 or Raji
cells. B-Myb is expressed in all four cell lines tested. These results
are consistent with previous studies that showed A-Myb expression in B
cells with a germinal center phenotype (22, 23, 26).
Bcl-2 expression is higher in normal mature B cells than in
pre-B cells, and bcl-2 is overexpressed in t(14;18)
lymphomas, and these cells are resistant to the induction of apoptosis
(2-4). We demonstrated that A-Myb acts as a powerful inducer of
bcl-2 activity in mature B cells and t(14;18) cells. In
light of the well established role of Bcl-2 in protection of B cells
from apoptosis, A-Myb can be considered to function as an antiapoptotic factor.
The region within the human bcl-2 P2 promoter that was
responsive to A-Myb was found to be 324 to 297 upstream of the
bcl-2 translational start site. This region consists of a
Cdx binding site flanked by AT-rich sequences. In the absence of this
sequence, A-Myb showed only minimal induction of the bcl-2
P2 promoter. EMSA with an oligonucleotide of the Cdx binding site and
DHL-4 nuclear extract revealed two specific complexes. Mutation of the Cdx sequence abolished formation of both complexes. In addition, mutation of the Cdx binding site in the bcl-2 promoter
construct resulted in the loss of the ability of A-Myb to induce
bcl-2 activity. In contrast, mutation of the Myb consensus
sequences had no effect on A-Myb induction of the P2 promoter. These
data demonstrate that a Cdx binding site rather than a Myb binding site
is necessary for induction of the bcl-2 P2 promoter by
A-Myb.
UV cross-linking followed by SDS-polyacrylamide gel electrophoresis of
both specific EMSA complexes revealed a single protein with a molecular
mass of 32 kDa. This is within the size range of the two characterized
human Cdx family members, Cdx1 and Cdx2. If A-Myb directly interacted
with this sequence, we would have expected a protein of 91 kDa. It is
possible that the more slowly migrating EMSA complex is formed by Cdx
and A-Myb with only Cdx contacting the DNA. Whereas we have an A-Myb
antibody for Western blot analysis, we do not have an A-Myb antibody
that produces a supershift in EMSA, so we cannot confirm this hypothesis.
We were able to demonstrate that A-Myb and Cdx2-M were present in the
nuclear protein complex that bound to the Cdx site. This supports our
transfection results that showed that A-Myb acts through the Cdx
binding site to induce bcl-2 promoter activity. However, we
could not demonstrate a direct interaction between these two proteins
when they were translated in vitro, even in the presence of
the Cdx oligonucleotide. These results suggest that there may be one or
more other nuclear proteins involved in this complex and that the
interaction of A-Myb with Cdx2 may not be direct. Because we were not
able to demonstrate that B-Myb bound to the Cdx site, it appears that
only A-Myb is recruited to the Cdx-2 complex on the bcl-2
promoter. This finding would explain why A-Myb is the only member of
the Myb family that induces expression of the bcl-2 promoter
in DHL-4 cells.
By Northern blot analysis, we demonstrated that Cdx2 or a Cdx family
member is expressed in the Nalm-6, DHL-9, DHL-4, and Raji B-cell lines.
This is surprising, because other studies have shown Cdx1 and Cdx2
expression to be confined to the intestinal epithelium (31). Only one
study has demonstrated expression of Cdx2 in non-intestinal tissue. In
that case, a patient with acute myelogenous leukemia with a t(12;13)
translocation displayed a fusion between the ETV6 and
Cdx2 genes with expression of a chimeric ETV6-Cdx2 fusion
protein and normal Cdx2 transcripts (34). Cdx2 expression was also
found in the leukemic cells from a patient with chronic myeloid
leukemia in transformation (34). From our results, we can state that a
Cdx family member is expressed in our malignant B cell lines, and a
protein that is the same size as the Cdx family members interacts with
the region of the bcl-2 P2 promoter that is responsive to
A-Myb. In addition, transfected Cdx2-M interacts with the
bcl-2 Cdx site.
In cotransfection studies with Cdx2 and A-Myb expression vectors, we
were able to demonstrate a significant induction of the wild-type
bcl-2 P2 promoter, but much less activity was seen with a
promoter construct containing a mutation or deletion of the Cdx binding
site or with a minimal P2 promoter construct. In addition, we observed
that the expression of both Cdx2 and A-Myb resulted in much higher
bcl-2 P2 promoter activity compared with the activity seen
when either expression vector was used alone. We believe it is likely
that a Cdx protein and A-Myb are included in a complex that binds to
the Cdx site in the bcl-2 P2 promoter. Our in
vitro binding studies demonstrate that both A-Myb and Cdx2-M
interact with the Cdx site. Although it is possible that A-Myb acts on the promoter of a Cdx gene and this leads to increased Cdx expression, we think this is unlikely to account for the effect of A-Myb on the
bcl-2 P2 promoter. We have seen activation of the
bcl-2 promoter by transfection of an A-Myb expression vector
at short time intervals. In addition, Cdx2 is already expressed in
DHL-4 cells, and by itself, it is a weak transactivator of the
bcl-2 P2 promoter even when the level of Cdx2 protein is
increased by transfection of the Cdx2 expression vector. Our results
with the bcl-2 promoter reporter construct are supported by
the demonstration that transfection of A-Myb and/or Cdx2 expression
vectors increased expression of endogenous Bcl-2, although we were not
able to demonstrate cooperativity. Transfection of the A-Myb expression
vector resulted in a greater induction of Bcl-2 protein than did
transfection of the Cdx2 expression vector. Because DHL-9 cells express
no A-Myb, this result demonstrates the important role of the A-Myb
protein in induction of endogenous Bcl-2 protein levels. The rather
high level of Cdx2 in DHL-9 cells may account for our inability to
demonstrate cooperativity with A-Myb in the induction of the endogenous
Bcl-2 protein.
There is precedent for the formation of a complex between a Myb protein
and a homeodomain protein. Bas1p is a Myb-related transcription factor
and Bas2p is a homeodomain protein. They form a complex and regulate
adenine biosynthetic genes in Saccharomyces cerevisiae (35). c-Myb is known to interact with several
different transcription factors, although usually this occurs with both factors binding to their DNA consensus sites. It has been reported that
c-Myb can interact synergistically with the Epstein-Barr virus BZLF1
leucine zipper transactivator in lymphoid cells. This interaction
occurs on the BZLF1 DNA binding site without DNA binding by c-Myb,
although the DNA binding domain of c-Myb is required for the
synergistic effect (36). It is also clear that c-Myb can transactivate
promoters that lack Myb binding sites probably through interactions
with particular types of TATA boxes (37). The DNA binding domain of
c-Myb is not required for this activity.
The structure of the A-Myb transcription factor can be separated into
three different domains: the N-terminal region, which consists of the
DNA binding domain, a central transactivation domain, and a negative
regulatory region within the C terminus (27). We have demonstrated that
the DNA binding and transactivation domains are both required for
induction of the bcl-2 P2 promoter by A-Myb, whereas the C
terminus has a negative effect on induction. We have not been able to
demonstrate a direct interaction of the Myb family members with any Myb
binding sites in the bcl-2 promoter. Although the DNA
binding domain of A-Myb is required, it is possible that this region
also mediates protein-protein interactions (28) or serves as a
transactivator. In this case, A-Myb could interact with another protein
that binds to Cdx, which then directly contacts the DNA. Because B-Myb
was not present in the complex with Cdx2, it is likely that sequences
that are not homologous between the two Myb family members are involved
in the interaction with the Cdx complex.
It has been suggested that v-Myb and c-Myb can regulate
bcl-2 expression in chicken myeloid cells and murine thymoma
cells, respectively, by direct interaction of the Myb protein with its consensus sequence in the promoter (12, 13). Increased expression of
bcl-2 correlated with resistance to apoptosis in these
cells, so the Myb proteins were shown to function as antiapoptotic
factors. Although v-Myb was a relatively weak activator of the chicken bcl-2 promoter in myeloid cells, the E26 Myb-Ets fusion
protein was a much stronger transactivator (12). Some, but not all, of
this activity was mediated by four Myb binding sites in the chicken
bcl-2 P2 promoter. The murine bcl-2 P2 promoter
contains one Myb binding site. It was shown that mutation of this site decreased promoter activity by about 50% in a murine T cell line, and
purified Myb protein bound to this site (13). Induction of the murine
bcl-2 P1 promoter in a T cell line by c-Myb has been
described (38). The mechanism whereby c-Myb increased bcl-2 promoter activity was not entirely defined, but a Myb binding site was
not required. B-Myb has been shown to up-regulate the murine
bcl-2 promoter in murine T cells through a region containing a Myb binding site (14). It was not clear if this binding site was
essential for the induction of bcl-2 activity by B-Myb,
because the site was not mutated. Our results with A-Myb in human B
cells are quite different from the results with c-Myb and B-Myb in
murine T cells.
In this study we demonstrated that A-Myb, rather than B- or c-Myb, is
the active positive regulator of bcl-2 activity in human malignant B cells. We have shown that the mechanism A-Myb utilizes to
induce bcl-2 P2 promoter activity is indirect and involves the binding site of the Cdx homeodomain proteins. Further studies are
being done to determine whether other proteins are involved in this
complex with Cdx and A-Myb and to discern their role in the transformed
phenotype of t(14;18) lymphoma cells.
,
TOP
ABSTRACT
INTRODUCTION
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati What's this?
