Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Originally published In Press as doi:10.1074/jbc.M008817200 on October 18, 2000

J. Biol. Chem., Vol. 276, Issue 1, 147-152, January 5, 2001
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
276/1/147    most recent
M008817200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Nakamura, T.
Right arrow Articles by Sugita, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Nakamura, T.
Right arrow Articles by Sugita, M.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Chloroplast Ribonucleoproteins Function as a Stabilizing Factor of Ribosome-free mRNAs in the Stroma*

Takahiro NakamuraDagger , Masaru OhtaDagger §, Masahiro SugiuraDagger , and Mamoru SugitaDagger ||

From the Dagger  Center for Gene Research, and the  Graduate School of Human Informatics, Nagoya University, Nagoya 464-8601, Japan

Received for publication, September 27, 2000



    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Post-transcriptional RNA processing is an important step in the regulation of chloroplast gene expression, and a number of chloroplast ribonucleoproteins (cpRNPs) are likely to be involved in this process. The major tobacco cpRNPs are composed of five species: cp28, cp29A, cp29B, cp31, and cp33 and these are divided into three groups (I, II, and III). By immunoprecipitation, gel filtration, and Western blot analysis, we demonstrated that these cpRNPs are abundant stromal proteins that exist as complexes with ribosome-free mRNAs. Many ribosome-free psbA mRNAs coprecipitate with cpRNPs, indicating that the majority of stromal psbA mRNAs are associated with cpRNPs. In addition, an in vitro mRNA degradation assay indicated that exogenous psbA mRNA is more rapidly degraded in cpRNP-depleted extracts than in nondepleted extracts. When the depleted extract was reconstituted with recombinant cpRNPs, the psbA mRNA in the extract was protected from degradation to a similar extent as the psbA mRNA in the nondepleted extract. Moreover, restoration of the stabilizing activity varied following addition of individual group-specific cpRNPs alone or in combination. When the five cpRNPs were supplemented in the depleted extract, full activity was restored. We propose that these cpRNPs act as stabilizing factors for nonribosome-bound mRNAs in the stroma.



    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Chloroplasts contain their own genes, and chloroplast gene expression is regulated at both the transcriptional and post-transcriptional level (1-3). Quantitative analysis of spinach (4) and barley (5, 6) has revealed that the mRNA levels of several protein-encoding genes in chloroplasts can increase dramatically (from 20- to ~1,000-fold) during plastid differentiation and chloroplast development. The increased abundance of these mRNAs cannot, however, account for the relative transcription rate of these genes (4).

The half-lives of chloroplast mRNAs have been shown to range from 6 h for the mRNA encoding the 83-kDa chlorophyll a apoprotein of photosystem I gene (psaA) to over 40 h for the mRNA encoding the D1 protein of photosystem II (psbA, 1 Refs. 7 and 8). Moreover, the stability of chloroplast mRNAs has been shown to change in response to chloroplast development and varying light conditions. This suggests that the differential accumulation of chloroplast mRNA is regulated primarily at the post-transcriptional level, with mRNA stability then contributing to the mRNA steady-state level. The mechanism underlying mRNA stability, however, is poorly understood.

Like Escherichia coli mRNAs, most chloroplast mRNAs contain an inverted repeat (IR) sequence in their 3'-untranslated region (UTR) that can fold into a stable stem-loop structure. This structure has been shown to be important in determining mRNA stability both in vitro (9-11), and in vivo (11, 12). Several chloroplast proteins, detected by UV cross-linking (13-17) and gel-shift assays (18-20), have been found to bind to the 5'- or 3'-UTRs of mRNAs. These chloroplast proteins could be gene-specific mRNA-binding proteins. In addition, numerous nuclear mutants of Chlamydomonas reinhardtii (17, 21), maize (22), barley (23, 24), and Arabidopsis thaliana (25), have been identified, which fail to accumulate individual chloroplast-encoded mRNAs (or precursor (pre)-mRNAs) despite having normal transcription rates.

We previously isolated five nuclear-encoded chloroplast ribonucleoproteins (cpRNPs) from tobacco, which we named cp28, cp29A, cp29B, cp31, and cp33 according to their sizes in kDa (26, 27). Based on phylogenetic comparison to the cpRNPs from A. thaliana, tobacco cpRNPs can be classified into three groups: cp29A and cp29B in group I, cp28 and cp31 in group II, and cp33 in group III (28). Tobacco cpRNPs have two consensus sequence-type RNA-binding domains and an acidic N-terminal domain. Similar proteins and genes encoding cpRNP homologs have also been found in a variety of other plant species (29) including spinach (30), A. thaliana (28), maize (31), and barley (32).

In vitro, tobacco cpRNPs have a strong affinity for RNA homopolymers (poly(G) and poly(U)) rather than single-stranded or double-stranded DNA (33, 34). After UV cross-linking chloroplast proteins with several mRNA probes, a subset of proteins of around 30 kDa can usually be detected in the chloroplasts of land plants (15, 16) and green algae (17). This suggests that cpRNPs bind nonspecifically to chloroplast RNAs. Spinach 28RNP, a similar protein to tobacco cp28 and cp31, was reported to be required for the formation of the 3'-end of several mRNAs in vitro (30, 35). Further studies have shown this protein directs correct processing of the 3'-end pre-mRNA by the high molecular weight complex in vitro (36). We recently found that tobacco cpRNPs in vivo bind not only to mRNAs (and pre-mRNAs) but also to intron-containing pre-tRNAs (37). This suggests that cpRNPs are involved in RNA processing rather than in the 3'-end formation of pre-mRNAs.

Despite extensive biochemical analysis of cpRNPs in vitro, little is known about their physiological function in vivo. To investigate the function of cpRNPs in RNA processing, we quantified cpRNPs and psbA mRNA levels in tobacco chloroplasts. We found cpRNPs were surprisingly abundant in the stroma, and the majority of these proteins exist as 30- to 600-kDa complexes with chloroplast RNAs that contribute to the stability of stromal mRNAs.


    EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Preparation of Intact Chloroplasts and Stromal Extracts-- Intact chloroplasts were isolated from the green leaves (5-8 cm) of tobacco plants (Nicotiana tabacum var. Bright Yellow 4) as described previously (26). The chloroplasts were lysed in extraction buffer (50 mM Tris-HCl, pH 8.0, 50 mM KCl, 2 mM dithiothreitol, 10 mM MgCl2, and 500 units of RNase inhibitor from Takara Shuzo) for 15 min at 4 °C. Stromal extracts were obtained by centrifuging the lysate at 15,000 × g for 10 min, and filtering the supernatant through a Millipore filter (0.22-µm pore size). The protein concentration of the extracts was determined using a Bio-Rad protein assay kit (Bio-Rad).

Detection of cpRNPs-- The number of isolated intact chloroplasts was counted in a hemocytometer by light microscopy. A series of dilute chloroplast suspensions (containing 105-108 chloroplasts) was prepared. Total protein was extracted from the suspensions by the addition of SDS-polyacrylamide gel electrophoresis (PAGE) sample buffer (50 mM Tris-HCl, pH6.8, 2% SDS, 10% 2-mercaptoethanol, 10% glycerol, 0.004% bromphenol blue). The protein extracts and recombinant cpRNPs, re-cp28, re-cp29A, and re-cp33 (1, 10, and 100 ng; Ref. 37) were separated by SDS-PAGE (15% polyacrylamide gel) and then transferred onto polyvinylidene difluoride membranes (Problott, PerkinElmer Life Sciences). The cpRNPs on the membrane were detected using antibodies against re-cp28, re-cp29A, re-cp31, or re-cp33 (37) and the ECL Western blotting analysis system (Amersham Pharmacia Biotech). The intensity of the membrane signals was quantified using a Fluor-S multi-imager (Bio-Rad Laboratories). Authentic cpRNPs in the extract were detected to be ~30 kDa whereas the recombinant cpRNPs fused with maltose-binding protein was 70 kDa (37). The antibodies used in this study cross-react with both cpRNP itself and with the maltose-binding protein of recombinant cpRNPs. By comparing the intensity of authentic cpRNPs with that of recombinant proteins having different molecular weights, we calculated the amount of cpRNPs in chloroplasts using appropriate corrections.

Gel Filtration of the Stromal Extract-- The stromal extract (1 mg protein) was applied to a Superdex 200PC 3.2/30 column using the SMART system (Amersham Pharmacia Biotech) and 50 µl/min extraction buffer. Ten minutes after sample injection, 100 µl of each of the 21 fractions were collected and subjected to Western blot analysis using recombinant cpRNP antibodies. The size of the proteins within each fraction of the extract was determined by comparison with the LMW (low) and HMW (high) molecular mass calibration markers (Amersham Pharmacia Biotech).

Immunoprecipitation-- Protein A-Sepharose (PAS) resin (0.3 mg, Amersham Pharmacia Biotech) was suspended in 500 µl of extraction buffer and was incubated with each antibody for 3 h at 4 °C. After washing five times with 1 ml of extraction buffer, the antibody-PAS resin was incubated with the stromal extract at 4 °C for 20 min, followed by centrifugation (10,000 × g for 30 s). The supernatant was collected and is labeled sup in Fig. 3. The precipitated resin was washed five times with 1 ml of extraction buffer and then collected and labeled ppt in Fig. 3. The supernatants and precipitates were used for RNA or protein extraction.

Nucleic Acid Isolation and Northern Blot Analysis-- Total nucleic acids were isolated from the precipitate by phenol/chloroform extraction (38). RNA electrophoresis and Northern blotting onto a nylon membrane (Hybond-N+, Amersham Pharmacia Biotech) were carried out as described by Li and Sugiura (26). A 3-kb 23 S rRNA gene-specific probe and 1.5-kb psbA probe were prepared from plasmids p23S and psbA-F (37), respectively, and were 32P-labeled using a random primer labeling kit (Takara Shuzo).

Preparation of Recombinant cp28-- The cDNA encoding the mature cp28 (26) was amplified by polymerase chain reaction using Pfu DNA polymerase (Stratagene) and the primers QE28A (CCGGATCCGTATTATCTGAAGATGAC) and QE28B (CCAAGCTTTCAGTATGTGTTGCGCCG). Polymerase chain reaction was carried out using 26 cycles of 94 °C for 30 s, 47 °C for 30 s, and 72 °C for 1.5 min (2 min for the last cycle). The amplified DNA was digested with BamHI and HindIII and cloned into the pQE30 vector (Qiagen). E. coli M15 cells were used to produce the recombinant proteins, which we named his-cp28.

In Vitro mRNA Degradation Assay-- The stromal extract (3 mg of protein) was gently mixed with anti-beta -galactosidase (beta -gal)-PAS or anti-cpRNP-PAS at 4 °C for 20 min, and then centrifuged at 10,000 × g for 1 min. The resulting supernatants, control extract, and cpRNP-depleted extract, respectively, were used in the mRNA degradation assay. For preparation of the reconstituted extract, individual recombinant cpRNPs (3 µg each of group I re-cp29A and re-cp29B, 1.5 µg each of group II re-cp28 and re-cp31, or 0.15 µg of group III re-cp33) were added to 300 µl of cpRNP-depleted extract (1.5 mg protein).

Samples of 32P-labeled full-length psbA mRNA (1,589 bases) or shorter psbA mRNA lacking 3'-UTR (1,454 bases) were produced from BamHI- or XhaI-digested psbA-F, respectively, using the T7 RNA polymerase in MEGA Script (Ambion). The labeled RNA (final concentration of 25 ng/µl) was added to six tubes, each containing 30 µl of the prepared extract and was incubated at 37 °C. At the indicated time the incubation was stopped, and total RNA was extracted from the samples with phenol/chloroform (38). In further reconstituted assays, individual group-specific recombinant cpRNPs alone or combinations of group-specific ones were added to the cpRNP-depleted extract and incubated at 37 °C for 3 min. The extracted RNAs were separated by electrophoresis through a formaldehyde/agarose gel and then transferred onto a Hybond-N+ membrane. The membrane was analyzed using a BAS2000 Fuji Imaging analyzer (Fuji Photo Film, Japan).

For the UV cross-linking assay, 30 µl of each stromal extract was incubated with 32P-labeled mRNA for 1 min and then UV irradiated (360 mJ/cm2) in a UV cross-linker (Funa, FS-1500). Subsequent digestion with RNase A (at a final concentration of 75 µg/ml) was performed as described by Vera and Sugiura (39).


    RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

cpRNPs Are Abundant Stromal Proteins-- The amount of cpRNP in a series of dilute chloroplast suspensions was determined by Western blot analysis. By comparing the intensity of the five cpRNP protein bands with the intensity of the control recombinant cpRNPs bands, 107 chloroplasts were estimated to contain ~20 ng of cp29A, 10 ng of cp28, and 2 ng of cp33 (Fig. 1A). This is equivalent to 105 molecules of cp29A, 51,000 molecules of cp28, and 8,000 molecules of cp33 per chloroplast. The levels of cp29A and cp29B were similar, and the cp28 and cp31 levels were equivalent to the cpRNP levels previously estimated by single-stranded DNA column chromatography (26, 27). These results indicate that tobacco cpRNPs accumulate at high levels in the chloroplasts of green leaves. In comparison, 106 chloroplasts have been shown to contain 200 ng of the large subunit (LS) of ribulose-1,5-bisphosphate carboxylase/oxygenase (RuBisCO) (Fig. 1B). This is equivalent to 2.2 × 107 molecules of LS per chloroplast. RuBisCO holoenzyme is composed of eight each of the large and small subunits and is thus calculated to be 2.8 × 106 molecules of RuBisCO holoenzyme per chloroplast. This is comparable with 5.8 × 106 RuBisCO molecules per chloroplast in barley (40).



View larger version (49K):
[in this window]
[in a new window]
 
Fig. 1.   Quantification of cpRNPs and psbA mRNA in chloroplasts. A, total protein extracts from a series of dilute chloroplast suspensions were subjected to Western blot analysis using 1-100 ng of recombinant cpRNPs (re-cp29A, re-cp28, and re-cp33) as controls, and specific antibodies against cp29A, cp28, or cp33. B, the LS of RuBisCO was stained with Coomassie Brilliant Blue to quantify the amount of protein present on the blot, along with 10-500 ng of ovalbumin as a standard. C, total RNA extracts from a series of dilute chloroplast suspensions were subjected to Northern blot analysis with 1-500 ng of in vitro-synthesized psbA mRNA (1,589 bases).

To compare the relative amount of cpRNP protein and mRNA in chloroplasts, we quantified the steady-state level of psbA mRNA by Northern blot analysis (Fig. 1C). Using in vitro synthesized psbA mRNA (1-500 ng) as the control, we detected 120 ng of psbA mRNA per 107 chloroplasts. This is the equivalent of ~14,000 psbA mRNA molecules per chloroplast.

cpRNPs Form Complexes with RNA-- In a previous analysis of the sedimentation profiles of stromal extract cpRNPs by sucrose density gradient centrifugation, we showed that most cp28 and cp31 sediments lie between the top of the gradient and the 18 S RuBisCO holoenzyme (41). Moreover, we have recently observed that stromal mRNAs and intron-containing pre-tRNAs coprecipitate with cpRNPs (37). These observations suggest that cpRNPs may form complexes with RNAs. If cpRNP-RNA complexes do exist in the stroma, their size may be expected to range from a minimum of ~30 kDa, up to 550 kDa (the size of the RuBisCO holoenzyme).

To determine the size of these proposed cpRNP-RNA complexes, tobacco stromal extracts were separated by size exclusion chromatography through a Superdex 200PC column (Fig. 2). This column separates proteins in the size range of 10-600 kDa. The 30 S ribosomal subunits (900 kDa) and 70 S ribosomes (2,500 kDa) could be excluded from the column and were collected in void fractions 1-6 (Fig. 2B). The cpRNPs were distributed over a wide range of fractions from 30-600 kDa, and cp29A, cp29B (group I), and cp33 (group III) were also detected in fraction 6 (>600 kDa) (Fig. 2A, frac. no.). The broad cpRNP peaks could not be attributed to overloading the column, because a reduction in the amount of extract loaded did not change the separation profiles (data not shown). The size of the cp28 complexes ranged from 30-600 kDa (fractions 7-14), and the cp31 complexes ranged in size from 30-400 kDa (fractions 8-13). This implies that most of the cpRNPs do not cofractionate with ribosomes.



View larger version (58K):
[in this window]
[in a new window]
 
Fig. 2.   Analysis of the cpRNP-RNA complex by gel filtration. A, size distribution of cpRNPs. The stromal extracts (1 mg of protein), with or without prior RNase treatment (RNase and control, respectively), were fractionated by gel filtration through a Superdex 200PC column. The cpRNPs were detected by Western blot analysis using cpRNP-specific antisera. B, protein profile of the control extract after gel filtration. The above fractions were subjected to SDS-PAGE and Coomassie Brilliant Blue staining. The positions of large (LS) and small (SS) subunits of RuBisCO are indicated. C, the recombinant cp28 (his-cp28) protein was fractionated using the same conditions as outlined in A and B. The positions of molecular size markers, RNase A (13.7 kDa), ovalbumin (43 kDa), aldolase (158 kDa), and ferritin (440 kDa), are indicated.

When the stromal extracts were treated with RNase A prior to size fractionation, the peaks for cp29A, cp29B, and cp28 shifted dramatically to 30 kDa (fraction 12) at the same position as recombinant cp28 (Fig. 2C, his-cp28). This confirms that the proteins detected at 30 kDa are RNA-free cpRNPs. By contrast, the peaks of cp31 and cp33 were detected at about 50 kDa (fraction 11). RNase treatment of the extracts did not change the protein profiles of stromal extracts (data not shown). Overall, these results suggest that cpRNPs form a stable RNA-protein high molecular weight complex with nonribosome-bound RNAs, with cp28, cp29A, and cp29B interacting as monomers and cp31 and cp33 interacting as oligomers.

Most of the Stromal psbA mRNA Binds with cpRNPs-- To test whether the cpRNPs are associated with ribosome-free stromal mRNAs, the stromal extracts were subjected to immunoprecipitation using antibodies against group I cpRNP (cp29A), II (cp28 and cp31), and III (cp33), respectively. The amount of mRNA was then determined by Northern blot analysis using gene-specific probes. Approximately 90% of the stromal psbA mRNA coprecipitated with group I and II cpRNPs (Fig. 3), whereas psbA mRNA coprecipitated less with group III cpRNP (cp33) than with group I and II proteins. This indicates that most of the psbA mRNAs are always associated with group I and II cpRNPs but not with group III cpRNP (cp33). Distribution of mRNA into the supernatant and pellet coincides with that of group I and II cpRNPs (Fig. 3). By contrast, the majority of 23 S ribosomal RNA did not coprecipitate with any group of cpRNPs and remains in the supernatant (Fig. 3). This result confirms that most of the mRNA associated with cpRNPs is likely to be ribosome-free. The anti-beta -gal antibody did not coprecipitate with psbA mRNA to such a high degree. These observations support previous studies that have shown that most of the stromal psbA mRNA in barley is ribosome-free (42).



View larger version (29K):
[in this window]
[in a new window]
 
Fig. 3.   Coprecipitation of stromal psbA mRNA with the cpRNPs. The stromal extracts were immunoprecipitated using the group-specific cpRNP antisera, and the mRNAs in the supernatant (sup) and pellet (ppt) were analyzed by Northern blot analysis using psbA- or 23 S rRNA gene-specific probes. The anti-cp29A serum was used for immunoprecipitation and detection of group I cpRNPs (lanes I), the mixture of anti-cp28 and cp31 sera for group II (lanes II), and the anti-cp33 serum for group III (lanes III). A beta -gal antibody was used as the control. The amount of group-specific cpRNP in the supernatant and pellet was checked by Western blot analysis.

cpRNPs Stabilize psbA mRNA-- To examine the possibility that cpRNPs bind to ribosome-free RNA to protect the RNA from degradation, the effect of cpRNPs on RNA degradation was analyzed using three different stromal extracts: an extract treated with unrelated serum (control ex), a cpRNP-depleted extract (dep-ex), and a depleted extract supplemented with recombinant cpRNPs (dep-ex + cpRNPs)(Fig. 4). Based on quantification of cpRNPs in the stromal extract (Fig. 1), 3 µg each of cp29A and B, 1.5 µg each of cp28 and cp31, and 0.15 µg of cp33 were supplemented to the depleted extract. Western blot analysis verified that prior to mRNA incubation the depleted extract sample was completely depleted of all five cpRNPs, and appropriate amounts of recombinant proteins were supplemented to the depleted extract (Fig. 4C). The in vitro-synthesized psbA mRNA was then incubated with each extract, and its degradation was monitored (Fig. 4, A and B). The half-life of the full-length psbA mRNA was 6 min in the control extract and 2 min in the depleted extract. Thus, the half-life of the psbA mRNA in the depleted extract was 3-fold shorter than in the control extract. Supplementing the depleted extract with five recombinant cpRNPs, however, lowered the degradation rate back to the level of the control extract. This result was the same as that of an in vitro assay using a shorter psbA mRNA, which lacks IR-containing 3'-UTR (data not shown).



View larger version (25K):
[in this window]
[in a new window]
 
Fig. 4.   Effect of the whole cpRNPs on the degradation of exogenous psbA mRNA in vitro. Three different stromal extracts (5 µg protein/µl) were used in the mRNA degradation assay. The control extract (A and C, control ex; B, closed circle) was a stromal extract treated with anti-beta -gal antibody-PAS; the cpRNP-depleted extract (A and C, dep-ex; B, open circle) was a stromal extract treated with anti-cpRNPs antibody-PAS; and the depleted extract + cpRNPs (A and C, dep-ex + cpRNPs; B, closed square;) was the depleted extract supplemented with five recombinant cpRNPs. A, in vitro-synthesized 32P-labeled psbA mRNA was incubated with each extract at 37 °C for the time indicated. The RNA was extracted and analyzed by electrophoresis. B, radioactivity of the top bands at 1,589 bases was quantified (0 min as 100%) and plotted. The assays were repeated three times, and the S. E. is indicated by bars. C, cpRNPs in each extract were detected by Western blot analysis (left panel). Each extract was incubated for 1 min with 32P-labeled psbA mRNA, and then analyzed by UV cross-linking (right panel).

The protein bands corresponding to the endogenous cpRNPs and the recombinant cpRNPs were detected by UV cross-linking and a 32P-labeled psbA mRNA probe. The cpRNPs interacted directly with the exogenous psbA mRNA probe (Fig. 4C). Overall, the results of this experiment suggest that binding of all or some cpRNPs to mRNA protects the RNA from degradation.

Different Contributions of Individual Group cpRNPs to mRNA Stability-- To investigate different effects of individual cpRNPs on mRNA stability, we carried out further in vitro mRNA degradation assays using reconstituted stromal extracts. As shown in Fig. 5, depletion of all three groups of cpRNPs reduced mRNA stability levels to 55% of the control extract. When either of three groups of recombinant cpRNP was supplemented to cpRNPs-depleted extract (Fig. 5, control), mRNA stability was increased. Supplement of the group III cpRNP (cp33) resulted in a drastic increase in mRNA stability rather than group I and II proteins. When the two groups of cpRNPs, in any combination, were supplemented to the depleted extract, mRNA stability was further increased to levels reaching 80-90% of the control extract. These observations indicate that all three groups of cpRNPs are cooperatively involved in stability of psbA mRNA, possibly via individual group-specific cpRNPs. In addition, group III protein (cp33) exhibited the most effective influence on mRNA stability. Supplementation of three groups resulted in full restoration of mRNA stability. This agrees with the previous experiment (Fig. 4).



View larger version (46K):
[in this window]
[in a new window]
 
Fig. 5.   Effect of group-specific cpRNPs on degradation of exogenous psbA mRNA in vitro. The effect of each cpRNP on RNA degradation was examined by the same procedure as described in the legend to Fig. 4. The control extract (control ex), cpRNP-depleted extract, and depleted extract supplemented with group-specific recombinant cpRNP (I, II, and III) alone or in combination were incubated with synthesized 32P-labeled psbA mRNA at 37 °C for 3 min. The remaining intact psbA mRNA in the control extract and each reconstituted extract are indicated as 100% and relative values, respectively. The assays were repeated three times, and the S.E. is indicated by bars.



    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

The present study has shown that the five cpRNPs are abundant (~3 × 105 molecules) and accumulate at one-tenth of the level of RuBisCO in tobacco chloroplasts. Their amounts are apparently greater than total molecules of chloroplast mRNAs, including the most abundant psbA mRNA (~14,000 molecules), and perhaps greater than ribosomes. For instance, Rapp et al. (6) estimated that each chloroplast of dark-grown barley seedlings has 1.4 × 105 molecules of 16 S rRNA.

We used size fractionation and immunological tools to show that the cpRNPs range in size from 30 to 600 kDa (cp28 and cp31), or to larger (cp29A, cp29B, and cp33) and that most of the cpRNPs bind to ribosome-free RNAs. This size distribution probably reflects the binding of either single or multiple cpRNPs to various RNA species in the stroma. The cpRNPs appear to be part of a higher molecular weight complex that is associated with RNA. RNase treatment of the complex shifts it to a smaller size ~30 kDa. Interestingly, the gel filtration results also suggest that cp28, cp29A, and cp29B interact with RNAs as monomers, whereas cp31 and cp33 may interact as oligomers (~50 kDa). This suggests that the presence of two distinct forms of cpRNPs may reflect different function(s) for different cpRNPs.

In the present study, the important finding was that cpRNPs contribute to RNA stabilization via direct binding to target RNAs. Chloroplast extracts depleted of all five cpRNPs degraded exogenous psbA mRNA faster than did nondepleted extracts. The IRs of psbA mRNA have previously been shown to act as cis-elements for RNA stability in spinach (9) and C. reinhardtii (11). In this study, however, the rapid degradation of IR-containing exogenous psbA mRNA suggests that the IR of psbA mRNA may only contribute in part to mRNA stability in vitro. Numerous ribonuclease activities have been reported in chloroplasts (36, 43-47). Klaff (48) reported that degradation of psbA mRNA is initiated by endonucleolytic cleavage of psbA mRNA. Once the mRNA has been cleaved internally, the RNA fragments are then efficiently polyadenylated and exonucleolytically degraded (49, 50). The cpRNPs probably bind to internal sequence(s) targeted for cleavage by endoribonucleases, thereby protecting these sequences from degradation. Although cp33 exists at a 10-fold lower level than other cpRNPs, it demonstrated a significant effect on mRNA stabilization rather than the more abundant group I and II cpRNPs. This implies that cp33 is involved, directly or indirectly, in the stability of mRNAs or pre-RNAs. Alternatively, one possibility is that cp33 may bind initially to mRNAs, and thereby recruit other cpRNPs or unknown components to facilitate the formation of stable cpRNP and mRNA complexes.

Our previous work has clearly shown that several mRNAs (psbA, petD, and rbcL) encoding photosynthetic components and intron-containing pre-tRNAs coprecipitate predominantly with group I and II cpRNPs (37). This suggests that group I and II cpRNPs are involved mainly in the stability of mRNA and/or splicing of pre-tRNAs. Moreover, using an in vitro RNA editing system developed from tobacco chloroplasts, we have observed that only cp31 is required for RNA editing (Cright-arrowU conversion) of psbL mRNA that encodes the L-protein of photosystem II.2 These results indicate that each cpRNP contributes to a differing extent to RNA stability, RNA cleavage, RNA editing, or RNA splicing.

It is likely that tobacco cpRNPs are general RNA-binding proteins, like nuclear-localized heterogeneous ribonucleoprotein (hnRNP). Both cpRNPs and hnRNPs have strong affinities for poly(G), poly(U), and single-stranded DNA (33, 34, 51), and both are abundant proteins within the chloroplast and nucleus, respectively. In analogy to the function of hnRNP, cpRNP plays a role in various RNA processing before initiation of translation of mature mRNAs. Transcription is believed to occur in nucleoids that are composed of chloroplast DNA and several proteins (52, 53). It is interesting to note that cpRNPs are also detected in tobacco chloroplast nucleoids.3 This suggests that cpRNPs bind to nascent RNAs in the nucleoids.

From the overall results of the present study, we propose a model for the possible role of cpRNPs. The cpRNPs associate with nascent RNAs or pre-RNAs immediately after transcription in the nucleoids, and form RNA-protein complexes in the stroma. These cpRNP·RNA complexes confer stability and ribonuclease resistance to the RNAs. The complexes also act as a scaffold for the specific catalytic machinery involved in RNA maturation, RNA splicing of intron-containing pre-tRNAs, or RNA editing. When the cpRNPs dissociate from fully processed and mature mRNAs, ribosomes then attach to the mRNAs for translation.

The cp31 and cp33 proteins have 64 and 42 residues, respectively, of auxiliary domains in their N terminus with 43% acidic residues (26). The N-terminal regions of these proteins may be functionally significant, because the acidic region is required for protein-protein interaction (54). The N-terminal acidic regions of some cpRNPs are efficiently phosphorylated in organello in a light-dependent manner, and association of cpRNPs with RNAs and their dissociation from RNAs may be regulated by phosphorylation in tobacco4 and spinach (55). To clarify this possibility, further biochemical and molecular analyses need to be carried out.


    ACKNOWLEDGEMENTS

We thank T. Hirose and M. Mutsuda for valuable discussions and G. Schuster for critical reading of the manuscript.


    FOOTNOTES

* This work was supported by Grant-in-aid for Scientific Research in Priority Areas No. 0927103 (to M. S.) from the Ministry of Education, Science, Sports, and Culture of Japan.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

§ Present Address: Plantech Research Inst., Research Center, 1000 Kamoshida-cho, Aoba-ku, Yokohama 227-0033, Japan.

|| To whom correspondence should be addressed. Tel/Fax: 81 52 789 4779; E-mail: sugita@info.human.nagoya-u.ac.jp.

Published, JBC Papers in Press, October 18, 2000, DOI 10.1074/jbc.M008817200

2 T. Hirose and M. Sugiura, unpublished results.

3 A. Sakai and M. Sugita, unpublished results.

4 T. Nakamura, M. Sugiura and M. Sugita, unpublished results.


    ABBREVIATIONS

The abbreviations used are: psbA, gene encoding D1 protein of photosystem II; IR, inverted repeat; UTR, untranslated region; cpRNP, chloroplast ribonucleoprotein; PAGE, polyacrylamide gel electrophoresis; PAS, protein A-Sepharose; beta -gal, beta -galactosidase; RuBisCO, ribulose-1,5-bisphosphate carboxylase/oxygenase; hnRNP, heterogeneous ribonucleoprotein; LS, large subunit; re-cp, recombinant cp.


    REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES


1. Gruissem, W., Barkan, A., Deng, X. W., and Stern, D. (1988) Trends Genet. 4, 258-263
2. Mullet, J. E. (1988) Annu. Rev. Plant Physiol. Plant Mol. Biol. 39, 475-502
3. Rochaix, J. D. (1995) Annu. Rev. Genet. 29, 209-230
4. Deng, W. X., and Gruissem, W. (1987) Cell 49, 379-387
5. Mullet, J. E., and Klein, R. R. (1987) EMBO J. 6, 1571-1579
6. Rapp, J. C., Baumgartner, B. J., and Mullet, J. H. (1992) J. Biol. Chem. 267, 21404-21411
7. Kim, M., Christopher, D. A., and Mullet, J. E. (1993) Plant Mol. Biol. 22, 447-463
8. Klaff, P., and Gruissem, W. (1991) Plant Cell 3, 517-529
9. Stern, D. B., and Gruissem, W. (1987) Cell 51, 1145-1157
10. Adams, C. C., and Stern, D. B. (1990) Nucleic Acids Res. 18, 6003-6010
11. Rott, R., Liveanu, V., Drager, R. G., Stern, D. B., and Schuster, G. (1998) Plant Mol. Biol. 36, 307-314
12. Stern, D. B., Radwanski, E. R., and Kindle, K. L. (1991) Plant Cell 3, 285-297
13. Stern, D. B., Jones, H., and Gruissem, W. (1989) J. Biol. Chem. 264, 18742-18750
14. Chen, H. C., and Stern, D. B. (1991) Mol. Cell. Biol. 11, 4380-4388
15. Memon, A. R., Meng, B., and Mullet, J. E. (1996) Plant Mol. Biol. 30, 1195-1205
16. Alexander, C., Faber, N., and Klaff, P. (1998) Nucleic Acids Res. 26, 2265-2272
17. Nickelsen, J., van Dillewijn, J., Rahire, M., and Rochaix, J. D. (1994) EMBO J. 13, 3182-3191
18. Chen, Q., Adams, C. C., Usack, L., Yang, J., Monde, R. A., and Stern, D. B. (1995) Mol. Cell. Biol. 15, 2010-2018
19. Danon, A., and Mayfield, S. P. (1991) EMBO J. 10, 3993-4001
20. Danon, A., and Mayfield, S. P. (1994) EMBO J. 13, 2227-2235
21. Rochaix, J. D. (1996) Plant Mol. Biol. 32, 327-341
22. Jenkins, B., Kulhanek, D. J., and Barkan, A. (1997) Plant Cell 9, 283-296
23. Hess, W., Hoch, B., Zelts, P., Hübschmann, T., Kössel, H., and Börner, T. (1994) Plant Cell 6, 1455-1465
24. Hübschmann, T., Hess, W. R., and Börner, T. (1996) Plant Mol. Biol. 30, 109-123
25. Meurer, J., Berger, A., and Westhoff, P. (1996) Plant Cell 8, 1193-1207
26. Li, Y., and Sugiura, M. (1990) EMBO J. 9, 3059-3066
27. Ye, L., Li, Y., Fukami-Kobayashi, K., Go, M., Konishi, T., Watanabe, A., and Sugiura, M. (1991) Nucleic Acids Res. 19, 6485-6490
28. Ohta, M., Sugita, M., and Sugiura, M. (1995) Plant Mol. Biol. 27, 529-539
29. Sugita, M., and Sugiura, M. (1996) Plant Mol. Biol. 32, 315-326
30. Schuster, G., and Gruissem, W. (1991) EMBO J. 10, 1493-1502
31. Cook, W. B., and Walker, J. C. (1992) Nucleic Acids Res. 20, 359-364
32. Churin, Y., Hess, W. R., and Börner, T. (1999) Curr. Genet. 36, 173-181
33. Li, Y., and Sugiura, M. (1991) Nucleic Acids Res. 19, 2893-2896
34. Ye, L., and Sugiura, M. (1992) Nucleic Acids Res. 20, 6275-6279
35. Lisitsky, I., Liveanu, V., and Schuster, G. (1995) Plant Physiol. 107, 933-941
36. Hayes, R., Kudla, J., Schuster, G., Gabay, L., Maliga, P., and Gruissem, W. (1996) EMBO J. 15, 1132-1141
37. Nakamura, T., Ohta, M., Sugiura, M., and Sugita, M. (1999) FEBS lett. 460, 437-441
38. Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual , 2nd Ed. , Cold Spring Harbor, NY
39. Vera, A., and Sugiura, M. (1994) EMBO J. 13, 2211-2217
40. Dean, C., and Leech, L. M. (1982) Plant Physiol. 69, 904-910
41. Nakamura, T., Ohta, M., Sugita, M., and Sugiura, M. (1998) in Photosynthesis. Mechanisms and Effects (Garab, G., ed), Vol. IV , pp. 2957-2958, Kluwer Academic Publishers, The Netherlands
42. Kim, M., Klein, P. G., and Mullet, J. E. (1994) Plant Mol. Biol. 25, 459-467
43. Nickelsen, J., and Link, G. (1993) Plant J. 3, 537-544
44. Drager, R. G., Girard-Bascou, J., Choquet, Y., Kindle, K. L., and Stern, D. B. (1998) Plant J. 13, 85-96
45. Yang, J., Schuster, G., and Stern, D. B. (1996) Plant Cell 8, 1409-1420
46. Liere, K., and Link, G. (1997) Nucleic Acids Res. 25, 2403-2408
47. Nickelsen, J., Fleischmann, M., Boudreau, E., Rahire, M, and Rochaix, J. D. (1999) Plant Cell 11, 957-970
48. Klaff, P. (1995) Nucleic Acids Res. 23, 4885-4892
49. Schuster, G., Lisitsky, I., and Klaff, P. (1999) Plant Physiol. 120, 937-944
50. Hayes, R., Kudla, J., and Gruissem, W. (1999) Trends Biochem. Sci. 24, 199-202
51. Dreyfuss, G., Matunis, M. J., Pinol-Roma, S., and Burd, C. G. (1993) Annu. Rev. Biochem. 62, 289-321
52. Sakai, A., Saito, C., Inada, N., and Kuroiwa, T. (1998) Plant Cell Physiol. 39, 928-934
53. Nakano, T., Murakami, S., Shoji, T., Yoshida, S., Yamada, Y., and Sato, F. (1997) Plant Cell 9, 1673-1682
54. Bandziulis, R. J., Swanson, M. S., and Dreyfuss, G. (1989) Genes Dev. 3, 431-437
55. Lisitsky, I., and Schuster, G. (1995) Nucleic Acids Res. 23, 2506-2511


Copyright © 2001 by The American Society for Biochemistry and Molecular Biology, Inc.
Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
Proc. Natl. Acad. Sci. USAHome page
M. Tillich, S. L. Hardel, C. Kupsch, U. Armbruster, E. Delannoy, J. M. Gualberto, P. Lehwark, D. Leister, I. D. Small, and C. Schmitz-Linneweber
Chloroplast ribonucleoprotein CP31A is required for editing and stability of specific chloroplast mRNAs
PNAS, April 7, 2009; 106(14): 6002 - 6007.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Hattori, H. Miyake, and M. Sugita
A Pentatricopeptide Repeat Protein Is Required for RNA Processing of clpP Pre-mRNA in Moss Chloroplasts
J. Biol. Chem., April 6, 2007; 282(14): 10773 - 10782.
[Abstract] [Full Text] [PDF]


Home page
Plant CellHome page
W. Majeran, Y. Cai, Q. Sun, and K. J. van Wijk
Functional Differentiation of Bundle Sheath and Mesophyll Maize Chloroplasts Determined by Comparative Proteomics
PLANT CELL, November 1, 2005; 17(11): 3111 - 3140.
[Abstract] [Full Text] [PDF]


Home page
J. Exp. Biol.Home page
B. D. Eads and S. C. Hand
Mitochondrial mRNA stability and polyadenylation during anoxia-induced quiescence in the brine shrimp Artemia franciscana
J. Exp. Biol., October 15, 2003; 206(20): 3681 - 3692.
[Abstract] [Full Text] [PDF]


Home page
Plant CellHome page
K. Meierhoff, S. Felder, T. Nakamura, N. Bechtold, and G. Schuster
HCF152, an Arabidopsis RNA Binding Pentatricopeptide Repeat Protein Involved in the Processing of Chloroplast psbB-psbT-psbH-petB-petD RNAs
PLANT CELL, June 1, 2003; 15(6): 1480 - 1495.
[Abstract] [Full Text]


Home page
Nucleic Acids ResHome page
S. Baginsky and W. Gruissem
Endonucleolytic activation directs dark-induced chloroplast mRNA degradation
Nucleic Acids Res., October 15, 2002; 30(20): 4527 - 4533.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
Z. J. Lorkovic and A. Barta
Genome analysis: RNA recognition motif (RRM) and K homology (KH) domain RNA-binding proteins from the flowering plant Arabidopsis thaliana
Nucleic Acids Res., February 1, 2002; 30(3): 623 - 635.
[Abstract] [Full Text] [PDF]


Home page
Plant CellHome page
J.-B. Peltier, O. Emanuelsson, D. E. Kalume, J. Ytterberg, G. Friso, A. Rudella, D. A. Liberles, L. Soderberg, P. Roepstorff, G. von Heijne, et al.
Central Functions of the Lumenal and Peripheral Thylakoid Proteome of Arabidopsis Determined by Experimentation and Genome-Wide Prediction
PLANT CELL, January 1, 2002; 14(1): 211 - 236.
[Abstract] [Full Text] [PDF]


Home page
Plant CellHome page
B. Boyle and N. Brisson
Repression of the Defense Gene PR-10a by the Single-Stranded DNA Binding Protein SEBF
PLANT CELL, November 1, 2001; 13(11): 2525 - 2537.
[Abstract] [Full Text] [PDF]


Home page
Plant Cell PhysiolHome page
Y. Shen, A. Danon, and D. A. Christopher
RNA Binding-Proteins Interact Specifically with the Arabidopsis Chloroplast psbA mRNA 5' Untranslated Region in a Redox-Dependent Manner
Plant Cell Physiol., October 1, 2001; 42(10): 1071 - 1078.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
276/1/147    most recent
M008817200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Nakamura, T.
Right arrow Articles by Sugita, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Nakamura, T.
Right arrow Articles by Sugita, M.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2001 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement