|
Originally published In Press as doi:10.1074/jbc.M008817200 on October 18, 2000
J. Biol. Chem., Vol. 276, Issue 1, 147-152, January 5, 2001
Chloroplast Ribonucleoproteins Function as a Stabilizing Factor
of Ribosome-free mRNAs in the Stroma*
Takahiro
Nakamura ,
Masaru
Ohta §,
Masahiro
Sugiura , and
Mamoru
Sugita ¶
From the Center for Gene Research, and the
¶ Graduate School of Human Informatics, Nagoya University,
Nagoya 464-8601, Japan
Received for publication, September 27, 2000
 |
ABSTRACT |
Post-transcriptional RNA processing is an
important step in the regulation of chloroplast gene expression, and a
number of chloroplast ribonucleoproteins (cpRNPs) are likely to
be involved in this process. The major tobacco cpRNPs are composed of
five species: cp28, cp29A, cp29B, cp31, and cp33 and these are divided into three groups (I, II, and III). By immunoprecipitation, gel filtration, and Western blot analysis, we demonstrated that these cpRNPs are abundant stromal proteins that exist as complexes with ribosome-free mRNAs. Many ribosome-free psbA mRNAs
coprecipitate with cpRNPs, indicating that the majority of stromal
psbA mRNAs are associated with cpRNPs. In addition, an
in vitro mRNA degradation assay indicated that
exogenous psbA mRNA is more rapidly degraded in
cpRNP-depleted extracts than in nondepleted extracts. When the depleted
extract was reconstituted with recombinant cpRNPs, the psbA
mRNA in the extract was protected from degradation to a similar
extent as the psbA mRNA in the nondepleted extract. Moreover, restoration of the stabilizing activity varied following addition of individual group-specific cpRNPs alone or in combination. When the five cpRNPs were supplemented in the depleted extract, full
activity was restored. We propose that these cpRNPs act as stabilizing
factors for nonribosome-bound mRNAs in the stroma.
 |
INTRODUCTION |
Chloroplasts contain their own genes, and chloroplast gene
expression is regulated at both the transcriptional and
post-transcriptional level (1-3). Quantitative analysis of spinach (4)
and barley (5, 6) has revealed that the mRNA levels of several
protein-encoding genes in chloroplasts can increase dramatically (from
20- to ~1,000-fold) during plastid differentiation and chloroplast
development. The increased abundance of these mRNAs cannot,
however, account for the relative transcription rate of these genes
(4).
The half-lives of chloroplast mRNAs have been shown to range from
6 h for the mRNA encoding the 83-kDa chlorophyll a
apoprotein of photosystem I gene (psaA) to over 40 h
for the mRNA encoding the D1 protein of photosystem II
(psbA, 1 Refs. 7
and 8). Moreover, the stability of chloroplast mRNAs has been shown
to change in response to chloroplast development and varying light
conditions. This suggests that the differential accumulation of
chloroplast mRNA is regulated primarily at the post-transcriptional
level, with mRNA stability then contributing to the mRNA
steady-state level. The mechanism underlying mRNA stability,
however, is poorly understood.
Like Escherichia coli mRNAs, most chloroplast mRNAs
contain an inverted repeat (IR) sequence in their 3'-untranslated
region (UTR) that can fold into a stable stem-loop structure. This
structure has been shown to be important in determining mRNA
stability both in vitro (9-11), and in vivo (11,
12). Several chloroplast proteins, detected by UV cross-linking
(13-17) and gel-shift assays (18-20), have been found to bind to the
5'- or 3'-UTRs of mRNAs. These chloroplast proteins could be
gene-specific mRNA-binding proteins. In addition, numerous nuclear
mutants of Chlamydomonas reinhardtii (17, 21), maize (22),
barley (23, 24), and Arabidopsis thaliana (25), have been
identified, which fail to accumulate individual chloroplast-encoded
mRNAs (or precursor (pre)-mRNAs) despite having normal
transcription rates.
We previously isolated five nuclear-encoded chloroplast
ribonucleoproteins (cpRNPs) from tobacco, which we named cp28, cp29A, cp29B, cp31, and cp33 according to their sizes in kDa (26, 27). Based
on phylogenetic comparison to the cpRNPs from A. thaliana, tobacco cpRNPs can be classified into three groups: cp29A and cp29B in
group I, cp28 and cp31 in group II, and cp33 in group III (28). Tobacco
cpRNPs have two consensus sequence-type RNA-binding domains and an
acidic N-terminal domain. Similar proteins and genes encoding cpRNP
homologs have also been found in a variety of other plant species (29)
including spinach (30), A. thaliana (28), maize (31), and
barley (32).
In vitro, tobacco cpRNPs have a strong affinity for RNA
homopolymers (poly(G) and poly(U)) rather than single-stranded or double-stranded DNA (33, 34). After UV cross-linking chloroplast proteins with several mRNA probes, a subset of proteins of around 30 kDa can usually be detected in the chloroplasts of land plants (15,
16) and green algae (17). This suggests that cpRNPs bind
nonspecifically to chloroplast RNAs. Spinach 28RNP, a similar protein
to tobacco cp28 and cp31, was reported to be required for the formation
of the 3'-end of several mRNAs in vitro (30, 35).
Further studies have shown this protein directs correct processing of
the 3'-end pre-mRNA by the high molecular weight complex in
vitro (36). We recently found that tobacco cpRNPs in
vivo bind not only to mRNAs (and pre-mRNAs) but also to
intron-containing pre-tRNAs (37). This suggests that cpRNPs are
involved in RNA processing rather than in the 3'-end formation of
pre-mRNAs.
Despite extensive biochemical analysis of cpRNPs in vitro,
little is known about their physiological function in vivo.
To investigate the function of cpRNPs in RNA processing, we quantified cpRNPs and psbA mRNA levels in tobacco chloroplasts. We
found cpRNPs were surprisingly abundant in the stroma, and the majority of these proteins exist as 30- to 600-kDa complexes with chloroplast RNAs that contribute to the stability of stromal mRNAs.
 |
EXPERIMENTAL PROCEDURES |
Preparation of Intact Chloroplasts and Stromal Extracts--
Intact chloroplasts were isolated from the green leaves (5-8 cm) of
tobacco plants (Nicotiana tabacum var. Bright Yellow 4) as
described previously (26). The chloroplasts were lysed in extraction
buffer (50 mM Tris-HCl, pH 8.0, 50 mM KCl, 2 mM dithiothreitol, 10 mM MgCl2, and
500 units of RNase inhibitor from Takara Shuzo) for 15 min at 4 °C.
Stromal extracts were obtained by centrifuging the lysate at
15,000 × g for 10 min, and filtering the supernatant through a Millipore filter (0.22-µm pore size). The protein
concentration of the extracts was determined using a Bio-Rad protein
assay kit (Bio-Rad).
Detection of cpRNPs--
The number of isolated intact
chloroplasts was counted in a hemocytometer by light microscopy. A
series of dilute chloroplast suspensions (containing
105-108 chloroplasts) was prepared. Total
protein was extracted from the suspensions by the addition of
SDS-polyacrylamide gel electrophoresis (PAGE) sample buffer (50 mM Tris-HCl, pH6.8, 2% SDS, 10% 2-mercaptoethanol, 10%
glycerol, 0.004% bromphenol blue). The protein extracts and recombinant cpRNPs, re-cp28, re-cp29A, and re-cp33 (1, 10, and 100 ng;
Ref. 37) were separated by SDS-PAGE (15% polyacrylamide gel) and then
transferred onto polyvinylidene difluoride membranes (Problott,
PerkinElmer Life Sciences). The cpRNPs on the membrane were detected
using antibodies against re-cp28, re-cp29A, re-cp31, or re-cp33 (37)
and the ECL Western blotting analysis system (Amersham Pharmacia
Biotech). The intensity of the membrane signals was quantified using a
Fluor-S multi-imager (Bio-Rad Laboratories). Authentic cpRNPs in the
extract were detected to be ~30 kDa whereas the recombinant cpRNPs
fused with maltose-binding protein was 70 kDa (37). The antibodies used
in this study cross-react with both cpRNP itself and with the
maltose-binding protein of recombinant cpRNPs. By comparing the
intensity of authentic cpRNPs with that of recombinant proteins having
different molecular weights, we calculated the amount of cpRNPs in
chloroplasts using appropriate corrections.
Gel Filtration of the Stromal Extract--
The stromal extract
(1 mg protein) was applied to a Superdex 200PC 3.2/30 column using the
SMART system (Amersham Pharmacia Biotech) and 50 µl/min extraction
buffer. Ten minutes after sample injection, 100 µl of each of the 21 fractions were collected and subjected to Western blot analysis using
recombinant cpRNP antibodies. The size of the proteins within each
fraction of the extract was determined by comparison with the LMW (low)
and HMW (high) molecular mass calibration markers (Amersham Pharmacia Biotech).
Immunoprecipitation--
Protein A-Sepharose (PAS) resin (0.3 mg, Amersham Pharmacia Biotech) was suspended in 500 µl of extraction
buffer and was incubated with each antibody for 3 h at 4 °C.
After washing five times with 1 ml of extraction buffer, the
antibody-PAS resin was incubated with the stromal extract at 4 °C
for 20 min, followed by centrifugation (10,000 × g for
30 s). The supernatant was collected and is labeled sup
in Fig. 3. The precipitated resin was washed five times with 1 ml of extraction buffer and then collected and labeled ppt
in Fig. 3. The supernatants and precipitates were used for RNA or
protein extraction.
Nucleic Acid Isolation and Northern Blot Analysis--
Total
nucleic acids were isolated from the precipitate by phenol/chloroform
extraction (38). RNA electrophoresis and Northern blotting onto a nylon
membrane (Hybond-N+, Amersham Pharmacia Biotech) were
carried out as described by Li and Sugiura (26). A 3-kb 23 S rRNA
gene-specific probe and 1.5-kb psbA probe were prepared from
plasmids p23S and psbA-F (37), respectively, and were
32P-labeled using a random primer labeling kit (Takara Shuzo).
Preparation of Recombinant cp28--
The cDNA encoding the
mature cp28 (26) was amplified by polymerase chain reaction using
Pfu DNA polymerase (Stratagene) and the primers QE28A
(CCGGATCCGTATTATCTGAAGATGAC) and QE28B (CCAAGCTTTCAGTATGTGTTGCGCCG). Polymerase chain reaction was carried out using 26 cycles of 94 °C
for 30 s, 47 °C for 30 s, and 72 °C for 1.5 min (2 min
for the last cycle). The amplified DNA was digested with
BamHI and HindIII and cloned into the pQE30
vector (Qiagen). E. coli M15 cells were used to produce the
recombinant proteins, which we named his-cp28.
In Vitro mRNA Degradation Assay--
The stromal extract (3 mg of protein) was gently mixed with anti- -galactosidase
( -gal)-PAS or anti-cpRNP-PAS at 4 °C for 20 min, and then
centrifuged at 10,000 × g for 1 min. The resulting supernatants, control extract, and cpRNP-depleted extract,
respectively, were used in the mRNA degradation assay. For
preparation of the reconstituted extract, individual recombinant cpRNPs
(3 µg each of group I re-cp29A and re-cp29B, 1.5 µg each of group
II re-cp28 and re-cp31, or 0.15 µg of group III re-cp33) were added
to 300 µl of cpRNP-depleted extract (1.5 mg protein).
Samples of 32P-labeled full-length psbA mRNA
(1,589 bases) or shorter psbA mRNA lacking 3'-UTR (1,454 bases) were produced from BamHI- or XhaI-digested
psbA-F, respectively, using the T7 RNA polymerase in MEGA Script
(Ambion). The labeled RNA (final concentration of 25 ng/µl) was added
to six tubes, each containing 30 µl of the prepared extract and was
incubated at 37 °C. At the indicated time the incubation was
stopped, and total RNA was extracted from the samples with
phenol/chloroform (38). In further reconstituted assays, individual
group-specific recombinant cpRNPs alone or combinations of
group-specific ones were added to the cpRNP-depleted extract and
incubated at 37 °C for 3 min. The extracted RNAs were separated by
electrophoresis through a formaldehyde/agarose gel and then transferred
onto a Hybond-N+ membrane. The membrane was analyzed using
a BAS2000 Fuji Imaging analyzer (Fuji Photo Film, Japan).
For the UV cross-linking assay, 30 µl of each stromal extract was
incubated with 32P-labeled mRNA for 1 min and then UV
irradiated (360 mJ/cm2) in a UV cross-linker (Funa,
FS-1500). Subsequent digestion with RNase A (at a final concentration
of 75 µg/ml) was performed as described by Vera and Sugiura (39).
 |
RESULTS |
cpRNPs Are Abundant Stromal Proteins--
The amount of cpRNP in a
series of dilute chloroplast suspensions was determined by Western blot
analysis. By comparing the intensity of the five cpRNP protein bands
with the intensity of the control recombinant cpRNPs bands,
107 chloroplasts were estimated to contain ~20 ng of
cp29A, 10 ng of cp28, and 2 ng of cp33 (Fig.
1A). This is equivalent to
105 molecules of cp29A, 51,000 molecules of cp28, and 8,000 molecules of cp33 per chloroplast. The levels of cp29A and cp29B were
similar, and the cp28 and cp31 levels were equivalent to the cpRNP
levels previously estimated by single-stranded DNA column
chromatography (26, 27). These results indicate that tobacco cpRNPs
accumulate at high levels in the chloroplasts of green leaves. In
comparison, 106 chloroplasts have been shown to contain 200 ng of the large subunit (LS) of ribulose-1,5-bisphosphate
carboxylase/oxygenase (RuBisCO) (Fig. 1B). This is
equivalent to 2.2 × 107 molecules of LS per
chloroplast. RuBisCO holoenzyme is composed of eight each of the large
and small subunits and is thus calculated to be 2.8 × 106 molecules of RuBisCO holoenzyme per chloroplast. This
is comparable with 5.8 × 106 RuBisCO molecules per
chloroplast in barley (40).

View larger version (49K):
[in this window]
[in a new window]
|
Fig. 1.
Quantification of cpRNPs and psbA
mRNA in chloroplasts. A, total protein
extracts from a series of dilute chloroplast suspensions were subjected
to Western blot analysis using 1-100 ng of recombinant cpRNPs
(re-cp29A, re-cp28, and re-cp33) as controls, and specific antibodies
against cp29A, cp28, or cp33. B, the LS of RuBisCO was
stained with Coomassie Brilliant Blue to quantify the amount of protein
present on the blot, along with 10-500 ng of ovalbumin as a standard.
C, total RNA extracts from a series of dilute chloroplast
suspensions were subjected to Northern blot analysis with 1-500 ng of
in vitro-synthesized psbA mRNA (1,589 bases).
|
|
To compare the relative amount of cpRNP protein and mRNA in
chloroplasts, we quantified the steady-state level of psbA
mRNA by Northern blot analysis (Fig. 1C). Using in
vitro synthesized psbA mRNA (1-500 ng) as the
control, we detected 120 ng of psbA mRNA per
107 chloroplasts. This is the equivalent of ~14,000
psbA mRNA molecules per chloroplast.
cpRNPs Form Complexes with RNA--
In a previous analysis of the
sedimentation profiles of stromal extract cpRNPs by sucrose density
gradient centrifugation, we showed that most cp28 and cp31 sediments
lie between the top of the gradient and the 18 S RuBisCO holoenzyme
(41). Moreover, we have recently observed that stromal mRNAs and
intron-containing pre-tRNAs coprecipitate with cpRNPs (37). These
observations suggest that cpRNPs may form complexes with RNAs. If
cpRNP-RNA complexes do exist in the stroma, their size may be expected
to range from a minimum of ~30 kDa, up to 550 kDa (the size of the RuBisCO holoenzyme).
To determine the size of these proposed cpRNP-RNA complexes, tobacco
stromal extracts were separated by size exclusion chromatography through a Superdex 200PC column (Fig. 2).
This column separates proteins in the size range of 10-600 kDa. The 30 S ribosomal subunits (900 kDa) and 70 S ribosomes (2,500 kDa) could be
excluded from the column and were collected in void fractions 1-6
(Fig. 2B). The cpRNPs were distributed over a wide range of
fractions from 30-600 kDa, and cp29A, cp29B (group I), and cp33 (group
III) were also detected in fraction 6 (>600 kDa) (Fig. 2A, frac.
no.). The broad cpRNP peaks could not be attributed to overloading
the column, because a reduction in the amount of extract loaded did not
change the separation profiles (data not shown). The size of the cp28 complexes ranged from 30-600 kDa (fractions 7-14), and the
cp31 complexes ranged in size from 30-400 kDa (fractions
8-13). This implies that most of the cpRNPs do not cofractionate
with ribosomes.

View larger version (58K):
[in this window]
[in a new window]
|
Fig. 2.
Analysis of the cpRNP-RNA complex by gel
filtration. A, size distribution of cpRNPs. The stromal
extracts (1 mg of protein), with or without prior RNase treatment
(RNase and control, respectively), were fractionated by gel filtration
through a Superdex 200PC column. The cpRNPs were detected by Western
blot analysis using cpRNP-specific antisera. B, protein
profile of the control extract after gel filtration. The above
fractions were subjected to SDS-PAGE and Coomassie Brilliant Blue
staining. The positions of large (LS) and small
(SS) subunits of RuBisCO are indicated. C, the
recombinant cp28 (his-cp28) protein was fractionated using the same
conditions as outlined in A and B. The positions
of molecular size markers, RNase A (13.7 kDa), ovalbumin (43 kDa),
aldolase (158 kDa), and ferritin (440 kDa), are indicated.
|
|
When the stromal extracts were treated with RNase A prior to size
fractionation, the peaks for cp29A, cp29B, and cp28 shifted dramatically to 30 kDa (fraction 12) at the same position as
recombinant cp28 (Fig. 2C, his-cp28). This confirms that the
proteins detected at 30 kDa are RNA-free cpRNPs. By contrast, the peaks
of cp31 and cp33 were detected at about 50 kDa (fraction
11). RNase treatment of the extracts did not change the protein
profiles of stromal extracts (data not shown). Overall, these results
suggest that cpRNPs form a stable RNA-protein high molecular weight
complex with nonribosome-bound RNAs, with cp28, cp29A, and cp29B
interacting as monomers and cp31 and cp33 interacting as oligomers.
Most of the Stromal psbA mRNA Binds with cpRNPs--
To test
whether the cpRNPs are associated with ribosome-free stromal mRNAs,
the stromal extracts were subjected to immunoprecipitation using
antibodies against group I cpRNP (cp29A), II (cp28 and cp31), and III
(cp33), respectively. The amount of mRNA was then determined by
Northern blot analysis using gene-specific probes. Approximately 90%
of the stromal psbA mRNA coprecipitated with group I and
II cpRNPs (Fig. 3), whereas
psbA mRNA coprecipitated less with group III cpRNP
(cp33) than with group I and II proteins. This indicates that most of
the psbA mRNAs are always associated with group I and II
cpRNPs but not with group III cpRNP (cp33). Distribution of mRNA
into the supernatant and pellet coincides with that of group I and II
cpRNPs (Fig. 3). By contrast, the majority of 23 S ribosomal RNA did
not coprecipitate with any group of cpRNPs and remains in the
supernatant (Fig. 3). This result confirms that most of the mRNA
associated with cpRNPs is likely to be ribosome-free. The anti- -gal
antibody did not coprecipitate with psbA mRNA to such a
high degree. These observations support previous studies that have
shown that most of the stromal psbA mRNA in barley is ribosome-free (42).

View larger version (29K):
[in this window]
[in a new window]
|
Fig. 3.
Coprecipitation of stromal psbA
mRNA with the cpRNPs. The stromal extracts were
immunoprecipitated using the group-specific cpRNP antisera, and the
mRNAs in the supernatant (sup) and pellet
(ppt) were analyzed by Northern blot analysis using
psbA- or 23 S rRNA gene-specific probes. The anti-cp29A
serum was used for immunoprecipitation and detection of group I cpRNPs
(lanes I), the mixture of anti-cp28 and cp31 sera for group
II (lanes II), and the anti-cp33 serum for group III
(lanes III). A -gal antibody was used as the control. The
amount of group-specific cpRNP in the supernatant and pellet was
checked by Western blot analysis.
|
|
cpRNPs Stabilize psbA mRNA--
To examine the possibility
that cpRNPs bind to ribosome-free RNA to protect the RNA from
degradation, the effect of cpRNPs on RNA degradation was analyzed using
three different stromal extracts: an extract treated with unrelated
serum (control ex), a cpRNP-depleted extract
(dep-ex), and a depleted extract supplemented with
recombinant cpRNPs (dep-ex + cpRNPs)(Fig.
4). Based on quantification of cpRNPs in
the stromal extract (Fig. 1), 3 µg each of cp29A and B, 1.5 µg each
of cp28 and cp31, and 0.15 µg of cp33 were supplemented to the
depleted extract. Western blot analysis verified that prior to mRNA
incubation the depleted extract sample was completely depleted of all
five cpRNPs, and appropriate amounts of recombinant proteins were
supplemented to the depleted extract (Fig. 4C). The in
vitro-synthesized psbA mRNA was then incubated with
each extract, and its degradation was monitored (Fig. 4, A
and B). The half-life of the full-length psbA
mRNA was 6 min in the control extract and 2 min in the depleted
extract. Thus, the half-life of the psbA mRNA in the
depleted extract was 3-fold shorter than in the control extract.
Supplementing the depleted extract with five recombinant cpRNPs,
however, lowered the degradation rate back to the level of the control
extract. This result was the same as that of an in vitro
assay using a shorter psbA mRNA, which lacks
IR-containing 3'-UTR (data not shown).

View larger version (25K):
[in this window]
[in a new window]
|
Fig. 4.
Effect of the whole cpRNPs on the degradation
of exogenous psbA mRNA in
vitro. Three different stromal extracts (5 µg
protein/µl) were used in the mRNA degradation assay. The control
extract (A and C, control ex;
B, closed circle) was a stromal extract treated
with anti- -gal antibody-PAS; the cpRNP-depleted extract
(A and C, dep-ex; B,
open circle) was a stromal extract treated with anti-cpRNPs
antibody-PAS; and the depleted extract + cpRNPs (A and
C, dep-ex + cpRNPs; B, closed
square;) was the depleted extract supplemented with five
recombinant cpRNPs. A, in vitro-synthesized
32P-labeled psbA mRNA was incubated with
each extract at 37 °C for the time indicated. The RNA was extracted
and analyzed by electrophoresis. B, radioactivity of the top
bands at 1,589 bases was quantified (0 min as 100%) and plotted. The
assays were repeated three times, and the S. E. is indicated by
bars. C, cpRNPs in each extract were detected by
Western blot analysis (left panel). Each extract
was incubated for 1 min with 32P-labeled psbA
mRNA, and then analyzed by UV cross-linking (right
panel).
|
|
The protein bands corresponding to the endogenous cpRNPs and the
recombinant cpRNPs were detected by UV cross-linking and a
32P-labeled psbA mRNA probe. The cpRNPs
interacted directly with the exogenous psbA mRNA probe
(Fig. 4C). Overall, the results of this experiment suggest
that binding of all or some cpRNPs to mRNA protects the RNA from degradation.
Different Contributions of Individual Group cpRNPs to mRNA
Stability--
To investigate different effects of individual cpRNPs
on mRNA stability, we carried out further in vitro
mRNA degradation assays using reconstituted stromal extracts. As
shown in Fig. 5, depletion of all
three groups of cpRNPs reduced mRNA stability levels to 55% of the
control extract. When either of three groups of recombinant cpRNP was
supplemented to cpRNPs-depleted extract (Fig. 5, control),
mRNA stability was increased. Supplement of the group III cpRNP
(cp33) resulted in a drastic increase in mRNA stability rather than
group I and II proteins. When the two groups of cpRNPs, in any
combination, were supplemented to the depleted extract, mRNA
stability was further increased to levels reaching 80-90% of the
control extract. These observations indicate that all three groups of
cpRNPs are cooperatively involved in stability of psbA
mRNA, possibly via individual group-specific cpRNPs. In addition,
group III protein (cp33) exhibited the most effective influence on
mRNA stability. Supplementation of three groups resulted in full
restoration of mRNA stability. This agrees with the previous experiment (Fig. 4).

View larger version (46K):
[in this window]
[in a new window]
|
Fig. 5.
Effect of group-specific cpRNPs on
degradation of exogenous psbA mRNA in
vitro. The effect of each cpRNP on RNA degradation was
examined by the same procedure as described in the legend to Fig. 4.
The control extract (control ex), cpRNP-depleted extract,
and depleted extract supplemented with group-specific
recombinant cpRNP (I, II, and III) alone or in combination were
incubated with synthesized 32P-labeled psbA
mRNA at 37 °C for 3 min. The remaining intact psbA
mRNA in the control extract and each reconstituted extract are
indicated as 100% and relative values, respectively. The assays were
repeated three times, and the S.E. is indicated by
bars.
|
|
 |
DISCUSSION |
The present study has shown that the five cpRNPs are abundant
(~3 × 105 molecules) and accumulate at one-tenth of
the level of RuBisCO in tobacco chloroplasts. Their amounts are
apparently greater than total molecules of chloroplast mRNAs,
including the most abundant psbA mRNA (~14,000
molecules), and perhaps greater than ribosomes. For instance, Rapp
et al. (6) estimated that each chloroplast of dark-grown
barley seedlings has 1.4 × 105 molecules of 16 S rRNA.
We used size fractionation and immunological tools to show that the
cpRNPs range in size from 30 to 600 kDa (cp28 and cp31), or to larger
(cp29A, cp29B, and cp33) and that most of the cpRNPs bind to
ribosome-free RNAs. This size distribution probably reflects the
binding of either single or multiple cpRNPs to various RNA species in
the stroma. The cpRNPs appear to be part of a higher molecular weight
complex that is associated with RNA. RNase treatment of the complex
shifts it to a smaller size ~30 kDa. Interestingly, the gel
filtration results also suggest that cp28, cp29A, and cp29B interact
with RNAs as monomers, whereas cp31 and cp33 may interact as oligomers
(~50 kDa). This suggests that the presence of two distinct forms of
cpRNPs may reflect different function(s) for different cpRNPs.
In the present study, the important finding was that cpRNPs contribute
to RNA stabilization via direct binding to target RNAs. Chloroplast
extracts depleted of all five cpRNPs degraded exogenous psbA
mRNA faster than did nondepleted extracts. The IRs of
psbA mRNA have previously been shown to act as
cis-elements for RNA stability in spinach (9) and C. reinhardtii (11). In this study, however, the rapid degradation of
IR-containing exogenous psbA mRNA suggests that the IR
of psbA mRNA may only contribute in part to mRNA
stability in vitro. Numerous ribonuclease activities have
been reported in chloroplasts (36, 43-47). Klaff (48) reported that
degradation of psbA mRNA is initiated by endonucleolytic cleavage of psbA mRNA. Once the mRNA has been
cleaved internally, the RNA fragments are then efficiently
polyadenylated and exonucleolytically degraded (49, 50). The cpRNPs
probably bind to internal sequence(s) targeted for cleavage by
endoribonucleases, thereby protecting these sequences from degradation.
Although cp33 exists at a 10-fold lower level than other cpRNPs, it
demonstrated a significant effect on mRNA stabilization rather than
the more abundant group I and II cpRNPs. This implies that cp33 is
involved, directly or indirectly, in the stability of mRNAs or
pre-RNAs. Alternatively, one possibility is that cp33 may bind
initially to mRNAs, and thereby recruit other cpRNPs or unknown
components to facilitate the formation of stable cpRNP and mRNA complexes.
Our previous work has clearly shown that several mRNAs
(psbA, petD, and rbcL) encoding
photosynthetic components and intron-containing pre-tRNAs coprecipitate
predominantly with group I and II cpRNPs (37). This suggests that group
I and II cpRNPs are involved mainly in the stability of mRNA and/or
splicing of pre-tRNAs. Moreover, using an in vitro RNA
editing system developed from tobacco chloroplasts, we have observed
that only cp31 is required for RNA editing (C U conversion) of
psbL mRNA that encodes the L-protein of photosystem
II.2 These results indicate
that each cpRNP contributes to a differing extent to RNA stability, RNA
cleavage, RNA editing, or RNA splicing.
It is likely that tobacco cpRNPs are general RNA-binding proteins, like
nuclear-localized heterogeneous ribonucleoprotein (hnRNP). Both cpRNPs
and hnRNPs have strong affinities for poly(G), poly(U), and
single-stranded DNA (33, 34, 51), and both are abundant proteins within
the chloroplast and nucleus, respectively. In analogy to the function
of hnRNP, cpRNP plays a role in various RNA processing before
initiation of translation of mature mRNAs. Transcription is
believed to occur in nucleoids that are composed of chloroplast DNA and
several proteins (52, 53). It is interesting to note that cpRNPs are
also detected in tobacco chloroplast
nucleoids.3 This suggests
that cpRNPs bind to nascent RNAs in the nucleoids.
From the overall results of the present study, we propose a model for
the possible role of cpRNPs. The cpRNPs associate with nascent RNAs or
pre-RNAs immediately after transcription in the nucleoids, and form
RNA-protein complexes in the stroma. These cpRNP·RNA complexes confer
stability and ribonuclease resistance to the RNAs. The complexes also
act as a scaffold for the specific catalytic machinery involved in RNA
maturation, RNA splicing of intron-containing pre-tRNAs, or RNA
editing. When the cpRNPs dissociate from fully processed and mature
mRNAs, ribosomes then attach to the mRNAs for translation.
The cp31 and cp33 proteins have 64 and 42 residues, respectively, of
auxiliary domains in their N terminus with 43% acidic residues (26).
The N-terminal regions of these proteins may be functionally
significant, because the acidic region is required for protein-protein
interaction (54). The N-terminal acidic regions of some cpRNPs are
efficiently phosphorylated in organello in a
light-dependent manner, and association of cpRNPs with RNAs and their dissociation from RNAs may be regulated by phosphorylation in
tobacco4 and spinach (55). To
clarify this possibility, further biochemical and molecular analyses
need to be carried out.
 |
ACKNOWLEDGEMENTS |
We thank T. Hirose and M. Mutsuda for
valuable discussions and G. Schuster for critical reading of the manuscript.
 |
FOOTNOTES |
*
This work was supported by Grant-in-aid for Scientific
Research in Priority Areas No. 0927103 (to M. S.) from the Ministry of
Education, Science, Sports, and Culture of Japan.The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
§
Present Address: Plantech Research Inst., Research Center, 1000 Kamoshida-cho, Aoba-ku, Yokohama 227-0033, Japan.
To whom correspondence should be addressed. Tel/Fax: 81 52 789 4779; E-mail: sugita@info.human.nagoya-u.ac.jp.
Published, JBC Papers in Press, October 18, 2000, DOI 10.1074/jbc.M008817200
2
T. Hirose and M. Sugiura, unpublished results.
3
A. Sakai and M. Sugita, unpublished results.
4
T. Nakamura, M. Sugiura and M. Sugita,
unpublished results.
 |
ABBREVIATIONS |
The abbreviations used are:
psbA, gene encoding D1 protein of photosystem II;
IR, inverted repeat;
UTR, untranslated region;
cpRNP, chloroplast ribonucleoprotein;
PAGE, polyacrylamide gel electrophoresis;
PAS, protein A-Sepharose;
-gal, -galactosidase;
RuBisCO, ribulose-1,5-bisphosphate
carboxylase/oxygenase;
hnRNP, heterogeneous ribonucleoprotein;
LS, large subunit;
re-cp, recombinant cp.
 |
REFERENCES |
| 1.
|
Gruissem, W.,
Barkan, A.,
Deng, X. W.,
and Stern, D.
(1988)
Trends Genet.
4,
258-263
|
| 2.
|
Mullet, J. E.
(1988)
Annu. Rev. Plant Physiol. Plant Mol. Biol.
39,
475-502
|
| 3.
|
Rochaix, J. D.
(1995)
Annu. Rev. Genet.
29,
209-230
|
| 4.
|
Deng, W. X.,
and Gruissem, W.
(1987)
Cell
49,
379-387
|
| 5.
|
Mullet, J. E.,
and Klein, R. R.
(1987)
EMBO J.
6,
1571-1579
|
| 6.
|
Rapp, J. C.,
Baumgartner, B. J.,
and Mullet, J. H.
(1992)
J. Biol. Chem.
267,
21404-21411
|
| 7.
|
Kim, M.,
Christopher, D. A.,
and Mullet, J. E.
(1993)
Plant Mol. Biol.
22,
447-463
|
| 8.
|
Klaff, P.,
and Gruissem, W.
(1991)
Plant Cell
3,
517-529
|
| 9.
|
Stern, D. B.,
and Gruissem, W.
(1987)
Cell
51,
1145-1157
|
| 10.
|
Adams, C. C.,
and Stern, D. B.
(1990)
Nucleic Acids Res.
18,
6003-6010
|
| 11.
|
Rott, R.,
Liveanu, V.,
Drager, R. G.,
Stern, D. B.,
and Schuster, G.
(1998)
Plant Mol. Biol.
36,
307-314
|
| 12.
|
Stern, D. B.,
Radwanski, E. R.,
and Kindle, K. L.
(1991)
Plant Cell
3,
285-297
|
| 13.
|
Stern, D. B.,
Jones, H.,
and Gruissem, W.
(1989)
J. Biol. Chem.
264,
18742-18750
|
| 14.
|
Chen, H. C.,
and Stern, D. B.
(1991)
Mol. Cell. Biol.
11,
4380-4388
|
| 15.
|
Memon, A. R.,
Meng, B.,
and Mullet, J. E.
(1996)
Plant Mol. Biol.
30,
1195-1205
|
| 16.
|
Alexander, C.,
Faber, N.,
and Klaff, P.
(1998)
Nucleic Acids Res.
26,
2265-2272
|
| 17.
|
Nickelsen, J.,
van Dillewijn, J.,
Rahire, M.,
and Rochaix, J. D.
(1994)
EMBO J.
13,
3182-3191
|
| 18.
|
Chen, Q.,
Adams, C. C.,
Usack, L.,
Yang, J.,
Monde, R. A.,
and Stern, D. B.
(1995)
Mol. Cell. Biol.
15,
2010-2018
|
| 19.
|
Danon, A.,
and Mayfield, S. P.
(1991)
EMBO J.
10,
3993-4001
|
| 20.
|
Danon, A.,
and Mayfield, S. P.
(1994)
EMBO J.
13,
2227-2235
|
| 21.
|
Rochaix, J. D.
(1996)
Plant Mol. Biol.
32,
327-341
|
| 22.
|
Jenkins, B.,
Kulhanek, D. J.,
and Barkan, A.
(1997)
Plant Cell
9,
283-296
|
| 23.
|
Hess, W.,
Hoch, B.,
Zelts, P.,
Hübschmann, T.,
Kössel, H.,
and Börner, T.
(1994)
Plant Cell
6,
1455-1465
|
| 24.
|
Hübschmann, T.,
Hess, W. R.,
and Börner, T.
(1996)
Plant Mol. Biol.
30,
109-123
|
| 25.
|
Meurer, J.,
Berger, A.,
and Westhoff, P.
(1996)
Plant Cell
8,
1193-1207
|
| 26.
|
Li, Y.,
and Sugiura, M.
(1990)
EMBO J.
9,
3059-3066
|
| 27.
|
Ye, L.,
Li, Y.,
Fukami-Kobayashi, K.,
Go, M.,
Konishi, T.,
Watanabe, A.,
and Sugiura, M.
(1991)
Nucleic Acids Res.
19,
6485-6490
|
| 28.
|
Ohta, M.,
Sugita, M.,
and Sugiura, M.
(1995)
Plant Mol. Biol.
27,
529-539
|
| 29.
|
Sugita, M.,
and Sugiura, M.
(1996)
Plant Mol. Biol.
32,
315-326
|
| 30.
|
Schuster, G.,
and Gruissem, W.
(1991)
EMBO J.
10,
1493-1502
|
| 31.
|
Cook, W. B.,
and Walker, J. C.
(1992)
Nucleic Acids Res.
20,
359-364
|
| 32.
|
Churin, Y.,
Hess, W. R.,
and Börner, T.
(1999)
Curr. Genet.
36,
173-181
|
| 33.
|
Li, Y.,
and Sugiura, M.
(1991)
Nucleic Acids Res.
19,
2893-2896
|
| 34.
|
Ye, L.,
and Sugiura, M.
(1992)
Nucleic Acids Res.
20,
6275-6279
|
| 35.
|
Lisitsky, I.,
Liveanu, V.,
and Schuster, G.
(1995)
Plant Physiol.
107,
933-941
|
| 36.
|
Hayes, R.,
Kudla, J.,
Schuster, G.,
Gabay, L.,
Maliga, P.,
and Gruissem, W.
(1996)
EMBO J.
15,
1132-1141
|
| 37.
|
Nakamura, T.,
Ohta, M.,
Sugiura, M.,
and Sugita, M.
(1999)
FEBS lett.
460,
437-441
|
| 38.
|
Sambrook, J.,
Fritsch, E. F.,
and Maniatis, T.
(1989)
Molecular Cloning: A Laboratory Manual
, 2nd Ed.
, Cold Spring Harbor, NY
|
| 39.
|
Vera, A.,
and Sugiura, M.
(1994)
EMBO J.
13,
2211-2217
|
| 40.
|
Dean, C.,
and Leech, L. M.
(1982)
Plant Physiol.
69,
904-910
|
| 41.
|
Nakamura, T.,
Ohta, M.,
Sugita, M.,
and Sugiura, M.
(1998)
in
Photosynthesis. Mechanisms and Effects
(Garab, G., ed), Vol. IV
, pp. 2957-2958, Kluwer Academic Publishers, The Netherlands
|
| 42.
|
Kim, M.,
Klein, P. G.,
and Mullet, J. E.
(1994)
Plant Mol. Biol.
25,
459-467
|
| 43.
|
Nickelsen, J.,
and Link, G.
(1993)
Plant J.
3,
537-544
|
| 44.
|
Drager, R. G.,
Girard-Bascou, J.,
Choquet, Y.,
Kindle, K. L.,
and Stern, D. B.
(1998)
Plant J.
13,
85-96
|
| 45.
|
Yang, J.,
Schuster, G.,
and Stern, D. B.
(1996)
Plant Cell
8,
1409-1420
|
| 46.
|
Liere, K.,
and Link, G.
(1997)
Nucleic Acids Res.
25,
2403-2408
|
| 47.
|
Nickelsen, J.,
Fleischmann, M.,
Boudreau, E.,
Rahire, M,
and Rochaix, J. D.
(1999)
Plant Cell
11,
957-970
|
| 48.
|
Klaff, P.
(1995)
Nucleic Acids Res.
23,
4885-4892
|
| 49.
|
Schuster, G.,
Lisitsky, I.,
and Klaff, P.
(1999)
Plant Physiol.
120,
937-944
|
| 50.
|
Hayes, R.,
Kudla, J.,
and Gruissem, W.
(1999)
Trends Biochem. Sci.
24,
199-202
|
| 51.
|
Dreyfuss, G.,
Matunis, M. J.,
Pinol-Roma, S.,
and Burd, C. G.
(1993)
Annu. Rev. Biochem.
62,
289-321
|
| 52.
|
Sakai, A.,
Saito, C.,
Inada, N.,
and Kuroiwa, T.
(1998)
Plant Cell Physiol.
39,
928-934
|
| 53.
|
Nakano, T.,
Murakami, S.,
Shoji, T.,
Yoshida, S.,
Yamada, Y.,
and Sato, F.
(1997)
Plant Cell
9,
1673-1682
|
| 54.
|
Bandziulis, R. J.,
Swanson, M. S.,
and Dreyfuss, G.
(1989)
Genes Dev.
3,
431-437
|
| 55.
|
Lisitsky, I.,
and Schuster, G.
(1995)
Nucleic Acids Res.
23,
2506-2511
|
Copyright © 2001 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
M. Tillich, S. L. Hardel, C. Kupsch, U. Armbruster, E. Delannoy, J. M. Gualberto, P. Lehwark, D. Leister, I. D. Small, and C. Schmitz-Linneweber
Chloroplast ribonucleoprotein CP31A is required for editing and stability of specific chloroplast mRNAs
PNAS,
April 7, 2009;
106(14):
6002 - 6007.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Hattori, H. Miyake, and M. Sugita
A Pentatricopeptide Repeat Protein Is Required for RNA Processing of clpP Pre-mRNA in Moss Chloroplasts
J. Biol. Chem.,
April 6, 2007;
282(14):
10773 - 10782.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
W. Majeran, Y. Cai, Q. Sun, and K. J. van Wijk
Functional Differentiation of Bundle Sheath and Mesophyll Maize Chloroplasts Determined by Comparative Proteomics
PLANT CELL,
November 1, 2005;
17(11):
3111 - 3140.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. D. Eads and S. C. Hand
Mitochondrial mRNA stability and polyadenylation during anoxia-induced quiescence in the brine shrimp Artemia franciscana
J. Exp. Biol.,
October 15, 2003;
206(20):
3681 - 3692.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Meierhoff, S. Felder, T. Nakamura, N. Bechtold, and G. Schuster
HCF152, an Arabidopsis RNA Binding Pentatricopeptide Repeat Protein Involved in the Processing of Chloroplast psbB-psbT-psbH-petB-petD RNAs
PLANT CELL,
June 1, 2003;
15(6):
1480 - 1495.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
S. Baginsky and W. Gruissem
Endonucleolytic activation directs dark-induced chloroplast mRNA degradation
Nucleic Acids Res.,
October 15, 2002;
30(20):
4527 - 4533.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Z. J. Lorkovic and A. Barta
Genome analysis: RNA recognition motif (RRM) and K homology (KH) domain RNA-binding proteins from the flowering plant Arabidopsis thaliana
Nucleic Acids Res.,
February 1, 2002;
30(3):
623 - 635.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J.-B. Peltier, O. Emanuelsson, D. E. Kalume, J. Ytterberg, G. Friso, A. Rudella, D. A. Liberles, L. Soderberg, P. Roepstorff, G. von Heijne, et al.
Central Functions of the Lumenal and Peripheral Thylakoid Proteome of Arabidopsis Determined by Experimentation and Genome-Wide Prediction
PLANT CELL,
January 1, 2002;
14(1):
211 - 236.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. Boyle and N. Brisson
Repression of the Defense Gene PR-10a by the Single-Stranded DNA Binding Protein SEBF
PLANT CELL,
November 1, 2001;
13(11):
2525 - 2537.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Shen, A. Danon, and D. A. Christopher
RNA Binding-Proteins Interact Specifically with the Arabidopsis Chloroplast psbA mRNA 5' Untranslated Region in a Redox-Dependent Manner
Plant Cell Physiol.,
October 1, 2001;
42(10):
1071 - 1078.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 2001 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|