|
Originally published In Press as doi:10.1074/jbc.M006032200 on October 11, 2000
J. Biol. Chem., Vol. 276, Issue 1, 165-171, January 5, 2001
Selective Resistance to Parathyroid Hormone Caused by a Novel
Uncoupling Mutation in the Carboxyl Terminus of G s
A CAUSE OF PSEUDOHYPOPARATHYROIDISM TYPE Ib*
Wei-I.
Wu ,
William F.
Schwindinger ,
Luis F.
Aparicio§, and
Michael A.
Levine ¶
From the Division of Pediatric Endocrinology and the
Ilyssa Center for Molecular and Cellular Endocrinology, Department of
Pediatrics, The Johns Hopkins University School of Medicine, Baltimore,
Maryland 21287 and § Metabolic Disease Associates, Erie,
Pennsylvania 16507
Received for publication, July 10, 2000, and in revised form, September 28, 2000
 |
ABSTRACT |
Gs is a
heterotrimeric ( , , and chains) G protein that couples
heptahelical plasma membrane receptors to stimulation of adenylyl
cyclase. Inactivation of one GNAS1 gene allele encoding the
chain of Gs (G s) causes
pseudohypoparathyroidism type Ia. Affected subjects have resistance to
parathyroid hormone (PTH) and other hormones that activate adenylyl
cyclase plus somatic features termed Albright hereditary
osteodystrophy. By contrast, subjects with pseudohypoparathyroidism
type Ib have hormone resistance that is limited to PTH and lack
Albright hereditary osteodystrophy. The molecular basis for
pseudohypoparathyroidism type Ib is unknown. We analyzed the
GNAS1 gene for mutations using polymerase chain reaction to
amplify genomic DNA from three brothers with pseudohypoparathyroidism type Ib. We identified a novel heterozygous 3-base pair deletion causing loss of isoleucine 382 in the three affected boys and their
clinically unaffected mother and maternal grandfather. This mutation
was absent in other family members and 15 additional unrelated subjects
with pseudohypoparathyroidism type Ib. To characterize the signaling
properties of the mutant G s, we used site-directed mutagenesis to introduce the isoleucine 382 deletion into a wild type
G s cDNA, transfected HEK293 cells with either wild
type or mutant G s cDNA, plus cDNAs encoding
heptahelical receptors for PTH, thyrotropic hormone, or
luteinizing hormone, and we measured cAMP production in response to
hormone stimulation. The mutant G s protein was unable to
interact with the receptor for PTH but showed normal coupling to the
other coexpressed heptahelical receptors. These results provide
evidence of selective uncoupling of the mutant G s from
PTH receptors and explain PTH-specific hormone resistance in these
three brothers with pseudohypoparathyroidism type Ib. The absence of
PTH resistance in the mother and maternal grandfather who carry the
same mutation is consistent with current models of paternal imprinting
of the GNAS1 gene.
 |
INTRODUCTION |
The term pseudohypoparathyroidism
(PHP)1 (1) describes a group
of disorders characterized by biochemical hypoparathyroidism (i.e. hypocalcemia and hyperphosphatemia), increased
secretion of PTH, and target tissue unresponsiveness to the biological
actions of PTH (1). Patients with PHP type I show neither a
phosphaturic nor a nephrogenous cyclic AMP response to administration
of exogenous PTH. These findings have implicated a defect in the PTH
receptor-G-protein-adenylyl cyclase complex in cells of the proximal
renal tubule as the basis for impaired PTH responsiveness. In one form
of PHP, the type Ia variant (2), patients are resistant to PTH as well
as multiple other hormones (3) that bind to receptors that are coupled by the stimulatory G protein (Gs) to activation of adenylyl
cyclase. In addition to hormone resistance, patients with PHP type Ia
also manifest a peculiar constellation of developmental and somatic defects, including short stature, round faces, brachydactyly, and
subcutaneous ossifications, that are collectively termed Albright's hereditary osteodystrophy (AHO) (1). The diverse clinical
manifestations of AHO have been attributed to heterozygous mutations in
the GNAS1 gene that lead to widespread deficiency of the subunit of Gs (G s) (4, 5). Although most
subjects with GNAS1 mutations have hormone resistance, and
thus PHP type 1a, in many families some members have AHO and normal
hormone responsiveness, a condition termed pseudo-PHP (PPHP) (4-6). In
a second form of PHP, termed type Ib, patients have normal
G s activity in accessible cells, lack features of AHO
(7, 8), and have hormone resistance that is limited to PTH (3).
Specific resistance of target tissues to PTH and normal
G s activity had implicated decreased expression or
function of the classical or type 1 PTH receptor (PTHR1)
that is expressed in bone and kidney as the cause for hormone
resistance. However, molecular studies have failed to disclose
mutations in the coding exons (9) and promoter regions (10) of the
PTHR1 gene or its mRNA (11). Moreover, mice (12)
and humans (13) in which one PTHR1 allele is inactivated do
not manifest PTH resistance or hypocalcemia. Indeed, inheritance of two
defective-type PTHR1 alleles results in Blomstrand
chondrodysplasia, a lethal genetic disorder that is characterized by
advanced endochondral bone maturation (13).
Most cases of PHP type Ib appear to be sporadic, but familial cases
have been described in which transmission of the defect is most
consistent with an autosomal dominant pattern (7, 14). Recent studies
using linkage analysis have mapped the genetic locus for PHP type 1b to
a small region of chromosome 20q13.3 near the GNAS1 gene,
thus raising the possibility that some patients with PHP type Ib have
inherited a GNAS1 mutation that leads to a selective defect
in PTH-dependent signaling (15). In this report we describe
a unique mutation in the GNAS1 gene that caused autosomal
dominant PTH resistance in three brothers with PHP type Ib, but which
was clinically silent in their mother and maternal grandfather. These
findings confirm that discrete mutations in this G protein can produce
a highly specific phenotype and provide additional evidence that
imprinting of the GNAS1 gene may explain variable
manifestations of the same mutation.
 |
EXPERIMENTAL PROCEDURES |
Materials
Bovine (Nle8,18,Tyr34)-PTH-(1-34)-amide
peptide was purchased from Bachem (Torrence, CA). Human chorionic
gonadotropin, bovine thyrotropic hormone (bTSH), and
( )-isoproterenol-(+)-bitartrate were purchased from Sigma. Plasmid
containing the cDNA for the human TSH receptor was a generous gift
of Dr. L. Kohn (National Institutes of Health), and plasmid containing
the rat LH receptor was a generous gift of Dr. Deborah Segaloff
(University of Iowa). The human kidney PTHR1 cDNA has been
described previously (16). All receptor cDNAs were cloned into the
expression vector pcDNAI/Amp (InVitrogen, Carlsbad, CA).
Methods
Analysis of G s Protein--
Erythrocyte membranes
were prepared by hypotonic lysis as described previously (17), and
activity of detergent-solubilized G s was determined by
assessing reconstitution of hormone-sensitive adenylyl cyclase activity
of S49 cyc membranes in the presence of 10 µM
L-isoproterenol plus 0.1 mM GTP S
(18).
To prepare a particulate fraction (referred to as "membranes") from
transfected HEK293 cells, cultured cells were incubated with a
hypotonic lysis buffer (5 mM HEPES, pH 7.4, 0.5 mM EDTA) for 30 min at 37 °C and subsequently harvested
by scraping with a Teflon policeman. Cells were disrupted by 20 strokes
of a Dounce homogenizer (loose-fitting) on wet ice and then centrifuged
at 480 × g for 10 min. The supernatant was collected
and centrifuged at 27,000 × g for 30 min. Membranes
were suspended in 25 mM HEPES and 1 mM
dithiothreitol and stored at 70 °C until used.
Expression of G s protein in erythrocyte and HEK293
membranes was determined by immunoblot analysis using 50-µg samples
of membrane protein, as described previously (19), using a polyclonal antibody (RM/1) directed against a carboxyl terminus decapeptide of
G s (PerkinElmer Life Sciences). Levels of immunoreactive
G s protein were normalized to the level of G protein
using a polyclonal antibody that reacts with the common forms of G .
Protein was assayed with the BCA Protein Assay Reagent (Pierce) with
BSA as a standard.
Identification of Mutation--
Exons 1-13 and the flanking
intron sequences of the human GNAS1 gene were amplified by
the polymerase chain reaction as described previously (20, 21) using
genomic DNA from peripheral blood leukocytes. Amplified DNA fragments
were analyzed first by polyacrylamide gel electrophoresis to assess the
size of the fragments and then by DGGE to detect mutations (20).
Amplified DNA fragments that migrated anomalously were precipitated
with sodium acetate and ethanol and taken up in TE (10 mM
Tris-HCl, 1 mM EDTA, pH 8) prior to ligation into the
plasmid cloning vector pCRII (InVitrogen, Carlsbad, CA). DNA from
individual clones was sequenced by dideoxynucleotide chain termination
method (22) using Sequenase (U. S. Biochemical Corp.). Total cellular
RNA was isolated from isolated mononuclear cells by the guanidinium
isothiocyanate-cesium chloride technique (23), and RT-PCR was used to
amplify a portion of G s mRNA as described previously
(24). One-fifth of the first strand cDNA served as a template in a
50-µl reaction with 50 pmol of sense primer 5' AM21 located in exon 8 and antisense primer 5' MAL21 located in exon 13 (20).
Construction of Expression Plasmids--
By using PCR, we
introduced the Ile382 mutation into a wild type human
G s cDNA (5) that contained a hemagglutinin epitope tag (codons 76-82, DVPDYAS) in exon 3 (25). Briefly, overlapping DNA
fragments were amplified using the full-length human G s
cDNA as a template. The 5' fragment was amplified with upstream
primer D1 (5'CAAGCAAGATCTGCTCGCTGAGA3') spanning the unique
BglII restriction site and downstream primer D2
(5'TGCGCTGAATGTCACGGCAGTCGT3') spanning the 3-base pair deletion. The
3' fragment was amplified with upstream primer D3
(5'ACGACTGCCGTGACATTCAGCGCA3') spanning the 3-base pair deletion and
downstream primer D4 (5'GTAGGCCGCCTTAAGCTTTCTAAAT3') spanning the
unique HindIII restriction site. These PCR products were
then mixed, denatured at 95 °C, and annealed together by cooling to
25 °C at 1 °C/s and then used as a template to amplify a
BglII-HindIII cassette. The cassette was
sequenced to confirm the introduction of the mutation, and the
BglII-HindIII fragment was used to replace the
corresponding wild type sequence in the G s cDNA.
Wild type and mutant Gs cDNA were subcloned into the pCDNA3.1 expression vector (InVitrogen, Carlsbad, CA).
Analysis of Recombinant Wild Type and Mutant
G s--
LipofectAMINE (Life Technologies, Inc.) was
used for transient transfection of HEK293 cells (2 × 106 in a T75 culture flask) with 8 µg of plasmid DNA.
After incubation overnight, cells were replated into 24-well dishes
(105 cells per well), and assays of cAMP production were
performed 48 h later as described previously (26). The ratio of
wild type G s plasmid to receptor plasmid was determined
empirically for each receptor to obtain optimized hormone-sensitive
accumulation of cAMP. Triplicate measurements were made, and
experiments were repeated at least three times. Data points were
normalized for cell protein and expressed in terms of maximal cAMP
accumulation in the presence of wild type G s. Results
are presented as the mean ± S.E. Data were analyzed with Prism
software (version 2.0, GraphPad, San Diego, CA).
 |
RESULTS |
Clinical Presentation and Diagnosis--
The proband (subject
III-3 in Fig. 1) and his two
brothers were referred for evaluation of PHP when they were discovered
to have elevated levels of serum PTH during an investigation of
hypocalcemia. The three brothers had normal intellectual function and
were at or above the 50th percentile for height; only one
(III-3) of the three boys was obese (39 kg, >95th percentile) (Table
I). Physical examination of the three
boys, their unaffected sister, and their parents failed to disclose
evidence of subcutaneous ossifications, brachydactyly, or other
features of AHO, and radiographs of hands and feet were normal. All
three brothers had elevated levels of intact PTH levels and failed to
show a significant increase in the urinary excretion of nephrogenous
cAMP after intravenous infusion of 200 units of synthetic human
PTH-(1-34) (Table II). By contrast, their mother showed a normal urinary cAMP response to administration of
human PTH-(1-34). Serum levels of magnesium, 25-(OH)-vitamin D,
thyroxine, triiodothyronine, and TSH were within the normal range, and serum levels of testosterone were appropriate for age in all
three boys (Table II). Subjects III-1 and III-2 showed pubertal LH and
follicle-stimulating hormone responses to intravenous infusion
of synthetic gonadotropin-releasing hormone (100 µg), and subject
III-3 showed a prepubertal response. All studies were approved by the
Joint Committee on Clinical Investigation of The Johns Hopkins
University School of Medicine, and written informed consent was given
by the study subjects or their parents.

View larger version (12K):
[in this window]
[in a new window]
|
Fig. 1.
Pedigree of family with
pseudohypoparathyroidism type Ib. Panel shows the pedigree of the
family and erythrocyte G s levels. The arrow
indicates the proband. Squares denote male family members
and circles female family members. Half-filled
symbols denote members with the Ile382 mutation,
and filled symbols denote those with both the gene mutation
and PTH resistance. The level of immunoactive erythrocyte
G s is indicated below the symbol and represents the mean
of three determinations.
|
|
Semi-quantitative immunoblot analysis was performed in triplicate and
demonstrated that levels of G s protein (Fig. 1) were not
reduced in erythrocyte membranes prepared from the three affected brothers (134 ± 8%) as compared with other unaffected family
members (99.3 ± 2.1%) or a control group of unrelated normal
subjects (92 ± 8%). To examine the functional activity of the
erythrocyte G s protein, we assessed the ability of
detergent-solubilized Gs from erythrocyte membranes to
reconstitute a hormonally responsive adenylyl cyclase system in
membranes prepared from the cyc clone of S49 murine lymphoma, which
genetically lacks G s protein (27). Addition of
increasing amounts of erythrocyte membrane extract to constant amounts
of cyc membranes produced linear increases in
L-isoproterenol (10 µM)-stimulated
adenylyl cyclase activity, with regression slopes for the three
affected members (III-1, III-2 III-3; 60.8 ± 4.3) and two members
who were unaffected carriers (I-1 and II-2; 69.3 ± 2.0) that were
equivalent (Fig. 2).

View larger version (24K):
[in this window]
[in a new window]
|
Fig. 2.
Erythrocyte
G s activity.
G s activity in detergent extracts of erythrocyte
membranes was determined by measuring the ability of various amounts of
the extract to reconstitute hormone-response adenylyl cyclase activity
in membranes prepared from the cyc clone of S49 murine lymphoma
cells, which genetically lack G s (27). Addition of
increasing amounts of erythrocyte membrane extract to constant amounts
of cyc membranes produced linear increases in
L-isoproterenol (10 µM)-stimulated
adenylyl cyclase activity, with regression slopes for the three
affected members with PHP (III-1, III-2, and III-3; 60.8 ± 4.3)
and two unaffected carriers with "PPHP" (I-2 and II-2; 69.3 ± 2.0) of the kindred that were equivalent. Results are representative of
three separate experiments, each performed with triplicate
determinations. Results are expressed as pmol of cyclic AMP per mg
protein per 20 min of incubation.
|
|
Identification and Confirmation of GNAS1 Mutation--
No
abnormalities were found in exons 1-12 of the proband's gene for
G s. Polyacrylamide gel electrophoresis (Fig.
3B) and DGGE (Fig.
3C) of DNA fragments amplified from exon 13 revealed additional bands indicating the presence of an abnormal allele. Although the typical pattern for heterozygous alleles on a denaturing gradient gel is composed of four bands, of which two bands represent homoduplex fragments and two bands represent heteroduplex fragments (28-30), DGGE of this PCR product consistently resolved only three bands. Thus, it is likely that under the conditions we employed the two
slowly migrating heteroduplex fragments migrated as a single band on
the denaturing gradient gel. The exon 13 PCR products were ligated into
the plasmid vector pCRII, and DNA from individual clones was sequenced.
Of 10 clones sequenced, 4 contained the wild type sequence for
G s exon 13. In addition, 6 clones contained inserts in
which there was a 3-base pair deletion (CAT) that eliminated an
isoleucine residue at position 382 ( Ile382) of
G s protein (Fig. 4).
RT-PCR of G s mRNA from peripheral blood mononuclear
cells amplified equivalent amounts of wild type and mutant cDNA,
indicating that mRNA derived from the mutant allele was stable
(data not shown).

View larger version (66K):
[in this window]
[in a new window]
|
Fig. 3.
Analysis of exon 13 of GNAS1
gene. A shows the pedigree of a portion of the
family; symbols are as described in Fig. 1. Exon 13 of GNAS1
was amplified by the polymerase chain reaction using genomic DNA as
described under "Experimental Procedures." PCR products were
analyzed by electrophoresis through nondenaturing polyacrylamide gels
(B) or through polyacrylamide gels containing a linearly
increasing concentration of the denaturants urea and formamide
(C). Although the typical pattern for heterozygous alleles
on a denaturing gradient gel is comprised of four bands, of which two
bands represent homoduplex fragments and two bands represent
heteroduplex fragments (28-30), DGGE of this PCR product consistently
resolved only three bands. The two lower bands represent the mutant
(lowest) and wild type (middle band)
G s sequences, whereas the upper-most band
consists of the two slowly migrating heteroduplex fragments.
|
|

View larger version (43K):
[in this window]
[in a new window]
|
Fig. 4.
Sequence analysis of antisense strand of exon
13 of the GNAS1 gene. Exon 13 was amplified by
PCR of genomic DNA from the propositus, and after ethanol precipitation
the DNA was ligated into the plasmid vector pCRII. DNA from individual
clones was sequenced as described under "Experimental Procedures."
Sequence analysis showed a heterozygous mutation (wild type
Normal Allele in left panel; mutant
Abnormal Allele in right panel) in which one
allele contained a 3-base pair deletion (CAT) that results in the
in-frame loss of the isoleucine residue at codon 382.
|
|
To genotype the rest of the family, PCR products of exon 13 from all
available members were analyzed by polyacrylamide gel electrophoresis
and DGGE. DNA from the clinically unaffected mother (II-1,
Fig. 3) and maternal grandfather showed patterns consistent with
heterozygosity for the Ile382 mutation, whereas DNA from
all other family members migrated as single bands indicating
homozygosity for the wild type GNAS1 allele (Fig. 3 and not
shown). The Ile382 mutation was not present in genomic
DNA from 15 additional unrelated subjects with PHP type 1b or from 30 other normal, unrelated subjects (data not shown).
Functional Analysis of Recombinant G s
Protein--
The Ile382 mutation occurs in the middle
of the 5 helix at the carboxyl terminus of the protein, a region
that contributes importantly to receptor selectivity. The
characteristics of the Ile382 mutation were assessed by
transiently expressing wild type and mutant forms of G s
plus cDNAs encoding G protein-coupled receptors in HEK293 cells at
37 °C. Immunoblot analyses revealed that the G s
containing the Ile382 mutation was expressed at a level
that was similar (118 ± 11%) to that of the wild type
recombinant G s protein under all experimental conditions
(Fig. 5). Moreover, cells that expressed
mutant or wild type G s proteins produced similar
agonist-dependent increases in cAMP when incubated with
various concentrations of L-isoproterenol, which
activates endogenous -adrenergic receptors (Fig.
6B). However, as the
Bmax for isoproterenol stimulation was slightly
reduced for the mutant G s protein, we cannot exclude a
subtle defect in coupling to -adrenergic receptors. To assess the
functional effects of the Ile382 mutation on receptor
coupling, wild type and mutant forms of G s were
transiently coexpressed in HEK293 cells with specific receptors that
can mediate activation of Gs but that are not found in
HEK293 cells (31), and after incubation with various concentrations of
hormones the production of cAMP was measured. Cells transfected with
the human PTHR1 showed a concentration-dependent
increase in intracellular cAMP accumulation after incubation with
10 11 to 10 7
M bPTH-(1-34), and this response was significantly
enhanced in cells that had been cotransfected with the wild type
G s cDNA (Fig. 6A). By contrast, HEK293
cells that had been cotransfected with the cDNAs for the mutant
G s and hPTHR1 showed cAMP responses to PTH (Fig.
6A) and PTHrP (data not shown) that were no greater than
those in cells that had been transfected with only the
hPTHR1.

View larger version (53K):
[in this window]
[in a new window]
|
Fig. 5.
Immunoblot analysis of recombinant wild type
and mutant G s proteins.
HEK293 cells were transfected with expression vectors (V)
(pcDNA3.1) encoding the wild type (WT) or mutant
(M) G s proteins, plus expression vectors
(pcDNA1/Amp) with no cDNA insert (Vector) or
cDNA encoding the PTHR1 (PTH-Rc), the TSH receptor
(TSH-Rc), or the LH receptor (LH-Rc). Cells were
harvested by scraping with a Teflon policeman in a hypotonic lysis
buffer (5 mM HEPES, pH 7.4, 0.5 mM EDTA) and
were disrupted by 20 strokes of a Dounce homogenizer (loose-fitting) on
wet ice. Membrane fractions were collected by centrifugation, and
expression of G s protein was determined by immunoblot
analysis in which 50-µg samples of membrane protein were resolved by
denaturing 10% SDS-PAGE, transferred to polyvinylidene difluoride
membranes, and incubated with a rabbit polyclonal antibody (RM/1)
directed against a carboxyl-terminal decapeptide of G s.
Antibody binding was detected using a 125I-labeled goat
anti-rabbit antibody and a PhosphorImager. Markers indicate the
overexpressed 52-kDa G s as well as the endogenous 45-kDa
G s. At least two additional experiments for each
cotransfection condition were performed and gave similar results.
|
|

View larger version (28K):
[in this window]
[in a new window]
|
Fig. 6.
Functional studies of the recombinant wild
type and mutant G s proteins.
HEK293 cells were transfected with expression vectors (pcDNA3.1)
encoding the wild type (WT) or mutant (MUT)
G s proteins, plus expression vectors (pcDNA1/Amp)
encoding the PTHR1 (A), the TSH receptor (C), or
the LH receptor (D). The cells were incubated for 10 min in
the presence of increasing concentrations of the indicated agonist, and
cyclic AMP was extracted and measured by radioimmunoassay. Each point
represents the mean (±S.E.) of at least three experiments in which
triplicate determinations were performed. The level of cyclic AMP is
expressed in terms of maximal agonist-induced accumulation (100%) by
cells expressing wild type G s. Cells were transfected
with 4 µg of plasmid containing PTHR1 or LH receptors plus 4 µg of
G s plasmid and 6 µg of plasmid containing TSH receptor
plus 2 µg of G s plasmid.
|
|
To assess the ability of the mutant G s protein to couple
to other heptahelical receptors, HEK293 cells were cotransfected with
wild type or mutant G s cDNAs plus cDNAs encoding
the TSH receptor or LH receptor. After incubation with various
concentrations of either bTSH or human chorionic gonadotropin, the
accumulation of cAMP was measured. At all concentrations of hormone
tested, cells expressing the wild type or mutant G s
cDNAs showed similar increases in cAMP that were significantly
greater than those in cells expressing the receptor alone (Fig. 6,
C and D).
 |
DISCUSSION |
PHP type Ib is characterized by isolated resistance to PTH and an
absence of features of AHO, and thus appears to be biochemically and
clinically distinct from PHP-type Ia. The identification of a novel
germ line mutation, Ile382, in the gene encoding
G s in three boys with PHP type Ib provides a new example
of how an inactivating mutation of a widely expressed G protein can
cause a limited disease. When expressed in vitro this mutant
G s was unable to couple to the PTHR1 but was
able to interact normally with a variety of other heptahelical
receptors (i.e. LH, TSH, and -adrenergic receptors) that
require G s to stimulate adenylyl cyclase. The ability of
the mutant G s protein to activate these other receptors
normally effectively excludes defects in  subunit interaction and
suggests another mechanism for the selective uncoupling from the
PTHR1. Several lines of evidence indicate that these
findings are the result of differential efficiency in receptor coupling
rather than artifact owing from differences in G s or
receptor expression. First, semi-quantitative immunoblot analysis
demonstrated equivalent expression of the mutant and wild type
G s recombinant proteins in each experimental paradigm,
thus excluding differences in the relative amount of mutant
G s protein expressed with different receptors as the
basis for the differential coupling to the various receptors. Second, although we did not quantify actual receptor levels, preliminary experiments were performed with each receptor cDNA and wild type G s to determine the optimal amount of each plasmid to
cotransfect to achieve maximal hormone responsiveness under each
condition. Third, experiments were repeated at least three times for
each combination of receptor and G s protein to avoid
random differences in receptor expression as a basis for differential
responsiveness of the mutant G s protein to different receptors.
The classical PTH receptor, PTHR1, is an ~75-kDa
glycoprotein that is often referred to as the PTH/PTHrP receptor as it
binds both PTH and parathyroid hormone-related protein (PTHrP), a
factor made by diverse tumors that cause humorally mediated
hypercalcemia, with equivalent affinity, and can activate both adenylyl
cyclase and phospholipase C (32). As PTH and PTHrP share greatest
homology in their amino termini, where the conserved sequences are
critical for receptor binding and activation, it is likely that binding of these two peptides to the PTHR1 induces similar
conformational changes in the receptor. It was therefore not surprising
that the mutant G s protein was also unable to couple to
the PTHrP-stimulated PTHR1 receptor. Thus, isolated
resistance to PTH, and the subsequent development of PHP type Ib in the
three affected subjects in this family, can be explained by a
GNAS1 mutation that produces an abnormal G s
molecule that, although widely expressed, is apparently unable to
interact with only the PTHR1. By contrast, subjects with PHP
type Ia have defective GNAS1 alleles that produce inadequate amounts of G s or G s molecules that are
unable to interact with all receptors (33-35). The basis for AHO in
subjects with PHP type Ia or their relatives with PPHP and normal
hormone responsiveness remains unexplained, but the lack of AHO in
these three affected boys provides further confirmation that defective
signaling through the PTHR1 is unlikely to be the cause.
Thus, abnormal growth of tubular bones, the presumptive basis for
brachydactyly in AHO patients with GNAS1 mutations that
completely inactivate G s, may result from defective
signaling through other adenylyl cyclase-coupled receptors that are
expressed in the growth plate.
Selective receptor uncoupling in the patients described here was due to
deletion of a single amino acid located in the carboxyl terminus of
G s, an essential region for receptor coupling and selectivity (reviewed in Ref. 36). The crystallographic structure of
the 394-amino acid G s molecule indicates that
Ile382 lies within the 5 helix, which together with the
4- 6 loop form a plane on the back of G s that may
interact with receptors (37). Additional evidence that the 5 helix
and 4- 6 loop contribute importantly to the receptor binding
surface comes from patterns of evolutionary conservation (38) as well
as from biochemical and genetic analyses. For example, peptide-specific
antibodies directed against the last 10 amino acids of G-protein chains can block receptor-mediated regulation of adenylyl cyclase
activity (39, 40), and experimentally produced mutations in this region uncouple G s from receptors (41). In addition, naturally
occurring mutations in the carboxyl terminus of G s that
inhibit coupling to all receptors have been identified in the
unc mutant of the S49 murine lymphoma cell line
(Arg389 Pro, (42, 43)) and in a patient with PHP type
Ia (Arg385 His, (33)). Deletion of Ile382
could alter the kink in the midsection of the 5 helix, thereby disrupting contact between the 5 and 4- 6 regions of the
G s chain. Specific uncoupling of the
Ile382 G s chain from only the
PTHR1 would imply that the interaction of G s
with the PTHR1 is particularly sensitive to this change in
the three-dimensional structure of the chain. Support for the
extraordinary specificity of this defect in receptor interaction derives from observations of differential efficacy of
G s-coupled receptors to activate chimeric forms of G
proteins in which only the last five amino acid residues are derived
from G s (44). These studies suggest that other amino
acids in the 5 helix must contribute to the fidelity of receptor-G
protein interaction.
That the same mutation could result in PHP type Ib in the three
brothers but fail to produce any clinical effects in their mother and
maternal grandfather is a remarkable discrepancy in genotype-phenotype
relations (Figs. 1 and 2). The discrepancy in the maternal grandfather
(I-1) might be explained by the presence of undetected mosaicism, but
this explanation could not account for the lack of phenotypic features
in his daughter (II-2), the mother of the three affected boys. The
inconstant phenotypes exhibited in members of this family who share the
same GNAS1 mutation are reminiscent of the peculiar pattern
of inheritance of hormone resistance exhibited by patients with other
GNAS1 gene mutations, in whom maternal transmission of
G s deficiency leads to PHP type Ia, whereas paternal
transmission of the defect leads to PPHP (6), a variant characterized
by somatic features of AHO but normal hormone responsiveness (45-48).
These observations first suggested imprinting of the GNAS1
locus as a mechanism for gene regulation but could not anticipate the
complex pattern of genomic imprinting now identified. Two upstream
promoters, each associated with a large coding exon, lie 35-40
kilobase pairs upstream of GNAS1 exon 1 and generate unique
proteins. In addition, a third alternative first exon, termed 1A, is
only about 3 kilobase pairs upstream of exon 1, and lacks translated
sequences (49). The more 5' of these exons encodes NESP55, which is
expressed exclusively from the maternal allele. By contrast, the XL s
(50, 51) and 1A exons (52)2
are paternally expressed. Although initial studies in human tissues were consistent with biallelic expression of G s (50, 51, 54), subsequent analyses in mice in which one Gnas allele is disrupted (Gnas +/ ) have suggested a model of cell- or
tissue-specific paternal imprinting of G s. In this
model, both Gnas alleles are expressed in most tissues, but
only the maternal allele is expressed in some tissues (e.g.
renal cortex) (55-57). Accordingly, Gnas +/ mice that
inherit an inactivated Gnas allele maternally will lack any
functional G s protein in tissues in which
Gnas is paternally imprinted, such as the PTH-sensitive
renal proximal tubule, and will consequently develop PTH resistance. By
contrast, Gnas +/ mice that inherit the inactive
Gnas allele paternally will express only the wild type
maternal allele in these tissues. As a consequence, these mice will
have "normal" levels of G s protein in renal cells and, like subjects with PPHP, will have normal PTH responsiveness. Finally, Gnas +/ mice and humans will have a 50%
reduction in G s expression in nonimprinted tissues,
which express both G s alleles. Biallelic expression
would explain the similar 50% reduction in G s activity
in erythrocytes and cultured fibroblasts from subject with PHP type Ia
or PPHP (19, 46), who inherit a defective GNAS1 allele from
their mother or father, respectively. Moreover, hormone responsiveness
in tissues that express both GNAS1 alleles would be normal
(e.g. renal medulla and vasopressin) or mildly impaired
(e.g. thyroid and TSH) based on whether 50% of the normal complement of G s is sufficient for normal signal
transduction. Biallelic expression of GNAS1 in bone cells
could also explain the normal response of cultured bone cells from a
patient with PHP type Ia to PTH treatment in vitro (58), as
well as the development of hyperparathyroid bone disease by many
patients with PHP type I who have elevated serum levels of PTH
(53).
The prevalence of mutations in the GNAS1 gene as a cause of
PHP type Ib remains to be determined, but our current studies indicate
that defects in coding exons are unlikely to be common. However, recent
molecular genetic analyses show linkage of PHP type Ib to the
chromosomal region that composes the GNAS1 gene locus, as
well as apparent paternal imprinting of PTH resistance (15), thus
suggesting that mutations in or near the promoter region of
GNAS1 are likely to be present in these patients. Such mutations may selectively reduce G s expression in the
renal proximal tubule and thereby impair PTH-dependent
signaling in the kidney. Identification of these mutations will provide
additional confirmation that defective regulation of G s
signaling is a common mechanism for PTH resistance in these two
distinctive forms of PHP type I.
 |
ACKNOWLEDGEMENTS |
We are grateful to Dr. Changlin Ding and
Phillip M. Smallwood for expert technical assistance.
 |
FOOTNOTES |
*
This work was supported in part by United States Public
Health Service Grant DK34281 (to M. A. L.) and by General Clinical Research Center Grant RR0035 from the National Institutes of Health.The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
¶
To whom correspondence should be addressed: Division of
Pediatric Endocrinology, Johns Hopkins University School of Medicine, Park Bldg., Rm. 211, 600 N. Wolfe St., Baltimore, Maryland 21287. Tel.:
410-955-6463; Fax: 410-955-9773; E-mail: mlevine@jhmi.edu.
Published, JBC Papers in Press, October 11, 2000, DOI 10.1074/jbc.M006032200
2
S. M. Jan de Beur, C. L. Ding, and
M. A. Levine, unpublished data.
 |
ABBREVIATIONS |
The abbreviations used are:
PHP, pseudohypoparathyroidism;
PPHP, pseudopseudohypoparathyroidism;
PTH, parathyroid hormone;
PTHrP, parathyroid hormone-related protein;
PTHR1, type 1 PTH receptor;
G protein, guanine
nucleotide-binding protein;
Gs, stimulatory G protein;
G s, chain of Gs;
Ile382, G s mutant with deletion of Ile382 AHO,
Albright hereditary osteodystrophy;
PPHP, pseudopseudohypoparathyroidism;
bTSH, bovine thyrotropic hormone;
PCR, polymerase chain reaction;
DGGE, denaturing gradient gel
electrophoresis;
RT-PCR, reverse transcription-PCR;
GTP S, guanosine
5'-3-O-(thio)triphosphate;
LH, luteinizing hormone;
TSH, thyrotropic hormone.
 |
REFERENCES |
| 1.
|
Albright, F.,
Burnett, C. H.,
and Smith, P. H.
(1942)
Endocrinology
30,
922-932
|
| 2.
|
Levine, M. A.
(2000)
in
Endocrinology
(DeGroot, L. J., ed), 4th Ed.
, pp. 1133-1153, W. B. Saunders Co., Philadelphia
|
| 3.
|
Levine, M. A.,
Downs, R. W., Jr.,
Moses, A. M.,
Breslau, N. A.,
Marx, S. J.,
Lasker, R. D.,
Rizzoli, R. E.,
Aurbach, G. D.,
and Spiegel, A. M.
(1983)
Am. J. Med.
74,
545-556
|
| 4.
|
Levine, M. A.
(1999)
J. Bone Miner. Res.
14,
1255-1260
|
| 5.
|
Patten, J. L.,
Johns, D. R.,
Valle, D.,
Eil, C.,
Gruppuso, P. A.,
Steele, G.,
Smallwood, P. M.,
and Levine, M. A.
(1990)
N. Engl. J. Med.
322,
1412-1419
|
| 6.
|
Albright, F.,
Forbes, A. P.,
and Henneman, P. H.
(1952)
Trans. Assoc. Am. Physicians
65,
337-350
|
| 7.
|
Winter, J. S. D.,
and Hughes, I. A.
(1980)
Can. Med. Assoc. J.
123,
26-31
|
| 8.
|
Nusynowitz, M. L.,
Frame, B.,
and Kolb, F. O.
(1976)
Medicine (Baltimore)
55,
105-125
|
| 9.
|
Schipani, E.,
Weinstein, L. S.,
Bergwitz, C.,
Iida-Klein, A.,
Kong, X. F.,
Stuhrmann, M.,
Kruse, K.,
Whyte, M. P.,
Murray, T.,
Schmidtke, J.,
Van Dop, C.,
Brickman, A. S.,
Crawford, J. D.,
Potts, J. T., Jr.,
Kronenberg, H. M.,
Abou-Samra, A. B.,
Segre, G. V.,
and Juppner, H.
(1995)
J. Clin. Endocrinol. & Metab.
80,
1611-1621
|
| 10.
|
Bettoun, J. D.,
Minagawa, M.,
Kwan, M. Y.,
Lee, H. S.,
Yasuda, T.,
Hendy, G. N.,
Goltzman, D.,
and White, J. H.
(1997)
J. Clin. Endocrinol. & Metab.
82,
1031-1040
|
| 11.
|
Fukumoto, S.,
Suzawa, M.,
Takeuchi, Y.,
Kodama, Y.,
Nakayama, K.,
Ogata, E.,
Matsumoto, T.,
and Fujita, T.
(1996)
J. Clin. Endocrinol. & Metab.
81,
2554-2558
|
| 12.
|
Lanske, B.,
Karaplis, A. C.,
Lee, K.,
Luz, A.,
Vortkamp, A.,
Pirro, A.,
Karperien, M.,
Defize, L. K.,
Ho, C.,
Mulligan, R. C.,
Abou-Samra, A. B.,
Juppner, H.,
Segre, G. V.,
and Kronenberg, H. M.
(1996)
Science
273,
663-666
|
| 13.
|
Jobert, A. S.,
Zhang, P.,
Couvineau, A.,
Bonaventure, J.,
Roume, J.,
Le Merrer, M.,
and Silve, C.
(1998)
J. Clin. Invest.
102,
34-40
|
| 14.
|
Allen, D. B.,
Friedman, A. L.,
Greer, F. R.,
and Chesney, R. W.
(1988)
Am. J. Med. Genet.
31,
153-158
|
| 15.
|
Juppner, H.,
Schipani, E.,
Bastepe, M.,
Cole, D. E.,
Lawson, M. L.,
Mannstadt, M.,
Hendy, G. N.,
Plotkin, H.,
Koshiyama, H.,
Koh, T.,
Crawford, J. D.,
Olsen, B. R.,
and Vikkula, M.
(1998)
Proc. Natl. Acad. Sci. U. S. A.
95,
11798-11803
|
| 16.
|
Adams, A. E.,
Pines, M.,
Nakamoto, C.,
Behar, V.,
Yang, Q. M.,
Chorev, M.,
Rosenblatt, M.,
Levine, M. A.,
and Suva, L. J.
(1995)
Biochemistry
34,
10553-10559
|
| 17.
|
Cain, C. D.,
Adey, W. R.,
and Luben, R. A.
(1987)
J. Bone. Miner. Res.
2,
437-441
|
| 18.
|
Gierschik, P.,
Codina, J.,
Simons, C.,
Birnbaumer, L.,
and Spiegel, A.
(1985)
Proc. Natl. Acad. Sci. U. S. A.
82,
727-731
|
| 19.
|
Patten, J. L.,
and Levine, M. A.
(1990)
J. Clin. Endocrinol. & Metab.
71,
1208-1214
|
| 20.
|
Miric, A.,
Vechio, J. D.,
and Levine, M. A.
(1993)
J. Clin. Endocrinol. & Metab.
76,
1560-1568
|
| 21.
|
Jan de Beur, S. M.,
Deng, Z.,
Ding, C. L.,
and Levine, M. A.
(1998)
Proceedings of the 80th Annual Meeting of the Endocrine Society, New Orleans
, p. 62, Endocrine Society, Bethesda, MD (abstr. OR7-6)
|
| 22.
|
Sanger, F.,
Nicklen, S.,
and Coulson, A. R.
(1977)
Proc. Natl. Acad. Sci. U. S. A.
74,
5463-5467
|
| 23.
|
Chirgwin, J. M.,
Przybyla, A. E.,
MacDonald, R. J.,
and Rutter, W. J.
(1979)
Biochemistry
18,
5294-5299
|
| 24.
|
Namnoum, A. B.,
Merriam, G. R.,
Moses, A. M.,
and Levine, M. A.
(1998)
J. Clin. Endocrinol. & Metab.
83,
824-829
|
| 25.
|
Gejman, P. V.,
Weinstein, L. S.,
Martinez, M.,
Spiegel, A. M.,
Cao, Q.,
Hsieh, W. T.,
Hoehe, M. R.,
and Gershon, E. S.
(1991)
Genomics
9,
782-783
|
| 26.
|
Levine, M. A.,
Eil, C.,
Downs, R. W., Jr.,
and Spiegel, A. M.
(1983)
J. Clin. Invest.
72,
316-324
|
| 27.
|
Sullivan, K. A.,
Liao, Y. C.,
Alborzi, A.,
Beiderman, B.,
Chang, F. H.,
Masters, S. B.,
Levinson, A. D.,
and Bourne, H. R.
(1986)
Proc. Natl. Acad. Sci. U. S. A.
83,
6687-6691
|
| 28.
|
Fischer, S. G.,
and Lerman, L. S.
(1983)
Proc. Natl. Acad. Sci. U. S. A.
80,
1579-1583
|
| 29.
|
Myers, R. M.,
Fischer, S. G.,
Maniatis, T.,
and Lerman, L. S.
(1985)
Nucleic Acids Res.
13,
3111-3129
|
| 30.
|
Myers, R. M.,
Maniatis, T.,
and Lerman, L. S.
(1987)
Methods Enzymol.
155,
501-527
|
| 31.
|
Chabre, O.,
Conklin, B. R.,
Brandon, S.,
Bourne, H. R.,
and Limbird, L. E.
(1994)
J. Biol. Chem.
269,
5730-5734
|
| 32.
|
Schipani, E.,
Karga, H.,
Karaplis, A. C.,
Potts, J. T., Jr.,
Kronenberg, H. M.,
Segre, G. V.,
Abou-Samra, A. B.,
and Juppner, H.
(1993)
Endocrinology
132,
2157-2165
|
| 33.
|
Schwindinger, W. F.,
Miric, A.,
Zimmerman, D.,
and Levine, M. A.
(1994)
J. Biol. Chem.
269,
25387-25391
|
| 34.
|
Warner, D. R.,
Gejman, P. V.,
Collins, R. M.,
and Weinstein, L. S.
(1997)
Mol. Endocrinol.
11,
1718-1727
|
| 35.
|
Warner, D. R.,
Weng, G., Yu, S.,
Matalon, R.,
and Weinstein, L. S.
(1998)
J. Biol. Chem.
273,
23976-23983
|
| 36.
|
Bourne, H. R.
(1997)
Curr. Opin. Cell Biol.
9,
134-142
|
| 37.
|
Sunahara, R. K.,
Tesmer, J. J.,
Gilman, A. G.,
and Sprang, S. R.
(1997)
Science
278,
1943-1947
|
| 38.
|
Lichtarge, O.,
Bourne, H. R.,
and Cohen, F. E.
(1996)
Proc. Natl. Acad. Sci. U. S. A.
93,
7507-7511
|
| 39.
|
Spiegel, A. M.,
Simonds, W. F.,
Jones, T. L.,
Goldsmith, P. K.,
and Unson, C. G.
(1990)
Biochem. Soc. Symp.
56,
61-69
|
| 40.
|
Simonds, W. F.,
Goldsmith, P. K.,
Woodard, C. J.,
Unson, C. G.,
and Spiegel, A. M.
(1989)
FEBS Lett.
249,
189-194
|
| 41.
|
Pantaloni, C.,
and Audigier, Y.
(1993)
J. Recept. Res.
13,
591-608
|
| 42.
|
Sullivan, K. A.,
Miller, R. T.,
Masters, S. B.,
Beiderman, B.,
Heideman, W.,
and Bourne, H. R.
(1987)
Nature
330,
758-760
|
| 43.
|
Rall, T.,
and Harris, B. A.
(1987)
FEBS Lett.
224,
365-371
|
| 44.
|
Conklin, B. R.,
Herzmark, P.,
Ishida, S.,
Voyno-Yasenetskaya, T. A.,
Sun, Y.,
Farfel, Z.,
and Bourne, H. R.
(1996)
Mol. Pharmacol.
50,
885-890
|
| 45.
|
Wilson, L. C.,
Oude Luttikhuis, M. E.,
Clayton, P. T.,
Fraser, W. D.,
and Trembath, R. C.
(1994)
J. Med. Genet.
31,
835-839
|
| 46.
|
Levine, M. A.,
Jap, T. S.,
Mauseth, R. S.,
Downs, R. W.,
and Spiegel, A. M.
(1986)
J. Clin. Endocrinol. & Metab.
62,
497-502
|
| 47.
|
Davies, S. J.,
and Hughes, H. E.
(1993)
J. Med. Genet.
30,
101-103
|
| 48.
|
Nakamoto, J. M.,
Sandstrom, A. T.,
Brickman, A. S.,
Christenson, R. A.,
and Van Dop, C.
(1998)
Am. J. Med. Genet.
77,
261-267
|
| 49.
|
Swaroop, A.,
Agarwal, N.,
Gruen, J. R.,
Bick, D.,
and Weissman, S. M.
(1991)
Nucleic Acids Res.
17,
4725-4729
|
| 50.
|
Hayward, B. E.,
Moran, V.,
Strain, L.,
and Bonthron, D. T.
(1998)
Proc. Natl. Acad. Sci. U. S. A.
95,
15475-15480
|
| 51.
|
Hayward, B. E.,
Kamiya, M.,
Strain, L.,
Moran, V.,
Campbell, R.,
Hayashizaki, Y.,
and Bonthron, D. T.
(1998)
Proc. Natl. Acad. Sci. U. S. A.
95,
10038-10043
|
| 52.
|
Liu, J., Yu, S.,
Litman, D.,
Chen, W.,
and Weinstein, L. S.
(2000)
Mol. Cell. Biol.
20,
5808-5817
|
| 53.
|
Burnstein, M. I.,
Kottamasu, S. R.,
Pettifor, J. M.,
Sochett, E.,
Ellis, B. I.,
and Frame, B.
(1985)
Radiology
155,
351-356
|
| 54.
|
Campbell, R.,
Gosden, C. M.,
and Bonthron, D. T.
(1994)
J. Med. Genet.
31,
607-614
|
| 55.
|
Yu, S., Yu, D.,
Lee, E.,
Eckhaus, M.,
Lee, R.,
Corria, Z.,
Accili, D.,
Westphal, H.,
and Weinstein, L. S.
(1998)
Proc. Natl. Acad. Sci. U. S. A.
95,
8715-8720
|
| 56.
|
Weinstein, L. S., Yu, S.,
and Ecelbarger, C. A.
(2000)
Am. J. Physiol.
278,
F507-F514
|
| 57.
|
Schwindinger, W. F.,
Lawler, A. M.,
Gearhart, J. D.,
and Levine, M. A.
(1998)
Proceedings of the 80th Annual Meeting of the Endocrine Society, New Orleans
, p. 480, Endocrine Society, New Orleans
|
| 58.
|
Murray, T. M.,
Rao, L. G.,
Wong, M. M.,
Waddell, J. P.,
McBroom, R.,
Tam, C. S.,
Rosen, F.,
and Levine, M. A.
(1993)
J. Bone Miner. Res.
8,
83-91
|
Copyright © 2001 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
A. Weinhaeusel, S. Thiele, M. Hofner, O. Hiort, and C. Noehammer
PCR-Based Analysis of Differentially Methylated Regions of GNAS Enables Convenient Diagnostic Testing of Pseudohypoparathyroidism Type Ib
Clin. Chem.,
September 1, 2008;
54(9):
1537 - 1545.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Plagge, G. Kelsey, and E. L Germain-Lee
Physiological functions of the imprinted Gnas locus and its protein variants G{alpha}s and XL{alpha}s in human and mouse
J. Endocrinol.,
February 1, 2008;
196(2):
193 - 214.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Linglart, M. J. Mahon, M. A. Kerachian, D. M. Berlach, G. N. Hendy, H. Juppner, and M. Bastepe
Coding GNAS Mutations Leading to Hormone Resistance Impair in Vitro Agonist- and Cholera Toxin-Induced Adenosine Cyclic 3',5'-Monophosphate Formation Mediated by Human XL{alpha}s
Endocrinology,
May 1, 2006;
147(5):
2253 - 2262.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Bastepe and H. Juppner
Pseudohypoparathyroidism, Gs{alpha}, and the GNAS Locus
IBMS BoneKEy,
December 1, 2005;
2(12):
20 - 32.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Wettschureck and S. Offermanns
Mammalian G Proteins and Their Cell Type Specific Functions
Physiol Rev,
October 1, 2005;
85(4):
1159 - 1204.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. S. Weinstein, J. Liu, A. Sakamoto, T. Xie, and M. Chen
Minireview: GNAS: Normal and Abnormal Functions
Endocrinology,
December 1, 2004;
145(12):
5459 - 5464.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. Mantovani, M. Maghnie, G. Weber, E. De Menis, V. Brunelli, M. Cappa, P. Loli, P. Beck-Peccoz, and A. Spada
Growth Hormone-Releasing Hormone Resistance in Pseudohypoparathyroidism Type Ia: New Evidence for Imprinting of the Gs{alpha} Gene
J. Clin. Endocrinol. Metab.,
September 1, 2003;
88(9):
4070 - 4074.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. F. Raposo, L. G. Sobrinho, and H. G. Ferreira
A Minimal Mathematical Model of Calcium Homeostasis
J. Clin. Endocrinol. Metab.,
September 1, 2002;
87(9):
4330 - 4340.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. S. Weinstein, S. Yu, D. R. Warner, and J. Liu
Endocrine Manifestations of Stimulatory G Protein {alpha}-Subunit Mutations and the Role of Genomic Imprinting
Endocr. Rev.,
October 1, 2001;
22(5):
675 - 705.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Bastepe, J. E. Pincus, T. Sugimoto, K. Tojo, M. Kanatani, Y. Azuma, K. Kruse, A. L. Rosenbloom, H. Koshiyama, and H. Juppner
Positional dissociation between the genetic mutation responsible for pseudohypoparathyroidism type Ib and the associated methylation defect at exon A/B: evidence for a long-range regulatory element within the imprinted GNAS1 locus
Hum. Mol. Genet.,
June 1, 2001;
10(12):
1231 - 1241.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 2001 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|