|
Originally published In Press as doi:10.1074/jbc.M006308200 on October 2, 2000
J. Biol. Chem., Vol. 276, Issue 1, 464-474, January 5, 2001
Zebrafish Acetylcholinesterase Is Encoded by a Single Gene
Localized on Linkage Group 7
GENE STRUCTURE AND POLYMORPHISM; MOLECULAR FORMS AND EXPRESSION
PATTERN DURING DEVELOPMENT*
Christelle
Bertrand ,
Arnaud
Chatonnet ,
Christina
Takke ,
YiLin
Yan§,
John
Postlethwait§,
Jean-Pierre
Toutant , and
Xavier
Cousin ¶
From the Différenciation Cellulaire et
Croissance, INRA, 2 Place Viala, 34060 Montpellier Cedex, France
and the § Institute of Neuroscience, University of Oregon,
Eugene, Oregon 97403
Received for publication, July 17, 2000, and in revised form, September 20, 2000
 |
ABSTRACT |
We cloned and sequenced the acetylcholinesterase
gene and cDNA of zebrafish, Danio rerio. We found a
single gene (ache) located on linkage group LG7. The
relative organization of ache, eng2, and shh
genes is conserved between zebrafish and mammals and defines a synteny.
Restriction fragment length polymorphism analysis was allowed to
identify several allelic variations. We also identified two
transposable elements in non-coding regions of the gene. Compared with
other vertebrate acetylcholinesterase genes, ache
gene contains no alternative splicing at 5' or 3' ends where only a T
exon is present. The translated sequence is 60-80% identical to
acetylcholinesterases of the vertebrates and exhibits an extra loop
specific to teleosts. Analysis of molecular forms showed a transition,
at the time of hatching, from the globular G4 form to asymmetric A12
form that becomes prominent in adults. In situ
hybridization and enzymatic activity detection on whole embryos
confirmed early expression of the acetylcholinesterase gene
in nervous and muscular tissues. We found no
butyrylcholinesterase gene or activity in Danio.
These findings make zebrafish a promising model to study function
of acetylcholinesterase during development and regulation of molecular forms assembly in vivo.
 |
INTRODUCTION |
The role of acetylcholinesterase
(AChE,1 EC 3.1.1.7) in
synaptic transmission is clearly demonstrated by the effects of
inhibitors of this enzyme. In addition to hydrolysis of the
neurotransmitter acetylcholine at synapses, AChE was shown to be
involved in non-cholinergic functions, influencing differentiation and
neuronal outgrowth (reviewed in Ref. 1). During development in
vertebrates, AChE appears long before synapses are functional, and its
role in this context is not clear (2, 3). Successive expression of
butyrylcholinesterase (BChE, EC 3.1.1.8) and AChE was associated with
transition from the proliferation state to differentiation in embryonic
chick somites (2).
Zebrafish is a useful model for vertebrate early development and is
amenable to experimental modulation of the cholinergic system, AChE
activity, or ache gene expression. In this fish, AChE is
expressed in neurons long before axons reach their target (4-7). When
embryos were bathed with organophosphate
(diisopropylfluorophosphate), AChE was totally
inhibited, and somitogenesis was altered (8). It is to note,
however, that effect on development may not be related to AChE
inhibition since diisopropylfluorophosphate inhibits many hydrolases.
In vertebrates, AChE is characterized by a large set of molecular
forms. During development and tissue differentiation their proportion
varies. This polymorphism is due to alternative mRNA processing at
the 3' end of the gene resulting in proteins containing different
C-terminal peptides. Exon H encodes a hydrophobic peptide that is
cleaved upon glycolipid addition. Exon T encodes a peptide highly
conserved among species. Soluble monomers (G1), dimers (G2), and
tetramers (G4) are composed of T subunits. In addition these tetramers
may be associated with structural subunits, a collagenic tail in
neuromuscular junctions, or a membrane protein in brain (9). In some
cases, the genomic sequence following the last common exon is retained
into the mRNA. Physiological significance of this readthrough
transcript is not known (9).
In order to study AChE functions during development of Danio
rerio, we first characterized its early expression. In this study, we cloned and sequenced the zebrafish ache gene and
cDNA. We showed that zebrafish has a single ache gene
encoding only T subunits and has no bche gene. We located
the ache gene in the zebrafish genome on LG7 near
eng2 and shh. It contains transposable elements in non-coding regions and also presents allelic variations. We show
that the fully mature pattern of AChE molecular forms is reached only
after 1 week of development, in free swimming larvae, whereas the AChE
expression pattern analysis showed an early expression from the 5- to
7-somite stage (12 h).
 |
EXPERIMENTAL PROCEDURES |
Materials--
D. rerio adults and embryos were from
our facility. Fish are maintained at 28 °C on a 13-h light/11-h dark
cycle. The AB strain was a gift of Dr. Bricaud (Université
des Sciences et Techniques du Languedoc, Montpellier, France), and the
ABO strain was a gift of Dr. Strähle (Institut de
Génétique et de Biologie moléculaire et Cellulaire,
Strasbourg, France). Embryos were collected from spontaneous spawnings
and staged according to Westerfield (10).
All molecular biology procedures including genomic DNA and RNA
isolation, Northern and Southern blots, PCR amplification followed standard techniques (10, 11) or the manufacturer's protocols. Chemicals are from Sigma, Fluka, or Aldrich, and enzymes are from Promega, New England Biolabs, and Roche Molecular Biochemicals. Sequencing was performed with the Big Dye kit from PerkinElmer Life
Sciences following the supplier's protocol.
cDNA Cloning, Library Screening, and Gene
Isolation--
Degenerate primers P1, P2, and P3 were designed from
conserved sequences of AChEs. Reverse transcription was performed
with Expand RT (Roche Molecular Biochemicals) using primer (P3)
5' GAACTC(A/G)AT(C/T)TCATAGCC(A/G)TG 3' on total adult RNAs. A first cDNA fragment was isolated by PCR using primers (P1) 5'
TT(T/C)C(C/A)(G/A)GGTTCiGAGATGTGGAA 3' and (P2)
5'-GC(T/G)(G/C)(G/C)iCCiGCACTCTC(C/T)CC(A/G)AA-3'. Rapid
amplification of cDNA ends experiments were performed to find the
5'- and 3'-untranslated regions and to locate the transcription start site.
A zebrafish genomic library cloned in Lambda Fix II vector was
purchased from Stratagene. Approximately 1 × 106
clones were first screened with the P1-P2 cDNA fragment. Clone 14 was fully sequenced, and although it covered 8 kb of genomic AChE
sequence, it did not contain non-coding exon 1. We performed a second
screen with a 220-bp probe covering exon 1. Two additional clones 8N
and 14N were isolated and sequenced, and they both contained the
transcriptional start site and promoter region.
Sequence analysis using the blast algorithm (12) was performed at
NCBI. For identification of transposable elements, blastn (nucleotide search versus a nucleotide data base) was
performed versus the "non-human, non-mouse EST" or
versus the non-redundant GenBankTM nucleotide
data base. Blastx analysis (translated nucleotide sequence search
versus a protein sequence data base) was performed versus the GenBankTM non-redundant protein data
base. Cholinesterase sequence analysis was performed at ESTHER data base.
Genomic Mapping--
The polymorphism found in the fourth intron
(see "Results") in genomic clones was used to search for
segregation in the MOP haploid mapping cross-panel
(13). The allele-specific oligonucleotides, indicated in Fig. 1,
(Forward) 5' GAGGAAGTCATAACAGAAGTGAGAAT 3' and (Reverse) 5'
CGCAGACAAGGCATTTCCTTGATAA 3' amplified a fragment of 300 bp for
one allele or 1100 bp for the other allele. The mapping panel was
previously genotyped for over 800 PCR-based markers (13, 14). The
strain distribution patterns were analyzed using MapManager. The
sequences of zebrafish loci, including simple sequence length (14) were
compared with sequences of human and mouse genes in
GenBankTM using the blastx algorithm (12). The map
locations of human ACHE and mouse Ache genes were
found in On Line Mendelian Inheritance in Man, GeneMap 99, and Mouse
Genome Data base. Human/mouse comparative mapping was accomplished at
the NCBI HomoloGene site.
Gene Polymorphism Analysis--
For Southern blot experiments,
about 30 µg of DNA were digested with each restriction enzyme and
loaded on 0.8% agarose gels. After migration, the DNA was transferred
to nylon membranes (Hybond-N+, Amersham Pharmacia Biotech) overnight in
0.4 N NaOH, 1 M NaCl. Probes were synthesized
with [32P]dCTPs and Megaprime kit (Amersham Pharmacia
Biotech) and purified on G-50 columns (Amersham Pharmacia Biotech).
Hybridizations were done in 6× SSC, 0.25% powdered milk, 0.5% SDS,
100 µg/ml salmon sperm DNA at 65 °C with 2 × 106
dpm/ml. After a 2-min wash in 6× SSC, 0.1% SDS at room temperature and two times for 20 min in 0.2× SSC, 1% SDS at 65 °C, membranes were exposed 24 h on a phosphoactivable screen and analyzed on a
StormImager (Molecular Dynamics).
PCRs analyses were performed on genomic DNA from the two parent fish
and nine 4-day-old offspring from one cross. For a single embryo, 5 µl of genomic DNA were used in PCR at a total volume of 50 µl. 5 µl of PCR products were digested with 10 units of EcoRI
during at least 3 h at 37 °C. The entire reaction was loaded on
0.8% agarose gel.
Whole Mount in Situ Hybridization and Histochemistry on
Embryos--
Embryos were fixed in 4% paraformaldehyde in
fixation buffer (0.15 M CaCl2, 4% sucrose in
0.1 M NaPO4, pH 7.4) for 12-16 h at 4 °C,
washed twice for 5 min in PBST (1× phosphate-buffered saline, 0.1%
Tween 20), pH 7.4, and conserved in methanol at 20 °C. Before
staining, embryos were rehydrated 10 min in solutions containing 75, 50, and 25% methanol in PBST and washed 5 min in PBST. A cDNA,
covering the entire coding sequence from the start codon to the stop
codon, was obtained by high fidelity RT-PCR and cloned in the pBS-SK+
vector. Sense and reverse constructs were used to synthesize in
situ hybridization antisense and sense mRNA probes.
Fluorescein or digoxigenin-labeled RNA probes were synthesized with T7
polymerase and NTP-labeling mix (Roche Molecular Biochemicals).
Hybridization was performed according to the method described (10).
Staining was performed with 4-nitro blue tetrazolium chloride and
5-bromo-4-chloro-3-indolyl-phosphate disodium (Roche Molecular Biochemicals).
AChE activity was detected on fixed embryos (6-8 h in fixation buffer
at room temperature) with a method adapted from Karnovsky and Roots
(15). Embryos were incubated 4-5 h in 60 mM sodium acetate
buffer, pH 6.4, 5 mM sodium citrate, 4.7 mM
CuSO4, 0.5 mM
K3(Fe(CN)6), and 1.7 mM
acetylthiocholine iodide and washed extensively with PBST before observation.
Analysis of Molecular Forms--
AChE proteins were extracted
from adult zebrafish or embryos. Tissues were homogenized sequentially
in 5-10 volumes of low salt (LS), high salt (HS), low salt-Triton
(LST) buffers, or a unique extraction in high salt-Triton (HST) buffer.
LS buffer contained 20 mM Tris-HCl, pH 7.5, 5 mM EDTA, 0.1 mg/ml bacitracin, and aprotinin (7.5 × 10 3 trypsin inhibiting unit/ml, Sigma). HS
buffer was LS + 1 M NaCl. LST and HST buffers contained the
same components as LS or HS + 1% Triton X-100 (Sigma).
The AChE activity of extracts and gradient fractions was assayed
according to the spectrophotometric method of Ellman et al. (16) using acetylthiocholine iodide or butyrylthiocholine iodide (Sigma) as substrates. Protein content of samples was estimated following the manufacturer's instructions (Bio-Rad Protein Assay).
Molecular forms were analyzed on non-denaturing polyacrylamide gel.
Electrophoresis was performed in a Bio-Rad apparatus (5 × 8-cm
gels of 7.5% bisacrylamide). Gels and running buffers contained 50 mM Tris glycine, pH 8.9, with detergents 0.2% Triton X-100 and 0.2% deoxycholate. Gels were washed in distilled water and stained
with acetylthiocholine as substrate according to Karnovsky and Roots
(15). Protein extracts were incubated for 1.5 h at 37 °C in the
presence of 0.25 milliunits/phosphatidylinositol phospholipase C (Roche
Molecular Biochemicals) or 0.5 mg/ml proteinase K (Sigma) before
loading. For collagenase treatment, HS extracts were diluted six times
to a final concentration of 150 mM NaCl, 10 mM
CaCl2, and 50 mM Tris-HCl buffer, pH 8.0. Collagenase (Clostridiopeptidase A, Worthington) was added to a final
concentration of 125 µg/ml and incubated at 30 °C. The reaction
was stopped by addition of NaCl to 0.5 M final and stored
on ice prior to centrifugation on sucrose gradient.
Sedimentation analysis was performed in 11 ml of 5-20% sucrose
gradients in LS, HS, LST, or HST buffers. Samples (250 µl) were
loaded and centrifuged for 18 h at 40,000 rpm (200,000 × g) at 4 °C in a SW41 rotor. Forty fractions were
collected from the bottom of each gradient and assayed for AChE
activity at pH 7. Alkaline phosphatase from calf intestine (Roche
Molecular Biochemicals) (s20,ww = 6.1) and
-galactosidase from Escherichia coli (Roche Molecular
Biochemicals) (s20,ww = 16)
were used as internal markers of migration.
Expression of Recombinant AChE in Drosophila S2 Cells and in
Zebrafish Embryos--
A mini-gene containing the entire coding
sequence of AChE was assembled from three genomic fragments and cloned
in the expression vector pMT/V5-His (Invitrogen). The gene extends from
117 bases upstream of exon 2 (183 upstream of start codon) to the stop
codon. The final construct was totally sequenced before transfection in
Drosophila S2 cells. This mini-gene was also introduced in pcDNA3 vector for in vivo overexpression in zebrafish embryos.
Transfection of 50 µg of plasmid and expression in
Drosophila S2 cells (3 × 106 cells/ml) was
performed with the Drosophila Expression System (Invitrogen). After induction of expression with copper, no serum was
added to the cell growth medium. AChE was recovered from the cell medium.
Microinjections into 1-2-cell stage embryos were performed with 200 ng/µl AChE-pcDNA3 plasmid in 0.5 M KCl, 2.5%
rhodamine-B isothiocyanate dextran (Sigma). About 500 pl of solution
were injected into each embryo using a Transjector 5246 (Eppendorf).
Determination of Kinetic Parameters--
In kinetic experiments
we used recombinant AChE secreted in growth medium or native AChE from
whole zebrafish extracts. Activity was assayed in Ellman reaction
buffer (16) containing 100 mM sodium phosphate, pH 7.4, 0.5 mM 5,5'-dithiobis(2-nitrobenzoic acid), 0.01% bovine serum
albumin. AChE extracts were incubated for 15 min with buffer reaction
before addition of various concentrations of acetylthiocholine iodide
at 25 °C. The reaction was monitored in a spectrophotometer at 412 nm. Km and Kss values were
determined according to the Haldan equation with 0.01-100 mM acetylthiocholine. Apparent first order rate constant,
kcat, was calculated as described previously
(17). The constants of inhibition, Ki and
Ki, were determined for several
inhibitors with acetylthiocholine from 0.06 to 0.7 mM. Each
experiment was repeated 3-5 times using 5 concentrations of ASCh and
4-5 concentrations of inhibitor. Results were identical for
recombinant or native AChE, with a standard error less than 10%.
 |
RESULTS |
A Single Acetylcholinesterase in Zebrafish--
Cholinesterase
activity was first detected, in whole embryos, using a histochemical
reaction adapted from Karnovsky and Roots (15). In 24-h embryos, strong
activity appeared with acetylthiocholine (ASCh) within a few hours of
staining, whereas there was no staining with butyrylthiocholine (BSCh).
Eserine (10 5 M) inhibited all
ASCh hydrolysis and staining of embryos.
Cholinesterase activity was also measured in protein extracts. The
level of BSCh hydrolysis in 24-, 48-, and 72-h embryo extracts was less
than 1% of the rate of ASCh hydrolysis. This value is similar to the
ratio determined for AChE of lamprey and hagfish, which have only an
AChE (18). A low
VmaxBSCh/VmaxASCh ratio is consistent with the properties of AChE (19). We also analyzed cholinesterase activity in adult in total extracts and in brain and
heart extracts. In all tissues there was no residual ASCh or BSCh
hydrolysis activity when a specific inhibitor of AChE, BW284c51, was
used at 10 6 M. We conclude that a
single AChE was responsible for ASCh and BSCh hydrolysis in zebrafish.
Cholinesterase activity in zebrafish heart is sensitive to BW284c51,
contrary to the cholinesterase activity found in the heart of
Torpedo, mainly originating from BChE (20). In addition, an
excess of the substrate ASCh inhibits activity of the enzyme, showing a
specific property of AChEs versus BChEs.
We failed to detect bche gene by RT-PCR with degenerated
oligonucleotides specific for BChEs. We did find, however, the
3'-coding region of an esterase (GenBankTM accession number
AF003943) 67% homologous to carboxyl ester lipase from Salmo
salar (GenBankTM accession number L23929). This
indicates that we used conditions that were relaxed enough to allow us
to detect hybridization of oligonucleotides to a putative zebrafish
bche gene if it had been present.
Sequence and Structure of AChE Gene and cDNA--
By using
primers P1 and P2, we first isolated a cDNA fragment that was used
to screen a genomic library. We isolated three independent genomic
clones (see "Experimental Procedures"). They overlap as shown in
Fig. 1. The total sequence covered 12 kb
of genomic sequence including 3.3 kb of 5' potential promoter region. The ache gene contains 5 exons; the first is non-coding and
is followed by a large intron of 5 kb. Compared with other vertebrate ache gene sequences, the zebrafish ache gene
contains an insertion interrupting the large exon 2. This 226-nt
insertion encodes 30 amino acids (Fig. 2)
followed by a small intron of 136 bp (Fig. 1). The inserted amino acids
were located on the protein surface as determined by three-dimensional
modeling (21). The last exon is a T exon. We fully sequenced all
intronic sequences upstream of the T exon where the H exon is located
in other vertebrate ache genes. We did not find any sequence
in genomic DNA that could correspond to a hydrophobic H exon. The start
of transcription, a cytosine, was found 303 bp upstream from the Met
initiation codon. A canonical TATA box is found 28 bp upstream of the
transcription start site. Coding sequence covers 1905 bp, and at the 3'
end, a poly(A) site identified with 3'-rapid amplification of cDNA ends defined a non-coding sequence of 340 bp. An additional downstream poly(A) site may be also used as PCR performed with an oligonucleotide located after the first poly(A) signal also amplified AChE cDNA. The total length of sequenced cDNA is 2548 bp, and a unique
mRNA was detected on Northern blots (data not shown). We never
found 3' alternative splicing or readthrough cDNA as seen in some
vertebrate AChEs (Massoulié et al. (9)). Only T exon
is present. No cryptic alternative splicing could be found similar to
what was described for Electrophorus electricus AChE
(21).

View larger version (7K):
[in this window]
[in a new window]
|
Fig. 1.
Structure of zebrafish ache
gene and genomic clones. The scheme represents 12 kb of sequenced genomic DNA containing the zebrafish ache
gene. The five ache exons are shown as open
boxes, and the extra-coding region specific of teleosts is
hatched. ATG and TAG point out initiation and stop codons.
H and E indicate positions of polymorphic
HindIII and EcoRI restriction sites (see also
Fig. 4). Three isolated genomic clones (14, 14N, and 8N) are shown
below the deduced gene structure of AB strain. Shaded
boxes I, II, and III indicate repeated and transposable
elements that are further described in Fig. 3. Insertions found in
clone 14N are indicated. Arrowheads on both sides of clone
14N 3' insertion indicate location of primers used for gene mapping.
Probes used during this work are represented as thick lines
above the gene structure.
|
|

View larger version (70K):
[in this window]
[in a new window]
|
Fig. 2.
Alignment of fish AChE peptide
sequences. Common features of AChEs are indicated above
the zebrafish sequence (Danio). Numbering is indicated
according to Torpedo mature sequence. First residue of
mature protein is marked by a vertical arrow. Closed circles
indicate catalytic triad (Ser-200, Glu-327, and His-440), and
closed triangles indicate the 14 aromatic residues lining
the active site gorge. They include choline-binding site (Trp-84) and
acyl pocket residues (Phe-288 and Phe-290) drawn as open
triangles. 6 cysteines forming disulfide bridges are
boxed. Glycosylation sites conserved in Danio,
Electrophorus, and Torpedo are boxed.
Extra-peptidic sequence, specific of teleost fish, is represented in a
shaded box. Asterisks below the
alignment indicate identical residues in all three sequences, and
semicolon and dots show higher or lower
similarity, respectively. Note the strong conservation of C-terminal
sequences encoded by T exons (thick line).
|
|
The 634-amino acid sequence of zebrafish AChE is 62% identical to
mammalian AChE, 64% identical to Torpedo, and 80%
identical to Electrophorus. We found at conserved positions
all the elements specific of AChEs, detailed in Fig. 2. The protein
contains 6 potential N-glycosylation sites, all identical in
position to glycosylation sites in a ray-finned fish, the electric eel
Electrophorus, but only two of them were conserved in the
AChE of a cartilagenous fish, the electric ray Torpedo.
Transposable Elements in the Ache Gene--
In the non-coding
region of the zebrafish ache gene (Fig. 1 and
3), we identified three domains
presenting high similarity to some otherwise unrelated fish genes and
ESTs.

View larger version (12K):
[in this window]
[in a new window]
|
Fig. 3.
Description of transposable and repeated
elements interspersed in the zebrafish ache gene.
Domains are numbered as in Fig. 1. Below each
shaded box, representing the whole domain, lines
indicate regions homologous with zebrafish EST, nucleotide, and protein
data bases, respectively (details under "Experimental Procedures").
Values at right of each line indicate number of hits in
blast analysis (E value < 2·10 4) and no
indicates no homologue. Pairs of arrowheads in
the 4th line show localization of repeated elements.
Transposon specific features are indicated in last line. In
domain I, letters indicate identified domains of tranposase,
nuclear localization signal (N) and G-rich domain
(G). The three boxes defined by Plasterk et
al. (22), corresponding to catalytic domains of Tc1 transposase,
are also indicated (D and E). D'
corresponds to the second mutated D box. For domain II
arrowheads show the repeated elements of angel
transposable element separated by a conserved motif (GGAAAAACAAA marked
by a line). No homology with transposable element has been
identified in domain III.
|
|
Domain I, located upstream from non-coding exon 1, is 1162 bp long. It
is flanked by two inverted repeats of 35 nt showing 80% of identity
(see Fig. 8, in "Discussion"). Blastx analysis with the protein
data base showed that almost all the sequence inside the inverted
repeats was highly homologous to the Tc1-like transposase
family. A translated sequence of transposase could be assembled by
removing frameshifts and stop codons. We identified 3 boxes
corresponding to the catalytic domain (for a review see Ref. 22). The
second D box is shortened compared with the canonical sequence, and
therein aspartic acid is changed to an asparagine. We also identified a
G-rich region as well as the nuclear localization signal. The DNA
binding domain is difficult to recognize in this sequence as such
domains in transposases are structural elements with low sequence
conservation (22). Blast analysis showed that more than 50 zebrafish
ESTs showed homology with the transposase region. This is also the case
of 7 non-coding regions of cloned genes from fish (4 from zebrafish and
one from either medaka fish Oryzia latipes, tilapia
Haplochromis burtoni or pufferfish Fugu rubripes). A 443-bp internal segment of this domain I is deleted in the AB line and in one of the isolated genomic clones (Fig. 1).
Domain II (822 bp) is located inside intron 1. As in the case of the
first domain, it is flanked by two inverted repeats (58 nt with 57% of
identity). Domain II has no homology with coding sequences when
compared with protein data base. It includes two sub-domains (Fig. 3).
A first sub-domain shows a large number of blast homology hits with
ESTs (>100), with non-coding region of 11 zebrafish genes, and
contains several large direct repeats. A second sub-domain is
characterized by two large inverted repeats separated by an A-rich
domain. This second sub-domain is homologous to
Danio-specific transposable element called angel
(23). We identified only one of the T2 domains that form short inverted repeats at both ends of angel elements (23).
Domain III is located in intron 4 and was only found in genomic clone
14N (Fig. 1). A 16-nucleotide sequence (AGCCCCTTTCACACAG) is found in
inverted orientation at both ends of the insertion. The central 0.5-kb
domain was flanked by direct long repeats of about 60 bp. As for
domains I and II, this sequence shows homology with a large number of
zebrafish ESTs (Fig. 3).
Evidence for Polymorphism in Ache Gene--
A commercial genomic
library made with DNA from several adults was screened. Three
independent clones were isolated. They differed from one other by two
large insertions and multiple point mutations (Fig. 1).
The whole domain III, previously described in intron 4, was only found
in the clone 14N. This insertional polymorphism was used to map
ache on zebrafish genetic map (see below). In addition, a
443-bp segment located inside domain I is deleted in fish from our
stock, in AB strain, and in one genomic clone.
Southern analysis of genomic DNA was first performed on fish from our
stock using probes 1 and 2 (see Fig. 1). Fifteen restriction enzymes
were used, and some results are presented on Fig.
4A. For most restriction
enzymes, or combinations, the size of the bands matched the expected
size deduced from the gene restriction map, but an extra high molecular
weight band was detected when EcoRI or HindIII
were used. Sizes of these second bands correspond to a genomic sequence
in which one HindIII and one EcoRI site, previously located in intron 1 and 2, are missing (Fig. 1). The same
experiment performed on AB and ABO fish showed that AB was polymorphic,
whereas ABO genomic DNA had only the short HindIII and
EcoRI fragments.

View larger version (66K):
[in this window]
[in a new window]
|
Fig. 4.
Restriction fragment polymorphism reveals two
ache alleles in the AB strain. A,
genomic DNA was digested with enzymes indicated above each
lane (E, EcoRI; H, HindIII;
X, XbaI) and Southern blot was hybridized with
probe 2 (see Fig. 1). Two bands visible in EcoRI and
HindIII lanes revealed the existence of polymorphic sites.
B, the genotype of AB fish was checked using PCRs, with
primers surrounding EcoRI allelic site, on genomic DNA from
one adult couple and 9 F1 progeny. The amplified 975-bp fragment was
then digested with EcoRI. Parents are homozygotes for
resistant (a unique 975-bp band in female) or sensitive (two bands of
160 and 815 bp in male) forms. All F1 progeny are heterozygotes as
shown by the presence of the restriction bands and undigested
fragment.
|
|
To ensure that the extra bands were due to allelic polymorphism rather
than the presence of a gene duplicate, we analyzed genetic transmission
of the two forms. We performed PCRs on genomic DNA with primers
surrounding the alternative EcoRI site, on adult breeding
pairs, and their progeny. Amplified fragments were digested with
EcoRI to determine the genotype of each fish. When one
parent was homozygous for one variant and the other parent was
homozygous for the alternative variant (Fig. 4B), all F1
progeny were heterozygotes and presented bands both resistant and
sensitive to EcoRI digestion. We also observed mendelian
transmission of this variation of restriction site by crossing one
homozygote and one heterozygote (not shown). By using the restriction
polymorphism, we have cloned and sequenced the
HindIII-EcoRI-resistant allele from the end of
intron 1 to the 3'-untranslated regions. Most of the 20 nucleotide
variations found in the whole gene are located in introns, and the four
polymorphisms occurring in the coding sequence are silent. Sequences
confirmed that the HindIII site and the EcoRI
site located in introns 1 and 2, respectively, are lost. Mendelian
transmission of the restriction polymorphism and conservation of the
coding sequence of the two forms allowed us to conclude that these
differences correspond to two different alleles of a unique
ache gene.
Mapping of Ache on the Zebrafish Genetic Map--
We took
advantage of the length of polymorphism in the fourth intron to locate
the ache gene with the specific allele amplification method
and segregation on the MOP cross-haploid mapping panel (13). According
to usual nomenclature, symbols used are ache for
zebrafish, ACHE for human, and Ache for murine genes.
On the MOP panel, ache mapped to LG07 between z4706 and
z3445 (Table I). Intercalation between
these markers places ache at about LG07_39.5 on the MGH
sex-averaged diploid map (14). As shown in Table I, a few centimorgans
away on LG07 reside shh and eng2, co-localizing
with z1059 at LG07_52.3 on the MGH map. In human, ACHE is
located at Hsa7q22, and SHH and EN2, the
orthologues of shh and eng2 (24, 25), reside in
Hsa7q36. The mouse orthologues of these three loci are also syntenic,
located on chromosome 5 (Ache, Mmu5_80.0; Shh,
Mmu5_12.0; En2, Mmu5_15.0). Interspersed between
ache and shh in zebrafish is islet3,
whose human orthologue is uncertain, and cyclin E, whose
human orthologue is located at Hsa19q12-q13. These results suggest that
ache belongs to a conserved chromosome segment that
originally included ache, shh, and
eng2 in the last common ancestor of zebrafish, human, and mouse.
View this table:
[in this window]
[in a new window]
|
Table I
ache single gene mapped on linkage group 7
The polymorphism found in the fourth intron in genomic clones and
allele-specific oligonucleotides (see Fig. 1) was used to search for
segregation in the MOP haploid mapping cross-panel (see "Experimental
Procedures"). ache was mapped on distal LG7, between
previously mapped genes fkd5 and islet 3. ache is located about 1.6 cM from each. Mat, number with
maternal genotype; Pat, number with paternal genotype; X, number of
recombinants; N, total number of segregants scored for the two adjacent
loci; Map, distance between two adjacent loci in centimorgans (cM);
95% = 95% confidence interval for map distance between adjacent
markers; LOD, logarithm of the odds score for linkage of adjacent
markers.
|
|
Pattern of Expression of AChE mRNA and Protein in
Embryos--
In situ hybridization with labeled
antisense mRNAs was performed at several developmental stages. In
all cases, overnight or longer incubations are required to detect
staining of AChE mRNAs in embryos. Controls performed with sense
RNA probe showed only staining of notochord (not shown).
ache mRNA was first detected in the trunk, in discrete
regions of paraxial mesodermal segmental plate at 12 h of
development (6-somite stage). At this stage there was usually no signal
in the two or three most recently formed somites. In contrast, in older
embryos a weak diffused staining was always found, even in unsegmented
presomitic mesoderm (Fig. 5A).
Expression, probably located in myoblasts, proceeds in a rostro-caudal
sequence according to the state of differentiation of the somites.
Initial narrow staining progressively enlarged in the differentiating
somite. At all stages, the ventral part of anterior somites showed more intense staining than the dorsal part (Fig. 5A). This could
be due to a higher rate of development of ventral myotome as accurately described in mouse embryos (26). In the spinal cord, mRNAs are also
present in primary motoneurons as seen in Fig. 5B, in a 24-h embryo.

View larger version (95K):
[in this window]
[in a new window]
|
Fig. 5.
Pattern of AChE transcripts expression in
24-h embryos. In situ hybridizations were performed
with an antisense mRNA probe covering AChE cDNA. 24-h embryos
are oriented in lateral view with anterior to the left and
dorsal to the top. A, in the trunk narrow
staining in caudal somites progressively enlarges. Expression is
stronger in the ventral part of the somite compared with the dorsal
part. B, a shorter incubation allows visualization of AChE
mRNAs in cell bodies of primary motoneurons (mn) in the
spinal cord. Triangles indicate borders of somites.
B corresponds to bracket in A.
|
|
In the brain, mRNAs first appear in a symmetrical cluster at
presumptive midbrain-hindbrain boundary from the 10-somite stage (14 h)
(not shown). Two hours later, additional stainings are detected in
three large bilateral clusters, in anterior telencephalon, on the floor
of the diencephalon and of the mesencephalon. At 24 h, these
clusters co-locate with the axonal tract of the anterior commissure,
the postoptic commissure, and the ventral longitudinal tract (6, 7,
27). We can also detect messengers in hindbrain, in ventrolateral
clusters at regularly repeated intervals (not shown). Small groups of
cells, segmentally reiterated, expand in longitudinal columns. This
corresponds to the location of differentiating reticulospinal neurons
in the seven hindbrain rhombomeres as previously shown with
zn1-antibody staining (4).
The method of Karnovsky and Roots (15) was used to detect AChE activity
in whole embryos, in order to complete the pattern of expression
described for neuronal (5, 6) and brain (7) differentiation in
zebrafish and also to correlate this pattern with the mRNA expression.
In the trunk the spatio-temporal expression of AChE protein matches
mRNA expression in peripheral nervous system and in muscles, along
differentiation of myoblasts. AChE activity is first detected in small
clusters of cells on both sides near the spinal cord (Fig.
6A). No activity is detectable
before 5-7 somites, at this stage staining appears in few cells in
each segment. This staining should correspond to muscle precursors
because it is found in myoblasts than in myofibers (8). The enzyme
activity appears more intense in somites following a rostro-caudal
sequence in a pattern similar to mRNA, and all somites show
activity (Fig. 6, B and E). Shortly after 18 h, myocommata, the borders between somites, start to express AChE (see
also at 24 h, Fig. 6E). This coincides with clustering
of acetylcholine receptors at neuromuscular junctions (28) and the
first spontaneous twitches of embryos. In addition, in the peripheral
nervous system, AChE protein initially appears in presumptive cell
bodies of primary sensory and motoneurons from 14 h (9-10-somite
stage). By 24 h (Fig. 6E), AChE is found in the spinal
cord in motoneurons, located in each hemisegment, in sensory neurons
(Rohon-Beard cells), and in reticulospinal interneurons. As a general
feature, AChE activity is strongly detected in cell bodies of neurons
but only slightly in axons.

View larger version (132K):
[in this window]
[in a new window]
|
Fig. 6.
Detection of AChE activity in whole
embryos. Embryos are oriented in lateral view with anterior to the
left and dorsal to the top, except for
A and D which are dorsal views. A,
appearance of AChE activity in a 5-7-somite embryo, seen in dorsal
view, anterior to the top; on both sides of the spinal cord large cells
are stained in all somites. B, 19-somite embryo; staining is
strongly detected in somites and in Rohon-Beard cells (rb).
In the brain, trigeminal ganglia (tg) were already stained,
and three new clusters of few cells appear in the anterior part
(drc, vrc, vcc). Small clusters are found in the hindbrain,
indicated by arrowheads. C-E, details of 24-h
embryo. In the head (C) rhombomeres are labeled in the
hindbrain (hb). The three clusters drc, vrc, and
vcc are found enlarged in the telencephalon, diencephalon,
and mesencephalon. Epiphysis (ep) and posterior commissure
(pc) stainings are now visible. In dorsal view of the head
(D), labeling is clearly seen in anterior (arrow)
and posterior (arrowheads) lateral line ganglia. Strong
activity is also found in the heart (h). In the bud tail
(E), AChE activity appears in myocommata (mc)
between somites, at junction of myofibers (my). In each
somite, heavily stained cells correspond to primary motoneurons
(mn). Dorsally, numerous Rohon-Beard cells are also detected
(rb). vrc, ventro-rostral cluster;
vcc, ventro-caudal cluster; drc, dorso-rostral
cluster.
|
|
In the posterior brain activity appeared after 14 h. A
bilateral large cluster, just anterior to hindbrain rudiment, indicates position of forming trigeminal ganglia. In the embryo at 16 h, three new symmetrically bilateral clusters are present as follows: dorso-rostral, ventro-rostral, and ventrocaudal clusters are shown on
Fig. 6B. Shortly after new clusters appear in the anlage of the epiphysis, in the posterior commissure, and in differentiating rhombomeres of hindbrain. At 24 h (Fig. 6C) AChE is
detected in all primary neurons in the brain (see also Ref. 5).
Expression in cranial ganglia can be detected in whole embryo until
about 36 h. We found additional stainings, yet undescribed, in a
sensory system in anterior and posterior lateral line ganglia as seen in the embryo at 24 h (Fig. 6D). In addition the heart
shows strong AChE activity from its early morphogenesis.
Identification and Localization of Molecular Forms of
AChE--
AChE protein in vertebrates exists in numerous molecular
forms that can be identified by their sedimentation and hydrophobic properties after centrifugation on sucrose gradients with or without non-denaturing detergent.
We first followed the evolution of different molecular forms
repartition during zebrafish embryonic development (Fig.
7A). Until 48 h of
development, in an HST protein extract, AChE sediments as soluble
globular G4 (12 S) and a minor G2 form (6 S). The asymmetric form A12
(17.5 S) that contains a collagenic subunit appears after 48 h
and becomes prominent after the 1st week of development.

View larger version (32K):
[in this window]
[in a new window]
|
Fig. 7.
Evolution of AChE sedimentation of molecular
forms during development and in adult tissues. Comparison with
molecular forms produced in vitro is shown.
Extraction and sedimentation conditions are indicated in each panel
(for example HS/HST indicates extraction in HS buffer and
sedimentation in HST buffer). Buffers are described under
"Experimental Procedures." Graphics represent AChE activity,
measured in each fraction of gradient, as a function of sedimentation
coefficient (S). A, protein extractions were
performed in HST buffer in 48-h ( ) and 96-h ( ) embryos and 1-week
larvae ( ). At 48 h, the large peak of sedimentation
indicates globular forms, G4 (12 S). Later, the peak at 17.5 S
corresponds to appearance of the asymmetric forms A12 which will become
prominent in adult (see C). B, analysis of
molecular forms was performed in total adult with three sequential
extractions in LS, HS, and LST (1, 2, and 3). In each panel presence
( ) or absence of 1% Triton X-100 ( ) in gradient is indicated.
The shift of the G2 form in B1 and B3 indicates it is amphiphilic.
Asymmetric forms A12 and A8 are only extracted with HS buffer.
Inset in B2 shows the effect of collagenase
treatment of HS extract during 15 ( ) or 30 min ( ) compared with
untreated enzyme ( ). Arrowheads indicate the undigested
form (black); heavier (open) and lighter
(shaded) forms confirm the 17.5 S form is a collagen-tailed
asymmetric form. C, molecular forms in adult. Extraction
with HST buffer shows that A12 and A8 are prominent in total adult
extract ( ) as well as in muscles ( ) with lower amounts of
globular forms (G4 and G2). On the contrary, in the heart ( ), most
forms are globular (G4 and G2), and A12 are also present. D,
recombinant molecular forms produced after injections of
ache mini-gene in zebrafish embryos ( ) or after
transfection in Drosophila S2 cells ( ) were analyzed in
LST extracts. In S2 cells there is no activity in controls ( ), and
AChE is overexpressed as G2 form. In 36-h injected embryos two
peaks of identical height correspond to overexpressed G4 and G2.
In control embryos ( ), at the same developmental stage, tetramers G4
are the major form.
|
|
In total extracts of adults (Fig. 7B), sequential
extractions of proteins in LS, HS, and LST showed that asymmetric A12
and A8 (14.5 S), the major forms of HS extract (Fig. 7B2),
were extremely predominant as 70% of total activity was found in HS extracts.
To ensure these 17.5 S forms correspond to collagen-tailed asymmetric
forms, we performed collagenase digestion of HS extract (inset in Fig. 7B2). After treatment, two forms
appear. In the heavier (19.5 S), the C-terminal domain of collagen
tail which slows migration of A12 forms is removed and migration
accelerated. In the lighter (15.5 S) digestion probably removes most
of the collagen domain. We also observed appearance of tetramers (not shown). We conclude that 17.5 S corresponds to true A12 asymmetric forms. Tetramers and dimers extracted with LS or LST were found in
similar amounts (Fig. 7, B1 and B3). The
sedimentation coefficient of dimers was reduced in the presence of
non-denaturing detergent indicating their amphiphilic nature (Fig. 7,
B1 and B3). In addition, G2 forms were
insensitive to phosphatidylinositol phospholipase C treatment, but
their migration was slightly modified on non-denaturing electrophoresis
when proteinase K was used (not shown). We conclude that these dimers
have no glycolipid anchors and are type II amphiphilic dimers made of T
subunits (9).
In isolated tissues of the adult (Fig. 7C), we found
asymmetric forms prominent in muscles and a few G4 and G2. In contrast, amphiphilic tetramers, which aggregate in absence of detergent, were
the major form in the brain (not shown). In the heart, we found G2 and
G4 and also some A12 in HST extracts (Fig. 7C). We never
identified glycolipid-anchored dimers. This is in agreement with the
absence of H exon in cDNA and confirm what is observed in the other
teleost, E. electricus (21).
In Vitro and in Vivo Expression of AChE, Catalytic
Properties--
Activity and molecular forms of expression of a
recombinant AChE were checked in vitro and in
vivo. Enzymatic assays indicated that AChE was produced in
transfected Drosophila S2 cells and highly secreted into the
growth medium. At 36 h, zebrafish embryos injected with the AChE
mini-gene construct under control of cytomegalovirus promoter expressed
recombinant AChE in all tissues as detected by in situ
hybridization and activity staining in whole embryos (not shown). Four
independent injection experiments were performed, and for each, two
batches of 10-15 embryos were assayed for AChE activity in whole
protein extracts. Depending on injections, AChE was overexpressed
5-25-fold compared with control embryos. This result was consistent
with a variable amount of mRNAs injected in overexpression
experiments and observed by in situ hybridization.
Fig. 7D shows that overexpressed AChE in embryos was
composed of dimers and tetramers in similar amounts, whereas in
non-injected embryos, prominent G4 and few G2 forms were detected.
Recombinant AChE in S2 cell extracts was only found as G2 forms (Fig.
7D). These results suggest a regulation of tetramers
assembly, different in Drosophila cells and in embryos.
The AChE of zebrafish has all residues characteristic of AChEs (Fig.
2). Kinetics parameters of AChE from zebrafish extracts or recombinant
enzyme are close to values measured for ASCh with other vertebrates
AChE, Km = 230 µM and
Kss = 20 mM. Zebrafish AChE
kcat (1300/s) is lower than mammalian AChE
kcat (about 3000/s) and 10 times lower than the
E. electricus kcat despite the very high
sequence homology between these two enzymes. Zebrafish enzyme is not
sensitive to specific BChE inhibitor tetraisopropylphosphoramide. On the contrary, high inhibition is
observed in the presence of active site inhibitors, serine (Ki = 14.4 µM) and edrophonium
(Ki = 0.53 µM), or bis-quaternary
inhibitor BW284c51 (Ki = 66 nM).
Ki for propidium (16 µM), a peripheral
site inhibitor, is 5-10-fold higher than Ki for
mammalian or Torpedo AChEs. This could be due to the change
of tyrosine 70 in phenylalanine since this residue is part of the
propidium-binding site, located at the periphery of AChE.
 |
DISCUSSION |
AChE Is Encoded by a Unique Gene--
The insertional polymorphism
observed in intron 4 (see Fig. 1) allowed us to locate ache
gene on zebrafish genome by segregation on MOP cross-haploid mapping
panel (13). A unique ache gene was mapped in linkage group 7 within a few centimorgans of shh and eng2 loci
(Table I). The synteny observed for these genes in zebrafish, human,
and mouse could indicate relative organization of the genes in the
common ancestor of teleosts and mammals living approximately 450 million years ago according to molecular time scale (29).
Many genes have been duplicated during evolution in zebrafish lineage
(13, 30, 31). For example, zebrafish has two copies of the
EN2 and SHH genes of human, and they are called
eng2a and eng2b (formerly called eng3
(25)) and shh and twhh (32), respectively. The
eng2a and shh loci are closely linked on LG7, and
the eng2b and twhh loci are syntenic on LG19
(13). These are duplications of a portion of Hsa7q as shown by genetic
mapping and phylogenetic analysis of HOX clusters (30). We hypothesize
that subsequent to the divergence of the human and fish lineages, a
chromosome inversion event in the zebrafish lineage rearranged this
chromosome segment and separated ache from shh
and eng2. ache and Shh/En2 are also separated by
apparent translocations and inversions on mouse chromosome 5: pieces
orthologous to human chromosomes 4, 1, 12, and 22 intervene between
them. In teleost lineage, the segment of chromosome containing
ache was probably duplicated, and then the duplicate
ache was lost in zebrafish. Loss of one or more copies of
duplicated genes occurred frequently during evolution as also
demonstrated by phylogenetic analysis in neurotrophin and Trk receptor
families (33).
Zebrafish Have No BChE--
In protein extracts of 24 and 48-h and
3-day embryos, or whole adult or heart, BSCh hydrolysis was always less
than 1% of ASCh activity. Catalytic parameters measured in the
presence of specific inhibitors of BChE
(tetraisopropylphosphoramide) or AChE (BW284c51) correspond to a
classical AChE. All attempts to identify BChE activity or BChE cDNA
failed, showing that there is no BChE in zebrafish. Several
duplications of cholinesterase genes occurred independently in
different phylogenetic lineages as follows: 4 AChE genes in
Caenorhabditis elegans (34) and 2 genes in
Amphioxus (18). The duplication of an ancestral gene, giving
rise to AChE and BChE, probably occurred before the split of
cartilagenous fish, but after divergence of jawless fish lineage as
BChE is found in Torpedo, birds, and mammals but is absent
in hagfish and lamprey (reviewed in Ref. 18). The situation is less
clear in bony fish because a BChE or pseudocholinesterase activity is found in some perciform fish as follows: flounder, sea bass, and surgeon fish (35, 36). A BChE activity was clearly demonstrated in gymnote brain (37). With no sequence information it is impossible to
tell if they correspond to orthologues of tetrapod BChE. Our findings
suggest that bche gene has been lost in zebrafish.
The Zebrafish ache Gene Contains Several Transposable
Elements--
Analysis of the non-coding region of the ache
gene revealed several domains containing repeats and showing homology
with transposable elements (Fig. 3).
Upstream of ache, we identified an inactive transposon of
the Tc1-like family (domain I, Fig. 1). Many
mutations accumulated in transposase sequence since transposition
occurred. Despite several frameshifts and stop codons, it is still
possible to identify the original amino acid sequence. The transposase
in ache shares less than 30% identity with tes1
from hagfish (38) or other zebrafish transposases (39). This is in
agreement with the fact that transposition is thought to have taken
place 10 million years ago (22). As can be expected, no homology was
found at the nucleotide level with these sequences. However, we
identified several fish genes containing domains homologous to the
ache transposon-like (80-95% identity in nucleotides). For
three of these genes, the homologous domain has a different size, but
the same inverted repeat flanks the central part (Fig.
8). This suggests that AChE transposon is
member of a new Tc1-like transposon family in zebrafish.

View larger version (26K):
[in this window]
[in a new window]
|
Fig. 8.
Repeated element flanking AChE domain I is
compared with transposable elements of other fish genes. Pairs of
inverted repeats identified at the 5' end of zebrafish genes
ache (ache), odorant cluster (odor,
GenBankTM accession number AF112374), and spermine synthase
(spsy, GenBankTM accession number DRAJ9633) and
O. latipes gene guanylyl cyclase (oryz,
GenBankTM accession number AB016081) are aligned.
s and as indicate sense and antisense repeats.
Last line shows 75% consensus. Position of repeated
elements in each sequence are indicated.
|
|
Domains II and III are made of a different set of repeats, associated
in domain II with angel transposable elements. This could
indicate that insertion occurred by combining different repeated
sequences. In Danio a retroelement inserted in the intron of
the elf-4E gene is also composed by association of a
DANA-transposable element with other repetitive sequences (40).
Since large numbers of ESTs present high similarity (>80%) with all
three domains, it appears that repeated and transposable elements are
very frequent in the zebrafish genome.
Repeated elements are also found in other cholinesterase genes. Two
tandem repeats have been described in the non-coding region of the two
alternative last exons of Torpedo californica
ache gene (41). Two Alu sequences probably integrated by
retrotransposition in human BChE gene have also been
described: one in the promoter region (42) and the other one occurred
in exon 2 leading to gene inactivation and a silent phenotype in a
Japanese family (43). A short interspersed element was also found in
the rabbit BChE intron 2 (44). Numerous repeats of Alu sequences are
found upstream of human ACHE gene as well as in introns. All
these retroposons are short interspersed repetitive elements that do
not encode reverse transcriptase. The zebrafish ache gene is
the first cholinesterase gene showing trace of ancient active transposition.
Intron Capture Occurred in Teleost Ache Genes Introducing Extra
Coding Sequence--
The zebrafish gene contains 5 exons and the first
one is non-coding. No alternative splicing was found in 5' or in 3'
ends contrary to what is found in the mammalian and Torpedo
gene (reviewed in Ref. 9). Sequence alignment with the
Torpedo gene showed a similar organization of exon-intron
junctions in Danio with the exception of an insertion that
splits the large coding exon 2 into two parts. This additional sequence
(Fig. 2), also found in Electrophorus ache gene
(21), introduces 30 residues in the protein and a small intron. The
inserted peptide domain is a glycine-rich hydrophilic peptide similar
in zebrafish and gymnote (94% of homology). Such coding insertions are
not uncommon in AChE since some are also found in chick,
Drosophila, and nematodes AChEs (9). Removal of insertions
by genetic deletion in gymnote (21) does not modify catalytic
properties or oligomerization of the enzyme. This is in agreement with
the three-dimensional structure which shows that insertions are located
at periphery of the protein, in loops between strands or helices, far
away from the active site. In both teleosts, insertion takes place at
the same position in ache exon 2 at position 415; in
Danio it is located between consensus 5'-TG/GT-3'
nucleotides usually found at exon junctions. This suggests that the
insertion may be the result of an intron capture as recently described
in zebrafish apolipoprotein E gene (45). When compared with the
Torpedo ache gene, an insertion also occurred in
exon 2 at position 318 in tetrapod ache genes. In mammals, it corresponds to an additional intron introduced at 5'-AG/GT-3' site.
In chick AChE, the additional sequence introduced at 5'-TG/GA-3' is not
spliced and encodes a large hydrophilic domain. The intron capture
mechanism may also have been responsible of these insertions. It is
likely that in teleost lineage, after the divergence of tetrapods and
teleost ancestors, a single insertion event of in frame intronic
sequence insertion occurred and allowed addition of coding sequence and intron.
Assembly of Different Forms of AChE Is Regulated by Structural
Proteins--
In vertebrate AChEs the C terminus is encoded by
alternatively spliced exons, T, H, or S exons. In insects only H
cDNAs are found. In nematodes T exon is present in
ace-1, whereas H exons are present in the three other
ache genes (9). The absence of H exon appears to be frequent
since it is lacking in Electrophorus (21), chick (46), or
snake genes (47). In zebrafish AChE cDNA and gene, we identified
only one kind of 3' exon encoding peptide T. The T peptide is
characterized by the succession of regularly spaced aromatic residues
(see Fig. 2). In vertebrate AChEs it is responsible for the association
with the proline-rich attachment domain of structural collagenic
subunit and formation of homotetramers (48).
Repartition of molecular forms in adult, shown in Fig. 7, B
and C, is consistent with what is observed in other
vertebrates, asymmetric forms being major forms in muscle and
amphiphilic tetramers the major form in brain.
As shown by sedimentation analyses, globular forms present at early
developmental stages and asymmetric forms appearing later are both
composed of T subunits (Fig. 7). Mechanisms driving molecular oligomerization of forms depend mainly on non-catalytic subunits. This
has been shown by mRNA injections in Xenopus oocytes.
Assembly of asymmetric forms is strictly correlated to collagenic tail amount (49). It is very likely that the same mechanism occurs in
vivo. In zebrafish RT-PCRs performed on RNAs during embryonic development indicate that the cDNA encoding the collagenic tail appears around 48 h,2
shortly before the appearance of asymmetric forms (Fig.
7A).
AChE produced by S2 cells transfected with the AChE mini-gene are
dimers, whereas the injection of the same construct in embryos resulted
in overexpression of equal amounts of tetramers and dimers (Fig.
7D). Molecular forms in control embryos and in
AChE-overexpressing embryos differ widely. In the latter, dimers and
tetramers are present in equal amounts, whereas in non-injected embryos
we found only tetramers. It has been shown that oligomerization of
tetramers could depend on proline-rich factors (9). We suggest that in the case of AChE overexpression the "assembler proline-rich
protein" may be present in too low a concentration to assemble all
AChE dimers in tetramers, and then excess dimers accumulated in
embryos. It is possible that such assembler elements are missing in S2 cells. It should be noted that in Drosophila,
ache gene has no T exon and tetramers never form. These
findings indicate that zebrafish could be a suitable model to study
regulation of molecular forms homo- and hetero-oligomerization.
Early Expression of mRNAs and Protein in Embryos--
Tissue
specificity and early expression of cholinesterases in mammals are due
to specific transcription factor binding sites (50), alternative
promoter usage (51), and intronic enhancers (52, 53). In the zebrafish
ache 5' non-coding region and first intron, no homology was
detected with other ache genes. We identified a canonical
TATA box that contrasts with other cholinesterase genes that are devoid
of this regulating element. However, a TATA box has been identified in
the recently described murine AChE neuronal promoter (51). A TATA
repeat was also found 32 bp upstream from the Torpedo AChE
transcription start site. Putative binding sites for AP1, Egr-1, MyoD,
and TTF-2 transcription factors are also present.
AChE mRNA and activity are undetectable before the 5-somite stage,
after which expression begins in recently formed somites. After about
the 10-somite stage, AChE transcripts and proteins are present in every
somite primordium, preceding boundary formation, and their expression
increases along with differentiation.
Current knowledge of somitogenesis suggests that the first few
rostral somites could be patterned by a different mechanism than the
more caudal ones (54). Appearance of AChE simultaneously in the 5-7
early somites, and progressively in the later ones, is consistent with
this hypothesis. It suggests that AChE expression could depend on
factors controlling the pathway of somite anteroposterior determination
(55) among which transcription factors Mesp, MyoD, or other members of
basic helix-loop-helix proteins, and the Eph family of receptor
tyrosine kinases and their ligand.
Such a regionalization of cholinesterases was also found during
somitogenesis in other species. In chick embryo a rostrocaudal asymmetry is established with differential expression of BChE and then
AChE in the rostral part of the somite (2). This suggests a conserved
regulation of expression of AChEs in myotomes. Early expression could
indicate that in zebrafish AChE covers both domains of expression of
BChE and AChE found in chick somites.
In the nervous system, mRNA and then protein were found in several
brain clusters and in spinal cord. Our results are consistent with
previous studies showing that, in zebrafish, all primary neurons,
including reticulospinal interneurons, sensory neurons, and primary
motoneurons, expressed AChE before axonal outgrowth and neurite
arborization (4-7). The pattern of AChE mRNAs expression in brain
is very similar to expression of the growth cone component GAP-43 (56).
The presence of AChE, before expression of GAP-43 (starting at 17-18
h) and growth of primary neurons, adds strength to the hypothesis of
AChE involvement in the control of neuronal differentiation as recently
suggested by in vitro experiments (57). However, in the
mouse, neither collagenic tail gene inactivation (58), which prevented
accumulation of all AChE at the synapse, nor ache gene
inactivation (59) prevented embryonic development. In these mutant
animals, showing delayed postnatal growth, BChE or other
carboxylesterases may supply AChE function (58, 59). In
Drosophila, which has no other cholinesterase than AChE, a mutation in AChE induced abnormal neuronal development (60). Similarly
in zebrafish no bche gene was found, and there is no close
relative of the active AChE. Identification of ache mutants in D. rerio will thus be a valuable tool to investigate the
implication of AChE in the development of vertebrates and especially
during regulation of morphogenesis of the nervous system.
 |
ACKNOWLEDGEMENTS |
We thank Dr. Bricaud (Université
des Sciences et Techniques du Languedoc, Montpellier, France) for the
AB strain and Dr. Strähle (Institut de Génétique et
de Biologie moléculaire et Génétique, Strasbourg,
France) for the ABO strain. Dr. Westerfield and Dr. Rosa are
acknowledged for constant support.
 |
FOOTNOTES |
*
This research work was supported by grants from Association
Française contre les Myopathies (to X. C., J.-P. T., and
A. C.) and National Institutes of Health Grant P01HD22486 (to
J.-H. P. and Y. Y.).The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EMBL Data Bank with accession number(s) AJ251640 (for ache) and AF003943 (for esterase).
¶
To whom correspondence should be addressed:
Différenciation Cellulaire et Croissance, INRA, 2 Place Viala,
34060 Montpellier Cedex, France. Tel.: 33 4 99 61 28 14; Fax: 33 4 67 54 56 94; E-mail: cousin@ensam.inra.fr.
Published, JBC Papers in Press, October 2, 2000, DOI 10.1074/jbc.M006308200
2
X. Cousin, unpublished results.
 |
ABBREVIATIONS |
The abbreviations used are:
AChE, acetylcholinesterase;
BChE, butyrylcholinesterase;
ASCh, acetylthiocholine;
BSCh, butyrylthiocholine;
BW284c51, 1,5-bis(4-allyldimethylammoniumphenyl)-pentan-3-one dibromide;
bp, base pair(s);
kb, kilobase pair(s);
LS, low salt, HS, high salt, LST, low
salt Triton;
HST, high salt Triton;
MOP, Mother of pearl;
PCR, polymerase chain reaction;
RT-PCR, reverse transcription-polymerase
chain reaction;
nt, nucleotides;
EST, expressed sequence tag.
 |
REFERENCES |
| 1.
|
Brimijoin, S.,
and Koenigsberger, C.
(1999)
Environ. Health Perspect.
1,
59-64
|
| 2.
|
Layer, P. G.,
Alber, R.,
and Rathjen, F. G.
(1988)
Development
102,
387-396
|
| 3.
|
Layer, P. G.
(1990)
BioEssays
12,
415-420
|
| 4.
|
Hanneman, E.,
Trevarrow, B.,
Metcalfe, W. K.,
Kimmel, C. B.,
and Westerfield, M.
(1988)
Development
103,
49-58
|
| 5.
|
Hanneman, E.,
and Westerfield, M.
(1989)
J. Comp. Neurol.
284,
350-361
|
| 6.
|
Wilson, S. W.,
Ross, L. S.,
Parrett, T.,
and Easter, S. S., Jr.
(1990)
Development
108,
121-145
|
| 7.
|
Ross, L. S.,
Parrett, T.,
and Easter, S. S., Jr.
(1992)
J. Neurosci.
12,
467-482
|
| 8.
|
Hanneman, E. H.
(1992)
J. Exp. Zool.
263,
41-53
|
| 9.
|
Massoulié, J.,
Anselmet, A.,
Bon, S.,
Krejci, E.,
Legay, C.,
Morel, N.,
and Simon, S.
(1998)
J. Physiol. (Paris)
92,
183-190
|
| 10.
|
Westerfield, M.
(1995)
The Zebrafish Book
, 3rd Ed.
, University of Oregon Press, Eugene, OR
|
| 11.
|
Sambrook, J.,
Fritsch, E. F.,
and Maniatis, T.
(1989)
Molecular Cloning: A laboratory Manual
, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
|
| 12.
|
Altschul, S. F.,
Madden, T. L.,
Schaffer, A. A.,
Zhang, J.,
Zhang, Z.,
Miller, W.,
and Lipman, D. J.
(1997)
Nucleic Acids Res.
25,
3389-3402
|
| 13.
|
Postlethwait, J. H.,
Yan, Y.-L.,
Gates, M.,
Horne, S.,
Amores, A.,
Brownlie, A.,
Donovan, A.,
Egan, E.,
Ekker, M.,
Force, A.,
Gong, Z.,
Goutel, C.,
Fritz, A.,
Kelsh, R.,
Knapik, E.,
Liao, E.,
Paw, P.,
Ransom, D.,
Singer, A.,
Thomson, M.,
Abduljabbar, T. S.,
Yelick, P.,
Beier, D.,
Joly, J.-S.,
Larhammar, D.,
Rosa, F.,
Westerfield, M.,
Zon, L. I.,
Johnson, S. L.,
and Talbot, W. S.
(1998)
Nat. Genet.
18,
345-349
|
| 14.
|
Shimoda, N.,
Knapik, E. W.,
Ziniti, J.,
Sim, C.,
Yamada, E.,
Kaplan, S.,
Jackson, D.,
de Sauvage, F.,
Jacob, H.,
and Fishman, M. C.
(1999)
Genomics
58,
219-232
|
| 15.
|
Karnovsky, M. J.,
and Roots, L. J.
(1964)
J. Histochem. Cytochem.
12,
219-221
|
| 16.
|
Ellman, G. L.,
Courtney, D. K.,
Andres, V.,
and Featherstone, R. M.
(1961)
Biochem. Pharmacol.
7,
88-95
|
| 17.
|
Cousin, X.,
Bon, S.,
Duval, N.,
Massoulié, J.,
and Bon, C.
(1996)
J. Biol. Chem.
271,
15099-15108
|
| 18.
|
Pezzementi, L.,
Sutherland, D.,
Sanders, M.,
Soong, W.,
Milner, D.,
McClellan, J. S.,
Sapp, M.,
Coblentz, W. B.,
Rulewicz, G.,
and Merritt, S.
(1998)
in
Structure and Function of Cholinesterases and Related Proteins
(Doctor, B. P.
, Taylor, P.
, Quinn, D. M.
, Rotundo, R. L.
, and Gentry, M. K., eds)
, pp. 105-110, Plenum Publishing Corp., New York
|
| 19.
|
Vellom, D. C.,
Radic, Z.,
Li, Y.,
Pickering, N. A.,
Camp, S.,
and Taylor, P.
(1993)
Biochemistry
32,
12-17
|
| 20.
|
Toutant, J. P.,
Massoulié, J.,
and Bon, S.
(1985)
J. Neurochem.
44,
580-592
|
| 21.
|
Simon, S.,
and Massoulié, J.
(1997)
J. Biol. Chem.
272,
33045-33055
|
| 22.
|
Plasterk, R. H.,
Izsvak, Z.,
and Ivics, Z.
(1999)
Trends Genet.
15,
326-332
|
| 23.
|
Izsvak, Z.,
Ivics, Z.,
Shimoda, N.,
Mohn, D.,
Okamoto, H.,
and Hackett, P. B.
(1999)
J. Mol. Evol.
48,
13-21
|
| 24.
|
Krauss, S.,
Concordet, J. P.,
and Ingham, P. W.
(1993)
Cell
75,
1431-144
|
| 25.
|
Ekker, M.,
Wegner, J.,
Akimenko, M. A.,
and Westerfield, M
(1992)
Development
16,
1001-1010
|
| 26.
|
Venters, S. J.,
Thorsteinsdottir, S.,
and Duxson, M. J.
(1999)
Dev. Dyn.
216,
219-232
|
| 27.
|
Kimmel, C. B.,
Hatta, K.,
and Eisen, J. S.
(1991)
Development
2 (suppl.),
47-57
|
| 28.
|
Liu, D. W. C.,
and Westerfield, M.
(1992)
J. Neurosci.
12,
1859-1866
|
| 29.
|
Kumar, S.,
and Hedges, S. B.
(1998)
Nature
392,
917-920
|
| 30.
|
Amores, A.,
Force, A.,
Yan, Y. L.,
Joly, L.,
Amemiya, C.,
Fritz, A.,
Ho, R. K.,
Langeland, J.,
Prince, V.,
Wang, Y. L.,
Westerfield, M.,
Ekker, M.,
and Postlethwait, J. H.
(1998)
Science
282,
1711-1714
|
| 31.
|
Nornes, S.,
Clarkson, M.,
Mikkola, I.,
Pedersen, M.,
Bardsley, A.,
Martinez, J. P.,
Krauss, S.,
and Johansen, T.
(1998)
Mech. Dev.
77,
185-196
|
| 32.
|
Ekker, S. C.,
Ungar, A. R.,
Greenstein, P.,
von Kessler, D. P.,
Porter, J. A.,
Moon, R. T.,
and Beachy, P. A.
(1995)
Curr. Biol.
5,
944-955
|
| 33.
|
Hallbook, F.
(1999)
Curr. Opin. Neurobiol.
9,
616-621
|
| 34.
|
Grauso, M.,
Culetto, E.,
Combes, D.,
Fedon, Y.,
Toutant, J. P.,
and Arpagaus, M.
(1998)
FEBS Lett.
424,
279-284
|
| 35.
|
Leibel, W. S.
(1988)
J. Exp. Zool.
247,
209-223
|
| 36.
|
Stieger, S.,
Gentinetta, R.,
and Brodbeck, U.
(1989)
Eur. J. Biochem.
181,
633-642
|
| 37.
|
Musset, F.,
Frobert, Y.,
Grassi, J.,
Vigny, M.,
Boulla, G.,
Bon, S.,
and Massoulie, J.
(1987)
Biochimie (Paris)
69,
147-156
|
| 38.
|
Heierhorst, J.,
Lederis, K.,
and Richter, D.
(1992)
Proc. Natl. Acad. Sci. U. S. A.
89,
6798-6802
|
| 39.
|
Ivics, Z.,
Izsvak, Z.,
Minter, A.,
and Hackett, P. B.
(1996)
Proc. Natl. Acad. Sci. U. S. A.
93,
5008-5013
|
| 40.
|
Izsvak, Z.,
Ivics, Z.,
Garcia-Estefania, D.,
Fahrenkrug, S. C.,
and Hackett, P. B.
(1996)
Proc. Natl. Acad. Sci. U. S. A.
93,
1077-1081
|
| 41.
|
Maulet, Y.,
Camp, S.,
Gibney, G.,
Rachinsky, T. L.,
Ekstrom, T. J.,
and Taylor, P.
(1990)
Neuron
4,
289-301
|
| 42.
|
Jbilo, O.,
Toutant, J. P.,
Vatsis, K. P.,
Chatonnet, A.,
and Lockridge, O.
(1994)
J. Biol. Chem.
269,
20829-20837
|
| 43.
|
Muratani, K.,
Hada, T.,
Yamamoto, Y.,
Kaneko, T.,
Shigeto, Y.,
Ohue, T.,
Furuyama, J.,
and Higashino, K.
(1991)
Proc. Natl. Acad. Sci. U. S. A.
88,
11315-11319
|
| 44.
|
Chatonnet, A.,
Lorca, T.,
Barakat, A.,
Aron, E.,
and Jbilo, O.
(1991)
Cell. Mol. Neurobiol.
11,
119-130
|
| 45.
|
Durliat, M.,
Andre, M.,
and Babin, P. J.
(2000)
Eur. J. Biochem.
267,
549-559
|
| 46.
|
Randall, W. R.,
Rimer, M.,
and Gough, N. R.
(1994)
Biochim. Biophys. Acta
1218,
453-456
|
| 47.
|
Cousin, X.,
Bon, S.,
Massoulié, J.,
and Bon, C.
(1998)
J. Biol. Chem.
273,
9812-9820
|
| 48.
|
Simon, S.,
Krejci, E.,
and Massoulié, J.
(1998)
EMBO J.
17,
6178-6187
|
| 49.
|
Krejci, E.,
Legay, C.,
Thomine, S.,
Sketelj, J.,
and Massoulié, J.
(1999)
J. Neurosci.
19,
10672-10679
|
| 50.
|
Mutero, A.,
Camp, S.,
and Taylor, P.
(1995)
J. Biol. Chem.
270,
1866-1872
|
| 51.
|
Atanasova, E.,
Chiappa, S.,
Wieben, E.,
and Brimijoin, S.
(1999)
J. Biol. Chem.
274,
21078-21084
|
| 52.
|
Luo, Z. D.,
Camp, S.,
Mutero, A.,
and Taylor, P.
(1998)
J. Biol. Chem.
273,
28486-28495
|
| 53.
|
Chan, R. Y.,
Boudreau-Lariviere, C.,
Angus, L. M.,
Mankal, F. A.,
and Jasmin, B. J.
(1999)
Proc. Natl. Acad. Sci. U. S. A.
96,
4627-4632
|
| 54.
|
Sawada, A.,
Fritz, A.,
Jiang, Y.-J.,
Yamamoto, A.,
Yamasu, K.,
Kuroiwa, A.,
Saga, Y.,
and Takeda, H.
(2000)
Development
127,
1691-1702
|
| 55.
|
Durbin, L.,
Sordino, P.,
Barrios, A.,
Gering, M.,
Thisse, C.,
Thisse, B.,
Brennan, C.,
Green, A.,
Wilson, S.,
and Holder, N.
(2000)
Development
127,
1703-1713
|
| 56.
|
Reinhard, E.,
Nedivi, E.,
Wegner, J.,
Skene, J. H. P.,
and Westerfield, M.
(1994)
Development
120,
1767-1775
|
| 57.
|
Bigbee, J. W.,
Sharma, K. V.,
Chan, E. L.,
and Bogler, O.
(2000)
Pharmacol. Ther.
86,
29-48
|
| 58.
|
Feng, G.,
Krejci, E.,
Molgo, J.,
Cunningham, J. M.,
Massoulié, J.,
and Sanes, J. R.
(1999)
J. Cell Biol.
144,
1349-1360
|
| 59.
|
Xie, W.,
Stribley, J.,
Chatonnet, A.,
Wilder, P. J.,
Rizzino, A.,
McComb, R. D.,
Taylor, P.,
Hinrichs, S. H.,
and Lockridge, O.
(2000)
J. Pharmacol. Exp. Ther.
293,
896-902
|
| 60.
|
Greenspan, R. J.,
Finn, J. A., Jr.,
and Hall, J. C.
(1980)
J. Comp. Neurol.
189,
741-774
|
Copyright © 2001 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
M. Behra, C. Etard, X. Cousin, and U. Strahle
The Use of Zebrafish Mutants to Identify Secondary Target Effects of Acetylcholine Esterase Inhibitors
Toxicol. Sci.,
February 1, 2004;
77(2):
325 - 333.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 2001 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|