![]()
|
|
||||||||
J. Biol. Chem., Vol. 276, Issue 10, 6930-6936, March 9, 2001
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
From the Departments of § Pharmacology and Therapeutics,
Received for publication, October 3, 2000, and in revised form, December 1, 2000
DNA-cytosine-5-methyltransferase 1 (DNMT1)
is the enzyme believed to be responsible for maintaining the epigenetic
information encoded by DNA methylation patterns. The target recognition
domain of DNMT1, the domain responsible for recognizing hemimethylated CGs, is unknown. However, based on homology with bacterial cytosine DNA
methyltransferases it has been postulated that the entire catalytic
domain, including the target recognition domain, is localized to 500 amino acids at the C terminus of the protein. The N-terminal domain has
been postulated to have a regulatory role, and it has been suggested
that the mammalian DNMT1 is a fusion of a prokaryotic methyltransferase
and a mammalian DNA-binding protein. Using a combination of in
vitro translation of different DNMT1 deletion mutant peptides and
a solid-state hemimethylated substrate, we show that the target
recognition domain of DNMT1 resides in the N terminus (amino acids
122-417) in proximity to the proliferating cell nuclear antigen
binding site. Hemimethylated CGs were not recognized specifically by
the postulated catalytic domain. We have previously shown that the
hemimethylated substrates utilized here act as DNMT1 antagonists and
inhibit DNA replication. Our results now indicate that the DNMT1-PCNA
interaction can be disrupted by substrate binding to the DNMT1 N
terminus. These results point toward new directions in our
understanding of the structure-function of DNMT1.
Vertebrate genomes are modified by methylation of ~60-80% of
the cytosines residing at the CG dinucleotide sequence (1). The
distribution of methylated cytosines is not random, resulting in gene-
and tissue-specific patterns of methylation (2). A large body of
evidence supports the hypothesis that both methylation patterns and
activity of DNA methyltransferases
(DNMTs)1 play critical roles
in development and in controlling genome functions such as differential
gene expression, chromosome imprinting, and X-chromosome inactivation
(3-5). It has also been suggested that DNMT1 is a downstream effector
of many oncogenic pathways and a potential target for anticancer
therapy (6-11). We have previously demonstrated that inhibition of
DNMT1 leads to an inhibition of DNA replication (12). Recently, it has
been shown that DNMT1 is able to form a complex with Rb, E2F, and HDAC1
and repress E2F-responsive expression (13, 14). Furthermore, it has
been shown that DNMT1 can establish a transcriptional repressive
complex with HDAC2 and DMAP1 at replication foci (15). These data
suggest that DNMT1 has multiple functions in the cell. However, because the DNMT1 target recognition domain is unknown it is not possible to
determine how these multiple functions and protein-protein interactions
relate to its target specificity.
If DNA methylation patterns contain significant information, there must
be a mechanism that ensures its proper inheritance in cell lineages.
Razin and Riggs (16) have proposed that patterns of methylation are
inherited, because DNMT1 is more proficient in methylating
hemimethylated DNA than nonmethylated DNA. This hypothesis has been
verified by a number of experiments (17, 18). Another level of
specificity is the ability of DNMT1 to recognize CG sequences almost
exclusively (19, 20). Thus, DNMT1 exhibits both substrate and sequence specificity.
The mammalian DNMT1 is a protein postulated to be composed, based on
its similarity to other cytosine DNA methyltransferases, of at least
three structural components (21-26). These domains are as follows: a
catalytic domain at the C terminus, an N-terminal domain that is
responsible for localization of the protein to the nucleus and
replication foci, and another poorly characterized central domain. It
is unclear as yet which segment is responsible for determining its
specificity for hemimethylated CG sequences. Previous reports have
shown that when the N-terminal domain is cleaved by proteolysis, the
enzyme loses its ability to discriminate between hemimethylated and
unmethylated DNA (23). It has been suggested that the N-terminal domain
performs a regulatory role by inhibiting the de novo
methylation activity of the C-terminal domain (23). Recently, it has
been demonstrated that a mouse prokaryotic methyltransferase hybrid,
DNMT1-HhaI, containing the intact N terminus of DNMT1 and
most of the coding sequence of HhaI, has a 2.5-fold
preference for hemimethylated DNA, whereas HhaI by itself
has preference for unmethylated DNA (27). This finding indicates that
the N terminus is responsible for binding specificity to hemimethylated
DNA. DNA binding activity has been shown to reside within the
N-terminal domain, but this binding activity does not show sequence
specificity, and it has been suggested that it determines the distance
traversed between replication and methylation (28).
To dissect the role that DNMT1 plays in different biological functions
using structure-function analysis, one has to determine which domain of
the DNMT1 is responsible for target recognition. Identifying the target
recognition domain of the enzyme is also critical for developing direct
inhibitors of this enzyme as potential anticancer agents. To map the
target recognition domain, we utilized a solid-state hemimethylated
DNMT1 substrate to test the binding affinities of in
vitro-translated DNMT1 deletion mutant peptides. This method
enabled us to determine which segment of DNMT1 per se is
responsible for target recognition. It has been previously demonstrated
that these modified hairpin oligonucleotide substrates are able to form
a stable complex with DNMT1 and inhibit its activity (29). Furthermore,
inhibition of DNMT1 with these modified hairpin oligonucleotides
results in both inhibition of DNA replication (12) and transcriptional
up-regulation of the tumor supressor p21 (30). However, the mechanism
by which inhibition of DNA replication occurs remains unclear. In this
manuscript, we show that the target recognition domain of DNMT1 does
not reside in the previously defined catalytic domain but rather in the
N-terminal region of DNMT1, between amino acids 122 and 417. This
result demonstrates the fundamental disparity between mammalian and
bacterial DNA methyltransferases and the inadequacy of amino acid
sequence-sequence similarities per se in predicting the
functional role of protein domains. The identification of the target
recognition domain in the N terminus points toward new directions in
our understanding of the structure-function relationship of mammalian
DNA methyltransferases.
Generating DNMT1 Deletion Mutant Constructs--
DNMT1 cDNA
deletion mutants were generated by RT-PCR (31) from 1 µg of total RNA
prepared from the human small cell lung carcinoma cell line H446 (ATCC
number HTB-171) using the following set of primers:
5'ccccatcggtttccgcgcgaaaa 3' (sense) and 5'gcatctgccattcccactct 3'
(antisense) for codons 1 to 125; 5'gcaaacagaaataaagaatc 3' (sense) and
5'gtgatggtggtttgcctggt 3' (antisense) for codons 122 to 170;
5'ggcaagggaaaagggaaggg 3' (sense) and 5'gtccttagcagcttcctcct 3'
(antisense) for codons 1113 to 1616; 5'ttatccgaggagggctacct 3' (sense)
and 5'cccttccctttgtttccagggc 3' (antisense) for codons 122 to 1112;
5'ttatccgaggagggctacct 3' (sense) and 5'cgccggcgcttaaaggcgtt 3'
(antisense) for codons 122 to 652. Amplification conditions were as
follows: 95 °C for 0.5 min, 60 °C for 0.5 min, and 68 °C for 5 min for 30 cycles using Promega Taq polymerase. The PCR products were cloned in a pCR3.1 vector (Invitrogen), and the sequence
of the cDNAs was verified by the dideoxy-chain termination method
(32) using a T7 DNA sequencing kit (Amersham Pharmacia Biotech) and
alignment to the published human Dnmt1 sequence (33, 34). To generate
construct M, we cleaved the pCR3.1 bearing codons 1113-1616 with
EcoRI, and the fragment was blunted and ligated to a pCR3.1
vector bearing codons 122 to 1212, which was cleaved at the 3'
EcoRV site. Construct FTR bears the RT-PCR product encoding
codons 122-652 inserted in the EcoRI site of pCR3.1. Constructs 5'-FTR and 3'-FTR were generated by digestion of construct FTR with BstEII and NotI. The resulting fragments
were blunted and ligated separately into pCR3.1. Construct N-FTR
bears an RT-PCR product encoding codons 122 to 1112 inserted in the
EcoRI site of pCR3.1. To generate construct N-CAT, the
blunted fragment bearing codons 1113-1616 was inserted into the
EcoRV site of a pCR3.1 bearing codons 122-652. To generate
construct CAT, we inserted the 1113-1616 coding fragment into the
EcoRV site of a pCR3.1 bearing codons 122 to 168. To
generate construct DNMT1, we cleaved construct M with XbaI
and ligated it into a pCR3.1 vector bearing codons 1-122, which was
cleaved at an internal XbaI site. To generate construct PS
(the cysteine at the catalytic dipeptide proline-cysteine is replaced
with a serine), the catalytic domain fragment encoding codons 1113 to
1616 was subcloned in the EcoRI site of the pAlter (Promega)
site-directed mutagenesis vector. Mutagenesis was performed according
to the manufacturer's protocol using a primer containing a single
mismatch in the codon encoding the cysteine in the catalytic dipeptide,
5'AAGCCCTGGGAGGGCGGCC 3' (the underlined G is
mismatched). The mutation was verified by sequencing, and the mutated
catalytic domain was cleaved with EcoRI, blunted, and
inserted into the EcoRV site of a pCR3.1 vector bearing
codons 122-1112. Construct DNMT1 corresponds to the
DNA-cytosine-5-methyltransferase initiated at the upstream ATG site,
and construct M corresponds to the one initiated at the downstream ATG
site. The insertion of the catalytic domain into the EcoRV
site of pCR3.1 leaves a linker between the GK repeat and the ATG
sequence (SRILQIIRLG). To ascertain that this linker does not impair
the activity of the catalytic domain, it was inserted in the same
position in the full-length DNMT1 constructs M and DNMT1 with no
observed effect on DNMT1 binding or enzymatic activities (data not shown).
Coupled in Vitro Transcription and Translation--
The peptides
encoded by the constructs described above were transcribed and
translated by coupled transcription-translation using the Promega TNT
reticulocyte lysate kit (according to manufacturer's protocol) using 2 µg of each construct and 40 µCi of [35-S]methionine
(l,000 Ci/mmol; Amersham Pharmacia Biotech) per 50 µl of reaction volume.
Solid-state DNMT1 Substrate and Other Oligonucleotides--
All
phosphorothioate hairpin oligonucleotides used for the binding study
(see Fig. 2 for sequences) were synthesized at Hybridon Inc.
using standard phosphoramadite chemistry as previously described (10).
Strepavidin-coated magnetic beads (Dynabeads M-280 streptavidin) were
purchased from Dynal. The 5' biotinylated phosphorothioate hemimethylated hairpin oligonucleotides (B1 and B2; see Fig. 2) (3 µM) were incubated with 5 mg of beads in a buffer
containing l0 mM Tris-HCl, EDTA (pH 7.4), and 1 M NaCl for 10 min at room temperature. The beads were then
washed and resuspended in 500 µ1 of the same buffer. The final
concentration of the oligonucleotide bound to the beads was 150 pmol
per mg. To assay binding to the hairpin-bound beads, 3 µl of in
vitro-translated polypeptides were preincubated in a 30-µl
reaction mixture including nonspecific or specific competitor
oligonucleotides (l00 µM), l0 mM Tris-HCl, 1 mM EDTA (pH 7.4), protease inhibitors (phenylmethylsulfonyl fluoride, aprotinin, and sodium vanadate, 1 mg/ml), and 40 mM NaCl. For the experiments in which CAT and FTR peptides
were concurrently present (see Fig. 5), 3 µl of each of the
in vitro-translated peptides was utilized where the plus
sign (+) is indicated, and 6 µl and 9 µl were used where
indicated by a triangle. After 30 min of pre incubation with
competitor oligonucleotide, the mixture was applied to 500 µg of
hairpin-bound beads (mix 1/1 of oligonucleotides B1- and B2-coated
beads) for 5 min. The beads and supernatant were separated by a magnet,
and the beads were washed twice with 50 µ1 of l0 mM
Tris-HCl, EDTA (pH 7.4) buffer followed by one wash in a 1 M NaC1-containing buffer. The beads were resuspended in 30 µl of l0 mM Tris-HCl, EDTA (pH 7.4), 0.1% SDS solution
and boiled for 5 min. The supernatant (fraction S, corresponding to unbound proteins) and boiled fraction (fraction B, corresponding to
bound proteins) were loaded onto an SDS-PAGE gel, dried, and exposed to
autoradiography. The autoradiograms were scanned, the amount of
proteins in each fraction was quantified, and the percentage of protein
stably bound to the beads was calculated as boiled/(boiled + supernatant) × 100.
Cell Culture and Transient Transfections--
HEK 293 cells, a
human adenovirus type 5 transformed human embryonal kidney cell line
(35) (ATCC number CRL 1573), were grown in Dulbecco's modified
Eagle's medium (high glucose) supplemented with 10% fetal calf serum
and 2 mM glutamine. For transient transfection experiments,
HEK 293 cells were plated 18 h prior to transfection at a density
of 7 × 105 cells/100-mm tissue culture dish. The
cells were transfected with 5 µg of Xpress-FTR plasmid using the
calcium phosphate protocol (36). The medium was replaced 24 h
after transfection, and the cells were harvested 48 h after transfection.
Immunoprecipitations and Western Blot Analysis--
Nuclear
extracts were isolated as described previously (37). For the
immunoprecipitation assay, 400 µg of nuclear extracts were incubated
with 10 µl of the agarose-conjugated PCNA antibody (PC10; Santa Cruz
Biotechnology) at 4 °C overnight. For the competition experiments
the reactions were preincubated with 100 nM final concentration of competitor oligonucleotides (Sc and H1) for 1 h
before addition of the PCNA antibody. After the overnight incubation, the beads were spun and washed three times with phosphate-buffered saline. The immune complexes were resolved by a 7.5% SDS
polyacrylamide gel electrophoresis. After transferring to a
polyvinylidene difluoride membrane and blocking the nonspecific binding
with 5% milk, Xpress-FTR protein was detected using mouse anti-Xpress
antibody (Invitrogen) at a 1:5000 dilution, followed by
peroxidase-conjugated anti-mouse secondary antibody (Jackson
ImmunoResearch) at a 1:20000 dilution, and enhanced chemiluminescence
detection kit (Amersham Pharmacia Biotech).
Nuclear Extract Binding Assay--
Nuclear extracts were
isolated as previously described (37), and binding was performed
utilizing 500 µg of hairpin-bound beads (mix 1/1 of oligonucleotides
B1- and B2-coated beads) for 5 min. The beads and supernatant were
separated by a magnet, and the beads were washed twice with 50 µ1 of
l0 mM Tris-HCl, EDTA (pH 7.4) buffer followed by one wash
in a 1 M NaC1-containing buffer. The beads were resuspended
in 30 µl of l0 mM Tris-HCl, EDTA (pH 7.4), 0.1% SDS
solution and boiled for 5 min. The supernatant (fraction S,
corresponding to unbound proteins) and boiled fraction (fraction B,
corresponding to bound proteins) were loaded onto an SDS-PAGE gel,
and Western blot analysis was performed as above.
Coupled in Vitro Transcription/Translation of Recombinant Human
DNMT1 Deletion Mutants--
To map the DNMT1 target recognition
domain, DNMT1 deletion mutant peptides were created using a coupled
in vitro transcription/translation rabbit reticulocyte
system (Fig. 1, A and
B). The constructs were designed as follows: DNMT1 bears the
entire coding sequence of the enzyme starting at the upstream ATG
initiation site (34), construct M bears the coding sequence of the
DNMT1 starting at the downstream ATG initiation site (33), construct PS
bears a single base mutation converting the previously proposed
catalytic site proline-cysteine dipeptide to proline-serine (24),
construct N-FTR bears the N-terminal fork-targeting region and the
central domain region contained within amino acids 122-1112, construct N-CAT bears the N-terminal and catalytic domains with a deletion of the
central domain from amino acid 652 to 1113, construct CAT encodes the
entire catalytic domain as proposed by homology to bacterial cytosine
methyltransferases plus the N-terminal portion responsible for nuclear
localization (21, 23, 24), construct FTR bears the N-terminal region
between amino acids 122 and 652, construct 5'-FTR is a deletion of FTR
containing the region between amino acids 122 and 417, and construct
3'-FTR contains the region between amino acids 417 and 731 (Fig.
1A). We utilized a luciferase construct as a control (Fig.
1A). Following coupled in vitro
transcription/translation in the presence of
[35-S]methionine, the peptides were size-fractionated by
SDS-PAGE and visualized by autoradiography (Fig. 1B). All
the peptides migrated according to their expected sizes.
Oligonucleotide Design--
Hemimethylated and nonmethylated
CG-containing phosphorothioate hairpin oligonucleotides were designed
as probes and competitors for our binding assays (Fig.
2). Because oligonucleotides B1 and B2
are biotinylated at the 5' arm of the hairpin, they can be conjugated
to streptavidin-coated magnetic beads and used as solid-state probes
for peptide binding experiments. The remaining oligonucleotides (Sc,
H1, and N1) were utilized as competitors. The 5' arm of the hairpins
containing methylated cytosines behaves as the methylation-guiding parental strand and the 3' arm behaves as the methyl-acceptor nascent
strand of replicating DNA. The hairpin substrates we utilized contained
an inosine (I) instead of the methyl acceptor, cytosine. These
substrates have been previously shown to form a high affinity complex
with DNMTl that could be dissociated only by boiling (29). Results from
these experiments have also indicated that the inosine (I) group
substitution, as well as synthesis of the backbone with a
phosphorothioate modification, results in increased hairpin binding
affinity to DNMT1 (29). Moreover, the CG sites present in the hairpins
are separated by 4 bases to avoid tandem CGs, which have been
demonstrated to be poor substrates for DNA methyltransferases (29).
The DNMT1 Target Recognition Domain Resides in the N-terminal
Region--
Previous studies have shown that DNMT1 forms a low
affinity complex with both hemimethylated and nonmethylated DNA (19). It has been proposed that the initial binding of DNMT1 with DNA does
not discriminate between hemimethylated and nonmethylated DNA (19) and
that discrimination between the two substrates occurs during catalysis
(19). In our binding assays (see Figs. 3-5), the ability of a polypeptide to
form a stable complex with the magnetic bead-conjugated substrate is
measured by comparing the abundance of [35-S]-labeled
polypeptide in the supernatant fraction (indicated as S in
Figs. 3-5) versus the abundance in the fraction eluted by boiling the hairpin-bound beads (indicated as B in Figs.
3-5). As observed (Fig. 3A), in the absence of any
competitor, peptide M is present exclusively in the bound fraction
(B), whereas a luciferase peptide, used as a negative
control, is unable to form a complex with the hemimethylated
solid-state substrate and is therefore present exclusively in the
supernatant fraction (S).
To test the binding specificity of the M peptide for the hemimethylated
solid-state substrate, we incubated
[35-S]methionine-labeled in vitro-translated M
peptide with the substrate in the presence of increasing concentrations
of either a hemimethylated (H1) or a nonspecific (Sc) oligonucleotide.
As observed (Fig. 3B), in the absence of any competitors
(N), M is able to form a stable complex with the hemimethylated
hairpin. This is indicated by the presence of M exclusively in fraction
B (Fig. 3B). Complex formation is not challenged by an
excess of 100 µM nonspecific oligonucleotide (Sc),
because M remains exclusively in fraction B. Conversely, complex
formation is partly abolished by a challenge with 10 µM
of cold hemimethylated competitor (H1) and is completely abolished by a
challenge with 100 µM cold competitor, as indicated by
the disappearance of M from B and its presence in S.
To determine which domain of DNMT1 interacts specifically with the
hemimethylated substrate, we incubated the different
[35-S]methionine-labeled recombinant polypeptides with
the solid-state hemimethylated substrate in the presence of 100 µM of either hemimethylated (H1), nonmethylated (N1) CG
bearing hairpin oligonucleotides or a nonspecific competitor (Sc) (Fig.
2). As observed in the autoradiograms (Fig.
4A) and in the graphical
representations (Fig. 4B), all the polypeptides form a
stable complex with the solid-state substrate in the absence of any
competitors. This is indicated by their presence in fraction B,
suggesting that both C-terminal and N-terminal domains can recognize
and form a stable complex with the substrate. However, the binding of
the catalytic domain peptide (CAT) to the hemimethylated substrate is
completely abolished by nonspecific (Sc), as well as specific,
competitors (H1 and N1). This is evident from the presence of the
peptide exclusively in fraction S and its complete absence from
fraction B. The binding of peptides bearing either the N-terminal
domain (N-FTR, N-CAT, FTR, and 5'-FTR) or the complete
protein (M and DNMT1) is not competed by the nonspecific competitor
(Sc) (>80% remain bound) but is abolished (<40% remain bound) by
the hemimethylated competitor (H1). The nonmethylated CG-bearing
hairpin (N1) is a partial competitor as indicated by the distribution
of the polypeptide in both the bound and unbound fractions. In all of
these cases the hemimethylated hairpin is 2-4-fold more effective in
competing out binding to the solid-state substrate than the
nonmethylated homolog (Fig. 4B). PS also shows a preference
for the hemimethylated substrate, but interestingly it is competed less
efficiently by the H1/N1 competitor pair, indicating the formation of a
tighter complex. The fact that the competition profiles of DNMT1 and
N-CAT are similar indicates that the central region of the enzyme
(amino acids 652-1113) is not required for target specificity. This is
confirmed by the similarity of competition profile of these two
peptides with the FTR peptide competition profile. Moreover, results
indicating that binding of F-CAT to the hemimethylated substrate is
competed as efficiently by the nonspecific competitor (Sc) as it is by the hemimethylated competitor (H1) further confirm that the central region is not essential for target recognition. The 5'-FTR peptide still retains hemimethylated binding specificity, which is indicated by
the fact that H1 competes for binding more efficiently than N1 and Sc.
Interestingly, the binding specificity of 3'-FTR peptide for the
hemimethylated substrate is weaker than the more inclusive FTR
peptides, because all competitors have a similar effect on binding.
Taken together, these results support the hypothesis that the target
recognition domain of DNMT1 resides in the N-terminal segment (amino
acids 122-417) of the protein, overlapping with the fork-targeting
region.
We then tested whether the FTR peptide still binds specifically to
hemimethylated DNA when both CAT and FTR peptides are present in the
same reaction, as is the case with the natural product. We tested their
affinity to hemimethylated DNA under two conditions, in the absence or
in the presence of competitor DNA. The presence of competitor DNA
mimics the in vivo scenario, where DNMT1 has to discriminate
between its specific target and the bulk of non-CG DNA. The results
(Fig. 5A) demonstrate that in
the absence of any competitors both CAT and FTR peptides can bind the
target, in agreement with results from Fig. 4, showing that both
peptides have high affinity to DNA. However, in the presence of a
nonspecific competitor (Fig. 5B), as is the case when DNMT1
interacts with the genome in vivo, only FTR is bound to
hemimethylated DNA. Having both CAT and FTR peptides concurrently also
verifies that the differences observed between distinct peptides in the
competition experiments depicted in Fig. 4 are not the result of
impurities in the in vitro translation reaction of one
peptide versus another. For clarity only the bound
fractions were loaded.
PCNA/FTR Complex Can Be Disrupted by a Hairpin
Oligonucleotide--
Previous reports have shown that modified hairpin
oligonucleotides can work as bona fide antagonists of DNMT1
and inhibit DNA replication (12, 29). Because the target recognition of DNMT1 may overlap with its PCNA binding site, we tested the hypothesis that the DNMT1/PCNA complex could be disrupted by FTR binding to the
modified hairpin oligonucleotides. We transfected HEK 293 cells with an
Xpress-tagged FTR expression vector followed by PCNA
immunoprecipitations in the presence of a nonspecific oligonucleotide (Sc), a hemimethylated hairpin (H1), or no competitor (N). The results
(Fig. 6A, top
panel) indicate that the PCNA/DNMT1 complex can be disrupted by H1
but not by Sc. The presence of IgG and PCNA in all the
immunoprecipitations was also tested (Fig. 6A, middle and bottom panels). We also immunoblotted
the supernatants of these immunoprecipitations to confirm FTR
expression (Fig. 6A, bottom panel). Because the
previous experiments had been performed using in
vitro-translated peptides, we tested the ability of the FTR
peptide to bind the hairpin solid-state substrate in HEK 293 nuclear
extracts. The results (Fig. 6B) demonstrate that the FTR peptide does indeed bind the solid substrate under these conditions, as
indicated by the FTR presence in the bound fraction (B). These results
suggest that the disruption of the PCNA/DNMT1 complex might be a
possible mechanism by which these modified hairpin oligonucleotides
inhibit DNA replication.
Recognition of hemimethylated CGs, the DNMT1 target sequence, is a
critical step in the replication of the DNA methylation pattern and
the epigenetic information that it encodes. Although the first
mammalian dnmt has been cloned and its cDNA sequenced more than a decade ago (21, 22), the domain responsible for its target
recognition has not yet been clearly defined. Based on sequence
homology between mammalian and bacterial cytosine methyltransferases
the entire catalytic domain, including the target recognition domain,
has been proposed to reside in the C terminus of the protein (24). The
additional N-terminal and central domains of the protein were proposed
to perform regulatory roles (23, 28). This hypothesis is based on the
assumption that the structure of the mammalian DNMT1 follows the rules
laid out in bacteria and that DNMT1 is an evolutionary hybrid of a primordial DNMT plus at least two additional regulatory protein modules
(23). Our results are in agreement with recent target specificity
studies utilizing a mouse prokaryotic hybrid DNMT, DNMT1-HhaI, containing the intact N terminus of DNMT1 and
most of the coding sequence of HhaI, demonstrating that it
has a 2.5-fold preference for hemimethylated DNA, whereas
HhaI by itself has preference for unmethylated DNA (27).
Moreover, structural analysis of de novo DNMTs, DNMT3a and
DNMT3b (4, 38), which lack the DNMT1 N-terminal region and recognize
nonmethylated CGs, further supports the hypothesis that the
hemimethylated target recognition domain resides within the DNMT1 N terminus.
To delineate the DNMT1 target recognition domain, we performed
experiments utilizing a solid-state hemimethylated substrate and
in vitro-translated deletion mutant peptides. Competition assays with hemimethylated and nonmethylated substrates revealed that
the N-terminal domain specifically recognizes a hemimethylated CG
substrate. The previously described catalytic domain, which has been
proposed to contain all the elements required for catalytic activity
including target recognition (24), binds DNA but does not exhibit
specificity to hemimethylated CG duplex DNA as determined by
competition assays. Moreover, when the catalytic domain and the
N-terminal domain are concurrently present in the reaction with
nonspecific DNA, the substrate binds to the N-terminal domain suggesting that it bears the target recognition domain. Interestingly, the PS mutant is competed less efficiently by the H1/N1 competitor pair, indicating the formation of a tighter complex. This result is
supported by a previous study indicating that EcoRII DNMT
mutants with substitution of the conserved cysteine for serine bind
tightly to DNA (39). These mutants resemble the wild-type enzyme in that their binding to substrate is not eliminated by the presence of
nonspecific DNA in the reaction (39).
Deciphering whether the catalytic components of DNMT1 reside entirely
in the C-terminal domain or whether they reside elsewhere is critical
for both structure-function and crystal structure analysis of the
protein, as well as for drug design. Identifying the location of the
different components of the catalytic domains of DNMTs is also critical
for interpretation of knockout experiments by homologous recombination,
which target putative catalytic domains (5). If these alleles, which
are inactivated at the C terminus, still maintain the sequence-specific
target recognition domain some of the previously described biological
effects of this knockout could be attributed to the DNA binding effects
of the truncated protein rather than inhibition of methylation.
The catalytic domain should, by definition, include the substrate
recognition domain, otherwise there is no catalysis. Our results shed
doubt on the previous designation of the DNMT1 C terminus as the
exclusive catalytic domain. The data presented in this paper suggest
that this conclusion might be revisited. In contrast to many bacterial
DNMTs (40), the target recognition domain of the mammalian DNMT1
resides at the N terminus, at a significant distance from the conserved
catalytic and AdoMet binding domains. Our data is consistent with the
hypothesis that the N-terminal is not just a regulatory domain, as has
been previously suggested (23, 41), but it is the substrate recognition
module of the enzyme. Therefore, the catalytic component of the
vertebrate enzyme is composed of two modular domains, a target
recognition domain in the N terminus, in addition to the previously
described AdoMet binding and methyl-transfer domains in the C terminus
of the enzyme. The fact that the target recognition domain and
methyl-transfer domain are located at such a distance on the linear
amino acid sequence must not necessarily translate to a similar
distance in the tertiary structure of the enzyme. The results presented here might explain the failure of previous attempts to demonstrate DNA
methylation activity in the previously postulated catalytic domain of
the enzyme (41). Despite the striking structural homology of the C
terminus of the vertebrate to bacterial DNMTs, its expression in
bacterial or mammalian cells does not result in DNA methylation activity (26). These results illustrate the risk in predicting biochemical functions exclusively from sequence homology.
We had previously demonstrated that the hairpin oligonucleotides
utilized here can form a stable complex with DNMT1 (29), inhibit its
activity, and inhibit DNA replication in parallel with a
transcriptional up-regulation of the tumor supressor p21 (12, 30). With
the knowledge that the PCNA interaction domain of DNMT1 and its target
recognition domain are overlapping, we were able to show that the
PCNA/DNMT1 complex could be disrupted by the hemimethylated hairpins.
These results might provide an alternative mechanism by which DNMT1
inhibition can supress oncogenic transformation (42). Because DNMT1 is
a multifunctional protein, identifying the domains important for
transformation is critical for DNMT1 anti-oncogenesis drug design.
Moreover, the identification of the target recognition domain allows a
more complete structure-function analysis of DNMT1, and it will help
the development of novel direct inhibitors of this enzyme (7).
We are grateful to Methylgene Inc.
for kindly synthesizing the hairpin oligonucleotides utilized here.
*
This research was supported by a grant from the Canadian
Institute of Health Research.The costs of publication of this
article were defrayed in part by the
payment of page charges. The article must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
Published, JBC Papers in Press, December 4, 2000, DOI 10.1074/jbc.M009037200
The abbreviations used are:
DNMT(s), DNA methyltransferase(s);
PCR, polymerase chain reaction;
PAGE, polyacrylamide gel electrophoresis;
HEK, human embryonic kidney;
aa, amino acid;
PCNA, proliferating cell nuclear antigen;
N, N
terminus.
The DNMT1 Target Recognition Domain Resides in the N
Terminus*
,
, and
Biochemistry, and ¶ Experimental Medicine, McGill
University, Montreal, PQ, H3G 1Y6, Canada
![]()
ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
![]()
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
![]()
EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
![]()
RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

View larger version (24K):
[in a new window]
Fig. 1.
In vitro-translated human DNMT1
deletion mutant peptides. A, physical maps of
constructs of the different deletion mutants of human DNMT1 are shown
relative to a schematic representation of the full-length human DNMT1
(construct DNMT1). The previously proposed structural motifs
and functional domains are illustrated (13, 15, 21, 23, 24, 28, 43,
44). DMAP1 (15), DNMT1-associated protein binding region (aa
1-126); PCNA (44), PCNA binding motif (aa 162-174);
NLS, nuclear localization signal (aa 194-213);
FTR, fork-targeting region (43) (aa 320-567),
Zn, zinc binding peptide (28) containing the CXXC
region (aa 653-691); Rb (13), Rb binding region (aa
416-913), repression domain (14) (653), linker region,
linker introduced in the catalytic domain-containing constructs (10 aa
between aa 1112 and 1113); PC site, Pro-Cys dipeptide site
(aa 1225-1226). The following peptides were translated:
DNMT1, full-length peptide (aa 1-1616); M, DNMT1
protein initiated at the downstream ATG (aa 122-1616); PS,
as construct M, but the cysteine at position 1226 was converted to a
serine by site-directed mutagenesis; N-FTR, includes aa
122-1112; N-CAT, includes aa 122-652 and 1113-1616;
CAT, includes aa 122-168 and 1113-1616; F-CAT,
includes aa 596-1190; FTR, includes aa 122-652;
5'-FTR, includes aa 122-417; 3'-FTR, includes aa
417-731; and LUC., luciferase control construct.
B, the different constructs were incubated in a coupled
in vitro transcription-translation reaction mix (Promega) in
the presence of [35S]methionine as described under
"Experimental Procedures." The radiolabeled peptides were
fractionated on SDS-PAGE and exposed to autoradiography. The positions
of molecular mass markers are indicated.

View larger version (28K):
[in a new window]
Fig. 2.
Hairpin oligonucleotide sequences and
modifications. B1 and B2 are solid-state biotinylated
hemimethylated substrates that were conjugated to avidin-coated
magnetic beads. The remaining oligonucleotides (Sc,
H1, and N1) served as competitors for the binding
assays. BIOTIN indicates biotin-modified oligonucleotides.
The shaded M indicates the position of methylated cytosines, and
the shaded I indicates inosine substitution. All
oligonucleotides contain phosphorothioate-modified backbones.

View larger version (14K):
[in a new window]
Fig. 3.
Specificity of the stable complex formed
between in vitro-translated human DNMT1 and
hemimethylated hairpin. A,
[35S]methionine-labeled constructs M and
luciferase (LUC.) were in vitro-transcribed and
-translated, as described under "Experimental Procedures," and
incubated at room temperature with avidin-coated magnetic beads, bound
to biotinylated hemimethylated hairpins Bl and B2. The hairpin-bound
(B) and unbound (S) fractions were separated on
SDS-PAGE and exposed to autoradiography. B, construct M was
in vitro-transcribed and -translated and preincubated with
no competitor (N), increasing concentrations of a
nonspecific phosphorothioate oligonucleotide (Sc), or
hemimethylated hairpin (H1). Following 30 min of
preincubation, avidin-coated magnetic beads bound to biotinylated
hemimethylated hairpins Bl and B2 were added to the mix, and the
fractions were analyzed as in A.

View larger version (29K):
[in a new window]
Fig. 4.
Binding specificity of various DNMT1 deletion
mutant peptides to the hemimethylated substrate. A,
[35S]methionine-labeled DNMT1 deletion mutant peptides
were in vitro-transcribed and -translated, as described
under "Experimental Procedures," and preincubated with no
competitor (N), 100 µM of a nonspecific
phosphorothioate oligonucleotide (Sc), hemimethylated
hairpin (H1), or nonmethylated CG-bearing hairpin
(N1). Following 30 min of preincubation at room temperature,
avidin-coated magnetic beads bound to biotinylated hemimethylated
hairpins (Bl and B2) were added to the mix as described under
"Experimental Procedures." The hairpin-bound (B) and
unbound (S) fractions were separated on SDS-PAGE and exposed
to autoradiography. B, bound (B) and unbound
(S) fractions were quantified by densitometry, and the
results were plotted as percentage bound.

View larger version (31K):
[in a new window]
Fig. 5.
Differential interaction of the catalytic and
N terminus regions of the DNMT1 with the hemimethylated substrate when
present concurrently. A, FTR and CAT peptides were
in vitro-transcribed and -translated, and different ratios
of both peptides were incubated at room temperature with avidin-coated
magnetic beads bound to biotinylated hemimethylated hairpins (Bl and
B2) in the absence of any competitors, as described under
"Experimental Procedures." The hairpin-bound (B) and
unbound (S) fractions were separated on SDS-PAGE and exposed
to autoradiography. B, a similar experiment was performed
but with the addition of nonspecific competitor (Sc) where
indicated. The bound and unbound fractions were separated as above. The
arrows indicate the expected positions of FTR and CAT
peptides. The plus sign (+) indicates presence of the
indicated peptide, the minus sign (
) indicates absence of
the indicated peptide, and the triangle indicates increasing
concentrations of the indicated peptides.

View larger version (31K):
[in a new window]
Fig. 6.
The FTR/PCNA complex can be disrupted by
hairpin oligonucleotides. A, an Xpress-tagged FTR
construct was transiently transfected into HEK 293 cells and
immunoprecipitated utilizing a PCNA antibody in the presence of no
competitor (N), a hemimethylated competitor (H1),
or a nonspecific competitor (Sc). Western blot analysis of
FTR, IgG, and PCNA of immunoprecipitated fractions was performed as
indicated. Western blot analysis of the FTR present in supernatant
fractions (Sup.) was also performed. B, nuclear
extracts from Xpress-tagged FTR-transfected HEK 293 cells were
incubated with avidin-coated magnetic beads and bound to biotinylated
hemimethylated hairpins Bl and B2. The hairpin-bound (B) and
unbound (S) fractions were separated on SDS-PAGE and
analyzed by Western blot with an anti-Xpress antibody.
![]()
DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
![]()
ACKNOWLEDGEMENTS
![]()
FOOTNOTES
To whom correspondence should be addressed: Dept. of
Pharmacology and Therapeutics, McGill University, 3655 Promenade Sir William Osler, Montreal, PQ, H3G 1Y6, Canada. Tel.: 514-398-7107; Fax:
514-398-6690; E-mail: mszyf@pharma.mcgill.ca.
![]()
ABBREVIATIONS
![]()
REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
1.
Razin, A.,
and Szyf, M.
(1984)
Biochim. Biophys. Acta
782,
331-342
2.
Yisraeli, J.,
and Szyf, M.
(1984)
in
Methylation: Biochemistry and Biological Significance
(Razin, A.
, Cedar, H.
, and Riggs, A. D., eds)
, pp. 353-378, Springer-Verlag New York Inc., New York
3.
Siegfried, Z.,
and Cedar, H.
(1997)
Curr. Biol.
7,
R305-7
4.
Bird, A. P.,
and Wolffe, A. P.
(1999)
Cell
99,
451-454
5.
Li, E.,
Beard, C.,
and Jaenisch, R.
(1993)
Nature
366,
362-365
6.
Szyf, M.
(1996)
Pharmacol. Ther.
70,
1-37
7.
Szyf, M.
(1998)
Cancer Metastasis Rev.
17,
219-231
8.
MacLeod, A. R.,
Rouleau, J.,
and Szyf, M.
(1995)
J. Biol. Chem.
270,
11327-11337
9.
MacLeod, A. R.,
and Szyf, M.
(1995)
J. Biol. Chem.
270,
8037-8043
10.
Ramchandani, S.,
MacLeod, A. R.,
Pinard, M.,
von Hofe, E.,
and Szyf, M.
(1997)
Proc. Natl. Acad. Sci. U. S. A.
94,
684-689
11.
Slack, A.,
Cervoni, N.,
Pinard, M.,
and Szyf, M.
(1999)
J. Biol. Chem.
274,
10105-10112
12.
Knox, J. D.,
Araujo, F. D.,
Bigey, P.,
Slack, A. D.,
Price, G. B.,
Zannis-Hadjopoulos, M.,
and Szyf, M.
(2000)
J. Biol. Chem.
275,
17986-17990
13.
Robertson, K. D.,
Ait-Si-Ali, S.,
Yokochi, T.,
Wade, P. A.,
Jones, P. L.,
and Wolffe, A. P.
(2000)
Nat. Genet.
25,
338-342
14.
Fuks, F.,
Burgers, W. A.,
Brehm, A.,
Hughes-Davies, L.,
and Kouzarides, T.
(2000)
Nat. Genet.
24,
88-91
15.
Rountree, M. R.,
Bachman, K. E.,
and Baylin, S. B.
(2000)
Nat. Genet.
25,
269-277
16.
Razin, A.,
and Riggs, A. D.
(1980)
Science
210,
604-610
17.
Gruenbaum, Y.,
Cedar, H.,
and Razin, A.
(1982)
Nature
295,
620-622
18.
Stein, R.,
Gruenbaum, Y.,
Pollack, Y.,
Razin, A.,
and Cedar, H.
(1982)
Proc. Natl. Acad. Sci. U. S. A.
79,
61-65
19.
Flynn, J.,
Glickman, J. F.,
and Reich, N. O.
(1996)
Biochemistry
35,
7308-7315
20.
Yoder, J. A.,
Soman, N. S.,
Verdine, G. L.,
and Bestor, T. H.
(1997)
J. Mol. Biol.
270,
385-395
21.
Bestor, T.,
Laudano, A.,
Mattaliano, R.,
and Ingram, V.
(1988)
J. Mol. Biol.
203,
971-983
22.
Bestor, T. H.
(1988)
Gene
74,
9-12
23.
Bestor, T. H.
(1992)
EMBO J.
11,
2611-2617
24.
Kumar, S.,
Cheng, X.,
Klimasauskas, S.,
Mi, S.,
Posfai, J.,
Roberts, R. J.,
and Wilson, G. G.
(1994)
Nucleic Acids Res.
22,
1-10
25.
Ramchandani, S.,
Bigey, P.,
and Szyf, M.
(1998)
Biol. Chem.
379,
535-540
26.
Margot, J. B.,
Aguirre-Arteta, A. M.,
Di Giacco, B. V.,
Pradhan, S.,
Roberts, R. J.,
Cardoso, M. C.,
and Leonhardt, H.
(2000)
J. Mol. Biol.
297,
293-300
27.
Pradhan, S.,
and Roberts, R. J.
(2000)
EMBO J.
19,
2103-2114
28.
Chuang, L. S.,
Ng, H. H.,
Chia, J. N.,
and Li, B. F.
(1996)
J. Mol. Biol.
257,
935-948
29.
Bigey, P.,
Knox, J. D.,
Croteau, S.,
Bhattacharya, S. K.,
Theberge, J.,
and Szyf, M.
(1999)
J. Biol. Chem.
274,
4594-4606
30.
Milutinovic, S.,
Knox, J. D.,
and Szyf, M.
(2000)
J. Biol. Chem.
275,
6353-6359
31.
Kawasaki, E. W.,
and Wang, A. M.
(1989)
in
PCR Technology
(Erlich, H. A., ed)
, pp. 89-97, Stockton, New York
32.
Sanger, F.,
Nicklen, S.,
and Coulson, A. R.
(1977)
Proc. Natl. Acad. Sci. U. S. A.
74,
5463-5467
33.
Yen, R. W.,
Vertino, P. M.,
Nelkin, B. D., Yu, J. J.,
el-Deiry, W.,
Cumaraswamy, A.,
Lennon, G. G.,
Trask, B. J.,
Celano, P.,
and Baylin, S. B.
(1992)
Nucleic Acids Res.
20,
2287-2291
34.
Yoder, J. A.,
Yen, R. W. C.,
Vertino, P. M.,
Bestor, T. H.,
and Baylin, S. B.
(1996)
J. Biol. Chem.
271,
31092-31097
35.
Graham, F. L.,
Smiley, J.,
Russell, W. C.,
and Nairn, R.
(1977)
J. Gen. Virol.
36,
59-74
36.
Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. D., Smith, J. A., Seidman, J. G., and Struhl, K.
(eds)
(1988)
Current Protocols in Molecular Biology
, John Wiley & Sons, Inc., New York
37.
Szyf, M.,
Bozovic, V.,
and Tanigawa, G.
(1991)
J. Biol. Chem.
266,
10027-10030
38.
Okano, M.,
Bell, D. W.,
Haber, D. A.,
and Li, E.
(1999)
Cell
99,
247-257
39.
Wyszynski, M. W.,
Gabbara, S.,
Kubareva, E. A.,
Romanova, E. A.,
Oretskaya, T. S.,
Gromova, E. S.,
Shabarova, Z. A.,
and Bhagwat, A. S.
(1993)
Nucleic Acids Res.
21,
295-301
40.
Malone, T.,
Blumenthal, R. M.,
and Cheng, X.
(1995)
J. Mol. Biol.
253,
618-632
41.
Zimmermann, C.,
Guhl, E.,
and Graessmann, A.
(1997)
Biol. Chem.
378,
393-405
42.
Szyf, M.,
Knox, D. J.,
Milutinovic, S.,
Slack, A. D.,
and Araujo, F. D.
(2000)
Ann. N. Y. Acad. Sci.
910,
156-177
43.
Leonhardt, H.,
Page, A. W.,
Weier, H. U.,
and Bestor, T. H.
(1992)
Cell
71,
865-873
44.
Chuang, L. S.,
Ian, H. I.,
Koh, T. W.,
Ng, H. H.,
Xu, G.,
and Li, B. F.
(1997)
Science
277,
1996-2000
Copyright © 2001 by The American Society for Biochemistry and Molecular Biology, Inc.
![]()
CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati What's this?
This article has been cited by other articles:
![]() |
F. E. Erfurth, R. Popovic, J. Grembecka, T. Cierpicki, C. Theisler, Z.-B. Xia, T. Stuart, M. O. Diaz, J. H. Bushweller, and N. J. Zeleznik-Le MLL protects CpG clusters from methylation within the Hoxa9 gene, maintaining transcript expression PNAS, May 27, 2008; 105(21): 7517 - 7522. [Abstract] [Full Text] [PDF] |
||||
![]() |
Q. Zhou, A. T. Agoston, P. Atadja, W. G. Nelson, and N. E. Davidson Inhibition of Histone Deacetylases Promotes Ubiquitin-Dependent Proteasomal Degradation of DNA Methyltransferase 1 in Human Breast Cancer Cells Mol. Cancer Res., May 1, 2008; 6(5): 873 - 883. [Abstract] [Full Text] [PDF] |
||||
![]() |
S.-i. Takebayashi, T. Tamura, C. Matsuoka, and M. Okano Major and Essential Role for the DNA Methylation Mark in Mouse Embryogenesis and Stable Association of DNMT1 with Newly Replicated Regions Mol. Cell. Biol., December 1, 2007; 27(23): 8243 - 8258. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Suetake, D. Hayata, and S. Tajima The Amino-Terminus of Mouse DNA Methyltransferase 1 Forms an Independent Domain and Binds to DNA with the Sequence Involving PCNA Binding Motif J. Biochem., December 1, 2006; 140(6): 763 - 776. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Vilkaitis, I. Suetake, S. Klimasauskas, and S. Tajima Processive Methylation of Hemimethylated CpG Sites by Mouse Dnmt1 DNA Methyltransferase J. Biol. Chem., January 7, 2005; 280(1): 64 - 72. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. M. Campbell and M. Szyf Human DNA methyltransferase gene DNMT1 is regulated by the APC pathway Carcinogenesis, January 1, 2003; 24(1): 17 - 24. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||